Abstract
Background: Identifying lung pathogens and acute spikes in lung counts remain a challenge in the treatment of patients with cystic fibrosis (CF). Bacteria from the deep lung may be sampled from aerosols produced during coughing.
Methods: A new device was used to collect and measure bacteria levels from cough aerosols of patients with CF. Sputum and oral specimens were also collected and measured for comparison. Pseudomonas aeruginosa, Staphylococcus aureus, Klebsiella pneumoniae, and Streptococcus mitis were detected in specimens using Real-Time Polymerase Chain Reaction (RT-PCR) molecular assays.
Results: Twenty adult patients with CF and 10 healthy controls participated. CF related bacteria (CFRB) were detected in 13/20 (65%) cough specimens versus 15/15 (100%) sputum specimens. Commensal S. mitis was present in 0/17 (0%, p=0.0002) cough specimens and 13/14 (93%) sputum samples. In normal controls, no bacteria were collected in cough specimens but 4/10 (40%) oral specimens were positive for CFRB.
Conclusions: Non-invasive cough aerosol collection may detect lower respiratory pathogens in CF patients, with similar specificity and sensitivity to rates detected by BAL, without contamination by oral CFRB or commensal bacteria.
Keywords: Cystic fibrosis, aerosols, specimen collection, respiratory infections, etiology
Introduction
The etiology of lower respiratory tract infections in the lungs is difficult to determine, in part because a good quality specimen from the site of the infection is not readily available 1– 4. Access to such a specimen would be an important advance in the monitoring and treatment of cystic fibrosis (CF), as well as other lower respiratory tract infections, such as pneumonia, tuberculosis, asthma, lung cancer, etc. Presently, oropharyngeal (OP), sputum, and bronchoalveolar lavage (BAL) specimens are typically used to monitor CF patients. OP specimens may be appropriate for detecting viruses, but are not ideal for most bacterial pathogens. Sputum is commonly collected to monitor CF but often contains contaminants and cystic fibrosis related bacteria (CFRB) from the upper respiratory tract. The difficulty some patients have in producing an acceptable sputum specimen further decreases the value of these samples, often causing the physician to treat the patient empirically 1– 4. BAL provides a specimen from the lungs but is an invasive procedure that cannot be routinely used. BAL specimens may also collect contaminants from the upper respiratory tract 5– 7.
An alternative source for a lung specimen is from aerosols generated during coughs 8– 12. Studies show that one cough can generate as many as 66,000 expelled particles 10, 13. Patients that have lower respiratory tract infections can infect others through respiratory dispersion of pathogens in aerosols generated by coughing or sneezing. Coughing produces a higher concentration of pathogens from the lower lungs than normal exhalation or sneezing 8– 13. A new cough specimen collection device (PneumoniaCheck™, Figure 1) collects aerosols from the lungs onto a micropore filter while minimizing contamination from the upper respiratory tract. Microbiology or molecular assays can then be used to detect pathogens collected on the device’s filter.
Figure 1. PneumoniaCheck™ specimen storage and transport container.
The device uses a reservoir to separate oral contents from deep lung aerosols using fluid mechanics for separation ( Figure 2). The initial volume of air that comes from exhalation or coughing is contaminated air from the upper respiratory tract, also known as anatomic dead space. When a patient coughs into the device, this air from the upper airways first flows into the reservoir ( Figure 2a). The exhaled air flows to the reservoir first as it has the least resistance compared to the filter at the end of the device. This reservoir has a volume of 250 ml, approximately 100 ml greater than the volume of anatomic dead space in the average adult 15, which ensures that all of the upper airway aerosols are completely separated out. The expanded reservoir is inelastic, creating a back-pressure, so subsequent exhaled breath is forced through the microbial filter ( Figure 2b). Therefore, only lung aerosol contents are collected onto the filter and are free from upper airway contamination.
Figure 2. PneumoniaCheck™ fluid mechanics airway separation.
( a) Contaminated upper airway particles from the mouth initially fill up air reservoir. ( b) Then, uncontaminated lower airway particles from the lungs are captured onto filter.
A previous study demonstrated that the device’s filter is >99% effective in collecting airborne bacteria (approximately 3.1 μm in diameter) and viruses (approximately 2.8 μm in diameter) 16. Sampling from normal individual controls showed zero collection of oral contents on the filter, even with up to 15 ml of liquid in the mouth (simulating sputum). The PneumoniaCheck™ device has been shown to significantly separate the lower airway gas from the upper airway gas based on oxygen and alcohol levels (p<0.0001) 16.
CF is a genetic disease that affects the lungs of approximately 28,000 children and adults in the United States each year 17. People with CF often have chronic lung infections and require regular monitoring to ensure that bacterial colonization does not develop into infection 26, 27. We used specimens from sputum and coughs to compare their abilities to capture, identify, and quantify relative levels of lung bacteria in adult CF patients. The goal of this study is to determine if the cough device can capture lung pathogens from adult patients with chronic lung infection while simultaneously excluding oral bacteria.
Materials and methods
Subjects
Patients with CF (n=20) aged >18 years old were recruited from the Emory Cystic Fibrosis Center Adult Clinic in Atlanta, Georgia. The Emory Institutional Review Board (H08353) approved the study and participants provided their written, informed consent. The sample size was sufficiently powered to demonstrate statistical significance for lower lung sampling without oral contamination. Tests of paired proportions were conducted using an exact form of the McNemar test to compare the presence of CFRB between two samples (i.e. cough and sputum). The Wilcoxon signed rank test was used to compare cycle threshold ( C T) values between the different methods of sampling. The C T value of 60 was used as the upper limit of detection for all PCR assays to determine relative quantity of bacteria in each specimen.
Clinical measurements
Throat swabs and cough device specimens were collected from 10 healthy, non-smoking subjects for normal controls. Separately, a sputum specimen and cough device specimen were each collected from 20 adult patients with CF. Cough device specimen collection preceded sputum specimen collection in order to help induce sputum. Specimen collections were supervised and emergency equipment was readily available. Streptococcus mitis is a commensal bacterium that is found in the mouth but not in the lungs 14. Streptococcus pneumoniae and Staphylococcus aureus are also commonly found in the oral cavity 3. Pseudomonas aeruginosa, Staphylococcus aureus and Klebsiella pneumoniae are cystic fibrosis related bacteria (CFRB) 18– 20. Oral and cough specimens were analyzed for these bacteria to determine levels of oral contamination.
Determining sufficient aerosol collection
Fennelly’s Cough Aerosol Sampling System (CASS) 29, 30 and Knibbs’ Distance Rig 13 have demonstrated that cough particles can carry substantial concentrations of bacteria from lower respiratory infections. A previous article on the cough collection device describes the ability of the device to selectively sample from the lower lungs while excluding oral contaminants 16. The cough device used in this study provides a less cumbersome option to Fennelly’s and Knibbs’ methods for lung specimen collection. Each patient coughed 10 times into the device to ensure sufficient aerosol collection.
Microbiology
Microbiology culturing has several limitations that decrease the efficiency and effectiveness of rapid diagnosis 24. Throat, sputum, and cough specimens were all analyzed using molecular PCR methods. All specimens were processed in a BSL 2 safety cabinet. The cough device filter was removed, placed into a 2 ml sterile freezer vial, and stored at -80°C. Respiratory secretions captured on the filter were removed by hydrating the filter with 1mL of lysis buffer (MagNA Pure LC lysis buffer; Roche Applied Science, Indianapolis, IN), vortexing, incubating for 5 min at room temperature, and collected using a pipette. Fluid remaining in the filter was collected by placing the filter in a sterile Costar SpinX microfuge tube with a 0.45 micron filter (Corning Inc., Corning, NY), centrifuging for 1 min at 10,000 rpm, and retrieved using a pipette. The residual fluid was then combined with original collected fluid and then 400 μL was extracted on the MagNA Pure Compact Instrument (Roche Applied Science) per the manufacturer’s instructions. The extracted nucleic acid was eluted into 100 μL of elution buffer and stored at -80°C for qPCR testing.
The sputum specimen was mixed with 1 mL of phosphate buffered saline (PBS), homogenized with pipetting and vortexing, mixed with a 12.5 mM equal volume of freshly prepared dithiothreitol (DTT, No Weigh™ format, Fisher Scientific), and incubated at room temperature for 30 min with periodic vortexing. The resultant solution was divided into 400 μL aliquots and stored at -80°C. A 400 μL aliquot of the processed sample was then extracted on the MagNA Pure Compact Instrument and stored as described above.
The extracted nucleic acid was tested for P. aeruginosa, S. aureus, K. pneumoniae, and S. mitis targets by individual real-time PCR assays. The primer and probe sequences for these assays have been previously described 25. The S. mitis primers are: Forward TTTTGTCATCTAGCCTTGC; Reverse GCAGTCATATCATCACCTTC and Probe ACTTGGGCAATCCCGACAGATTCTAAC, with a 5' FAM reporter and a 3' BHQ quencher. The PCR reactions were done with 5 μl of extracted nucleic acid from the specimens plus 12.5 μl of PerfeCTa Multiplex qPCR SuperMix (catalog no. 95063-200; Quanta BioSciences), 0.5 μM final concentrations of each primer, 0.1 μM final concentration of the probe, and nuclease-free water (catalog no. P1193; Promega) to a final reaction volume of 25 μL. Real-time PCR reactions were performed using an ABI 7500 standard machine (Life Technologies, Carlsbad, CA) with enzyme activation at 95°C for 5 min, followed by 45 cycles of 95°C for 15 seconds and 60°C for 1 min. All specimens from CF patients were run in duplicate for each target. The C T values for individual PCR assays were used as an indication of the relative quantity of bacteria in the specimen.
Results
All subjects completed specimen collection safely. Ten healthy subjects were used for controls. Sputum and cough specimens were successfully collected from 20 adult patients with CF, with the exception of five patients who could not produce a sputum specimen.
Normal controls demonstrated a high incidence of false positives from oral sampling, shown in Table 1. Bacteria were isolated from throat swabs in 4/10 (40%) normal, healthy control subjects. S. pneumoniae was positive in 2/10 (20%) oral specimens and S. aureus was positive in 3/10 (30%) oral specimens, with one subject positive for both bacteria. In contrast, 0/10 (0%, p=0.0313) cough specimens were positive for bacteria in normal controls. The calculated true negative rate or specificity for sputum specimens was 60% and 100% for cough specimens.
Table 1. Detection of bacteria in throat and cough specimens from normal, healthy controls.
| Throat | Cough | |
|---|---|---|
| 1 | S. aureus | Negative |
| 2 | Negative | Negative |
| 3 | Negative | Negative |
| 4 | S. aureus | Negative |
| 5 | S. aureus, S. pneumoniae | Negative |
| 6 | Negative | Negative |
| 7 | Negative | Negative |
| 8 | S. pneumoniae | Negative |
| 9 | Negative | Negative |
| 10 | Negative | Negative |
Specificity in the CF patients was similar. For the CF patients, S. mitis was isolated from 13/14 (93%) sputum specimens but in none of the cough specimens (0%, p=0.0002). The cough specimens collected no S. mitis. CFRB was collected in both specimen types. P. aeruginosa was isolated from 13/15 (87%) sputum specimens and 9/20 (45%) cough specimens (p=0.0213). S. aureus was isolated from 9/15 (60%) sputum specimens and 3/20 (15%) cough specimens. K. pneumoniae was isolated from 2/15 (13%) sputum specimens and 3/20 (15%) cough specimens.
In aggregate, sputum specimens were positive for CFRB in 15/15 (100%) samples. Cough specimens were positive for CFRB in 13/20 (65%) samples. The sputum specimens had a 93% rate of oral commensals. Sputum specimens were positive for three or more pathogens in 2/15 (13%) samples, and positive for two or more pathogens in 7/15 (47%) samples. In contrast, cough specimens had no commensals and were positive in 65% of the CF patients. The cough specimens were positive for two or more pathogens in 2/20 (10%, p<0.05) specimens and no cough specimens were positive for three or more pathogens. The results of these real-time PCR identifications are listed in Table 2.
Table 2. Detection of bacteria in sputum and cough specimens from adult CF patients.
| Sputum | Cough | |||||
|---|---|---|---|---|---|---|
| n=15* | % |
C
T
range |
n=20 | % |
C
T
range |
|
| P. aeruginosa | 13/15 | 87% | 18–33 | 2/20 | 45% | 33–42 |
| S. aureus | 9/15 | 60% | 24–38 | 3/20 | 15% | 36–40 |
| K. pneumoniae | 2/15 | 13% | 37–38 | 3/20 | 15% | 39–43 |
| CFRB total | 15/15 | 100% | 18–38 | 13/20 | 65% | 33–43 |
| 2+ pathogens | 7/15 | 47% | 18–38 | 2/20 | 10% | 36–43 |
| 3+ pathogens | 2/15 | 13% | 18–38 | 0/20 | 0% | N/A |
| S. mitis | 13/14† | 93% | 24–41 | 0/17§ | 0% | N/A |
* Five patients were unable to produce viable sputum specimens
† Six sputum specimens were not tested for S. mitis
§ Three cough specimens were not tested for S. mitis
C T values are inversely proportional to the quantity of bacteria in a sample, i.e. small values indicate higher quantities of colony forming units (CFU). For the CFRB samples, P. aeruginosa C T values ranged from 18–33 in sputum specimens and 33–42 in cough specimens. S. aureus C T values ranged from 24–38 in sputum specimens and 36–40 in cough specimens. For both P. aeruginosa and S. aureus the cough and sputum specimens significantly differed in C T values (p=0.0017 and 0.0092, respectively). K. pneumoniae C T values ranged from 37–38 in sputum specimens and 39–43 in cough specimens. Thus, the C T values for cough specimens were consistently higher than those of sputum. Note that the cough filter samples from normal controls exhibited no pathogens up to C T values of 60.
Discussion
It is widely recognized that a simple, safe, non-invasive, low maintenance, inexpensive, widely accessible sampler is needed for the collection of lower respiratory pathogens 34– 37.
Collection of lower lung contents by coughing is much easier than BAL specimen collection. The method is convenient for patients who are already inclined to cough and they reported that the use of the device helped clear their lungs. Cough specimens may provide a non-invasive yet specific sample for in-home surveillance to watch for spikes in lung pathogens in patients with CF. Use of the device to collect cough aerosols has the potential to provide a clean alternative to oral samples for detecting lower lung pathogens.
As is well known, commonly used samples of sputum or OP swabs show strong contamination in the upper airway 3, 4. Nearly all of the sputum specimens were positive for the oral commensal S. mitis. In contrast, none of the cough specimens were positive for S. mitis. This difference in the commensal S. mitis between sputum and cough specimens reiterates the unreliability and low specificity of sputum 3, 4. Further, not all patients can produce an adequate sputum sample. Examining the 12 subjects with paired sputum and S. mitis results, 8/12 (67%) sputum and cough specimens had concordant positives, although six of these eight were positive for additional bacteria in sputum. These six sputum specimens with multiple bacteria likely indicate false positives from oral contamination rather than co-infection.
The number of concordant sputum and cough specimens (2/12, 17%) was small. Conversely, the pathogen detected in the cough specimen was different from that observed in the sputum specimen. 2/12 (17%) sputum specimens did not identify bacteria that were identified in cough specimens, possibly reflecting masked readings associated with commensal distraction. The differences demonstrate that the cough device is not just collecting sputum.
P. aeruginosa is the most common bacterium found in lungs of adult CF patients 19, and was also the most prevalent bacterium collected in our cohort. 13/20 (65%) cough specimens were positive for CFRB. This incidence and distribution of pathogens in CF is similar to the 59% positive for CFRB in BAL sampling 22, 23. Prior series of BAL specimens in similar populations have yielded positive CFRB of 59–85%, similar to the 65% positivity from the cough device illustrating comparable sensitivity 22, 23.
Collection of exhaled aerosols has been studied by several previous groups. An alternate device for aerosol collection is the RTube™; however, it varies greatly in design and function 28. The RTube™ system is designed to collect from all exhaled breath that condenses 28 while PneumoniaCheck™ is designed to collect particulate sized lung aerosols and separate out the mouth contents 16. The majority of exhaled gas passes out of the end of the RTube™ as only water condensate is intended to be collected. Exhaled breath condensate can be a useful specimen for identifying pH levels, but is generally not viewed as a reliable specimen for identifying lower respiratory infections 34– 37.
Wainwright et al., reported detecting P. aeruginosa in cough aerosols by culture 12. They reported 25/28 (89%) positive in a mixed population of children and adults with CF using a cough aerosol sampling system (CASS) for 5 minutes with each subject 12. Similarly, Knibbs et al. reported that 14/18 (78%) patients aerosolized P. aeruginosa that remained viable and presumably transmissive up to 45 minutes after coughs sampled on an Anderson impactor 13. Knibbs et al. used conventional microbiology cultures to quantify colony forming units. Both of these studies used a specially constructed aerosol sampler that is expensive, cumbersome, and difficult to use in a clinical setting. For these studies, patients cough into a standard mouthpiece and aerosols are sucked into impactors using vacuum air pumps. The CASS system was not designed for routine use in clinical settings and the mouthpiece was not designed to exclude oral contents. These designs differ from PneumoniaCheck™, which has a mouthpiece designed to specifically exclude oral contaminants 16. The high incidence of P. aeruginosa, using the snorkel type mouthpiece and tubing, may reflect some collection of oral contents using CASS.
RT-PCR may be used to quantify the amount of pathogens in a sample. As more material is collected on the filter, the C T counts will drop similar to the inverse of CFUs 32. It should be noted that an aerosolized lung specimen should have higher C T values compared to the liquid specimens of sputum due to a lack of contamination and the small physical volume of aerosols. C T values in the sputum specimens ranged from 19–38, whereas the range in cough specimens was 33–43 (p<0.001, Table 3). Nonetheless, C T values in all positive cough specimens are significantly lower than the baseline of >60 for normal controls. While the C T values are higher for the cough specimens, the background noise level of the virgin filter is >60, allowing limits of detection by PCR that may be more sensitive to lung CFRB.
Table 3. C T values of sputum and cough specimens grouped by pathogen.
| Subject | P. aeruginosa | S. aureus | K. pneumoniae | S. mitis | ||||
|---|---|---|---|---|---|---|---|---|
| # | Sputum | Cough | Sputum | Cough | Sputum | Cough | Sputum | Cough |
| 1 | 22 | 33 | - | - | - | - | 41 | - |
| 2 | N/A | 42 | N/A | - | N/A | - | N/A | - |
| 3 | 32 | - | - | - | - | - | 32 | - |
| 4 | 21 | 41 | 36 | - | - | - | 24 | - |
| 5 | N/A | - | N/A | - | N/A | - | N/A | - |
| 6 | 18 | - | - | - | - | 41 | 32 | - |
| 7 | N/A | - | N/A | - | N/A | - | N/A | - |
| 8 | N/A | 35 | N/A | - | N/A | - | N/A | - |
| 9 | N/A | - | N/A | 36 | N/A | 43 | 31 | - |
| 10 | 19 | - | 38 | 40 | 37 | - | N/A | N/A |
| 11 | 19 | 42 | 27 | - | 38 | - | N/A | N/A |
| 12 | 20 | - | - | - | - | - | 30 | - |
| 13 | 33 | 39 | 30 | - | - | - | 33 | - |
| 14 | 33 | 40 | 24 | - | - | - | 33 | - |
| 15 | - | - | 37 | - | - | - | 32 | - |
| 16 | 25 | - | - | - | - | - | 31 | - |
| 17 | - | - | 33 | - | - | 39 | 27 | - |
| 18 | 25 | - | - | - | - | - | 29 | - |
| 19 | 25 | 39 | 29 | 39 | - | - | 29 | - |
| 20 | 22 | 42 | 34 | - | - | - | - | N/A |
One can utilize the C T values to compare relative amounts of pathogens being coughed by an individual patient compared with a population 32, 33. Jones-López et al. found that both CF and TB patients can produce aerosols with viable pathogens, but the amount of pathogens produced by individuals varies greatly 31. Patients with high amounts of M. tuberculosis in cough aerosols were more likely to have transmitted to others 30. Those that produce large amounts of pathogens in coughs may be more efficient transmitters, e.g. “superspreaders” 13, 30. The quantity of pathogens in a cough may be a critical metric in transmission of infectious disease, controlling epidemics, and monitoring colonization. In the Jones-López et al. study, the amount of aerosolized M. tuberculosis fell dramatically after three weeks of treatment. Therefore, a cough specimen could also be used to monitor levels of resistant bacteria, if present.
Published guidelines for CF patients suggest acquiring quarterly respiratory specimens to monitor lung infections 26, 27. Cough specimens may be a more specific and sensitive method for monitoring colonization and determining infectivity. Additional studies could explore this application further by comparing C T values with symptoms. If a CF patient is monitored on a regular basis using cough specimens, a sudden decrease in C T value may indicate a change in pathogen burden 32, 33. The C T value of pathogen burden in cough aerosols may be useful as a measurement to determine if the lung burden is growing.
This study has several limitations. Our study included only adult patients; thus, we cannot comment on the aerosol production during coughing by pediatric patients. This study reports on 20 patients. Most studies in the literature have a similar number of subjects, since lower respiratory identification has always been an enormous challenge 12, 13. Future studies may evaluate the benefits of requiring more coughs or coughing for a specified amount of time, such as 5 minutes, to establish C T thresholds for this new method of specimen collection. The RT-PCR molecular assays used in this study are not available at all hospitals, although a few commercial laboratories can provide clinical respiratory identification services.
Conclusion
In summary, we have shown that a new device can collect lung pathogens from adult patients with CF from cough aerosols with identification using molecular assays. The device excludes oral contaminants showing higher specificity than sputum samples. Identifying causative pathogens in the lower respiratory tract is likely to play a significant role in patient management 24. The data in this study suggest an alternative to sputum collection for the identification of lower respiratory pathogens.
Consent
Written informed consent was obtained by all participants through Institutional Review Board Protocol #000-2492 approved by Georgia Institute of Technology, Emory University, and US Centers for Disease Control and Prevention.
Data availability
The data referenced by this article are under copyright with the following copyright statement: Copyright: © 2016 Ku DN et al.
All raw data are provided in the tables above.
Funding Statement
Supported by internal grants from US Centers for Disease Control and Prevention and Emory University Hospital.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
[version 1; referees: 2 approved]
References
- 1. Burns MW: Precipitins to Klebsiella and Other Enterobacteria in the Serum of Patients with Chronic Respiratory Disorders. The Lancet. 1968;1(7539):383–385. 10.1016/S0140-6736(68)91353-6 [DOI] [PubMed] [Google Scholar]
- 2. Goddard AF, Staudinger BJ, Dowd SE, et al. : Direct sampling of cystic fibrosis lungs indicates that DNA-based analyses of upper-airway specimens can misrepresent lung microbiota. Proc Natl Acad Sci U S A. 2012;109(34):13769–13774. 10.1073/pnas.1107435109 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Lentino JR, Lucks DA: Nonvalue of Sputum Culture in the Management of Lower Respiratory Tract Infections. J Clin Microbiol. 1987;25(5):758–762. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Rosenfeld M, Emerson J, Accurso F, et al. : Diagnostic accuracy of oropharyngeal cultures in infants and young children with cystic fibrosis. Pediatr Pulmonol. 1999;28(5):321–328. [DOI] [PubMed] [Google Scholar]
- 5. Gilchrist FJ, Salamat S, Clayton S, et al. : Bronchoalveolar lavage in children with cystic fibrosis: how many lobes should be sampled? Arch Dis Child. 2011;96:215–217. 10.1136/adc.2009.177618 [DOI] [PubMed] [Google Scholar]
- 6. Willner D, Haynes MR, Furlan M, et al. : Spatial distribution of microbial communities in the cystic fibrosis lung. ISME J. 2012;6(2):471–474. 10.1038/ismej.2011.104 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Wimberley N, Faling LJ, Bartlett JG: A Fiberoptic Bronchoscopy Technique to Obtain Uncontaminated Lower Airway Secretions for Bacterial Culture. Am Rev Respir Dis. 1979;119(3):337–343. [DOI] [PubMed] [Google Scholar]
- 8. Couch RB, Cate TR, Douglas RG, Jr, et al. : Effect of Route of Inoculation on Experimental Respiratory Viral Disease in Volunteers and Evidence for Airborne Transmission. Bacteriol Rev. 1966;30(3):517–529. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Couch RB, Cate TR, Gerone PJ, et al. : Production of Illness with a Small-Particle Aerosol of Coxsackie A 21. J Clin Invest. 1965;44(4):535–542. 10.1172/JCI105166 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Gerone PJ, Couch RB, Keefer GV, et al. : Assessment of Experimental and Natural Viral Aerosols. Bacteriol Rev. 1966;30(3):576–584. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Lee N, Chan PK, Hui DS, et al. : Viral loads and duration of viral shedding in adult patients hospitalized with influenza. J Infect Dis. 2009;200(4):492–500. 10.1086/600383 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Wainwright CE, France MW, O’Rourke P, et al. : Cough-generated aerosols of Pseudomonas aeruginosa and other Gram-negative bacteria from patients with cystic fibrosis. Thorax. 2009;64(11):926–931. 10.1136/thx.2008.112466 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Knibbs LD, Johnson GR, Kidd TJ, et al. : Viability of Pseudomonas aeruginosa in cough aerosols generated by persons with cystic fibrosis. Thorax. 2014;69(8):740–745. 10.1136/thoraxjnl-2014-205213 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Liljemark WF, Gibbons RJ: Proportional distribution and relative adherence of streptococcus miteor ( mitis) on various surfaces in the human oral cavity. Infect Immun. 1972;6(5):852–859. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Hart MC, Orzalesi MM, Cook CD: Relation between anatomic respiratory dead space and body size and lung volume. J Appl Physiol. 1963;18(3):519–522. Reference Source [DOI] [PubMed] [Google Scholar]
- 16. Scholz TL, Midha PA, Anderson LJ, et al. : PneumoniaCheck: A Device for Sampling Lower Airway Aerosols. J Med Devices. 2010;4(4):041005 10.1115/1.4002760 [DOI] [Google Scholar]
- 17. Cystic Fibrosis Foundation Patient Registry: 2013 Annual Data Report to the Center Directors.Bethesda, Maryland.2014. [Google Scholar]
- 18. Furness JC, Habeb A, Spencer DA, et al. : To the editor: Bronchoalveolar lavage (BAL) in pediatric cystic fibrosis (CF): its clinical use modified by audit in a regional CF center. Pediatr Pulmonol. 2002;33(3):234. 10.1002/ppul.10052 [DOI] [PubMed] [Google Scholar]
- 19. Lyczak JB, Cannon CL, Pier GB: Lung infections associated with cystic fibrosis. Clin Microbiol Rev. 2002;15(2):194–222. 10.1128/CMR.15.2.194-222.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Ramsey BW, Wentz KR, Smith AL, et al. : Predictive value of oropharyngeal cultures for identifying lower airway bacteria in cystic fibrosis patients. Am Rev Respir Dis. 1991;144(2):331–337. 10.1164/ajrccm/144.2.331 [DOI] [PubMed] [Google Scholar]
- 21. Armstrong DS, Grimwood K, Carlin JB, et al. : Bronchoalveolar lavage or oropharyngeal cultures to identify lower respiratory pathogens in infants with cystic fibrosis. Pediatr Pulmonol. 1996;21(5):267–275. [DOI] [PubMed] [Google Scholar]
- 22. Harris JK, De Groote MA, Sagel SD, et al. : Molecular identification of bacteria in bronchoalveolar lavage fluid from children with cystic fibrosis. Proc Natl Acad Sci U S A. 2007;104(51):20529–20533. 10.1073/pnas.0709804104 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Zemanick ET, Wagner BD, Harris JK, et al. : Pulmonary exacerbations in cystic fibrosis with negative bacterial cultures. Pediatr Pulmonol. 2010;45(6):569–577. 10.1002/ppul.21221 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Oosterheert JJ, Bonten MJ, Buskens E, et al. : Algorithm to determine cost savings of targeting antimicrobial therapy based on results of rapid diagnostic testing. J Clin Microbiol. 2003;41(10):4708–4713. 10.1128/JCM.41.10.4708-4713.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Emery SL, Erdman DD, Bowen MD, et al. : Real-time reverse transcription-polymerase chain reaction assay for SARS-associated coronavirus. Emer Infect Dis. 2004;10(2):311–316. 10.3201/eid1002.030759 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Saiman L, Siegel J, Cystic Fibrosis Foundation: Infection control recommendations for patients with cystic fibrosis: microbiology, important pathogens, and infection control practices to prevent patient-to-patient transmission. Infect Control Hosp Epidemiol. 2003;24(5 Suppl):S6–52. 10.1086/503485 [DOI] [PubMed] [Google Scholar]
- 27. Yankaskas JR, Marshall BC, Sufian B, et al. : Cystic fibrosis adult care: consensus conference report. Chest. 2004;125(1 Suppl):1S–39S. 10.1378/chest.125.1_suppl.1S [DOI] [PubMed] [Google Scholar]
- 28. Soyer OU, Dizdar EA, Keskin O, et al. : Comparison of two methods for exhaled breath condensate collection. Allergy. 2006;61(8):1016–1018. 10.1111/j.1398-9995.2006.01064.x [DOI] [PubMed] [Google Scholar]
- 29. Fennelly KP, Martyny JW, Fulton KE, et al. : Cough-generated aerosols of Mycobacterium tuberculosis: a new method to study infectiousness. Am J Respir Crit Care Med. 2004;169(5):604–609. 10.1164/rccm.200308-1101OC [DOI] [PubMed] [Google Scholar]
- 30. Fennelly KP, Jones-López EC, Ayakaka I, et al. : Variability of infectious aerosols produced during coughing by patients with pulmonary tuberculosis. Am J Respir Crit Care Med. 2012;186(5):450–457. 10.1164/rccm.201203-0444OC [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Jones-López EC, Namugga O, Mumbowa F, et al. : Cough aerosols of Mycobacterium tuberculosis predict new infection: a household contact study. Am J Respir Crit Care Med. 2013;187(9):1007–1015. 10.1164/rccm.201208-1422OC [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Mehta T, McGrath E, Bheemreddy S, et al. : Detection of oseltamivir resistance during treatment of 2009 H1N1 influenza virus infection in immunocompromised patients: utility of cycle threshold values of qualitative real-time reverse transcriptase PCR. J Clin Microbiol. 2010;48(11):4326–4328. 10.1128/JCM.01190-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Espy MJ, Uhl JR, Sloan LM, et al. : Real-time PCR in clinical microbiology: applications for routine laboratory testing. Clin Microbiol Rev. 2006;19(1):165–256. 10.1128/CMR.19.1.165-256.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Xu Z, Shen F, Li X, et al. : Molecular and microscopic analysis of bacteria and viruses in exhaled breath collected using a simple impaction and condensing method. PLoS One. 2012;7(7):e41137. 10.1371/journal.pone.0041137 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Houspie L, De Coster S, Keyaerts E, et al. : Exhaled breath condensate sampling is not a new method for detection of respiratory viruses. Virol J. 2011;8:98. 10.1186/1743-422X-8-98 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Fabian P, McDevitt JJ, DeHaan WH, et al. : Influenza virus in human exhaled breath: an observational study. PLoS One. 2008;3(7):e2691. 10.1371/journal.pone.0002691 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Huynh KN, Oliver BG, Stelzer S, et al. : A new method for sampling and detection of exhaled respiratory virus aerosols. Clin Infect Dis. 2008;46(1):93–95. 10.1086/523000 [DOI] [PubMed] [Google Scholar]