Skip to main content
PLOS One logoLink to PLOS One
. 2016 Dec 1;11(12):e0167725. doi: 10.1371/journal.pone.0167725

Increased Nasopharyngeal Density and Concurrent Carriage of Streptococcus pneumoniae, Haemophilus influenzae, and Moraxella catarrhalis Are Associated with Pneumonia in Febrile Children

Sopio Chochua 1,#, Valérie D'Acremont 2,3,#, Christiane Hanke 1,#, David Alfa 1,#, Joshua Shak 1,#, Mary Kilowoko 4,#, Esther Kyungu 5,#, Laurent Kaiser 6,#, Blaise Genton 2,3,7,#, Keith P Klugman 1,#, Jorge E Vidal 1,*,#
Editor: Shamala Devi Sekaran8
PMCID: PMC5132320  PMID: 27907156

Abstract

Background

We assessed nasopharyngeal (NP) carriage of five pathogens in febrile children with and without acute respiratory infection (ARI) of the upper (URTI) or lower tract, attending health facilities in Tanzania.

Methods

NP swabs collected from children (N = 960) aged 2 months to 10 years, and with a temperature ≥38°C, were utilized to quantify bacterial density of S. pneumoniae (Sp), H. influenzae (Hi), M. catarrhalis (Mc), S. aureus (Sa), and N. meningitidis (Nm). We determined associations between presence of individual species, densities, or concurrent carriage of all species combination with respiratory diseases including clinical pneumonia, pneumonia with normal chest radiography (CXR) and endpoint pneumonia.

Results

Individual carriage, and NP density, of Sp, Hi, or Mc, but not Sa, or Nm, was significantly associated with febrile ARI and clinical pneumonia when compared to febrile non-ARI episodes. Density was also significantly increased in severe pneumonia when compared to mild URTI (Sp, p<0.002; Hi p<0.001; Mc, p = 0.014). Accordingly, concurrent carriage of Sp+, Hi+, and Mc+, in the absence of Sa- and Nm-, was significantly more prevalent in children with ARI (p = 0.03), or clinical pneumonia (p<0.001) than non-ARI, and in children with clinical pneumonia (p = 0.0007) than URTI. Furthermore, Sp+, Hi+, and Mc+ differentiated children with pneumonia with normal CXR, or endpoint pneumonia, from those with URTI, and non-ARI cases.

Conclusions

Concurrent NP carriage of Sp, Hi, and Mc was a predictor of clinical pneumonia and identified children with pneumonia with normal CXR and endpoint pneumonia from those with febrile URTI, or non-ARI episodes.

Introduction

The nasopharynx is an ecologic reservoir for human bacterial pathogens such as Streptococcus pneumoniae (Sp), Moraxella catarrhalis (Mc), Haemophilus influenzae (Hi), Staphylococcus aureus (Sa), and Neisseria meningitidis (Nm) [1]. Whereas these species form part of the nasopharyngeal microbiome [1, 2], they are also the source of several of the most prevalent causes of morbidity and mortality to human kind, which include diseases such as acute otitis media, pneumonia, bacteremia and meningitis [3].

Carriage of these nasopharyngeal species in healthy children varies amongst different studies and geographic regions [4]. In general, carriage prevalence of these bacteria is lower in industrialized countries than in resource-limited nations. The tendency, however, is that carriage of Sp, Hi or Mc increases during childhood, peaking at the age of 3 years, and then decreases [1]. Conversely, Nm carriage is low during childhood, but peaks in prevalence in young adults [5], whereas nasopharyngeal carriage of Sa decreases during childhood and remains relatively low thereafter [6, 7].

There are limited studies focused on investigating nasopharyngeal carriage during disease episodes. Studies conducted in Vietnamese children (<2 years old) showed a similar prevalence of nasopharyngeal carriage of Sp, Hi or Mc in children with pneumonia compared to healthy controls but an increased Sp nasopharyngeal density was observed in pneumonia patients, compared to controls [8]. Carriage of Sp, Hi or Mc has also been associated with the development of otitis media and sinusitis [9, 10]. An increased nasopharyngeal carriage of Sp has also been associated with infection with influenza virus, rhinovirus, and adenovirus in admitted South African children with pneumonia [11] and to influenza virus and parainfluenza virus in Peruvian children with acute respiratory infection (ARI) [12].

The complex milieu of these nasopharyngeal (NP) pathogens can also be modified by factors such as the use of antimicrobial medicines or vaccines, or the innate immune response, which include the development of an acute infection [13, 14]. To the best of our knowledge, carriage dynamics by all these five species (i.e., Sp, Mc, Hi, Sa and Nm) have not been previously investigated at the same time in the nasopharynx of ill children. The present study investigated carriage of these five major human pathogens in a cohort of urban and rural Tanzanian children presenting with an acute febrile illness [15]. The associations between presence of these bacteria, concurrent carriage or nasopharyngeal densities, and disease conditions were assessed. More precisely, we investigated differences in bacterial carriage according to: 1) respiratory disease versus other type of infections causing fever, 2) clinical pneumonia versus upper respiratory tract infections, 3) type of radiological findings in children with clinical pneumonia, and 4) disease severity.

Material and Methods

Study area and population

Nasopharyngeal swabs (NP) were collected from 1005 febrile children, aged 2 months to 10 years, presenting at the outpatient clinic of Amana District Hospital in the economical capital of Tanzania, Dar es Salaam, and at the outpatient clinic of St. Francis Designated District Hospital in Ifakara, Kilombero District, a small rural town in South central Tanzania, as described elsewhere [15]. Briefly, the enrollment period was from April to August 2008 for patients of Dar es Salaam and from June to December 2008 for those of Ifakara. Children with an axillary temperature of ≥ 38°C and requiring no immediate lifesaving procedures were assessed for inclusion criteria: 1) first visit for the present illness, 2) fever duration ≤ 1 week, 3) chief reason for visit not injury/trauma, 4) no antimalarial or antibiotic received during the preceding week, and 5) no severe malnutrition. A questionnaire and clinical examination were administered. At the time of study, enrollment in the Expanded Program on Immunization in Tanzania did not include the pneumococcal vaccine or Haemophilus influenzae vaccine. Ethical approval by the Institutional Review Board of the Ifakara Health Institute (IHI/IRB/No. A 60) and the National Institute for Medical Research Review Board (NIMR/HQ/R.8a/Vol.IX/823) in Tanzania, as well as the Ethikkommission beider Basel (EKBB 130/09) in Switzerland.

Definition of febrile diseases

Final diagnosis(ses) for acute febrile illness was established based on criteria from the World Health Organization (WHO), Infectious Diseases Society of America guidelines and systematic reviews [15]. Acute respiratory infection (ARI) was defined as any acute (≤1 week) infection manifested by at least one respiratory sign or symptom localized to the upper or lower respiratory tract and divided in two categories: clinical pneumonia or upper respiratory tract infection (URTI). Children with clinical pneumonia were further divided in three categories based on chest radiography (CXR) findings, according to the WHO Pneumococcal Trials Ad Hoc Committee recommendations [16, 17]: alveolar consolidation and/or pleural effusion was categorized as endpoint pneumonia; other infiltrates (that in all these children corresponded to peribronchial thickening +/- atelectasis, compatible with the clinical entity of bronchiolitis), were categorized as pneumonia with other infiltrates; normal radiography was categorized as pneumonia with normal CXR. Severe febrile disease (whenever due to ARI or another type of infection) was defined as the presence of at least one of the following features: respiratory distress, impaired consciousness, seizures, meningismus, cardiovascular failure, renal failure, severe anemia (hemoglobin <5 g/dl), severe dehydration, jaundice, and severe malnutrition.

Specimen collection and storage

NP swabs were collected according to recommendations from the WHO [18] and immediately stored in 1 ml of STGG (skim-milk, tryptone, glucose and glycerol) transport medium [19], vortexed for 20 s with the swabs inside to release bacteria into the STGG and frozen at -80°C until further analysis.

DNA extraction from nasopharyngeal swabs

All DNA extractions were performed in an access-restricted laboratory room utilized only for processing clinical samples and under a biological safety cabinet with sterile environment. Frozen NP samples were thawed at room temperature and then vortexed for 15 s. Two hundred microliters of the sample were mixed with 100 μl of TE buffer (10mM Tris-HCl, 1 mM EDTA, pH 8.0) containing 0.04 g/ml of lysozyme and 75 U/ml of mutanolysin, and then incubated for 1 h in a 37°C in water bath. The subsequent steps were carried out according to the Qiagen DNA mini kit protocol, as detailed elsewhere [20, 21]. DNAs were eluted in 100 μl of elution buffer and stored at -80°C. DNA from reference strains Sp (TIGR4), Sa (American Type Culture Collection (ATCC) 25923), Hi (Centers for Disease Control and Prevention (CDC) reference strain M5216), Mc (CDC reference strain M15757), and Nm (CDC8201085) [22] were also extracted from overnight cultures using the QIAamp kit. DNA concentration was measured by the Nanodrop method (Nanodrop Technologies, Wilmington, DE).

Quantitative PCR

Quantitative PCR (qPCR) assays targeting the following genes lytA, nuc, hpd, copB, and sodC, carried by all Sp, Sa, Hi, Mc, and Nm respectively, were performed. The qPCR assays utilized published primers and probes at concentrations optimized in this study and shown in Table 1 [2328].

Table 1. Primers and probes utilized in this study.

Target Gene Sequence Probe fluorophore and quencher Concentration (nM) Reference
lytA Forward ACGCAATCTAGCAGATGAAGCA 200 [23]
Reverse TCGTGCGTTTTAATTCCAGCT 200
Probe TGCCGAAAACGCTTGATACAGGGAG 5' FAM, 3' BHQ1 200
nuc Forward GTTGCTTAGTGTTAACTTTAGTTGTA 400 [26]
Reverse AATGTCGCAGGTTCTTTATGTAATTT 400
Probe FAM-AAGTCTAAGTAGCTCAGCAAATGCA 5' HEX, 3' BHQ1 200
sodC Forward GCACACTTAGGTGATTTACCTGCAT 400 35
Reverse CCACCCGTGTGGATCATAATAGA 400
Probe CATGATGGCACAGCAACAAATCCTGTTT 5' TEXAS RED, 3' BHQ1 200
hpd Forward GGTTAAATATGCCGATGGTGTTG 300 [27]
Reverse TGCATCTTTACGCACGGTGTA 300
Probe TTGTGTACACTCCGT“T”GGTAAAAGAACTTGCAC 5' FAM, BHQ1dT, 3' SPC6 100
copB Forward CGTGTTGACCGTTTTGACTTT 200 [25]
Reverse TAGATTAGGTTACCGCTGACG 200
Probe ACCGACATCAACCCAAGCTTTGG 5' HEX, 3' BHQ1 100

Quantitative PCR reactions were carried out in a final 25 μl volume and performed using Platinum qPCR superMix (Invitrogen), according to the instructions of the manufacturer, with 2.5 μl of purified DNA and the concentration of each primer and probe set shown in Table 1. A no-template control was always included in every run. To quantify the number of genome copies present in each sample, purified genomic DNA from the corresponding reference strain was serially diluted with TE and run in parallel. Genome copies of each set of standards were as follows: Sp (TIGR4) 2.14, 2.14x101, 4.29x101, 4.29x102, 4.29x103, 4.29x104, 4.29x105; Sa (ATCC 25923) 1.64, 1.64x101, 3.29x101, 3.29x102, 3.29x103, 3.29x104, 3.29x105; Hi (CDC M5216) 2.53, 2.53x101, 5.06x101, 5.06x102, 5.06x103, 5.06x104, 5.06x105; Mc (CDC M15757) 2.49, 2.49x101, 4.97x101, 4.97x102, 4.97x103, 4.97x104, 4.97x105, and Nm (CDC8201085) 2.14, 2.14x101, 4.29x101, 4.29x102, 4.29x103, 4.29x104, 4.29x105. These standards were run along with DNA from NP samples in a CFX96 real time system (BioRad, Hercules, CA) and CFU/ml were calculated using the software Bio-Rad CFX manager. The following cycling parameters were utilized: 95°C for 2 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Negative samples were defined with cycle threshold (CT) values, if any, greater than >40. All reactions showed an efficiency between 94 and 98% (recommended 90–110%) [29].

Statistical analysis

The main outcomes of interest were the relationships of carriage with the presence of a certain febrile disease. Chi-square tests were performed to examine whether there was an association among bacterial densities of all bacteria, and between each bacteria, and other independent categorical variables in the dataset. Logistic regression models were used to determine if carriage of one bacterial species was associated with carriage of the other species. To examine the effects of covariates on each species, we modeled carriage of all five bacteria separately. Carriage of Sp, Hi, Sa, Mc, or Nm was modeled separately, and each model included the presence/absence of the other species as the main exposures of interest and adjusted for age, sex, site, and ARI. Evaluation of models was done using the ‘Goodness of fit’ tests such as the Hosmer-Lemeshow test. All statistical analyses were performed using SAS version 9.4 (SAS Institute, Inc., Cary, NC, USA) or SigmaPlot for Windows Version 12.0 (Systat Software, Inc.).

Results

Demographic and clinical characteristics of the febrile children

A total of 1005 febrile children were consecutively recruited. Nine hundred and sixty febrile children, for whom enough NP material was available, were included in this study. Demographic and clinical characteristics of these children are described in Table 2. Among the children included in the analysis, 62% presented at the clinic with an ARI (44% with URTI, 12% with pneumonia with normal CXR, 3% with pneumonia with infiltrates and 3% with endpoint pneumonia), whereas 23% were diagnosed with other diseases, and 15% had unknown disease. About 6% of children had malaria, 6% gastrointestinal disease, 2% typhoid, 4% urinary tract infection, 5% systemic disease and less than 1% presented with occult bacteremia, or skin disease. Overall, 13% of the children had a severe febrile illness, and among children with ARI, 10.6% had a severe presentation (Table 2).

Table 2. Demographic and Clinical Characteristics of Febrile Children (N = 960).

Characteristic Number (%)
Sex
 Male 491 (51.1)
 Female 469 (48.9)
Age (month)
 ≤ 12 312 (32.5)
 > 12–36 432 (45.0)
 > 36 216 (22.5)
Site
 Rural (Ifakara) 481 (50.1)
 Urban (Dar es Salaam) 479 (49.9)
Acute respiratory infection 597 (62.2)
 Upper respiratory tract infection 420 (43.8)
 Clinical pneumonia 177 (18.4)
  Pneumonia with normal CXR 117 (12.2)
  Pneumonia with other infiltrates 33 (3.4)
  End-point pneumonia 27 (2.8)
Other disease 220 (22.9)*
 Malaria 60 (6.3)
 Gastrointestinal infection 57 (5.9)
 Typhoid 19 (2.0)
 Urinary tract infection 39 (4.1)
 Skin infection 9 (0.9)
 Occult bacteremia# 7 (0.7)
 Other systemic infection 51 (5.3)
Unknown disease 143 (14.9)
Severe disease 124 (12.9)

* Note: total of the other disease sum (220) does not equal to the sum of individual diseases (242) summed up, because some children have more than one category of the other disease;

#defined as a child with a positive blood culture other than Salmonella typhi, without a localized source of infection

Prevalence of individual nasopharyngeal carriage of bacterial pathogens and association with respiratory infections

The overall prevalence of nasopharyngeal carriage of Sp was 81%, Hi 75%, Sa 23%, Mc 91%, and Nm 51% (Table 3). However, when detection of these species was individually assessed in each disease category, Sp, Hi or Mc was more prevalent in the nasopharynx in cases of febrile ARI, in comparison to febrile non-ARI cases [Sp (odds ratio, OR = 1.76, 95% confidence interval, CI: 1.27–2.44), Hi (1.91, 1.42–2.56) or Mc (1.65, 1.06–2.56)], as well as in cases of clinical pneumonia when compared to non-ARI cases [Sp (2.32, 1.40–3.85), Hi (2.55, 1.62–4.01) or Mc (3.26, 1.44–7.41)] (Table 3). Carriage rates of individual species when comparing the different types of respiratory disease, or disease severity, for example URTI vs clinical pneumonia, end-point vs other infiltrates, end-point pneumonia vs normal CXR pneumonia, was similar (data not shown).

Table 3. Prevalence of nasopharyngeal carriage by bacterial species and their association with respiratory infections.

Bacterial pathogen Overall
(N = 960)
Non-ARI
(N = 363)
ARI
(N = 597)
Odds Ratio*
(95% CI)
P-value (2-tail)
Clinical pneumonia
(N = 177)
Odds Ratio**
(95% CI)
P-value (2-tail)
S. pneumoniae 776 (80.8%) 273 (75.2%) 503 (84.3%) 1.76 (1.27–2.44)
6.5x10-4
155 (87.5%) 2.32 (1.40–3.85)
6.5x10-4
H. influenzae 715 (74.5%) 242 (66.7%) 473 (79.2%) 1.91 (1.42–2.56)
1.8x10-5
148 (83.6%) 2.55 (1.62–4.01)
2.3x10-5
S. aureus 223 (23.2%) 95 (26.2%) 128 (21.4%) 0.77 (0.57–1.05)
9.4x10-2
35 (19.8%) 0.69 (0.44–1.07)
1.0x10-10.1021
M. catarrhalis 872 (90.8%) 320 (88.1%) 552 (92.5%) 1.65 (1.06–2.56)
2.7x10-2
170 (96.0%) 3.26 (1.44–7.41)
1.9x10-3
N. meningitidis 492 (51.2%) 190 (52.3%) 302 (50.6%) 0.93 (0.72–1.21)
5.9x10-1
82 (46.3%) 0.78 (0.54–1.12)
1.9x10-1

*Non-ARI vs ARI,

**Non-ARI vs clinical pneumonia

Concurrent carriage of bacterial pathogens and association with respiratory infections

Further analyses revealed that 94.2% of febrile children enrolled were carrying more than one species of the five bacterial species tested in this study (Table 4). Concurrent carriage of Sp, Hi, and Mc was associated with respiratory infections (S1 Table). Carriage of all three Sp, Hi, and Mc [in the absence of Sa and Nm (Sa- and Nm-)] was significantly more prevalent in the nasopharynx of children with febrile ARI than in children with a febrile non-ARI episode (p = 0.035) or in children with clinical pneumonia vs URTI (p = 0.009) (S1 Table). Furthermore, concurrent carriage of these three species, in the absence of Sa- and Nm-, was also significantly more prevalent in the nasopharynx of children with pneumonia with normal CXR than those children with URTI (p = 0.018) (S1 Table). The sensitivity and specificity to differentiate pneumonia with normal CXR and endpoint pneumonia from non-ARI cases was 75% and 80% or 81% and 80%, respectively, whereas the sensitivity to differentiate pneumonia with normal CXR, or endpoint pneumonia, from URTI cases was 75% and 77%, or 81.5%, and 77.6%, respectively.

Table 4. Prevalence of concurrent carriage by bacterial species in the nasopharynx of febrile children.

Pattern Bacterial species and combinations Number (%)
No bacterial species identified 24 (2.5)
One bacterial species identified 56 (5.8)
Most prevalent M. catarrhalis 26 (2.7)
Least prevalent H. influenzae 6 (0.6)
Two bacterial species identified 128 (13.3)
Most prevalent S. pneumoniae + M. catarrhalis 53 (5.5)
Least prevalent S. pneumoniae + S. aureus,H. influenzae + S. aureus 2 (0.2)
2 (0.2)
Three bacterial species identified 325 (33.9)
Most prevalent S. pneumoniae + H. influenzae + M. catarrhalis 223 (23.2)
Least prevalent H. influenzae + S. aureus + N. meningitidis 1 (0.1)
Four bacterial species identified 344 (35.8)
Most prevalent S. pneumoniae + H. influenzae + M. catarrhalis +N. meningitidis 262 (27.3)
Least prevalent H. influenzae + M. catarrhalis + S. aureus +N. meningitidis 15 (1.6)
All five bacterial species identified 83 (8.6)

Assessing the associations of nasopharyngeal carriage of Sp, Hi, Sa, Mc, and Nm

Logistic regression models of carriage (presence or absence) of Sp, Hi, Mc, Nm, and Sa are shown in Table 5. All models were controlled for age, gender, enrollment site and ARI. The model of carriage of Sp indicated a significant positive association between Sp and Hi, Sp and Mc, and Sp and Nm. The presence of Sa and age >36 months was negatively associated with carriage of Sp.

Table 5. Odds ratios with 95% confidence intervals for the associations between different bacterial species in the nasopharynx (adjusted for age, sex, site and ARI).

S. pneumoniae H. influenzae S. aureus M. catarrhalis N. meningitidis
S. pneumoniae
 Absence (ref) - 2.46 (1.66–3.64) 0.53 (0.35–0.82) 5.22 (3.05–8.95) 1.54 (1.04–2.28)
H. influenzae
 Absence (ref) 2.41 (1.63–3.57) - 0.66 (0.46–0.96) 3.34 (1.94–5.74) 1.55 (1.10–2.17)
S. aureus
 Absence (ref) 0.54 (0.35–0.83) 0.66 (0.45–0.96) - 1.36 (0.73–2.53) 1.73 (1.25–2.40)
M. catarrhalis
 Absence (ref) 5.41 (3.18–9.21) 3.40 (2.00–5.78) 1.40 (0.76–2.58) - 1.66 (0.97–2.84)
N. meningitidis
 Absence (ref) 1.49 (1.01–2.21) 1.56 (1.11–2.18) 1.73 (1.25–2.39) 1.63 (0.95–2.83) -
Sex
 Male (ref) 0.82 (0.57–1.19) 0.85 (0.61–1.17) 0.82 (0.60–1.11) 1.04 (0.63–1.74) 0.93 (0.71–1.21)
Site
 Rural (ref) 0.29 (0.18–0.45) 0.42 (0.30–0.61) 0.59 (0.42–0.84) 0.11 (0.04–0.28) 1.20 (0.88–1.62)
Age
 0–12 months (ref)
 >12–36 months 1.19 (0.75–1.89) 1.18 (0.80–1.74) 0.97 (0.67–1.40) 1.24 (0.66–2.32) 3.70 (2.70–5.07)
 >36 months 0.58 (0.36–0.94) 0.89 (0.58–1.38) 1.04 (0.67–1.59) 1.24 (0.65–2.37) 3.14 (2.16–4.56)
Acute respiratory infection
 Absence (ref) 1.14 (0.78–1.66) 1.43 (1.03–1.99) 0.75 (0.54–1.03) 0.95 (0.56–1.59) 0.94 (0.71–1.26)

Note: significant associations are shown in bold

The model of Hi carriage showed a positive association between Hi and Mc, and Hi and Nm, while the presence of Sa was negatively associated with carriage of Hi. In the logistic regression model only the presence of Hi was associated with ARI. The model of Sa carriage showed that the presence of Nm was positively associated with carriage of Sa. There was no significant association found between carriage of Sa and Mc. The model of Mc carriage additionally showed no significant associations with the presence of Nm. Furthermore, the model of Nm carriage showed positive associations between Nm carriage and age > 12–36 months and > 36 months.

The odds of carrying Sp, Hi, Sa, and Mc in a child enrolled in the urban clinic was significantly less than that of a child enrolled in the rural clinic. This association was found regardless of the local prevalence of ARI among all febrile episodes (that was lower in the urban than in the rural site). All other possible covariates were assessed but found not to be significantly associated with bacterial carriage.

Association between bacterial density and respiratory infections

Density was categorized according to increasing bacterial load. Table 6 shows that 64.0%, 75.1%, or 81.3% of children carried in the nasopharynx >1x106 cfu/ml of Sp, Hi or Mc, respectively, whereas only 9.9%, or 13.3%, of children carried >1x106 cfu/ml of Nm or Sa, respectively. We next investigated differences in nasopharyngeal density in children with respiratory infection in comparison to children with a non-ARI episode. As shown in Fig 1 and S2 Table, NP density of Sp, Hi, or Mc, was significantly higher in febrile ARI cases (clinical pneumonia or children with pneumonia with normal CXR) than in febrile non-ARI episodes [p<0.001 for all cases (S2 Table)]. Similarly, nasopharyngeal density of Hi or Mc was found significantly increased in clinical pneumonia when compared to URTI, (not shown). Nasopharyngeal density of Sp, Hi or Mc, was significantly higher in children with severe clinical pneumonia when compared to mild URTI (p<0.002, p<0.001 and p = 0.014 respectively) (Fig 2). Nasopharyngeal density of Sa and Nm were similarly detected in children with respiratory and non-respiratory infection.

Table 6. Prevalence of carriage by bacterial density overall and during ARI.

Bacterial density CFU/ml* S. pneumoniae H. influenzae S. aureus M. catarrhalis N. meningitidis
Overall
N (%)
ARI
N (%)
Overall
N (%)
ARI
N (%)
Overall
N (%)
ARI
N (%)
Overall
N (%)
ARI
N (%)
Overall
N (%)
ARI
N (%)
0 184 94 245 124 737 469 88 45 468 295
≥102–<103 - - - - 6 (2.7) 5 (3.9) - - 11 (2.2) 8 (2.6)
≥103–<104 30 (3.9) 12 (2.4) 13 (1.8) 8 (1.7) 75 (33.6) 45 (35.2) 11 (1.3) 1 (0.2) 136 (27.6) 91 (30.1)
≥104–<105 86 (11.1) 42 (8.3) 69 (9.7) 33 (7.0) 69 (30.9) 39 (30.5) 61 (7.0) 19 (3.4) 214 (43.5) 127 (42.1)
≥105–<106 202 (26.0) 127 (25.2) 134 (18.7) 77 (16.3) 42 (18.8) 22 (17.2) 135 (15.5) 83 (15.0) 90 (18.3) 46 (15.2)
≥106–<107 317 (40.9) 225 (44.7) 258 (36.1) 180 (38.1) 16 (7.2) 6 (4.7) 358 (41.1) 237 (42.9) 33 (6.7) 25 (8.3)
≥107–<108 140 (18.0) 96 (19.1) 212 (29.7) 151 (31.9) 11 (4.9) 8 (6.3) 298 (34.2) 206 (37.3) 6 (1.2) 4 (1.3)
≥108–<109 1 (0.1) 1 (0.2) 29 (4.1) 24 (5.1) 4 (1.8) 3 (2.3) 9 (1.0) 6 (1.1) 2 (0.4) 1 (0.3)

*Lowest limit of detection is 80 CFU/ml.

Fig 1. Nasopharyngeal density during non-ARI, ARI or clinical pneumonia in febrile Tanzanian children.

Fig 1

The species analyzed is shown above each graphic. (A) ARI cases were compared against non-ARI. (B) Non-ARI cases were compared against children with clinical pneumonia (Clin Pneu). Statistical analyses were performed using the Mann-Whitney U test and showed significance for S. pneumoniae, H. influenzae, and M. catarrhalis in A and B. Dotted lines represent the means.

Fig 2. Nasopharyngeal density during severe pneumonia and mild URTI in febrile Tanzanian children.

Fig 2

Nasopharyngeal density (cfu/ml) of each species in children with severe pneumonia were compared against children with mild upper respiratory tract infection (URTI). Statistical analyses were performed using the Mann-Whitney U test and showed significance for S. pneumoniae, H. influenzae, and M. catarrhalis. Dotted lines are the means.

Discussion

We have studied, for the first time, nasopharyngeal carriage of five major human bacterial pathogens, Sp, Hi, Mc, Sa, and Nm in children presenting the most common childhood syndrome: acute fever. Our analyses demonstrate that Tanzanian febrile children experiencing an episode of any type of ARI (including URTI, clinical pneumonia or pneumonia with normal CXR) carried significantly more Sp, Hi, and Mc, at the same time in the nasopharynx, in the absence of Sa and Nm than children with non-ARI infections. Accordingly, bacterial densities of these three species were found to be significantly increased in the nasopharynx of children with respiratory infection, when compared to those with non-ARI infections. Such a significantly higher prevalence, or increased density, was not observed in children carrying Sa or Nm.

Carriage studies including bacterial species investigated here, in children with ARI, have increased the last few years. The high prevalence of nasopharyngeal carriage of Sp, Hi, and Mc (87.5%, 82.6%, and 96.5%, respectively) in children with pneumonia, whether clinical or radiological, that we observed, differs from that obtained in a recent study of Vietnamese children with radiological pneumonia, whose carriage prevalence was 38.7, 50 and 28.1% for Sp, Hi and Mc, respectively [8]. A study by Wolter et al (2014) analyzed South African children experiencing invasive pneumococcal pneumonia and showed a 53% prevalence of nasopharyngeal carriage of the pneumococcus [11].

An increased nasopharyngeal pneumococcal density has been associated with pneumococcal pneumonia in HIV-infected adults [30] and children with pneumococcal or radiological pneumonia [8, 11, 30]. In line with this evidence, our study demonstrates a statistically higher pneumococcal density in the nasopharynx of children with ARI (median, 2.25x106 cfu/ml), URTI (median, 1.73x106 cfu/ml), clinical pneumonia (median, 2.05x106 cfu/ml), and pneumonia with normal CXR (median, 1.90x106 cfu/ml), when compared to those suffering from a non-ARI episode (median, 9.17x105 cfu/ml), which represents a ∼2.5, ∼1.8, ∼2.2, or ∼2 fold-increase in pneumococcal density, respectively. Furthermore, we found a 4.2-fold increase of pneumococcal nasopharyngeal density when children with severe clinical pneumonia were compared to those with mild URTI, and a statistically significant high density in four children who died of pneumonia (median, 2.27x107 cfu/ml), compared to children who survived (p = 0.003). These findings suggest that there might be a correlation between high nasopharyngeal density and disease severity, although further studies would be required to confirm these observations.

Nasopharyngeal bacterial density in children with respiratory infection (ARI, URTI, clinical pneumonia and pneumonia with normal CXR) was also found to be increased when evaluated for Hi and Mc, but not for Sa and Nm. While nasopharyngeal pneumococcal density has not been found useful to assist in the diagnosis of radiological pneumonia in children [8], our findings of a 2.5-fold, or 2-fold, increase in pneumococcal density in the nasopharynx of children with clinical pneumonia, or ARI, respectively, may facilitate secondary bacterial infection.

In healthy children the most common positive association seen in the nasopharynx is between Sp and Hi, whereas a negative association between Sp and Sa has been observed [31]. When we modeled our prevalence data, the strongest positive association was detected between Sp and Mc, followed by Hi and Mc, suggesting that Mc may drive the carriage of the other two species. Acquiring evidence to support whether Mc may play a central role in driving carriage of Sp and Hi will require further efforts. Carriage of Mc does not affect carriage of Sa or Nm as this bacterium, Mc, was neither negatively, nor positively associated with Nm or Sa, in contrast to both Sp and Hi which were both positively associated with Nm and negatively associated with carriage of Sa.

There are some limitations in this manuscript that need to be mentioned. For example, bacterial cultures were not obtained, and pneumococcal types were not investigated. The latter information may have been relevant in view that potential association between pneumococcal serotypes and individual species (i.e., Mc, Hi, Sa, or Nm) could not be explored. Another important limitation relates to the fact that viral infections have not been included in this paper, since the presentation of results would have been too complex.

In summary, our study demonstrated a significant association in febrile children between concurrent nasopharyngeal carriage of Sp, Hi, and Mc and respiratory infection. Firstly, when individually analyzed, carriage prevalence of Sp, Hi, or Mc was significantly increased in febrile ARI cases, cases of URTI, and children with clinical pneumonia. Secondly, when we considered all five species, our analyses showed that in the absence of Sa and Nm, concurrent carriage of Sp, Hi, and Mc was significantly more prevalent in the nasopharynx of children with clinical pneumonia and pneumonia with abnormal CXR, in comparison to non-ARI cases and URTI. Thirdly, when we assessed nasopharyngeal density, our study demonstrated a significantly increased density of Sp, Hi, and Mc in cases of febrile respiratory infection vs non-ARI. These findings call for the development of quantitative multiplex point-of-care tests, or at least semi-quantitative tests that would ideally allow better prediction of a LRTI.

Supporting Information

S1 Table. Concurrent nasopharyngeal carriage stratified by disease.

(DOCX)

S2 Table. Median bacterial density (cfu/ml) of each pathogen in the different respiratory diseases.

(DOCX)

Acknowledgments

We thank Philipina Hongoa, Paschal Mgaya and Burton Ngewe for assistance with patient enrollment and collection of NP swabs and blood, and Leonor Alamo for reading the chest radiographs. We also thank Dr. Lesley McGee from the Centers for Disease Control and Prevention (CDC) and Dr. Yih-Ling Tzeng from Emory University School of Medicine for providing reference strains for the study. We want to express our gratitude towards Dr. Fuminori Sakai for his assistance in molecular assays, and David Watson, both from Emory University Rollins School of Public Health, for reading and his thoughtful comments on this manuscript. Authors finally thanks all patients and caregivers who participated in the study.

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

Supported by grants from the National Institutes of Health NIH) R21AI112768-01A1, Swiss National Science Foundation 3270B0-109696, IZ70Z0-124023 and 32003B_127160), the Commission for International Medicine of the University Hospital of Geneva, and the Bill and Melinda Gates Foundation. JEV was in part funded by a grant from the National Institutes of Health (NIH; R21AI112768-01A1). The content is solely the responsibility of the authors and does not necessarily represent the official view of the National Institutes of Health. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Shak JR, Vidal JE, Klugman KP. Influence of bacterial interactions on pneumococcal colonization of the nasopharynx. Trends in microbiology. 2013;21(3):129–35. Epub 2013/01/01. 10.1016/j.tim.2012.11.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Bogaert D, Keijser B, Huse S, Rossen J, Veenhoven R, van Gils E, et al. Variability and diversity of nasopharyngeal microbiota in children: a metagenomic analysis. PloS one. 2011;6(2):e17035 10.1371/journal.pone.0017035 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Walker CL, Rudan I, Liu L, Nair H, Theodoratou E, Bhutta ZA, et al. Global burden of childhood pneumonia and diarrhoea. Lancet. 2013;381(9875):1405–16. Epub 2013/04/16. 10.1016/S0140-6736(13)60222-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Garcia-Rodriguez JA, Fresnadillo Martinez MJ. Dynamics of nasopharyngeal colonization by potential respiratory pathogens. The Journal of antimicrobial chemotherapy. 2002;50 Suppl S2:59–73. [DOI] [PubMed] [Google Scholar]
  • 5.Christensen H, May M, Bowen L, Hickman M, Trotter CL. Meningococcal carriage by age: a systematic review and meta-analysis. The Lancet infectious diseases. 2010;10(12):853–61. 10.1016/S1473-3099(10)70251-6 [DOI] [PubMed] [Google Scholar]
  • 6.Kwambana BA, Barer MR, Bottomley C, Adegbola RA, Antonio M. Early acquisition and high nasopharyngeal co-colonisation by Streptococcus pneumoniae and three respiratory pathogens amongst Gambian new-borns and infants. BMC infectious diseases. 2011;11:175 10.1186/1471-2334-11-175 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.van den Bergh MR, Biesbroek G, Rossen JW, de Steenhuijsen Piters WA, Bosch AA, van Gils EJ, et al. Associations between pathogens in the upper respiratory tract of young children: interplay between viruses and bacteria. PloS one. 2012;7(10):e47711 10.1371/journal.pone.0047711 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Vu HT, Yoshida LM, Suzuki M, Nguyen HA, Nguyen CD, Nguyen AT, et al. Association between nasopharyngeal load of Streptococcus pneumoniae, viral coinfection, and radiologically confirmed pneumonia in Vietnamese children. The Pediatric infectious disease journal. 2011;30(1):11–8. 10.1097/INF.0b013e3181f111a2 [DOI] [PubMed] [Google Scholar]
  • 9.Revai K, Mamidi D, Chonmaitree T. Association of nasopharyngeal bacterial colonization during upper respiratory tract infection and the development of acute otitis media. Clin Infect Dis. 2008;46(4):e34–7. 10.1086/525856 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Kaiser L, Morabia A, Stalder H, Ricchetti A, Auckenthaler R, Terrier F, et al. Role of nasopharyngeal culture in antibiotic prescription for patients with common cold or acute sinusitis. Eur J Clin Microbiol Infect Dis. 2001;20(7):445–51. [DOI] [PubMed] [Google Scholar]
  • 11.Wolter N, Tempia S, Cohen C, Madhi SA, Venter M, Moyes J, et al. High nasopharyngeal pneumococcal density, increased by viral coinfection, is associated with invasive pneumococcal pneumonia. The Journal of infectious diseases. 2014;210(10):1649–57. 10.1093/infdis/jiu326 [DOI] [PubMed] [Google Scholar]
  • 12.Grijalva CG, Griffin MR, Edwards KM, Williams JV, Gil AI, Verastegui H, et al. The role of influenza and parainfluenza infections in nasopharyngeal pneumococcal acquisition among young children. Clin Infect Dis. 2014;58(10):1369–76. 10.1093/cid/ciu148 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Pettigrew MM, Gent JF, Revai K, Patel JA, Chonmaitree T. Microbial interactions during upper respiratory tract infections. Emerging infectious diseases. 2008;14(10):1584–91. 10.3201/eid1410.080119 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Xu Q, Almudervar A, Casey JR, Pichichero ME. Nasopharyngeal bacterial interactions in children. Emerging infectious diseases. 2012;18(11):1738–45. Epub 2012/10/25. 10.3201/eid1811.111904 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.D'Acremont V, Kilowoko M, Kyungu E, Philipina S, Sangu W, Kahama-Maro J, et al. Beyond malaria—causes of fever in outpatient Tanzanian children. The New England journal of medicine. 2014;370(9):809–17. 10.1056/NEJMoa1214482 [DOI] [PubMed] [Google Scholar]
  • 16.Cherian T, Mulholland EK, Carlin JB, Ostensen H, Amin R, de Campo M, et al. Standardized interpretation of paediatric chest radiographs for the diagnosis of pneumonia in epidemiological studies. Bulletin of the World Health Organization. 2005;83(5):353–9. doi: /S0042-96862005000500011 [PMC free article] [PubMed] [Google Scholar]
  • 17.Group WHOPVTI. Standardization of interpretation of chest radiographs for the diagnosis of pneumonia in children In: Biologicals DoVa, editor. Geneva, Switzerland: World Health Organization; 2001. [Google Scholar]
  • 18.Satzke C, Turner P, Virolainen-Julkunen A, Adrian PV, Antonio M, Hare KM, et al. Standard method for detecting upper respiratory carriage of Streptococcus pneumoniae: updated recommendations from the World Health Organization Pneumococcal Carriage Working Group. Vaccine. 2013;32(1):165–79. 10.1016/j.vaccine.2013.08.062 [DOI] [PubMed] [Google Scholar]
  • 19.O'Brien KL, Bronsdon MA, Dagan R, Yagupsky P, Janco J, Elliott J, et al. Evaluation of a medium (STGG) for transport and optimal recovery of Streptococcus pneumoniae from nasopharyngeal secretions collected during field studies. Journal of clinical microbiology. 2001;39(3):1021–4. 10.1128/JCM.39.3.1021-1024.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Sakai F, Chochua S, Satzke C, Dunne EM, Mulholland K, Klugman KP, et al. Single-plex quantitative assays for the detection and quantification of most pneumococcal serotypes. PloS one. 2015;10(3):e0121064 10.1371/journal.pone.0121064 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Sakai F, Talekar SJ, Klugman KP, Vidal JE, for the Investigators G. Expression of Virulence-Related Genes in the Nasopharynx of Healthy Children. PloS one. 2013;8(6):e67147 10.1371/journal.pone.0067147 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Stephens DS, Swartley JS, Kathariou S, Morse SA. Insertion of Tn916 in Neisseria meningitidis resulting in loss of group B capsular polysaccharide. Infection and immunity. 1991;59(11):4097–102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Carvalho Mda G, Tondella ML, McCaustland K, Weidlich L, McGee L, Mayer LW, et al. Evaluation and improvement of real-time PCR assays targeting lytA, ply, and psaA genes for detection of pneumococcal DNA. Journal of clinical microbiology. 2007;45(8):2460–6. 10.1128/JCM.02498-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Dolan Thomas J, Hatcher CP, Satterfield DA, Theodore MJ, Bach MC, Linscott KB, et al. sodC-based real-time PCR for detection of Neisseria meningitidis. PloS one. 2011;6(5):e19361 10.1371/journal.pone.0019361 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Dunne EM, Manning J, Russell FM, Robins-Browne RM, Mulholland EK, Satzke C. Effect of pneumococcal vaccination on nasopharyngeal carriage of Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, and Staphylococcus aureus in Fijian children. Journal of clinical microbiology. 2012;50(3):1034–8. 10.1128/JCM.06589-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Elizaquivel P, Aznar R. A multiplex RTi-PCR reaction for simultaneous detection of Escherichia coli O157:H7, Salmonella spp. and Staphylococcus aureus on fresh, minimally processed vegetables. Food Microbiol. 2008;25(5):705–13. 10.1016/j.fm.2008.03.002 [DOI] [PubMed] [Google Scholar]
  • 27.Wang X, Mair R, Hatcher C, Theodore MJ, Edmond K, Wu HM, et al. Detection of bacterial pathogens in Mongolia meningitis surveillance with a new real-time PCR assay to detect Haemophilus influenzae. Int J Med Microbiol. 2011;301(4):303–9. 10.1016/j.ijmm.2010.11.004 [DOI] [PubMed] [Google Scholar]
  • 28.Chien YW, Vidal JE, Grijalva CG, Bozio C, Edwards KM, Williams JV, et al. Density interactions among Streptococcus pneumoniae, Haemophilus influenzae and Staphylococcus aureus in the nasopharynx of young Peruvian children. The Pediatric infectious disease journal. 2013;32(1):72–7. Epub 2012/09/01. 10.1097/INF.0b013e318270d850 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.D'Haene B, Vandesompele J, Hellemans J. Accurate and objective copy number profiling using real-time quantitative PCR. Methods. 2010;50(4):262–70. 10.1016/j.ymeth.2009.12.007 [DOI] [PubMed] [Google Scholar]
  • 30.Albrich WC, Madhi SA, Adrian PV, van Niekerk N, Mareletsi T, Cutland C, et al. Use of a rapid test of pneumococcal colonization density to diagnose pneumococcal pneumonia. Clin Infect Dis. 2012;54(5):601–9. Epub 2011/12/14. 10.1093/cid/cir859 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Dunne EM, Smith-Vaughan HC, Robins-Browne RM, Mulholland EK, Satzke C. Nasopharyngeal microbial interactions in the era of pneumococcal conjugate vaccination. Vaccine. 2013;31(19):2333–42. Epub 2013/03/26. 10.1016/j.vaccine.2013.03.024 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. Concurrent nasopharyngeal carriage stratified by disease.

(DOCX)

S2 Table. Median bacterial density (cfu/ml) of each pathogen in the different respiratory diseases.

(DOCX)

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES