Abstract
Clusters of regularly interspaced short palindromic repeats (CRISPRs) and cas (CRISPR-associated) operon form an RNA-based adaptive immune system against foreign genetic elements in prokaryotes1. Type I account for 95% of CRISPR systems, and have been utilized to control gene expression and cell fate2,3. During CRISPR RNA (crRNA)-guided interference, Cascade (CRISPR-associated complex for antiviral defense) facilitates crRNA-guided invasion of double-stranded DNA (dsDNA) for complementary base-pairing with the target DNA strand, while displacing the non-target strand, forming an R-loop4,5. Cas3 nuclease/helicase is recruited subsequently to degrade two DNA strands4,6,7. Protospacer adjacent motif (PAM) flanking target DNA is crucial for self vs. foreign discrimination4,8–16. Here we present a 2.45 Å crystal structure of E. coli Cascade bound to a foreign dsDNA target. The 5′-ATG PAM is recognized in double-stranded form, from the minor groove side, by three structural features in Cse1. The promiscuity inherent to minor groove DNA recognition rationalizes the puzzling observation that a single Cascade can respond to several distinct PAM sequences. Optimal PAM recognition coincides with a wedge insertion, initiating the directional target DNA strand unwinding for segmented base-pairing with crRNA. The non-target strand is guided along a parallel path 25 Å apart, and the R-loop structure is further stabilized by locking this strand behind Cse2 dimer. These observations provide the structure basis for understanding the PAM-dependent directional R-loop formation process17,18.
Differentiating between ‘self’ and ‘non-self’ antigens is critical in CRISPR systems, as foreign target sequences (protospacers) are identical to sequences recorded in the host CRISPR locus (spacers). In Type I and II CRISPR systems, foreign DNA detection relies on protein-mediated PAM recognition4,8–16. Whereas PAM recognition in Cas9-based Type II systems has been elucidated based on major-groove DNA contact19,20, it remains unclear as to whether Cascade recognizes PAM from DNA major or minor groove12, in ss- or ds-form4,21. A particularly puzzling observation is the promiscuity in PAM recognition. Five PAM sequences (5′-ATG, AAG, AGG, GAG, and TAG reading from the non-target strand) are capable of triggering robust CRISPR interference via E. coli Cascade4,11,21,22. Crystal structures of E. coli Cascade in free- and ssDNA-bound forms revealed multiple conformational states, and provided valuable insights about the crRNA-guided ssDNA recognition mechanism21,23,24, however, the mechanisms for dsDNA entry, PAM recognition, and R-loop formation remain poorly defined.
To understand the PAM-dependent foreign DNA recognition mechanism, we determined the 2.45 Å crystal structure of E. coli Cascade bound to dsDNA that forms a partial R-loop (Fig. 1a–c, Extended Data Fig. 1); such DNA substrates were efficiently bound by T. fusca Type I-E Cascade, and the resulting complex specifically recruited Cas325. This structure agrees well with the cryo-EM reconstruction of the full R-loop/Cascade complex, underlining its validity in explaining the R-loop formation process21 (Extended Data Fig. 2, Supplementary Video 1). Comparison with high-resolution crystal structures suggests the R-loop formation requires both the sliding of Cse1-CTD (C-terminal domain)-Cse2.1-Cse2.2, as seen in the ssDNA-bound structure, and the engagement of Cse1-NTD (N-terminal domain) as seen in the free-Cascade structure21,23,24 (Extended Data Fig. 3, Supplementary Videos 2, 3). In addition, a localized conformational change takes place near the putative Cas3 binding site21, which is only observed in this R-loop bound structure, therefore may play a role in Cas3 recruitment (Extended Data Fig. 4). dsDNA enters Cascade between Cas7.5 and Cas7.6, contacted by the lysine-rich helices16,26 (Fig. 1d–e, Extended Data Fig. 5). DNA bifurcates underneath PAM. The entire target DNA strand flips to form the segmented DNA-crRNA duplex27. The 10-nt non-target strand is guided to a parallel path 25 Å apart by sequence nonspecific contacts, an active mechanism to stabilize R-loop (Fig. 1d–e). Modeling dsDNA beyond PAM projects it across Cse1-CTD without severe steric clashes (Fig. 1f), illustrating a possible PAM-searching scenario21.
The 5′-ATG PAM sequence is recognized in the double-stranded form, from the minor groove side, by the Cse1 subunit of the Cascade (Fig. 2a–b). This rather surprising mode of recognition strongly biases towards the target DNA strand, which rationalizes the previous observations that mismatched PAMs could be tolerated, provided the target strand sequence was optimal4,21. Three structural features in Cse1 are involved in PAM recognition: the glutamine-wedge, the glycine-loop and a lysine-finger (Fig. 2a–b). Only CT-1−GNT-1 is tolerated at the −1 PAM position (PAM-1) in E. coli5,21, although recent analyses revealed spacer-dependent tolerance of alternative base-pairs at PAM-128. In our structure (Fig. 2a–d), the amide of A355 in the glutamine-wedge donates a H-bond to O2 of CT-1, specifying a pyrimidine in the target strand. The carbonyl of G157 in the glycine-loop accepts a water-mediated H-bond from N2 of GNT-1. GNT-1-to-inosine substitution assayed by Electrophoretic Mobility Shift Assay (EMSA) suggests this contact only provides minor discrimination against ANT-1(Extended Data Fig. 6a). Cascade’s affinity for different PAM-1 base-pair combinations corroborate well with the structure observation that a target strand pyrimidine is strongly specified (Extended Data Fig. 6b). The 10-fold differences in Kd, however, do not support an absolute CT-1−GNT-1 specification at PAM-1. Indeed, Cas3 was able to cleave alternative PAM-1 targets, provided Cascade concentration is above the corresponding Kd (Extended Data Fig. 6c). These results echo the recent finding in suggesting that PAM-1 readout is further complicated by Cascade/Cas3 expression level and spacer content28.
Importantly, PAM recognition coincides with the glutamine-wedge insertion into dsDNA underneath PAM (Fig. 2a, d). The tip residue Q354 stacks underneath CT-1 and, together with N353, sterically displaces the first two protospacer nucleotides in the target strand, forcing them to rotate outwards. Given its strategic location, it is rather surprising that this wedge is not highly conserved in sequence (Extended Data Fig. 7). Indeed, tip residue substitutions (Q354A, N353A, and Q354A/N353A) had little consequence in DNA-binding. In contrast, trimming this wedge (NNQAS352-356/GG) led to 100-fold DNA binding defect, suggesting the wedge functions through a steric interference mechanism, to nucleate the target strand displacement upon PAM recognition (Fig. 2e–f). A serine-to-phosphate ‘lock’ is essential in initiating the target strand flipping in Cas919. T125 is in a similar location in our structure but contacts the +1 bridging oxygen instead, and T125A substitution had negligible defect (Fig. 2e).
Recognition at PAM-2 is promiscuous by E. coli Cascade. Only GT-2-CNT-2 is rejected at this position; the other three combinations lead to efficient interference22. Here the glycine-loop residues (159–161) assume a lip-like structure, introduces DNA bending at AT-2-TNT-2, and ‘bites’ onto PAM-1 base-pair in conjunction with the glutamine-wedge underneath; TNT-2 retreats backwards and tilts upwards (Fig. 2b, d). The rim of the glycine-loop explores shape-complementarity to AT-2, and donates a weak H-bond to N3 of AT-2. G160A substitution disrupts the shape complementarity, and reduced Cascade-binding affinity by ~100-fold and Cas3-cleavage to baseline level (Fig. 2e–f). Rejection of GT-2-CNT-2 at PAM-2 is rationalized by the fact that N2 amine of GT-2 would introduce steric clashes against the glycine loop; whereas TT-2-ANT-2 or CT-2-GNT-2 would not, based on modeling (Extended Data Fig. 8a). Indeed, removal of this amine in inosine substitution largely rescued the DNA-binding defect, confirming that N2 of GT-2 is the anti-determinant for PAM-2 specificity (Extended Data Fig. 8b). An equivalent glycine-rich loop is present in all known Cse1 structures; they likely play a similar minor groove DNA recognition function (Extended Data Fig. 7).
PAM-3 is typically specified as a pyrimidineT-purineNT pair by E. coli Cascade4,11,21. 5′-TAG PAM also leads to interference, but GT-3-CNT-3 containing PAMs fail to22,28. Here a favorable electrostatic interaction from a lysine-finger (K268) to O2 of TT-3 is observed, which rationalizes the strong preference for pyrimidine at this position (Fig. 2b, d). K268A mutation reduced Cascade-binding and Cas3-cleavage by >8-fold and >10-fold, respectively, emphasizing its positive contribution to PAM-3 recognition (Fig. 2e–f). Interestingly, K268A mutant still retained wild-type level discrimination against 5′-CTG-PAM (Extended Data Fig. 8c). GT-3–to-inosine substitution ultimately proved that N2 of GT-3 also serves as a strong anti-determinant in the rejection of GT-3–containing PAMs (Extended Data Fig. 8d). Interestingly, K268 makes an electrostatic interaction to CT-4 (Fig. 2b, d), implying certain level of sequence discrimination at PAM-4 as well.
Detailed structure dissection also helps rationalizing the self-avoidance mechanism. All spacers in E. coli CRISPR loci are ‘protected’ by a 5′-CCG-PAM. This PAM is the combination of the least-preferred nucleotides at each position (3′-GT-3GT-2CT-1), which would strongly disfavor Cascade-mediated R-loop formation, despite a perfect spacer match.
The non-target strand is guided sequence nonspecifically along the Cascade surface, 20–25 Å away from the target strand (Fig. 3a). The sugar-phosphates of nucleotides 1–3 are contacted by K163, G169, and K296 of Cse1-NTD, nucleotides 6–9 by a string of positive charges(R393/K394/K488/H489/R491) across Cse1-CTD (Fig. 3a). The redundant interactions were not disrupted by a point mutation (Y397A). A double mutant (488–489 KH/AA) neutralizing a positive patch, however, led to a 4-fold binding defect (Fig. 3b). The 10th/last nucleotide rests at an intersection between Cse1-CTD and Cse2.1. To investigate whether the following non-target residues travels on the surface or backside of the Cse2 dimer, we further determined a 3.2 Å structure where the non-target protospacer is 22-nt longer. Although most of the additional residues remain unresolved, density clearly reveals that the non-target strand residues take the downward trench route towards the backside of the Cse2.1 dimer, attracted by the favorable electrostatic environment therein (Fig. 3c–e). The non-target strand sequestration likely corresponds to the extra “locking” step after most R-loop forms, as a mechanism to prevent the R-loop collapse17.
In summary, our structural analysis provides important insights about the PAM-dependent directional R-loop formation process17 (Fig. 4). Recognition of an interference PAM by Cascade coincides with the wedge-mediated displacement of the first two target strand nucleotides, initiating DNA unwinding. The directional DNA melting ensures the ordered guidance of the non-target DNA strand ~25Å away from the target strand, as a mechanism to stabilize the seed bubble. Further R-loop propagation leads to non-target strand sequestration behind Cse2 dimer, locking the R-loop in place. Conformational changes accompany the process and reorganize the Cse1 surface, paving the way for Cas3 binding. The active guidance of the non-target DNA strand is a theme not observed in Cas9-DNA structures19,20. It rationalizes the observation that the Cascade-bound R-loop is significantly more stable than that by Cas917. Besides five interference PAMs, Twenty-one other PAMs stimulate the “primed adaptation” in E. coli22, where Cascade and Cas3 actively recruit the Cas1/Cas2 spacer acquisition complex29,30. Priming PAMs may lead to suboptimal Cascade contacts and non-canonical R-loops. Such R-loops are difficult to form and may not be completely unwound18, requiring higher Cascade concentration30 and favorable DNA torque17. They also fail to directly recruit Cas330, which may indicate that the non-target DNA strand is misguided, as Cas3 recruitment is contingent upon non-target strand contact as well25. Overall, our work provides a framework for future studies to better understand the interference and primed adaptation mechanisms in Type I CRISPR-Cas systems.
METHODS
Expression and purification of Cascade, Cascade-dsDNA complex and Cas3
Sequence information for primers and the synthetic CRISPR expression cassette can be found in Extended Data Table 1. Cascade expression was similar to26. Briefly, cse1 was PCR amplified from E. coli K12 genomic DNA and cloned into pRSF-Duet-ORF1 vector (KanR), between Ncol and NotI restriction sites (Extended Data Table 1). The cse2-cas7-cas5e-cas6e sub-operon was cloned into pET52b (AmpR) between Ncol and NotI; as a Precission cleavable His6 fusion at the N-terminal of cse2. The pre-crRNA expression cassette was synthesized by Life Technologies and cloned into the pHSG-398 vector (CamR) (Extended Data Table 1). E. col BL21 (DE3) star cells containing the 3 plasmids were grown in LB medium at 37 °C to O.D. 600 of 0.6. Cascade expression was induced by the addition of 0.5 mM isopropyl-β-D-1-thiogalactopyranoside (IPTG) and cells were further cultured at 20 °C for 12 hr.
The cells ware disrupted by sonication in buffer A (50mM Tris pH 8.0, 20mM imidazole, 300 mM NaCl), loaded to Ni-NTA column, and eluted with buffer A supplemented with 300 mM imidazole. The His6 tag was cleaved by Precision protease, and back-adsorbed with a second Ni-NTA column binding step. Cascade was concentrated and buffer exchanged into buffer B (20 mM Tris pH 7.5, 150 mM NaCl, 2 mM DTT), and further purified on Superdex 200 prep grade column (GE healthcare). Free-Cascade containing fractions were pooled, concentrated to 15 mg/mL, flash-frozen, and stored at −80 °C.
Cascade-dsDNA complex was prepared by mixing free-Cascade with dsDNA R-loop mimicking substrate. DNA substrates were chemically synthesized from IDT (Extended Data Table 1). The non-target strand was annealed with the target strand at a 1.5:1 molar ratio. The resulting R-loop mimicking substrate was mixed with Cascade at a 2:1 molar ratio, incubated at room temperature for 30 minutes, and re-purified on Superdex 200. Cascade-dsDNA complex fractions were pooled and utilized in crystallization trials. The Cascade-dsDNA complex containing the 32-nt non-target strand overhang was also obtained using the above protocol, except the His tag was not cleaved. Cascade mutants were constructed with site-directed mutagenesis, and purified using the same method as free-Cascade, except that the N-terminal His6 tag was left intact. Cascade integrity was checked using SDS-PAGE (Extended Data Fig. 4b).
The Cas3 gene was amplified from E. coli K12 genomic DNA and cloned between BamHI and Xhol into the pET28a-SUMO plasmid. E. coli BL21 (DE3) star cells were grown in LB medium at 20 °C to O.D.600 of 0.3, induced with 0.2 mM IPTG, and further cultured at 20 °C for 12 hr. The Ni-NTA and SEC purification procedures were similar to the procedure mentioned above. The monomeric SUMO-Cas3 fractions were pooled, concentrated to 2 mg/mL, flash-frozen and stored at -80 °C until usage in biochemical assays.
Crystallization and structure determination of Cascade/partial R-loop complex
Cascade complex crystals were grown using the hanging drop vapor-diffusion method by mixing 2 μL of purified Cascade-ds-DNA complex (15 mg/mL) with 2 μL of mother liquor (1.6 M Na/K Phosphate pH 6.2) at 18 °C. Initial crystals appeared after 2 weeks and grew to full size after ~6 weeks. Crystals were cryoprotected in motherliquor supplemented with 20% ethylene glycol and flash frozen in liquid nitrogen. Diffraction data were collected at Advanced Photon Source – NECAT beamline 24-ID-C and were processed with HKL200031. The structure was solved by molecular replacement with PDB: 4QYZ as the search model. Iterative model building and refinement was conducted with COOT32 and PHENIX33. A summary of the diffraction and refinement statistics can be found in Extended Data Table 2. The Ramachandran plot for the Cascade-dsDNA 10-nt overhang structure indicated 96.65% of residues in the favored region, 3.10% allowed, and 0.25% outliers. The Ramachandran plot for the Cascade ds-DNA 32-nt overhang structure indicated 94.56% of residues in the favored region, 4.81% allowed, and 0.63% outliers. Figures were generated using Pymol34 and CCP4mg35.
Electrophoretic mobility shift assay
Fluorescent dsDNA target substrates were generated for biochemical assays. The crRNA-matching targets with varied PAMs were cloned into pCDF-Duet between the Pstl and Ncol sites Extended Data Table 1. The dsDNA1 and dsDNA2 substrates were PCR amplified from the plasmid using the indicated fluorescent oligonucleotides (5′ 6-FAM for the non-target strand and 5′ Cy5 for the target strand). The dsDNA3 substrates were prepared by oligonucleotide annealing. All dsDNA substrates were subsequently gel-purified. The dsDNA1 substrate (5′ATG-PAM) was used for all main-text EMSA and Cas3 cleavage assays. The dsDNA2 substrates were used for the experiments shown in Extended Data Figures 6b, 6c, and 8c. The dsDNA3 substrates were used in the experiments shown in Extended Data Figures 6a, 8b, 8d. DNA binding was conducted in 20 mM Tris pH 7.5, 150 mM NaCl, 5% glycerol. The dsDNA substrate concentration was held constant at 3 nM and Cascade concentration was titrated as indicated. The Cascade and dsDNA were incubated at 37 °C for 30 minutes in 20 mM Tris pH 7.5, 150 mM NaCl, 5% glycerol. EMSA was carried out at 4 °C on 2% agarose gels. Fluorescent signals were scanned using a Typhoon 9200 scanner.
Cascade-mediated Cas3 DNA cleavage assay
Cascade-R-loops were pre-formed by mixing 40 nM Cascade or Cascade mutants with 6 nM fluorescent dsDNA target in binding buffer (5 mM HEPES pH 7.5, 60 mM KCl) at 37 °C for 30 minutes. Cascade-R-loops were then mixed with 500 nM SUMO-Cas3 in DNA cleavage RXN buffer (5 mM HEPES pH 7.5, 60 mM KCl, 10 mM MgCl2, 10 μM CoCl2). Either 2 mM ATP or 2 mM AMPPNP was added and the reaction was incubated at 37 °C for 30 minutes. Cy5 and 6-FAM fluorescent signals were recorded by Typhoon 9200 scanner. The wild-type E. coli Cascade specifically nicked the non-target DNA strand ~10–12 nt into the R-loop region in the presence of a non-hydrolyzable ATP analog, AMPPNP. Addition of ATP triggered processive degradation of the non-target DNA strand and distributive degradation of the target strand upstream of the R-loop. These results are consistent with previous studies11,21.
Extended Data
Extended Data Table 1.
Oligonucleotide | Sequence (5′−3′) | Notes |
---|---|---|
Cse1 (forward) | GCGCGCCATGGCTAATTTGCTTATTGATAACTGGATCC | Ncol + Cse1 fragment (pRSF-Duet ORF1) |
Cse1 (reverse) | GGCCCGCGGCCGCTCAGCCATTTGATGGCCCTCC | Cse1 fragment + NotI (pRSF-Duet ORF1) |
Cse2-Cas7-Cas5e-Cas6e (forward) | GCGCGGGTACCAGATGGCTGATGAAATTGATGCA | Kpnl + Cse2-Cas7-Cas5e-Cas6e fragment (pET52b) |
Cse2-Cas7-Cas5e-Cas6e (reverse) | CGCGCGCGGCCGCTCACAGTGGAGCCAAAGATAG | Cse2-Cas7-Cas5e-Cas6e fragment + NotI (pET-52b) |
Cse2-Cas7-Cas5e-Cas6e (forward) | GCGCGCCATGGGTCATCACCACCATCATCACGGTGCACTTGAAGTCCTCTTTC | Ncol + 6XHIS + Precission (pET-52b) |
R-loop mimic (target strand) | CTGTTGGCAAGCCAGGATCTGAACAATACCGTCATCGAGCACTGCACAGA | |
R-loop mimic (non-target strand) | TCTGTGCAGTGCTCGATGTTTTATTTAT | |
SUMO-Cas3 (forward) | GCGCCGCGGATCCATGGAACCTTTTAAATATATATGCCAT | BamHI + Cas3 fragment (pET28b-SUMO vector) |
SUMO-Cas3 (reverse) | GCGCCGCCTCGAGTTATTTGGGATTTGCAGGGAT | Cas3 fragment + Xhol (pET28b-SUMO vector) |
Target plasmid construction (non-target strand) | CATGG ACGGTATTGTTCAGATCCTGGCTTGCCAACAGCTGCA | Ncol overhang + Target sequence + Pstl overhang (pCDF-Duet1) altered as indicated in text |
Target plasmid construction (target strand) | GCTGTTGGCAAGCCAGGATCTGAACAATACCGT C | Pstl + non-target sequence + Ncol (pCDF-Duet1) altered as indicated in text. |
dsDNA1 Fluorescent ATG PAM substrate (forward) | AACTTTAATAAGGAGATATACCATGGATG | 5′–6-FAM label, PCR product used in main text EMSA and Cas3 cleavage assays. |
dsDNA1 Fluorescent ATG PAM substrate (reverse) | GCGGCCGCAAGCTTGTC | 5′- Cy5 label, PCR product used in main text EMSA and Cas3 cleavage assays. |
dsDNA2 Fluorescent substrate (forward) | TAATACGACTCACTATAGGG | T7 Forward 5′–6-FAM label. Used with dsDNA1 (reverse) primer to amplify set of 5′-ATA, ATT, ATC, ATG, AGG and CTG PAM substrates from target plasmids. |
dsDNA3 (non-target strand) | AGATATACATGG ACGGTATTGTTCAGATCCTGGCTTGCCAACAGCTGCAGGTCGACA | 5′ 6-FAM or HEX label, altered (base mutation or inosine substitution) as indicated in text. |
dsDNA3 (target strand) | TGTCGACCTGCAGCTGTTGGCAAGCCAGGATCTGAACAATACCGT CCATGTATATCT | altered (base mutation or inosine substitution) as indicated in text. |
crRNA expression cassette | GCGCCGGGAATTCCCTGCATTAGG ACGGTATTGTTCAGATCCTGGCTTGCCAACAG ACGGTATTGTTCAGATCCTGGCTTGCCAACAG ACGGTATTGTTCAGATCCTGGCTTGCCAACAG ACGGTATTGTTCAGATCCTGGCTTGCCAACAG ACGGTATTGTTCAGATCCTGGCTTGCCAACAG ACGGTATTGTTCAGATCCTGGCTTGCCAACAG GGACCGGATCCCCG | The crRNA expression cassette containing six identical repeat-spacer units was de novo synthesized and inserted to the pHSG-398 vector. The T7 promoter, T7 terminator, and the repeats are highlighted green, red, and yellow, respectively. |
Extended Data Table 2.
Cascade-dsDNA | Cascade-dsDNA (32-nt non-target spacer) | |
---|---|---|
Data collection | ||
Space group | P2 2121 | P 2 21 21 |
Cell dimensions | ||
a, b, c (Å) | 92.98, 150.06,400.55 | 92.81,149.83,404.10 |
α, β, γ (°) | 90, 90, 90 | 90, 90, 90 |
Resolution (Å) | 50.0–2.45 (2.49−2.45) | 50.0–3.20 (3.26−3.21)* |
Rmerge | 0.169 (1.288) | 0.265 (1.066) |
Rpim | 0.050 (0.531) | 0.143 (0.667) |
I/σI | 12.9 (1.1) | 5.8 (1.5) |
Completeness (%) | 99.7 (97.2) | 96.8 (84.1) |
Redundancy | 12.1 (6.5) | 3.6 (3.0) |
CC(l/2) | 0.997 (0.496) | 0.967 (0.422) |
Refinement | ||
Resolution (Å) | 50.0–2.45 | 50.0–3.21 |
No. reflections | 205,381 | 90,215 |
Rwork/Rfree | 0.2058/0.2327 | 0.2087/0.2470 |
No. atoms | ||
Macromolecule | 27896 | 27237 |
Ligand/ion | 1(Zn) | 1(Zn) |
Water | 1051 | 0 |
B-factors | ||
Macromolecule | 53.60 | 62.10 |
Ligand/ion | 51.90 | 61.50 |
Water | 45.90 | N/A |
R.m.s. deviations | ||
Bond lengths (Å) | 0.013 | 0.018 |
Bond angles (°) | 0.840 | 1.010 |
One crystal was used for each structure.
Values in parentheses are for highest-resolution shell.
Supplementary Material
Acknowledgments
This work is supported by NIH grants GM102543 and GM086766 to A.K, GM097330 to S.B. and GM108888 to B.W. NE-CAT beamlines were supported by NIH grants P41 GM103403 and S10 RR029205. We thank Gerald Feigenson and John Mallon for technical help, Ilya Finkelstein and Ian Price for helpful discussions.
Footnotes
Supplementary Information
Three supplementary movies.
Author Contributions
R.P.H. and A.K. designed the research, R.P.H. determined the structure and performed biochemical analyses, Y.X., F.D., and P.E. contributed to biochemical analysis, K.R. assisted with diffraction data collection and processing, B.W. and S.B. contributed to assay setup. R.P.H., B.W., and A.K. wrote the manuscript.
The structure factors and coordinates for Cascade/partial R-loop structures with 10-nt and 35-nt non-target protospacer have been deposited in the Protein Data Bank under accession numbers 5H9F and 5H9E, respectively.
The authors declare no competing financial interests.
References
- 1.van der Oost J, Westra ER, Jackson RN, Wiedenheft B. Unravelling the structural and mechanistic basis of CRISPR-Cas systems. Nature reviews. Microbiology. 2014;12:479–492. doi: 10.1038/nrmicro3279. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Luo ML, Mullis AS, Leenay RT, Beisel CL. Repurposing endogenous type I CRISPR-Cas systems for programmable gene repression. Nucleic acids research. 2015;43:674–681. doi: 10.1093/nar/gku971. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Caliando BJ, Voigt CA. Targeted DNA degradation using a CRISPR device stably carried in the host genome. Nature communications. 2015;6:6989. doi: 10.1038/ncomms7989. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Westra ER, et al. CRISPR immunity relies on the consecutive binding and degradation of negatively supercoiled invader DNA by Cascade and Cas3. Molecular cell. 2012;46:595–605. doi: 10.1016/j.molcel.2012.03.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Jore MM, et al. Structural basis for CRISPR RNA-guided DNA recognition by Cascade. Nature structural & molecular biology. 2011;18:529–536. doi: 10.1038/nsmb.2019. [DOI] [PubMed] [Google Scholar]
- 6.Brouns SJ, et al. Small CRISPR RNAs guide antiviral defense in prokaryotes. Science. 2008;321:960–964. doi: 10.1126/science.1159689. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Wiedenheft B, et al. Structures of the RNA-guided surveillance complex from a bacterial immune system. Nature. 2011;477:486–489. doi: 10.1038/nature10402. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Westra ER, et al. Type I-E CRISPR-cas systems discriminate target from non-target DNA through base pairing-independent PAM recognition. PLoS genetics. 2013;9:e1003742. doi: 10.1371/journal.pgen.1003742. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Marraffini LA, Sontheimer EJ. Self versus non-self discrimination during CRISPR RNA-directed immunity. Nature. 2010;463:568–571. doi: 10.1038/nature08703. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Mojica FJ, Diez-Villasenor C, Garcia-Martinez J, Almendros C. Short motif sequences determine the targets of the prokaryotic CRISPR defence system. Microbiology. 2009;155:733–740. doi: 10.1099/mic.0.023960-0. [DOI] [PubMed] [Google Scholar]
- 11.Mulepati S, Bailey S. In vitro reconstitution of an Escherichia coli RNA-guided immune system reveals unidirectional, ATP-dependent degradation of DNA target. The Journal of biological chemistry. 2013;288:22184–22192. doi: 10.1074/jbc.M113.472233. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Rollins MF, Schuman JT, Paulus K, Bukhari HS, Wiedenheft B. Mechanism of foreign DNA recognition by a CRISPR RNA-guided surveillance complex from Pseudomonas aeruginosa. Nucleic acids research. 2015;43:2216–2222. doi: 10.1093/nar/gkv094. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Sashital Dipali G, Wiedenheft B, Doudna Jennifer A. Mechanism of Foreign DNA Selection in a Bacterial Adaptive Immune System. Molecular cell. 2012;46:606–615. doi: 10.1016/j.molcel.2012.03.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Sinkunas T, et al. In vitro reconstitution of Cascade-mediated CRISPR immunity in Streptococcus thermophilus. The EMBO journal. 2013;32:385–394. doi: 10.1038/emboj.2012.352. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Sternberg SH, Redding S, Jinek M, Greene EC, Doudna JA. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature. 2014;507:62–67. doi: 10.1038/nature13011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.van Erp PB, et al. Mechanism of CRISPR-RNA guided recognition of DNA targets in Escherichia coli. Nucleic acids research. 2015 doi: 10.1093/nar/gkv793. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Rutkauskas M, et al. Directional R-Loop Formation by the CRISPR-Cas Surveillance Complex Cascade Provides Efficient Off-Target Site Rejection. Cell reports. 2015 doi: 10.1016/j.celrep.2015.01.067. [DOI] [PubMed] [Google Scholar]
- 18.Blosser TR, et al. Two distinct DNA binding modes guide dual roles of a CRISPR-Cas protein complex. Molecular cell. 2015;58:60–70. doi: 10.1016/j.molcel.2015.01.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Anders C, Niewoehner O, Duerst A, Jinek M. Structural basis of PAM-dependent target DNA recognition by the Cas9 endonuclease. Nature. 2014;513:569–573. doi: 10.1038/nature13579. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Nishimasu H, et al. Crystal Structure of Staphylococcus aureus Cas9. Cell. 2015;162:1113–1126. doi: 10.1016/j.cell.2015.08.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Hochstrasser ML, et al. CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference. Proceedings of the National Academy of Sciences of the United States of America. 2014;111:6618–6623. doi: 10.1073/pnas.1405079111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Fineran PC, et al. Degenerate target sites mediate rapid primed CRISPR adaptation. Proceedings of the National Academy of Sciences of the United States of America. 2014;111:E1629–1638. doi: 10.1073/pnas.1400071111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Zhao H, et al. Crystal structure of the RNA-guided immune surveillance Cascade complex in Escherichia coli. Nature. 2014;515:147–150. doi: 10.1038/nature13733. [DOI] [PubMed] [Google Scholar]
- 24.Jackson RN, et al. Structural biology. Crystal structure of the CRISPR RNA-guided surveillance complex from Escherichia coli. Science. 2014;345:1473–1479. doi: 10.1126/science.1256328. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Huo Y, et al. Structures of CRISPR Cas3 offer mechanistic insights into Cascade-activated DNA unwinding and degradation. Nature structural & molecular biology. 2014;21:771–777. doi: 10.1038/nsmb.2875. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Jackson RN, et al. Crystal structure of the CRISPR RNA-guided surveillance complex from Escherichia coli. Science. 2014;345:1473–1479. doi: 10.1126/science.1256328. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Mulepati S, Heroux A, Bailey S. Crystal structure of a CRISPR RNA-guided surveillance complex bound to a ssDNA target. Science. 2014;345:1479–1484. doi: 10.1126/science.1256996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Xue C, et al. CRISPR interference and priming varies with individual spacer sequences. Nucleic acids research. 2015 doi: 10.1093/nar/gkv1259. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Datsenko KA, et al. Molecular memory of prior infections activates the CRISPR/Cas adaptive bacterial immunity system. Nature communications. 2012;3:945. doi: 10.1038/ncomms1937. [DOI] [PubMed] [Google Scholar]
- 30.Redding S, et al. Surveillance and Processing of Foreign DNA by the Escherichia coli CRISPR-Cas System. Cell. 2015 doi: 10.1016/j.cell.2015.10.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Otwinowski Z, Minor W. Processing of X-ray Diffraction Data Collected in Oscillation Mode. Methods in Enzymology. 1997;276:307–326. doi: 10.1016/S0076-6879(97)76066-X. [DOI] [PubMed] [Google Scholar]
- 32.Emsley P, Cowtan K. Coot: model-building tools for molecular graphics. Acta crystallographica. Section D, Biological crystallography. 2004;60:2126–2132. doi: 10.1107/S0907444904019158. [DOI] [PubMed] [Google Scholar]
- 33.Adams PD, et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta crystallographica. Section D, Biological crystallography. 2010;66:213–221. doi: 10.1107/S0907444909052925. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Schrodinger LLC. The PyMOL Molecular Graphics System, Version 1.3r1. 2010 [Google Scholar]
- 35.Collaborative Computational Project, N. The CCP4 suite: programs for protein crystallography. Acta crystallographica. Section D, Biological crystallography. 1994;50:760–763. doi: 10.1107/S0907444994003112. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.