Skip to main content
Nucleic Acids Research logoLink to Nucleic Acids Research
. 2004 Nov 1;32(19):5874–5893. doi: 10.1093/nar/gkh908

Identification of the CRP regulon using in vitro and in vivo transcriptional profiling

Dongling Zheng 1, Chrystala Constantinidou 1,*, Jon L Hobman 1, Stephen D Minchin 1
PMCID: PMC528793  PMID: 15520470

Abstract

The Escherichia coli cyclic AMP receptor protein (CRP) is a global regulator that controls transcription initiation from more than 100 promoters by binding to a specific DNA sequence within cognate promoters. Many genes in the CRP regulon have been predicted simply based on the presence of DNA-binding sites within gene promoters. In this study, we have exploited a newly developed technique, run-off transcription/microarray analysis (ROMA) to define CRP-regulated promoters. Using ROMA, we identified 176 operons that were activated by CRP in vitro and 16 operons that were repressed. Using positive control mutants in different regions of CRP, we were able to classify the different promoters into class I or class II/III. A total of 104 operons were predicted to contain Class II CRP-binding sites. Sequence analysis of the operons that were repressed by CRP revealed different mechanisms for CRP inhibition. In contrast, the in vivo transcriptional profiles failed to identify most CRP-dependent regulation because of the complexity of the regulatory network. Analysis of these operons supports the hypothesis that CRP is not only a regulator of genes required for catabolism of sugars other than glucose, but also regulates the expression of a large number of other genes in E.coli. ROMA has revealed 152 hitherto unknown CRP regulons.

INTRODUCTION

The Escherichia coli cyclic AMP receptor protein (CRP) is an important transcription factor that regulates transcription initiation for more than 100 genes mainly involved in catabolism of carbon sources other than glucose (1). E.coli preferentially utilizes glucose over other sugars and only catabolizes other sugars when the supply of glucose has become depleted [reviewed in (2)]. The presence of glucose prevents E.coli from catabolizing alternative sugars by several mechanisms, one of which is that glucose lowers the level of cAMP, the inducer for CRP.

CRP functions as a dimer in the form of a CRP–cAMP complex, and regulates transcription initiation by binding to a symmetrical DNA sequence (consensus sequence 5′-AAATGTGATCTAGATCACATTT-3′), located near or within the promoter regions. At CRP-dependent promoters, CRP activates transcription by making direct protein–protein contacts with RNA polymerase (RNAP). Class I CRP-dependent promoters, e.g. lac, contain a single CRP-binding site upstream of the DNA-binding sites for RNAP. At these promoters, CRP activates transcription by interacting with the C-terminal domain of the RNAP α subunit (αCTD) via a surface-exposed patch, known as activating region 1 (AR1) (residues 156–164). Class II CRP-dependent promoters, e.g. galP1 and melR, contain a CRP-binding site overlapping the −35 hexamer for RNAP. At these promoters, CRP makes multiple interactions with RNAP, including between AR1 and αCTD, the activating region 2 (AR2) (residues 19, 21 and 101) and the N-terminal domain of α subunit (αNTD) and between AR3 (residues 52–58) and the RNAP σ70 subunit region 4. Many promoters contain tandem CRP sites and are known as Class III promoters. CRP activation at these promoters involves a combination of the Class I and Class II mechanisms. Additionally, many CRP-dependent promoters are co-dependent on a second activator (3).

The recent completion of several bacterial genome sequences has facilitated the development of computer-based bioinformatic approaches and microarray techniques to study transcription regulation at a genome-wide level. Bioinformatic analysis has allowed the prediction of the regulon of a particular transcription factor by searching for the consensus sequences, or by using algorithms to search for sequence patterns within the genome. CRP-binding sites present within the E.coli genome have been predicted using different computational approaches (4,5). In the latter study, Tan et al. have predicted 161 strong (including known sites) and 285 weak candidate CRP-binding sites, using a comparative genomic approach. However, in silico-predicted DNA-binding sites may not be occupied in vivo, or may only function in the presence of other factors. Conversely, operons with weak, but functional, sites may not have been identified using these approaches. In this study, we have utilized oligonucleotide microarray technology to determine the CRP regulation experimentally, and compared these data with the predicted CRP-binding sites.

The DNA microarray technology allows thousands of genes to be studied simultaneously in a single experiment, and thus provides a powerful tool to investigate gene function at a genomic level. Transcription profiles of E.coli in different media (6,7), under various stress conditions (8,9) and between different strains (10,11), have revealed the roles of many regulatory factors. However, the interference of other regulatory networks makes it difficult to distinguish direct effects on transcription from indirect effects, and therefore it is hard to directly link the results to a specific transcriptional factor. Recently, Helmann and co-workers (12) have developed a novel technique, which combined in vitro run-off transcription with macroarray analysis (ROMA), to define the direct effects of σW on Bacillus subtilis promoters. Run-off transcription reactions in this experimental system used genomic DNA as template. The resulting 33P-labelled RNA products, transcribed by either σW holoenzyme or core enzyme, were hybridized to macroarray membranes. Direct visual comparison of the core versus holoenzyme experiments allows the ready identification of genes targeted by σW. The result from ROMA for σW from B.subtilis was consistent with those determined by promoter consensus searching and in vivo transcriptional profiling. In this study, the term ‘in vitro’ refers to experiments completed with purified DNA and protein components, whereas ‘in vivo’ refers to experiments in E.coli cells grown in planktonic culture.

In this study, the ROMA procedure was modified so as to exploit oligonucleotide arrays on glass slides and ROMA was then used to identify CRP-regulated operons in vitro.

MATERIALS AND METHODS

Strains and growth conditions

E.coli K-12 MG1655 (CGSC 7740) was used in this study (13). A Δcrp derivative of MG1655 was constructed using the gene disruption method of Datsenko and Wanner (14). Primers: CRP P1: 5′-GCTCTGGAGAAAGCTTATAACAGAGG ATAACCGCGCGTGTAGGCTGGAGCTGCTTC-3′ and CRP P2:5′-TGGCGCGCTACCAGGTAACGCGCCACTCCGACGGGACATATGAATATCCTCCTTAG-3′ were used to amplify a chloramphenicol resistance gene cassette from plasmid pKD3 (14). The bases underlined in the primer sequences shown above represent the short regions of homology to genomic sequences flanking crp, which were used in Red-mediated recombination of the chloramphenicol resistance cassette into the chromosome. Transformants were grown on Luria–Bertani (LB) agar (15) containing 0.2% glucose and 50 μg/ml chloramphenicol. PCR was used to screen chloramphenicol resistant transformants, for replacement of crp with the chloramphenicol resistance cassette, using the primers CRPSCREEN 1: 5′-GGATGCTACAGTAATACATTGATG-3′, and CRPSCREEN2: 5′-GACCGAATCGTAATTCGCCAAG-3′. Amplicons generated by the screening PCR were sequenced using a BigDye™ version 3 sequencing kit (Applied Biosystems, Warrington, UK) and analysed on an ABI 3700 sequencer (Applied Biosystems). MG1655 Δcrp strains were grown on Maconkey agar containing maltose (1% w/v) to confirm the phenotype.

For in vivo microarray experiments, both wild-type and Δcrp strains were grown in M9 minimal media (14) containing 0.2% fructose at 37°C to OD600 0.8. Glucose (0.2%) was then added to the cultures, which were grown for a further 15 min, prior to harvesting. The cell samples for RNA preparations were collected before and after the addition of glucose. Two volumes of RNAProtect (Qiagen Ltd, Crawley, UK) were added per volume of bacterial culture, prior to centrifugation.

E.coli oligonucleotide array

E.coli oligonucleotide arrays were produced by the UBEC group (University of Birmingham E.coli group). The oligonucleotides were designed and synthesized by Qiagen Operon Ltd as the E.coli Array ready oligo set vs 1.0 (Qiagen) and represented 4289 E.coli K12 strain (MG1655) open reading frames (ORFs); 1416 ORFs designed to the O157:H7 (EDL933) strain; and 273 ORFs unique to the O157:H7 (Sakai) strain (http://oligos.qiagen.com/arrays/oligosets_ecoli.php). In addition, 110 oligonucleotides representing ORFs from the EDL933 and Sakai plasmids were added to the oligonucleotide array set. Also included within the array set were 12 positive and 12 negative control oligonucleotides, which were printed within each subarray. The average size of each oligonucleotide used in the array was a 70mer, with a Tm = 75 ± 5°C. The position of each oligonucleotide within the ORF was more than 40 bases away from the 3′ end. The oligonucleotides were arrayed on Corning CMT-GAPS II slides in 48 blocks, each containing 324 spots (18 rows by 18 columns) using a MicroGrid II robot (BioRobotics, UK). Each oligonucleotide was printed in duplicate on the array, and Amersham Lucidea™ Universal Scorecard™ (Amersham, UK) controls were printed within each subarray.

Genomic run-off transcription for ROMA

Genomic DNA was isolated from the E.coli MG1655 (CGSC 7740) wild-type strain using phenol/chloroform extraction (http://www.research.umbc.edu/~jwolf/m1.htm), digested with EcoRI overnight and purified by phenol/chloroform extraction, followed by isopropanol precipitation. RNAP holoenzyme was purified as described previously (16). Wild-type CRP, AR1-mutated CRP (HL159) and AR2-mutated CRP (KE101) were purified as described previously (17).

For a single ROMA experiment, two run-off transcription reactions were set up in parallel. The control reaction contained 4 μg of EcoRI digested genomic DNA, and 1 mM each of ATP, GTP, CTP and UTP, in transcription buffer (40 mM Tris/acetate, pH 7.9, 10 mM MgCl2, 1 mM DTT, 100 mM KCl, 0.1 mg/ml BSA), which contained RNase Out (Invitrogen, UK) at a concentration of 50 U/reaction. The test reaction contained 2 μl of 5 mM cAMP (final concentration 200 μM), and 4 μl of 10 μM CRP (40 pmol of monomer, at a final concentration of 800 nM) in addition to the components of the control mixture. Both run-off transcription reaction mixtures were incubated for 10 min at 37°C and transcription started by the addition of 20 pmol of RNA polymerase holoenzyme. Run-off transcription reactions were incubated at 37°C for 30 min. After incubation, the reactions were stopped by the addition of 5 μl of 250 mM EDTA and placed on ice.

RNA purification and labelling

Both RNA transcripts from in vitro transcription reactions and total RNA from cell cultures were extracted using the Qiagen RNeasy mini kit. On-column DNase I digestion (Qiagen Ltd) was used to remove contaminating genomic DNA from the RNA preparations. The concentrations of RNA or in vitro transcription products were determined at OD260 and OD280. An indirect labelling method was used to obtain fluorescence-labelled cDNA for any RNA sample. Briefly, all RNA transcripts from each reaction or 10–20 μg of total RNA were mixed with 6 μg of random hexamers (Amersham Biosciences, Little Chalfont, UK) to a final volume of 18.4 μl, incubated at 70°C for 10 min and snap-cooled in ice. Reverse transcription labelling mixture (11.6 μl) was then added to the RNA template and random hexamers, which contained 0.5 mM dATP, dCTP, dGTP, 0.2 mM dTTP, 0.3 mM aminoallyl-dUTP (aa-dUTP), RNase inhibitor (30 U), 400 U SuperScript II (Invitrogen, Paisley, UK), 10 mM DTT and 1× first strand buffer. The mixture was incubated at 42°C for 3 h or overnight to generate aminoallyl-labelled cDNA. To hydrolyse the RNA template, 10 μl of 0.5 M EDTA and 10 μl of 1 M NaOH were added to the reaction and incubated at 65°C for 15 min. The reaction was neutralized by the addition of 10 μl 1 M HCl. Unincorporated aa-dUTP and free amines were removed by washing the cDNA in a microconcentrator (Microcon YM-30, Millipore) and the sample was then vacuum dried. The aminoallyl-cDNA pellet was resuspended in 4.5 μl of 0.1 M sodium carbonate buffer (pH 9.0) and coupled with Cy3 or Cy5 monoreactive dye (Amersham), prepared in dimethyl sulfoxide for 2 h at room temperature in the dark. For the ROMA experiment, the aa-cDNA from the control reactions was coupled with Cy3 and aa-cDNA from the CRP reactions coupled with Cy5. For in vivo transcriptional profiling, the aa-cDNA obtained from either wild-type strain or ΔCRP strains before the addition of glucose was coupled with Cy3 and after the addition of glucose was coupled with Cy5. Uncoupled dyes were removed using a QIAquick PCR purification kit (Qiagen). Lucidea™ Scorecard (Amersham) mRNA spike mixes were added to labelling reactions for both in vivo and ROMA experiments.

For the in vivo microarray work, the quality and concentration of the RNA prepared was assessed using the Agilent 2100 Bioanalyser. Total RNA (10–20 μg) was labelled using the CyScribe Post-Labelling Kit (Amersham Biosciences) as described by the manufacturer.

Prehybridization and hybridization

Before hybridization, the arrayed slides were prehybridized in a buffer containing 25% formamide, 5× SSC, 0.1% SDS and 10 mg/ml BSA at 42°C for 2 h and washed by dipping twice in distilled water. The slides were then dipped in 95% ethanol for 1 sec and dried in a clean 50 ml centrifuge tube by centrifugation at 1500 g for 10 min. The Cy3 and Cy5 labelled cDNAs were mixed, vacuum dried and resuspended in 70 μl hybridization buffer containing 25% formamide, 5× SSC, 2 μl of 50× Denhardt's, 2 μl yeast tRNA (20 μg/ml) and 0.1% SDS. The labelled cDNAs were denatured by heating at 95°C for 5 min, and applied to the prehybridized slide in a CMT-Hybridization chamber (Corning Inc., Corning, NY). A HybriSlip (Sigma) was carefully lowered onto the slide. To maintain humidity inside the chamber, 10 μl of distilled water was added to the two reservoir wells. The chamber was then tightly sealed and incubated at 42°C for 16–20 h in the dark. The slide was then removed from the chamber, washed for 5 min sequentially in 2× SSC/0.1% SDS buffer, 0.1× SSC/0.1% SDS buffer and 0.1× SSC buffer, rinsed in distilled water for 5 s and dried by centrifugation at 2000 r.p.m. for 10 min. The hybridized slides were scanned with a confocal laser scanner (Axon GenePix 4000A) using appropriate gains on the photomultiplier tube to obtain the highest intensity without saturation. Three replicates were completed for each experiment.

Image extraction and data normalization

Scanned images for Cy3 and Cy5 were then overlaid with GenePix Pro 3.0 software. Only data generated from spots representing E.coli MG1655 genes were analysed in our studies. Spots with background-subtracted intensity lower than 100 in both Cy3 and Cy5 channels were filtered out. GeneSpring software (SiliconGenetics) was used for global normalization and density-dependent normalization (Lowess) to correct artefacts dependent on density or caused by different dye incorporation rates for the two dyes. The duplicate spots for each gene on a single slide were taken as two individual spots. Three independent experiments were performed for each comparison and, therefore, six replicate data sets were obtained for each gene. The normalized data from GeneSpring software were exported to a Microsoft Excel spreadsheet.

Data reproducibility

To assess data reproducibility, the spot-to-spot variation was calculated as described by Loos et al. (18) and correlation between data sets analysed by the Pearson correlation coefficient (r). The spot-to-spot variation was represented by the percent error calculated by dividing the SD by the average ratio for each gene (% = σ/μ). Average variation within a slide was calculated as the average of the gene spot-to-spot variations on that slide (two spots), and average variation across slides was calculated as the average of gene spot-to-spot variations based on the six spots of the data set. The latter variation included spot, slide and cDNA variability. The Pearson correlation coefficient (r) was calculated for Cy3 data sets from any two slides and for Cy5/Cy3 from any two replicate slides.

Identification of differentially transcribed genes

Differentially transcribed genes were selected using an outlier iteration method (18,19). The data for each gene were averaged and the geometric mean and SD were calculated for the entire population. Any gene with a log-ratio more than three SDs away from the mean was considered an outlier. Outliers were then removed from the population and retained within the differentially expressed subset, and the mean and SDs were recalculated for the rest of the data. The step was repeated until few or no outliers were detected. The 99% predictive interval (PI) was set for the final cut-off ratio to define the remaining differentially transcribed genes within the now symmetrical and well-defined distribution.

The in vitro transcription profiles of CRP derivatives were compared with wild-type CRP, and significant changes were identified by outlier iteration. The average of the log-ratios for each gene from the CRP derivative experiments was normalized to the wild-type CRP experiment. The geometric mean and SD were calculated for the entire population. The outliers were selected as stated above and the 95% PI was set as a final cut-off. The genes with a log-ratio change between two experiments falling in the outlier group or beyond the PI were regarded as differentially regulated by CRP mutants and wild-type CRP.

Sequence processing

The differentially transcribed genes were grouped into operons using the RegulonDB database at http://www.cifn.unam.mx/Computational_Genomics/regulondb. The current version of the RegulonDB database (RegulonDB 4.0) identifies 87 CRP-regulated operons that have been verified experimentally. In this study, 24 of these operons were shown in the ROMA experiments to be regulated by CRP and, therefore, were further analysed. CRP-binding site predictions were based on the previous study (5), where a Positional Weight Matrix was generated from alignment of known CRP-binding sites and used to determine the strength of a site. In this study, a strong site was defined as a sequence with a score more than 10 (consistent with the prediction by Tan et al.) and a weak site as a sequence with a score between 5 and 10. Sequences with a score below 5 were rejected.

RESULTS

Combination of run-off transcription and microarray analysis (ROMA) on glass slides

The original ROMA procedure used macroarray membranes to analyse radioactively labelled RNA transcripts (12). In our study, the procedure was modified by using a post-transcriptional fluorescence-labelling procedure to enable hybridization to a sense-oligonucleotide array. To gauge data reproducibility, data from each of three replicate slides were subjected to statistical analysis. Gene spot-to-spot variation was 5.0% (range, 4.1–6.3%) between replicate spots within a given slide, and 13.9% (range, 12.6–15.4%) among six spots across three slides. The latter number includes both the hybridization variation and biological variation. Comparison of the duplicated probe sets within a single hybridization showed good reproducibility of the fluorescence signals with a Pearson correlation coefficient (r) of >0.98. This result illustrates uniform hybridization of the microarray. The reproducibility of signal between replicate reactions was lower, with a Pearson correlation coefficient (r) of >0.80. This variability was considered to be mainly due to variations from independent reactions. In addition, the detail of signal intensities showed that ∼90% of all genes gave a detectable signal.

CRP regulatory profiles in the ROMA system

Comparison of RNA transcripts from reactions containing wild-type CRP to control reactions containing only RNAP revealed many differentially transcribed genes (Figure 1a). Data for the majority of genes fall within the threshold values, with a ratio between +2 and −2, and therefore indicates that these genes are not significantly regulated by CRP. As expected, transcripts of many genes were increased by the addition of CRP and transcripts of very few genes were reduced, which is consistent with the view that CRP activates most of the genes that it regulates. A total of 280 genes, present in 188 different operons, had significantly higher transcriptional levels and 20 genes, in 16 operons, had reduced transcriptional levels in response to CRP. Taken together, these data show that ∼7% of the genes in the E.coli genome were transcribed differentially upon the addition of CRP in the ROMA experiment. The highest activation, 13-fold induction, was observed at the sdaC gene encoding a protein that is a putative serine transporter. Of the 176 operons identified by ROMA in this study, 24 are known members of the CRP regulon (Table 2), i.e. the promoter regions and CRP sites have been mapped experimentally. For genes present within the same polycistronic operon, the signal for the promoter-proximal gene should be the same or higher than the signal for promoter distal genes. Of the 188 operons activated by CRP, the promoter-proximal gene was activated in the vast majority (176 operons). For 8 of these 176 operons, the promoter-proximal gene was subjected to only marginal activation (above 95% PI), while the promoter distal gene(s) were activated at a significant level. In only 12 operons was a promoter-distal gene up-regulated and not the promoter-proximal gene (Tables 1 and 2). These 12 promoters were not included in the CRP-regulated set. Up-regulation of promoter-distal genes in the absence of regulation of the promoter-proximal genes may represent false positives in the assay; alternatively it may be due to CRP-dependent promoters within operons that are active in vitro.

Figure 1.

Figure 1

Logarithmic-scale scatter plots of spot intensities. The data were subjected to global and density-dependent normalization, and plotted on GeneSpring 4.2.1. Each data point corresponds to the average of two spots representing an individual MG1655 gene. The ratios were colour coded, with red for ratio above one and green for ratio below one. The middle line passes genes with no change at two conditions (ratio = 1) and the other two lines demarcate threshold values for genes with significant increase or decrease in transcription in response to CRP deletion (ratio = ±2). (a) Transcriptional profiles from reactions with wild-type CRP (wt. CRP) versus without CRP (−CRP). (b) Transcriptional profiles from reactions with AR1-mutated CRP (HL159) versus without CRP (−CRP). (c) Transcriptional profiles from reactions with AR2-mutated CRP (KE101) versus without CRP (−CRP).

Table 2. Operons which have been experimentally verified as being regulated by CRP.

Operon name ROMA CRP sites Other regulatorsb Gene function Reference
  WT HL HL/wt KE KE/wt Positiona Sites Score      
bglG 1.96 0.85 ↓ 1.73 — −61.5 AACTGCGAGCATGGTCATATTT 11.2 Fis Positive regulation of bgl operon (49)
dctA 2.44 1.09 ↓ 1.85 — −81.5 TTGTGCGAGCCAGCTCAAACTT 14.1 DcuR, ArcA Uptake of C4-dicarboxylic acids (50)
rbsDACBKR 3.80 0.89 ↓ 4.10 — −61.5 CGTTTCGAGGTTGATCACATTT 9.4 RbsR d-ribose high-affinity transport system (51)
rhaSR 1.46 0.86 ↓ 1.66 — −113.5 TGATGTGATGCTCACCGCATTT 12.4 RhaR Positive regulator for rhabad operon (52)
sdhCDAB 2.71 1.11 ↓ 2.38 — −83.5 TATCGTGACCTGGATCACTGTT 16.4 ArcA, FNR Succinate dehydrogenase, cytochrome b556 (53)
tnaLAB 1.98 0.95 ↓ 2.08 — −61.5 GATTGTGATTCGATTCACATTT 19.6   Tryptophanase leader peptide (54)
treBC 3.09 1.35 ↓ 4.73 — −60.5 AATTGTGATCTTCGCTGCGTTT 8.8   PTS system enzyme II, trehalose specific (55)
focA_pflB 3.90 1.59 ↓ 1.39 ↓ −41.5 AGATATGATCTATATCAATTTC 10.1 FNR Probable formate transporter (43)
galS 2.49 1.22 ↓ 1.09 ↓ −41.5 TGCTGTGACTCGATTCACGAAG 10.4 GalR, GalS Mgl repressor, galactose operon inducer (56)
glpTQ 4.51 0.89 ↓ 2.21 ↓ −41.5 ATGTGTGCGGCAATTCACATTT 17.2 GlpR Sn-glycerol-3-phosphate permease (57)
malXY 6.24 1.71 ↓ 2.94 ↓ −49.5 TTATGTGACAGATAAAACGTTT 11.2   PTS system, maltose and glucose-specific II ABC (58)
melR 2.29 1.20 ↓ 1.17 ↓ −41.5 AACCGTGCTCCCACTCGCAGTC 5.5 MelR Regulator of melibiose operon (59)
mglBAC 6.78 1.49 ↓ 1.78 ↓ −41.5 ATCTGTGAGTGATTTCACAGTA 16.6   Galactose-binding transport protein (56)
ptsG 2.11 1.14 ↓ 1.13 ↓ −40.5 AAACGTGATAGCCGTCAAACAA 14.3 Mlc PTS system, glucose-specific IIBC component (35)
ptsHI_crr 2.95 1.01 ↓ 1.56 ↓ −42.5 TTTTATGATTTGGTTCAATTCT 9.5   PTS system protein hpr (60)
yhfA 1.88 0.97 ↓ 1.10 ↓ −44.5 TAATGTGACGTCCTTTGCATAC 11.7   Orf, hypothetical protein (61)
aspA 6.29 2.50 ↓ 2.65 ↓ −90.5 AGCGGTGATCTATTTCACAAAT 15.5 FNR Aspartate ammonia-lyase (aspartase) (62)
            −40.5 TAAAGTGATCCAGATTACGGTA 14.2      
deoCABD 3.22 2.37 — 2.37 — −94.5 TTATTTGAACCAGATCGCATTA 17.1 CytR, DeoR 2-Deoxyribose-5-phosphate aldolase (21)
            −41.5 AATTGTGATGTGTATCGAAGTG 11.9      
glpACB 4.38 1.72 ↓ 3.31 — −90.5 AAATGTGAATTGCCGCACACAT 17.2 FNR, ArcA, FlhD, GlpR Sn-glycerol-3-phosphate dehydrogenase (57)
            −40.5 AATGACGCATGAAATCACGTTT 3.3      
manXYZ 4.26 2.59 ↓ 2.17 ↓ −92.5 GAATGTGACAAGGATATTTTAC 2.4 Mlc, NagC PTS enzyme IIAB, mannase-specific (63,36)
            −40.5 ATTACGGATCTTCATCACATAA 7.6      
nupC 3.25 1.17 ↓ 1.39 ↓ −89.5 AAATGTATGACAGATCACTATT 12.6 CytR Permease of transport system for 3 nucleosides (64)
            −40.5 TAGTGTGTGTCAGATCTCGTTT 12.6      
nupG 4.45 1.01 ↓ 3.25 — −92.5 AAATGTTATCCACATCACAATT 20.4 CytR, DeoR Transport of nucleosides, permease protein (65)
            −42.5 TTATTTGCCACAGGTAACAAAA 10.6      
rpoH 2.18 1.75 — 1.15 ↓ −93.5 ATTTCATCTCTATGTCACATTT 7.4 CytR Sigma(32) factor (22)
            −41.5 ACTTGTGGATAAAATCACGGTC 2.2      
tsx 3.96 1.19 ↓ 2.40 ↓ −40.5 AACTGTGAAACGAAACATATTT 12.9 CytR Receptor of phage T6 and colicin K (66)
            −74.5 AAACGTGAACGCAATCGATTAC 5.8      

aThe centre of an experimentally verified CRP-binding site relative to corresponding transcription start site.

bFactors that regulate transcription in addition to CRP.

Table 1. Operons activated by wild-type CRP in ROMA experiment.

Operon namea ROMA CRP-binding site Gene product Gene function
  WTb HLc HL/wtd KEe KE/wtf Positiong Site sequence Scoreh    
acrE 1.86 1.35 ↓ 1.89 — −289 AATCGTTAAATAAATAATATAT 7.2 Transmembrane protein affects septum formation Membrane; inner membrane
adhE 2.49 1.13 ↓ 1.02 ↓ −241 AAATTTGATTTGGATCACGTAA 18.72 Coa-linked acetaldehyde dehydrogenase and iron-dependent alcohol dehydrogenase Enzyme; energy metabolism, carbon: Fermentation
arcA 1.84 1.11 ↓ 0.99 ↓ −295 GAACTTGATATATGTCAACGAA 6.78 Negative response regulator of genes in aerobic pathways Regulator; global regulatory functions
            −358 TAATGTGACGAAAGCTAGCATT 5.12    
argR 1.86 1.58 — 2.05 — −33 TAATGTTGTATCAACCACCATA 6.42 Repressor of arg regulon Regulator; amino acid biosynthesis: Arginine
            −193 CAATTTGATAACAATTAATTTA 5.65    
b0846 1.98 0.91 ↓ 2.42 — −335 CATCGTGACCAGGATGACATTA 8.37 Putative DEOR-type transcriptional regulator Putative regulator; not classified
            −40 TTGTGTACATTTGTACACAATT 7.94    
b1329 2.3 1.17 ↓ 2 — −101 TATATTGATACTTAAAACATTT 6.94 Putative transport periplasmic protein Putative transport; not classified
            −38 TTCTTTAAGGCGAAACAAATAA 5.8    
b1431 1.94 1.72 — 1.59 — −216 GGATGTGAAATTAATCACAGTA 14.71 Orf, hypothetical protein Orf; unknown
b1513_ydeYZ_b1516_yneB 4.56 1.2 ↓ 1.56 ↓ −183 ATCTGTGATGGCAACCACAGTT 13.9 Putative ATP-binding component of a transport system Putative transport; not classified
b2085_b2084_b2083 2.23 1.9 — 1.44 ↓ −29 TATTATAATCCTATTCAATTAT 7.03 Orf, hypothetical protein Orf; unknown
b2448_b2449 2.52 1.17 ↓ 1.04 ↓ −156 TTTTGTGATGCAGATCGCTTTT 16.65 Orf, hypothetical protein Orf; unknown
            −4 AACTGTGAAGGAGGACGCCATG 5.4    
b2450 2.35 1.16 ↓ 1.44 ↓ −69 TTTTGTGATCTGCGTCAATATT 16 Orf, hypothetical protein Orf; unknown
            −229 CAATGAAACTGAGTTCAAACTT 9.14    
b2462_b2461_b2459_eutI_cchA 2.03 1.07 ↓ 1.18 ↓ −31 CTTAGTGATCTACCTCACCTTT 13.48 Orf, hypothetical protein Orf; unknown
b2463 2.72 0.93 ↓ 0.99 ↓ −257 ATGAGTGCGTTAATTCACACTT 13.2 Putative multimodular enzyme Putative enzyme; not classified
b2611_ypjE_yfjD 1.7 1.02 ↓ 1.25 ↓       Orf, hypothetical protein Orf; unknown
b2710_ygbD 3.31 2.02 ↓ 1.62 ↓ −90 TAGAGTAAAAACAATCAGATAA 7.05 Putative flavodoxin Putative enzyme; not classified
b2736_b2737 2.13 1.51 — 1.4 ↓ −90 TTATGTGAATCAGATCACCATA 18.82 Putative dehydrogenase Putative enzyme; not classified
            −51 TTATATTCACAATATCAAACAA 5.14    
b2740 2.26 1.58 — 1.26 ↓       Putative transport protein Putative transport; not classified
b2876_b2875 3.24 1.03 ↓ 1.41 ↓ −277 TTTTGATACTTGTATCAAGAAT 7.57 Orf, hypothetical protein Orf; unknown
            −366 GATATTGCTCTGGTTCGCATAA 6.7    
b2997_hybABCDEF 2.47 1.96 — 1.84 — −114 TATCATGATATCGATAACCATA 7.2 Putative hydrogenase subunit Putative enzyme; not classified
            −53 TTTTGCGATTGAGGCAAAATAT 6.4    
b3001 2.62 1.42 ↓ 1.42 ↓ −379 ATACGTGATGTACTCAGCAACA 5.15 Putative reductase Putative enzyme; not classified
b3836_b3837_b3838_yigU_yigW_1 1.98 0.88 ↓ 1.2 ↓       Orf, hypothetical protein Orf; unknown
cchB_eutEJG 1.65 0.88 ↓ 1.03 ↓       Detox protein Phenotype; not classified
celABCDF_ydjC 2.05 0.92 ↓ 1.63 — −201 AAATGTGAAGAGGGTCATAACC 11.91 PEP-dependent phosphotransferase enzyme IV for cellobiose Enzyme; transport of small molecules: carbohydrates, organic acids, alcohols
csgDEFG 1.78 1.17 ↓ 1.12 ↓ −201 TTTAGTTACATGTTTAACACTT 8.81 Putative 2-component transcriptional regulator for second curli operon Putative regulator; not classified
            −35 AGGTGTGCGATCAATAAAAAAA 5.86    
            −329 TTATTAGTAAGTTATCACCATT 5.25    
cyoABCDE 2.13 1.23 ↓ 2.46 — −245 ATAATTGTTTTATTTCACATTG 9.95 Cytochrome o ubiquinol oxidase subunit II Enzyme; energy metabolism, carbon: aerobic respiration
            −91 GAATTTAATCATGTTTACAGTA 7.43    
dapB 3.28 1.18 ↓ 2.08 ↓       Dihydrodipicolinate reductase Enzyme; amino acid biosynthesis: Lysine
ecpD_htrE 1.9 1.51 — 1.43 —       Probable pilin chaperone similar to papd Putative factor; surface structures
exuT 2.79 0.87 ↓ 1.33 ↓ −152 ATTTGTGATGGCTCTCACCTTT 16.3 Transport of hexuronates Transport; transport of small molecules: carbohydrates, organic acids, alcohols
            −274 TTTCGTGAGTTAGATCAATAAA 11.9    
fadBA 3.41 1.04 ↓ 3.89 —       3-Hydroxyacyl-coa dehydrogenase; 3-hydroxybutyryl-coa epimerase Enzyme; degradation of small molecules: Fatty acids
fadD 1.91 1.15 ↓ 1.79 — −131 AATAGTGACGCGCTTCGCAACC 8.72 Acyl-coa synthetase, long-chain-fatty-acid–coa ligase Enzyme; degradation of small molecules: Fatty acids
fucAO 3.95 1.26 ↓ 1.55 ↓ −361 TTATGTGACTACCATCACTTTA 16.9 l-fuculose-1-phosphate aldolase Enzyme; degradation of small molecules: carbon compounds
            −144 TTAGTTGAACCAGGTCACAAAA 15.59    
            −54 TAGTGTGAAAGGAACAACATTA 12.46    
fucPI 10.79 2.17 ↓ 4.03 ↓ −207 TAAAGTGATGGTAGTCACATAA 16.9 Fucose permease Transport; transport of small molecules: carbohydrates, organic acids, alcohols
            −167 AAGTGTGACCGCCGTCATATTA 16.54    
fumA 4.27 1.52 ↓ 2.1 ↓ −11 GTGAGAGAACAATGTCAAACAA 7.18 Fumarase A = fumarate hydratase Class I Enzyme; energy metabolism, carbon: TCA cycle
gatYZA 2.38 1.42 ↓ 0.96 ↓ −75 TTTTGTGATCGTTATCTCGATA 13.62 Tagatose-bisphosphate aldolase 1 Enzyme; degradation of small molecules: carbon compounds
gef 2.31 1.26 ↓ 2.5 —       Gef protein interferes with membrane function when in excess Membrane; cell killing
glcC 2.33 2.38 — 1.81 — −95 ATGTTAAATTGATGTAACATAA 6.93 Transcriptional activator for glc operon Regulator; degradation of small molecules: carbon compounds
gntP 3.32 1.16 ↓ 0.97 ↓ −90 GGATGTGACATTCATCGCAACA 9.87 Gluconate transport system permease 3 Transport; transport of small molecules: carbohydrates, organic acids, alcohols
            −69 AATGGTTGACCAATTTACATAA 6.74    
grpE 3.38 1.25 ↓ 1.77 ↓ −293 GAGCGTGCCAGTTTTCACATTC 7.54 Phage lambda replication; heat shock protein IS, phage, Tn; Phage-related functions and prophages
hrsA_ybgG 2.07 1.67 — 1.26 ↓ −21 TCAAGTGAAATTGATCACATAA 11.07 Protein modification enzyme, induction of ompc Enzyme; proteins: translation and modification
            −321 TTCTTTGACGTAAGTCCCGCTG 5.31    
hydHG 2.68 1.32 ↓ 1.25 ↓ −255 TTTCGTGTTCCGTTTCATGGTT 6.48 Sensor kinase for hydg, hydrogenase 3 activity Enzyme; energy metabolism, carbon: fermentation
inaA 4.93 1.73 ↓ 2.19 ↓       Ph-inducible protein involved in stress response Phenotype; adaptations, atypical conditions
kbl_tdh 1.66 1.02 ↓ 1.73 —       Glycine acetyltransferase Enzyme; central intermediary metabolism: pool, multipurpose conversions
kdgT 4.13 1.27 ↓ 1.44 ↓ −171 TTTTGTGATCAATTTCAAAATA 17.05 2-Keto-3-deoxy-d-gluconate transport system Transport; transport of small molecules: carbohydrates, organic acids, alcohols
kdgT           −111 TGATGTGGTTTTGATCACTTTT 13.87    
leuLABCD 1.92 1.16 ↓ 1.45 —       Leu operon leader peptide Leader; amino acid biosynthesis: Leucine
marRAB 1.93 0.9 ↓ 2.69 — −147 AAACGTGGCATCGGTCAATTCA 7.43 Repressor of mar operon Regulator; drug/analog sensitivity
            −61 TAATGTGAAAAGTACCAGCGAT 6.74    
mgtA 2.02 1.02 ↓ 1.9 —       Mg2+ transport atpase, P-type 1 Enzyme; transport of small molecules: cations
mhpR 1.82 1.33 ↓ 1.23 ↓       Transcriptional regulator for mhp operon Regulator; not classified
modABC 1.59 0.88 ↓ 1.99 — −100 TTTTCTTATCTACCTCACAAAG 9.06 Molybdate transport permease protein Transport; transport of small molecules: anions
nadA_pnuC 2.1 1.14 ↓ 2.28 —       Quinolinate synthetase, A protein Enzyme; biosynthesis of cofactors, carriers: pyridine nucleotide
ndk 2.24 0.82 ↓ 2.3 — −173 GACAGTGAAATTTGTCATGCAA 5.25 Nucleoside diphosphate kinase Enzyme; purine ribonucleotide biosynthesis
nrdAB_yfaE 2.29 0.8 ↓ 1.4 ↓ −257 AACAGTTATTTTTAACAAATTT 6.49 Ribonucleoside diphosphate reductase 1, alpha subunit, B1 Enzyme; 2′-deoxyribonucleotide metabolism
pflA 2.03 1.66 — 1.05 ↓       Pyruvate formate lyase activating enzyme 1 Enzyme; energy metabolism, carbon: anaerobic respiration
ribB 2.18 1.12 ↓ 1.5 —       3,4 Dihydroxy-2-butanone-4-phosphate synthase Enzyme; biosynthesis of cofactors, carriers: Riboflavin
rpiR_yjcXWVUTS 2.69 2.13 — 1.36 ↓ −285 ATTTGTGATGTTAATGAATTAA 6.38 Transcriptional repressor of rpib expression Regulator; central intermediary metabolism: non-oxidative branch, pentose pathway
            −47 TTTTGTGAAGTCGCCAGCATCT 5.93    
            −103 AAATTTTAAGCCACTCGCCATT 5.47    
sbmC 2.3 1.33 ↓ 2.02 — −93 GAGTGCGAGTCTGCTCGCATAA 8.91 Sbmc protein Orf; unknown function
sdaC_sdaB_exo 13.43 2.01 ↓ 3.89 ↓ −179 ATTTGAGATCAAGATCACTGAT 14.46 Probable serine transporter Putative transport; transport of small molecules: Amino acids, amines
seqA_pgm 2.46 0.89 ↓ 1.4 ↓       Negative modulator of initiation of replication Regulator; DNA-replication, repair, restriction/modification
sodA 1.98 1.23 ↓ 1.51 — −161 GTGGGTGATTTGCTTCACATCT 13.61 Superoxide dismutase, manganese Enzyme; detoxification
speAB 2.62 1.15 ↓ 2.15 — −45 AGTCGTTAACTGTTTTACACTT 8.81 Biosynthetic arginine decarboxylase Enzyme; central intermediary metabolism: polyamine biosynthesis
speF_potE 1.99 0.87 ↓ 0.78 ↓ −11 AGAGATGAAAAATGTCAAAATT 7.64 Ornithine decarboxylase isozyme, inducible Enzyme; central intermediary metabolism: polyamine biosynthesis
srlAEBD_gutM_srlR_gutQ 3.07 1.97 ↓ 1.62 ↓ −93 TTTTGCGATCAAAATAACACTT 13.12 PTS system, glucitol/sorbitol-specific IIC component Transport; transport of small molecules: carbohydrates, organic acids, alcohols
            −394 CATTGTGCTGCGGCTCAAGCAG 5.63    
thrS_infC_rpmI_rplT 1.85 1.3 ↓ 1.43 — −322 TGCTGTAAATCCGCTCGCAGTA 7.27 Threonine trna synthetase Enzyme; aminoacyl tRNA synthetases, tRNA modification
            −230 AATTGCGAATCGAATCAATGTG 6.87    
tpiA 2.06 1.11 ↓ 1.08 ↓       Triosephosphate isomerase Enzyme; energy metabolism, carbon: glycolysis
ubiB 1.83 1.03 ↓ 1.49 —       NADPH:flavin oxidoreductase Enzyme; energy metabolism, carbon: electron transport
ucpA 1.94 1.11 ↓ 1.22 ↓ −291 AACGGTGATTGCCATTACTTCT 7.62 Putative oxidoreductase Putative enzyme; not classified
            −27 ATTAGTGAGCTGATCCGCAGCA 5.76    
uidR 2.01 1.04 ↓ 1.83 —       Repressor for uid operon Regulator; degradation of small molecules: carbon compounds
uspA 1.99 1.42 ↓ 1.01 ↓       Universal stress protein; broad regulatory function? Putative regulator; adaptations, atypical conditions
uxaB 2.46 1.3 ↓ 1.47 ↓ −145 AACCATGATCCGCGCCACACTT 10.86 Altronate oxidoreductase Enzyme; degradation of small molecules: carbon compounds
wzzB 2.09 1.69 — 3.14 — −73 TTTTGTTACTTACACAACAATT 9.43 Regulator of length of O-antigen component of lipopolysaccharide chains Regulator; outer membrane constituents
yaaF 4.37 1.29 ↓ 2.45 ↓ −83 ATTCGTGAAGTCGATTAAGTCA 7.31 Orf, hypothetical protein Orf; unknown
yabQ 1.94 1.25 ↓ 1.07 ↓ −279 TATCGAGTTAAGTGTCACTTTT 7.69 Orf, hypothetical protein Orf; unknown
            −149 GATTGTTACCTTGGTAAAAAAA 6.8    
yacL 1.96 1.59 — 1.1 ↓       Orf, hypothetical protein Orf; unknown
yadN 1.83 1.39 ↓ 1.53 — −342 TTCTGAAAATCATATCTCATCT 8.46 Putative fimbrial-like protein Putative structure; not classified
            −198 AATTTTGAATTAAGTAAATTTA 8.44    
yaeH 2.61 1.19 ↓ 1.28 ↓       Putative structural protein Putative structure; not classified
yahM 2.2 1.66 — 1.99 — −68 AAATATGCTGTAAGGCTCATAT 8.82 Orf, hypothetical protein Orf; unknown
            −260 TGTTGTGATCGGCGACACTTCG 6.52    
yahO 1.86 1.52 — 1.94 — −127 GGGTGCGAGAGAGATCACAAAG 8.62 Orf, hypothetical protein Orf; unknown
            −188 CATAGTGATTTCATCCATAAAT 5.66    
yaiB_phoA 1.83 1.6 — 1.54 — −323 AGATGTGCGCAAGATCACAAAA 15.37 Orf, hypothetical protein Orf; unknown
            −41 TAATGTTAACTTCTCCATACTT 8.63    
            −341 GAAAGTGCGTTATCTCAAAGAT 7.24    
yajD 2.31 1.2 ↓ 1.23 ↓       Orf, hypothetical protein Orf; unknown
ybbB 1.86 1.75 — 1.46 — −144 TATTGTGACCTTGTTTACCCAG 10.73 Putative capsule anchoring protein Phenotype; Surface polysaccharides and antigens
ybeL 2.3 1.16 ↓ 1.01 ↓       Putative alpha helical protein Phenotype; not classified
ybfP 1.81 1.16 ↓ 1.01 ↓       Putative pectinase Putative enzyme; not classified
ybhD 1.92 1.22 ↓ 1.96 —       Putative transcriptional regulator LYSR-type Putative regulator; not classified
ybhJ 1.99 1.34 ↓ 2 —       Putative enzyme Putative enzyme; not classified
ybhK 2.39 1.32 ↓ 1.43 ↓       Putative structural protein Putative structure; not classified
ybiH_b0795_ybhFSR 1.98 1.28 ↓ 1.64 — −111 TTTTGTGACGCAGCGCATAAAT 12.53 Putative transcriptional regulator Putative regulator; not classified
ybiP 2.42 0.99 ↓ 3.09 — −190 ATTTGCAATCCCCTTCGCAAAA 8.89 Putative enzyme Putative enzyme; not classified
ybiP           −325 TTGTGCGATATGGTCAACAACA 6.83   Putative enzyme; not classified
            −218 TGGTCTGAAAAACCCCACTTTT 5.11    
ycdZ 4.78 1.49 ↓ 2.08 ↓ −55 AAGTGTGATCTACGTCACTCAT 19.82 Orf, hypothetical protein Orf; unknown
            −4 AAATGTGTGCTCGATCTCATTC 13.87    
ychH 5.63 4.5 — 2.1 ↓ −105 AATTGTGATCACGCCCGCACAT 12.05 Orf, hypothetical protein Orf; unknown
ydcH 1.8 1.36 ↓ 1.38 — −153 AAACACGATCCCGCTCGCATTT 8.83 Orf, hypothetical protein Orf; unknown
ydeD 1.91 0.96 ↓ 1.96 —       Orf, hypothetical protein Orf; unknown
ydeF 2.2 0.87 ↓ 3.36 —       Putative transport protein Putative transport; not classified
ydeI 2.04 1.16 ↓ 1.32 ↓ −173 ATGTTTAAGACTTTTCAATCTT 5.79   Orf; unknown
            −218 CAATATAATAATTTTCAAACAT 5.57    
yeaA_b1777 1.86 0.98 ↓ 2.08 — −137 AAATGTGATTTTCATCACGATT 19.64 Orf, hypothetical protein Orf; unknown
            −34 TAATGTGAGCACGATTAAAGTG 10.37   Orf; unknown
yedEF 2.65 0.94 ↓ 1.73 ↓ −109 AAATTTGATCTAACTATTATTT 9.78 Orf, hypothetical protein Putative transport; not classified
            −204 AATTGCGAGTTTTTTCATCATT 7.64    
yedK 3.37 1.04 ↓ 2.06 ↓       Orf, hypothetical protein Orf; unknown
yedL 2.28 1.41 ↓ 1.61 — −64 CTATTAGACAAAGATTTCATTA 6.74 Orf, hypothetical protein Orf; unknown
yedM 2.37 1.03 ↓ 1.22 ↓ −74 ATTTTTGATAGTGGTAATTTTA 5.6 Orf, hypothetical protein Orf; unknown
yedN_b1933 2.41 1.29 ↓ 1.47 ↓ −27 AAATGTGTTGAACTCCACAATA 13.14 Orf, hypothetical protein Orf; unknown
            −271 TTAAGTTATTGCACTCAGAATA 6.04    
yeeA 3.14 1.14 ↓ 2.14 — −34 ATGAGCGCTTTTAATCTCATTA 7.01 Orf, hypothetical protein Orf; unknown
            −273 TTATTTGAACAATGGCGCGGAA 5.32    
yeeX 2.46 1.26 ↓ 1.82 —       Putative alpha helix protein Phenotype; not classified
yejK 1.87 1.3 ↓ 1.03 ↓ −192 ATTTGTGGCATAAATCGAAATC 8.6 Orf, hypothetical protein Orf; unknown
            −112 ATGCGTTAAATCATTCTCGTTA 6.88    
yfaD 3.29 1.61 ↓ 2.03 ↓ −367 AAAAGAGAACTACCCCACCTCA 6.94 Orf, hypothetical protein Orf; unknown
yfaH 4.63 1.2 ↓ 1.96 ↓       Orf, hypothetical protein Orf; unknown
yfaO 2.35 1.46 ↓ 1.6 — −80 AAAAGAGATTACTGTCACTTTC 8.84 Orf, hypothetical protein Orf; unknown
yfeA 2.18 0.86 ↓ 1.11 ↓       Orf, hypothetical protein Orf; unknown
yfeCD 3.63 4.08 — 2.54 — −84 AGTAGTTATTCATGTCACGGTT 8.3 Orf, hypothetical protein Orf; unknown
yfiD 1.83 1.01 ↓ 0.99 ↓ −125 TTTATTGATTTAAATCAAAGAT 11.26 Putative formate acetyltransferase Putative enzyme; energy metabolism, carbon: anaerobic respiration
ygbLM 2.36 1.91 — 1.36 ↓ −4 TATCATGAGCGATTTCGCAAAA 8.37 Orf, hypothetical protein Putative enzyme; not classified
ygbLM           −285 AACAGCAATACGGTGCACAAAA 6.03    
ygcB 1.99 1.29 ↓ 1.13 ↓ −70 ATTTATGAGCAGCATCGAAAAA 8.23 Orf, hypothetical protein Orf; unknown
yggG 1.85 1.07 ↓ 1.97 —       Orf, hypothetical protein Orf; unknown
yghA 2.96 1.47 ↓ 1.4 ↓       Putative oxidoreductase Putative enzyme; not classified
ygjU 2.49 0.86 ↓ 2.53 — −152 AAATATGACCTCTCTTTAAAAT 7.48 Putative transport protein Putative transport; not classified
ygjV 2.1 1.06 ↓ 2.28 —       Orf, hypothetical protein Orf; unknown
yhaB_yhaC 1.89 1.39 ↓ 1.66 — −203 TTTTGTGTTGAGGATCACAAAA 16.06 Orf, hypothetical protein Orf; unknown
yhcB 1.86 1.18 ↓ 1.05 ↓       Orf, hypothetical protein Orf; unknown
yhcM 1.94 1.18 ↓ 1.15 ↓       Orf, hypothetical protein Orf; unknown
yhdG_fis 1.79 1.08 ↓ 2.74 — −297 AAGTGCGAGCAAGCTCACAAAA 15.81 Putative dehydrogenase Putative enzyme; not classified
yhdG_fis           −212 AATTGAGAACTTACTCAAATTT 14.56    
yhdJ 2.11 1.31 ↓ 2.34 — −25 CTTTTTTATAGGTGTCACAAAG 6.42 Putative methyltransferase Putative enzyme; not classified
yhdU 1.88 1 ↓ 1.89 — −113 GAAGTTGACCCCGATCTCATTA 11.45 Orf, hypothetical protein Orf; unknown
yhfMNO 2.18 1.24 ↓ 1.22 ↓ −75 TTTTGTGATCTTCCTCCACATT 7.75 Putative amino acid/amine transport protein Putative transport; not classified
            −40 TGTTGTTATATTCATCATGCAT 6.95    
yhfPQR 1.73 1.21 ↓ 0.97 ↓ −296 AAAAGCGGGCGGCATCAAACAA 7.02 Orf, hypothetical protein Orf; unknown
yhfZY 3.37 1.04 ↓ 3.08 — −314 AAATGTGAAGTGCCTCGCCGTT 13.39 Orf, hypothetical protein Orf; unknown
yhiP 3.29 3.03 — 1.41 ↓ −180 AACATTTAACACCATCATATTT 5.04 Putative transport protein Putative transport; not classified
yhjJ 2.22 0.97 ↓ 1.54 —       Orf, hypothetical protein Orf; Unknown
yi81_1 2 1.28 ↓ 1.4 ↓ −76 TAAAGTGGCGGGGATCACTCCC 6.61 IS186 hypothetical protein IS, phage, Tn; transposon-related functions
yi81_2 1.88 0.82 ↓ 1.27 ↓ −185 AACGGTGCTGGGATTTACGCTT 5.95 IS186 hypothetical protein IS, phage, Tn; transposon-related functions
yi82_1 2.01 1.09 ↓ 1.34 ↓       IS186 and IS421 hypothetical protein IS, phage, Tn; transposon-related functions
yidE 2.95 0.84 ↓ 1.03 ↓ −58 ATGTGCGCTATAAGGCAAATCT 5.7 Putative transport protein Putative transport; not classified
yidP 2.09 1.33 ↓ 1.26 ↓ −185 ATTCGTGATCGCTTTCATGCTT 10.02 Putative transcriptional regulator Putative regulator; not classified
yidW_b3694_dgoKA 7.82 1.52 ↓ 2.75 ↓ −154 TTTTGTGATCTAAATTGTAGTA 10.24 Regulator protein for dgo operon Putative regulator; not classified
            −96 AAACGCGAACGTCATCACGCTG 8.31    
yiePO 1.85 0.81 ↓ 1.52 — −213 TTTTGCAACCGTAATCACACTT 12.09 Orf, hypothetical protein Orf; unknown
            −243 TAATGTGCCATAAAACAAGCAA 8.42    
yigC 2.51 1.15 ↓ 1.89 — −370 AGTCGTGGTATGAATCACTTCT 8.59 Putative oxidoreductase Putative enzyme; not classified
yihVWX_rbn_yihZ_ yiiD 2.17 1.87 — 1.03 ↓ −70 AAAATTGACAGCCGTCACTTTT 11.71 Putative kinase Putative enzyme; not classified
yiiM 2.09 1.42 ↓ 1.38 ↓       Orf, hypothetical protein Orf; unknown
yjaE 1.82 1.4 ↓ 2.1 —       Putative transcriptional regulator Putative regulator; not classified
yjeM 2.35 0.93 ↓ 1.31 ↓ −75 ATATTTGATATCATCCAGGTAT 6.84 Putative transport Putative transport; not classified
yjeNO 1.87 0.93 ↓ 1.24 ↓ −217 ATTTGCGAACGTCTTCACCATC 8.45 Orf, hypothetical protein Orf; unknown
            −283 GTTTGTGATTTTCAAAACGCAT 6.6    
yjfG 2.64 1.46 ↓ 1.45 ↓ −34 AAATGAGCGGCAGATTAAAAAA 9.06 Putative ligase Putative enzyme; not classified
yjhBC 1.92 1.19 ↓ 1.26 ↓ −109 TAGAGTGAAATATGTTAAGAAG 5.44 Putative transport protein Putative transport; not classified
yjhQP 3.42 1.05 ↓ 4.23 —       Orf, hypothetical protein Orf; unknown
yjiMLKJ 3.04 1.37 ↓ 1.38 ↓ −70 AACCGCGAGAGAGATCAAATAA 10.71 Orf, hypothetical protein Orf; unknown
yjjM 2.81 1.27 ↓ 1.35 ↓ −173 TTTTGTGAAAACACACGCATAA 8.94 Orf, hypothetical protein Orf; unknown
yjjY 1.9 0.84 ↓ 1.08 ↓       Orf, hypothetical protein Orf; unknown
ynfM 2.12 1.32 ↓ 1.22 ↓ −94 TTATTTGAGATTATTAATATAT 8.26 Putative transport protein Putative transport; not classified
yqeA 1.93 0.95 ↓ 0.97 ↓       Putative kinase Putative enzyme; not classified
yqgA 2.37 0.81 ↓ 1.6 —       Putative transport protein Putative transport; not classified
yqgB 2.97 1.25 ↓ 3.49 —       Orf, hypothetical protein Orf; unknown
yqhA 2.35 1.28 ↓ 1.44 ↓       Orf, hypothetical protein Orf; unknown
yqiEB_icc_yqiA_parE 1.89 1.24 ↓ 1.29 ↓ −51 AACGTCGCTGAAATTCACATTT 6.03 Orf, hypothetical protein Orf; unknown
ytfQ 3.38 1.21 ↓ 2.03 ↓ −98 AAGTGTGATGTAACGCAATCTG 8.65 Putative LACI-type transcriptional regulator Putative regulator; not classified
ytfRST_yjfF 2.1 0.96 ↓ 1.58 —       Putative ATP-binding component of a transport system Putative transport; not classified
zipA 2.16 1.69 — 1.12 ↓ −250 AGATGTGAATGATGAAACCATA 6.28 Cell division protein involved in ftsz ring Membrane; cell division
            −313 TAGTGTAGAGCAGAAAACAAAA 5.88    

aGene or genes of an operon that are activated by wild-type CRP in ROMA experiment.

bAverage ratios of RNA transcripts in wild-type CRP reaction versus control reaction.

cAverage ratios of RNA transcripts in HL159-CRP reaction versus control reaction. Operons that are still significantly activated by HL159-CRP (outliers) are indicated in boldface.

dSignificance of ratio change between HL159-CRP and wild-type CRP experiments. Operons that are not activated by HL159-CRP or regulated in a reduced level (outliers) are indicated by ‘↓’, and operons that are activated by HL159-CRP at the same level as by wild-type CRP indicated by ‘—’.

eAverage ratios of RNA transcripts in KE101-CRP reaction versus control reaction. Operons that are still significantly activated by KE101-CRP (outliers) are indicated in boldface.

fSignificance of ratio change between KE101-CRP and wild-type CRP experiments. Operons that are not activated by KE101-CRP or regulated in a reduced level (outliers) are indicated by ‘↓’, and operons that are activated by KE101-CRP at the same level as by wild-type CRP indicated by ‘—’.

gThe position of 5′ end of a CRP site relative to corresponding translation start site.

hA site score was calculated from Positional Weight Matrices generated by Tan et al. (5) to indicate the conservation of a site sequence. The higher the score the better match to the consensus sequence.

Determination of CRP-binding sites

We scanned the upstream regions of the 176 up-regulated operons for putative CRP-binding sites to determine whether the activation observed is due to a site that matches the CRP-binding site consensus. A previous study using a comparative genomic approach (5) identified 447 operons on the E.coli genome that contain putative CRP sites upstream from the translation start site. Using the same approach as Tan et al., 55 of the 176 (31%) operons identified in our study were found to contain a CRP site. Tan et al. predicted CRP-binding sites with a good match to the consensus (10 as a cut-off score). However, some known CRP-dependent promoters contain weak CRP sites that are not identified when using a cut-off of 10 (see Table 2), e.g. the melR CRP site has a score of 5.5 and rpoH as two sites with scores of 2.2 and 7.4. In addition, they also identified many false positives.

We therefore scanned the regulatory regions of the remaining operons for sequences with a lower match to the consensus (5 as a cut-off score) and found an additional 70 operons that contain CRP sites with a score between 5 and 10 (Tables 1 and 2). Thus, a total of 125 operons identified in the ROMA assay contain CRP sites identified by either Tan et al. (5) or this study. The remaining 51 operons (29%) identified by ROMA do not contain a recognizable CRP site (score <5).

Effect of CRP AR1 and AR2 on activation

Previous studies have shown that CRP activation is dependent on the interactions of its activating regions with subunits of RNAP [reviewed in (3)]. In this study, the effects of two CRP derivatives containing a mutation at either AR1 or AR2 were analysed. The HL159-CRP carries a His-to-Leu mutation at position 159 within AR1 and has been shown to be defective at both Class I and Class II promoters. Whereas KE101-CRP, which contains a Lys-to-Glu mutation at position 101 within AR2, fails to activate transcription at Class II promoters, but still functions at Class I promoters (20).

The transcriptional level of each gene in the presence of either HL159-CRP or KE101-CRP was compared with those from the control reaction. As expected, the results showed that HL159-CRP failed to activate transcription of 86% (151/176) of the CRP-dependent genes identified in the initial ROMA experiment (Table 1, Figure 2 and Figure 1b). Therefore only 14% (25/176) of operons were activated by HL159-CRP to the same level as by wild-type CRP. The AR2 mutant KE101-CRP was defective for activation at 59% (104/176) of CRP-dependent operons (Table 1, Figure 2 and Figure 1c). The AR2 mutant, therefore, still activated transcription for many genes although the level of activation was reduced. We predict that the promoter regions of the operons whose transcription is not up-regulated by the AR2 mutant contain a CRP-binding site overlapping the −35 hexamer (Class II binding site).

Figure 2.

Figure 2

Regulatory map of 50 highest CRP-regulated operons. The figure indicates the activation by HL159-CRP (middle) and KE101-CRP (right) relative to wild-type CRP (=1), generated by GeneSpring clustering in distance order, so that those with similar regulation pattern were grouped together. The relative activation changes are colour coded: yellow indicates that a gene is regulated at the same level as wild-type CRP, blue indicates that a gene is regulated at a much lower level than wild-type CRP and red indicates that a gene is regulated at a higher level.

To validate the ROMA data, we considered the 24 up-regulated operons whose promoter regions and CRP sites have been mapped experimentally. Of these 24 operons, 7 contain a single Class I CRP-dependent promoter (possess a CRP site far upstream of the −35 hexamer), 9 contain a single Class II promoter (possess a CRP site overlapping the −35 hexamer) and 8 contain a Class III promoter with tandem CRP-binding sites (Table 2). All Class III promoters contain a Class II binding site and a Class I binding site. In the ROMA assay, HL159-CRP failed to activate all promoters, except the two Class III promoters, deoCABD and rpoH. Both the deoCABD and the rpoH operons have several promoter regions that are under differential regulation by CRP (21,22) and therefore the effect of the AR1 mutation may be compromised by transcription from different promoters. In contrast to HL159-CRP, KE101-CRP could still activate class I promoters, but failed to activate all class II promoters and half of the class III promoters. It is therefore clear from the experiments with activating region mutants that the CRP regulation observed in ROMA is similar to that observed in vivo. In addition, it allows us to predict that 59% of the CRP-regulated operons identified by ROMA contain a class II CRP site and are therefore class II or class III promoters.

CRP-repressed operons in the ROMA system

Although CRP is predominantly an activator, we found 16 operons where the promoter-proximal gene had reduced levels of transcription in response to CRP in the ROMA experiments (Table 3). The strongest repression, 3-fold reduction, occurred at the yjcB gene. In contrast to activation, the repression levels of most operons were not significantly affected by either HL159-CRP or KE101-CRP, which indicates that most CRP repression is not dependent on either the AR1 or the AR2 determinant. However, repression at four operons was slightly affected by the AR1 mutation, suggesting some role for AR1 at these operons. We have identified possible CRP-binding sites within 11 of the 16 promoter regions, 8 operons contain a strong CRP-binding site (>10) and 3 operons contain a weak site (5–10). The yjcB and ycfR operons contain a CRP site almost identical to the consensus.

Table 3. Operons repressed by wild-type CRP in ROMA experiment.

Operon name ROMA CRP-binding site Product
  wt HL HL/wt KE KE/wt Positiona CRP sites Score  
yjcB 0.34 0.36 — 0.40 — −80 AATTGTGATATAGTTCACAAAA 22.26 Orf, hypothetical protein
ycfR 0.38 0.48 — 0.46 — −87 GTATGTGATCCAGATCACATCT 20.52 Orf, hypothetical protein
            −136 AAATTTAAAGATTTTTAAATTA 6.68  
metK 0.40 0.54 — 0.52 — −200 GAATGAGACACGATTCAAAAAA 12 Methionine adenosyltransferase 1
nirB_nirD 0.42 0.54 — 0.50 — −76 GAATTTGATTTACATCAATAAG 8.5 Nitrite reductase (NAD(P)H) subunit
            −331 CTTTGTGATGTGCTTCCTGTTA 6.13  
ybiS 0.43 0.56 — 0.48 — −116 AAATGTGATTTCGTACACATCT 16.59 Orf, hypothetical protein
            −201 AGATATGACAAACCGCGCATTA 6.75  
ykfC 0.45 0.44 — 0.46 —       Orf, hypothetical protein
yhfC 0.46 0.48 — 0.64 — −141 TTCCGTGATCAAAATCACCTCT 12.33 Putative transport
            −88 AACATTTAAACAGATCACAAAA 10.22  
rbfA_truB 0.49 0.72 — 0.66 —       Ribosome-binding factor A
panF_prmA 0.52 0.81 — 0.64 —       Sodium/pantothenate symporter
amiC 0.53 0.89 ↑ 0.71 —       N-acetyl-muramyl-l-alanine amidase
ydfK 0.54 0.94 ↑ 0.56 — −195 AATTGTCAACTATATCATATAT 10.99 Orf, hypothetical protein
yeeF 0.54 0.80 — 0.65 — −252 TATTCTGACAAGCCTCTCATTC 8.98 Putative amino acid/amine transport protein
            −29 TTACGCGACGGTTATCACCGTA 8.17  
ygfJ 0.54 0.92 ↑ 0.75 —       Orf, hypothetical protein
ynaE 0.57 0.78 — 0.57 — −195 AATTGTCAACTATATCATATAT 10.99 Orf, hypothetical protein
pncB 0.58 0.63 — 0.64 — −106 TGGTGTGATCGGGGTTCAATAA 7.19 Nicotinate phosphoribosyltransferase
            −276 TGTTGAGTCATAAATAACCTTT 5.41  
apbA_yojL 0.58 0.96 ↑ 0.61 — −151 ATTTTTGATGCGAAGCATAATA 10.45 Involved in biotin biosynthesis

aThe position of 5′ end of a CRP site relative to corresponding translation start site.

Of the 16 repressed operons, promoter regions of two, nirB and pncB, have been determined experimentally (23,24). Sequence analysis indicates that their CRP-binding sites overlap the binding sites for RNAP (Figure 3) and it is therefore probable that CRP represses transcription at the nirB and pncB promoters by either blocking the interaction between RNAP and the promoter DNA, or blocking transcription from an alternative upstream promoter. The position of putative CRP-binding sites relative to the RNAP-binding site was determined for the other repressed operons (Figure 3). The position of the CRP site is variable, but at most promoters the CRP site overlaps the region between the −35 and −10 hexamers. Therefore, repression at these operons might also involve a simple blocking mechanism. However, at the metK, ybiS and yjcB predicted promoter regions, the CRP sites are located 3 bp upstream of the −35 hexamer. The yjcB promoter contains a very strong CRP-binding site (score = 22). The promoter architecture might be such that the CRP-binding site still stops productive binding of RNAP.

Figure 3.

Figure 3

Non-template strand sequences of promoters repressed by CRP. Except nirB and pncB, promoter regions are predicted by searching the −10 and −35 sequences upstream of 10 down-regulated genes with a CRP site. The predicted −10 and −35 hexamers are underlined and in boldface with the −10 regions aligned together. The potential CRP-binding sites are shown as shaded boxes. *ydfK and ynaE are both associated with different prophage (Quin and Rac, respectively) but have essentially identical sequences.

Identification of CRP regulon by in vivo transcriptional profiling

An in vivo microarray experiment was also designed to identify CRP-regulated genes. Both wild-type and Δcrp strains were grown in minimal media containing fructose and then pulsed with glucose, and the transcriptome before the addition of glucose for both strains was compared with that after glucose addition. In the presence of glucose, the cAMP level is expected to be decreased, and hence the cAMP CRP level, thus the CRP-dependent regulation is repressed. However, glucose also affects gene expression through other mechanisms, thus glucose effects will be observed in the Δcrp strain. The CRP-regulated genes in this study were defined as genes regulated by glucose in the wild-type strain, but not regulated in the Δcrp strain. In total, we identified only 17 operons repressed by glucose (CRP-activated operons) and six glucose-activated operons (CRP-repressed operons), listed in Table 4. In the 17 CRP-activated operons, 9 operons are known members of the CRP regulon and 7 operons were activated by CRP in the ROMA experiment. Our in vivo experiments failed to identify most CRP-regulated genes.

Table 4. CRP-regulated genesa identified by in vivo transcription profiling.

Operons Genes Glucose effectb CRP-binding site Product
    Wt strain crp-strain Position Sequence Score  
Glucose repression (CRP-activated operons)
acs acs 0.542 1.131 −100 TTGCGTGATCTGTCGCCCAAAT 8.47 Acetyl-CoA synthetase
aldAc aldA 0.524 1.057 −112 TTTTATGAAGCCCTTCACAGAA 12.79 Aldehyde dehydrogenase, NAD-linked
fruBKA fruB 0.218 0.515 −178 AATTGTGCAGCACATCAAACTT 15.13 PTS system, fructose-specific IIA/fpr component
  fruK 0.410 0.755       Fructose-1-phosphate kinase
gatYZABCD_gatR_2c gatY 0.177 1.410 −75 TTTTGTGATCGTTATCTCGATA 13.62 Tagatose-bisphosphate aldolase 1
  gatZ 0.122 0.841 −30 TATTTTGAAATCGAAAACAAAC 6.62 Putative tagatose 6-phosphate kinase 1
  gatA 0.122 0.921       Galactitol-specific enzyme IIA of phosphotransferase system
  gatC 0.265 1.240       PTS system galactitol-specific enzyme IIC
  gatD 0.368 0.589       Galactitol-1-phosphate dehydrogenase
gcvP gcvP 0.492 0.810       Glycine decarboxylase
glpFKc glpF 0.137 1.096 −142 TTTTATGACGAGGCACACACAT 10.45 Facilitated diffusion of glycerol
  glpK 0.144 0.828       Glycerol kinase
glpTQc glpQ 0.154 0.785 −129 ATGTGTGCGGCAATTCACATTT 17.23 Glycerophosphodiester phosphodiesterase, periplasmic
  glpT 0.509 1.390       sn-Glycerol-3-phosphate permease
mglBACc mglB 0.519 0.958 −270 ATCTGTGAGTGATTTCACAGTA 16.64 Galactose-binding transport protein; receptor for galactose taxis
  mglA 0.400 0.934       ATP-binding component of methyl-galactoside transport and galactose taxis
  mglC 0.549 0.967       Methyl-galactoside transport and galactose taxis
nmpC_trs5_2 nmpC 0.490 0.823 −69 AATAGAGATCTACTTCACAAAT 16.15 Outer membrane porin protein
ompF ompF 0.518 2.915 −242 AAATATGACGGTGTTCACAAAG 12.53 Outer membrane protein 1a (Ia;b;F)
rbsDACBK rbsD 0.426 0.973 −66 CGTTTCGAGGTTGATCACATTT 9.35 d-ribose high-affinity transport system
  rbsB 0.497 1.488       d-ribose periplasmic binding protein
ribB ribB 0.505 1.119       3,4 Dihydroxy-2-butanone-4-phosphate synthase
tnaLABc tnaL 0.437 0.802 −94 GATTGTGATTCGATTCACATTT 19.57 Tryptophanase leader peptide
ybeK ybeK 0.504 1.910 −97 AATTGCGCGCCATCTCACGCTT 10.64 Putative tRNA synthetase
yihQPO_yshA yihQ 0.310 1.081 −76 TTATGAGAATCATTTTACATAA 14.51 Putative glycosidase
sdhCDAB_b0725_sucABCDc sdhD 0.605 1.018 −313 TATCGTGACCTGGATCACTGTT 16.39 Succinate dehydrogenase, hydrophobic subunit
  sdhA 0.509 1.250       Succinate dehydrogenase, flavoprotein subunit
  sucC 0.494 1.101       Succinyl-CoA synthetase, beta subunit
  sucD 0.381 1.067       Succinyl-CoA synthetase, alpha subunit
Glucose induction (CRP-repressed operons)
gcd gcd 2.014 0.864 −80 AATTGTGATGACGATCACACAT 20.43 Glucose dehydrogenase
proP proP 2.413 1.111 −227 ATGTGTGAAGTTGATCACAAAT 20.42 Proline permease II
ptsGc ptsG 3.632 1.628 −154 AAACGTGATAGCCGTCAAACAA 14.25 PTS system, glucose-specific IIBC component
soda sodA 2.012 1.174 −161 GTGGGTGATTTGCTTCACATCT 13.61 Superoxide dismutase, manganese
trpLEDCBA trpL 2.200 1.087       Trp operon leader peptide
  trpE 2.806 1.061       Anthranilate synthase component I
  trpD 2.152 0.972       Anthranilate synthase component II, glutamine amidotransferase and phosphoribosylanthranilate transferase
  trpC 2.096 1.202       N-(5-phosphoribosyl)anthranilate isomerase and indole-3-glycerolphosphate synthetase
  trpA 2.144 0.982       Tryptophan synthase, alpha protein
yagU yagU 1.872 1.022       Orf, hypothetical protein

aThe CRP-regulated genes in this study were defined as genes regulated by glucose (i.e. the ratio of gene expression plus glucose divided by the gene expression minus glucose) in the wild-type strain, but not regulated in the Δcrp strain.

bThe ratio of gene expression plus glucose divided by the gene expression minus glucose.

cGenes that were also identified as CRP-regulated by Gosset et al. (40).

DISCUSSION

The combination of run-off transcription and microarray analysis (ROMA) has shown advantages in defining σW-dependent promoters in B.subtilis (12). In this study, we have established ROMA exploiting microarray glass slides and further demonstrated its application to investigate a specific transcription factor. The microarray glass slide has several advantages over a macroarray membrane. First, the slide array allows more genes to be studied in a single experiment (up to 50 000 genes) compared with a few thousand genes that can be printed on a macroarray membrane. Second, RNA from two different sources of interest can be dual fluorescence labelled and simultaneously hybridized on a single slide, whereas nylon arrays are generally probed in serial or parallel hybridization reactions to allow comparison. Third, the utilization of fluorescence instead of radioactive material is safer, easier to handle and produces higher resolution and lower background. Therefore, the establishment of ROMA on glass slides provides a convenient system to obtain high quality information. Our results have shown the high sensitivity and reproducibility of the system. However, our procedure does have some disadvantages compared with the original macroarray procedure. First, several purification steps are required which might result in the loss of short transcripts. Second, a large amount of template DNA and protein is required. Third, any trace of template DNA remaining after RNA purification will result in high background hybridization that might mask the actual induction level.

Using this newly established ROMA system, we have identified 152 novel CRP-dependent operons and 24 operons corresponding to previously known CRP regulons. Regulation at these operons was further verified by using two CRP mutants. Our experiments indicate that ROMA is a very powerful technique to identify direct regulation by a transcription initiation factor. The ROMA system was, however, unable to identify some known CRP-regulated operons. There are several reasons that could account for these false negatives. First, some operons require other factors for CRP to activate transcription, e.g. AraC at the araBAD promoter (25), which are missing in the ROMA system. Second, transcripts that can initiate from different promoters upstream from the same operon cannot be resolved. So genes where CRP alters the transcription start point will not be identified. For example, the galP1 promoter is a well-known Class II CRP-dependent promoter. However, in the absence of CRP, transcription of the gal operon can initiate from the upstream galP2 promoter (26), which will mask the weak transcription from galP1. Third, certain promoter structures result in a situation where CRP can activate transcription by binding to an upstream site but can also repress transcription by binding to a downstream site, e.g. the crp promoter (27). In addition, some operons may not be transcribed efficiently due to DNA relaxation, or in the experimental system described here, the existence of an EcoRI restriction site within the promoter region or coding region. Finally, because of the necessity for data manipulation to identify only the most robust changes in transcription, promoters that are only weakly activated by CRP in vitro will not be detected. The CRP regulon may therefore contain more operons than were identified in this study.

In the σW ROMA experiment, 50% of the genes identified using ROMA were also identified using consensus sequence searching and in vivo transcriptional profiling (12). However, in the case of CRP, these approaches have serious limitations. Comparison of the ability of each method to identify known members of the CRP regulon demonstrates that sequence searching generates the highest number of hits, and in vivo transcriptional profiling generates the fewest (Figure 4). A combination of the three methods can identify more than 80% of known operons, but failed to identify 14 operons known to be regulated by CRP. Although the sequence prediction generates the highest number of hits, it is probable that this includes many false positives and is therefore not necessarily the best approach. In addition, many weak sites are difficult to identify by sequence searching. Lowering the cut-off score would facilitate the identification of known sites but would inevitably lead to more false positives. Besides DNA sequence, CRP activation is dependent on the location of the binding site. Previous studies have indicated that at a Class I promoter, the CRP-binding site is normally positioned at −61.5, −71.5, −81.5 or −91.5, and no activation occurs when CRP sites are located further than −113.5, which might be beyond the reach of αCTD [reviewed in(28)]. Therefore, many in silico predicted sites might be null sites that are not functional during transcription. For promoters containing tandem CRP sites, the space between the two sites is an important determinant for synergistic activation (29–32). Therefore, although some operons contain several predicted binding sites, we hypothesized that at least some sites are not functional due to improper spacing. This may also explain why some operons with strong predicted binding sites were not regulated by CRP in our experiments. It is also probable that sequence searching generates many false negatives due to the ability of CRP to bind variable sequences. For example, previous work has identified the CRP sites within the melR, rpoH and rbs promoters that play important roles in regulation of these promoters (22). These sites have scores below 10 and were, therefore, not identified in the sequence search. It is therefore possible that several promoters identified by ROMA that do not contain a putative CRP-binding site, e.g. inaA and yfaH, may still be regulated by CRP.

Figure 4.

Figure 4

Venn diagram of the CRP regulon as identified by three genomic approaches: ROMA, in vivo transcriptional profiling, sequence search (5). The result for (a) 87 known (experimentally verified) CRP regulon collected in RegulonDB database and (b) all operons are shown. The number of operons identified by each approach is presented in a coloured circle. The numbers covered by more than one circles are operons identified by two or three methods.

Comparing activation levels of operons with strong CRP sites to those with weak sites indicated that there is no significant relationship between the degree of activation and the ‘quality’ of CRP-binding sites. For example, the focA-pflB operon which is activated 3.9-fold contains a relatively weak CRP site (score = 10.1), whereas the tnaL operon which is activated 2-fold contains a very strong CRP-binding site (score = 19.6) (Table 2). Therefore, conservation of CRP-binding sequence is not sufficient to predict CRP activation levels.

In our study, the in vivo transcriptional profiles failed to identify many CRP-regulated genes. The main reason for this is the complexity of the CRP regulon. CRP activation at some promoters, such as melAB and araBAD, is dependent on the presence of an additional regulator (MelR and AraC, respectively) (33,25) that is only induced by a specific substrate. It is impossible to include all inducers in the growth media and, moreover, the presence of extra inducers may trigger expression of other genes that are independent on CRP, further complicating the interpretation of the data. In addition, most CRP-dependent promoters are subjected to repression by other factors, which will mask the CRP activation in vivo. For example, the galE promoter is repressed by GalR, the lacZ promoter repressed by LacI and many CRP-activated promoters are repressed by CytR (Table 2). Therefore, the variability of CRP regulation at different operons makes it difficult to design an in vivo microarray experiment to distinguish direct effects from indirect effects. ROMA is better suited for identifying the regulon of a factor that is part of a complex regulatory network. In the six glucose-induced operons, two operons, gcd and proP, are known CRP-repressed operons, which contain a strong CRP-binding site between the −10 and −35 regions, thus blocking RNAP binding. As observed in previous studies (34,35), the ptsG gene encoding the major glucose transporter was highly induced by glucose in the wild-type stain. Previous studies have indicated that the ptsG promoter, which contains a CRP activation site (see Table 2) (36), is both activated by CRP and strongly repressed by the pleiotropic transcriptional repressor Mlc. The glucose induction of ptsG is through a complicate Mlc-dependent mechanism that involves several layers of regulation (34–39). The case of ptsG demonstrates that an in vivo indirect effect can mask the real regulation by CRP, sometimes leading to the opposite conclusion. The regulation observed in the trp operon might also have resulted from an indirect effect, as there is no evidence from previous studies to indicate that CRP regulates this operon.

Further evidence of the limitations of in vivo transcription profiling of a complex regulon has come from a recent study of CRP using an Affymetrix E.coli array (40). Gosset et al completed a similar in vivo transcriptomic study of CRP and identified 39 operons under CRP-dependent glucose repression and 19 operons under CRP-dependent glucose activation. Among these operons, only seven glucose-repressed operons and one glucose-activated operon were identified in our in vivo transcriptional profiling (Table 4). However, direct comparison of the two data sets is difficult because of differences in the strain and the growth conditions used. Gosset et al in their study used the E.coli strain BW25113 and an isogenic crp mutant derivative and grew their cells in LB media with or without glucose. The difference in composition between the LB media used in the Gosset study and minimal media used in this study could contribute to a different profile of induction of some genes. For example, the presence of fructose in our growth conditions meant that the fru operon was identified as CRP regulated in our study, but not regulated in the Gosset study due to the lack of fructose in LB media. Gosset et al. (40) used long-term growth in glucose plus media rather than a glucose shock which was used in this study. Long-term growth in glucose should result in higher levels of induction but can also lead to a larger number of indirect effects, such as regulation of ribosomal protein-encoding genes, RNA-encoding genes, stress-related genes and temperature shock genes, which were significantly affected in their study. One-third of operons subject to CRP-dependent glucose repression (13/39) in Gosset et al. were activated by CRP in ROMA experiment. This figure is similar to the data obtained by in vivo transcription profiling in this study (7/17). This indicates that ROMA has limitations to detect a certain set of operons that may be subjected to complex regulation or regulated indirectly in vivo. However, as seen in this study, Gosset et al. failed to identify many CRP-regulated genes, such as rpoH, melR and rbs, so neither study produced a definitive list of members of the CRP regulon. This further indicates that the study of complex regulons, such as CRP, in vivo has many limitations. However, combining several approaches, such as in vivo profiling, sequence analysis and ROMA increases the likelihood of obtaining a more accurate definition of a complex regulon.

The mechanism of CRP activation, in particular the role of different activating regions, has been studied using several well-characterized promoters. At Class I promoters, CRP binds to a DNA sequence upstream of the RNAP-binding site and makes direct protein–protein contact to αCTD via AR1 of the downstream subunit of the CRP dimer, and this interaction recruits αCTD to its DNA target immediately downstream of the CRP-binding site. At Class II promoters, CRP binds to a site overlapping the −35 hexamer and makes several contacts with RNAP: AR1 of the upstream subunit of the CRP dimer binds αCTD, AR2 of the downstream subunit of the CRP dimer binds αNTD and AR3 of the downstream subunit binds region 4 of σ70. The αCTD binds to its target upstream of the CRP site. At Class III promoters that contain tandem sites, CRP activation involves both Class I and Class II mechanisms [reviewed in (3)]. Nearly 90% of operons identified by ROMA showed dependence on the AR1 determinant of CRP for full activation, while AR2 is required for activation of 59% (104) of operons. We predicted that these 104 AR2-dependent operons (including 14 known operons) contain a Class II binding site in their promoter regions.

It is not surprising that transcription of some Class III operons was still activated by KE101-CRP though they all contain a Class II binding site. It has been previously shown that CRP activation at this kind of promoter involves a Class I mechanism (upstream site) and a Class II mechanism (downstream site) (30). Inactivation of AR2 only affects the proximal Class II activation, while the distal Class I site could still drive efficient activation. In some cases, where CRP activation is mainly dependent on the proximal site, the AR2 determinant will be crucial.

Interestingly, a few known FNR-regulated operons, adhE, sdhC, sodA, cyoA and focA, were also activated by CRP in the ROMA experiments. FNR is a CRP homologue and regulates genes during anaerobic growth. The consensus sequence for FNR is similar to that for CRP consensus, and previous studies have shown that FNR activates transcription initiation in a similar way to CRP and that both proteins can bind to the DNA site for the other protein (41,42). Therefore, we propose that some CRP-regulated operons identified in this study are actually regulated by FNR in vivo and contribute to anaerobic growth.

At some promoters, transcription activation by CRP can be repressed by a transcriptional regulator protein, CytR. The CytR-regulated promoters usually contain two DNA sites for CRP, centred at positions −41.5 and −93.5 with respect to the transcription start point, and a DNA site for CytR located between the two CRP-binding sites (43). Cytidine is an allosteric inducer of CytR. In the presence of cytidine, CytR is inactive, and thus CRP can activate transcription in a Class III dependent manner. In the absence of cytidine, CytR is active and binds between the two CRP dimers, repressing CRP-dependent transcription [reviewed in (42)]. CytR binds to two 5′-TTGCAA-3′ motifs between two CRP-binding sites separated by 10–30 bp (44). The deoC, nupG and tsx operons that are under CytR regulation were activated by CRP in our study. Many operons identified by ROMA possess tandem CRP-binding sites separated by 30–60 bp (Table 1). Sequence analysis of the promoter sequence of these operons may identify more CytR-regulated promoters.

In addition to activation, our data also shows that CRP can serve as a repressor at some promoters. There are several different mechanisms by which repressors can inhibit transcription initiation. The simplest mechanism is by blocking the interaction between RNAP and a promoter. This can occur if a binding site for a repressor protein is located overlapping the binding site for RNAP at a promoter, e.g. over the transcription start site or the −10 hexamer. The blocking mechanism is common for most repressors, such as LacI at the lacUV5 promoter and IclR at the iclR promoter (45–47). CRP repression at nirB, pncB, yeeF, ycfR, yhfC, ydfK, ynaE and apbA might also involve this mechanism since at these promoter regions the CRP-binding site overlaps the sites for RNAP. Repressors also can inhibit transcription initiation by direct contact with RNAP, a process more commonly associated with activators. The P4 protein of the B.subtilis bacteriophage Φ29 represses the transcription of early promoter A2C by inhibiting promoter clearance (48). The binding of P4 overstabilizes the open complex formed by RNAP and DNA, thus impeding the following promoter escape step. The repression at metK, ybiS and yjcB might involve this mechanism since they all contain a strong CRP-binding site immediately upstream of a recognizable −35 hexamer. Interestingly, the CRP-binding site and the −35 region at three promoters are separated by 3 bp, which suggests that the structure of protein–protein interaction might play an important role.

CRP has been identified as a regulator of genes required for catabolism of sugars other than glucose and a large number of other genes [reviewed in (1)]. The CRP regulon defined in this study includes several operons that are involved in carbohydrate transport and metabolism, such as fucPI for fucose, kdgT for gluconate and fucAO for fuculose. CRP also regulates transcription of genes required for energy production, amino acid metabolism, nucleotide metabolism and ion transport systems. In addition, CRP can regulate transcription of other transcription factors, such as MelR, RpoH, BlgG, Fis and PdhR, which could further regulate transcription of genes involved in the above processes. We predict that there are several hundred genes that are directly or indirectly subjected to regulation by CRP. In our list, the functions of more than one-third of the gene products are unknown. Identification of function of the gene product of these genes will help to define the biological function of CRP in E.coli.

Acknowledgments

ACKNOWLEDGEMENTS

We thank Nigel J. Savery and Georgina S. Lloyd for the CRP protein used in this study. This work was supported by Biotechnology and Biological Sciences Research Council Grants EGA16107 and JIF 13209, and by a Darwin Trust of Edinburgh studentship (to D.Z.). The authors thank Steve J.W. Busby for his interest in this work and stimulating discussions.

REFERENCES

  • 1.Kolb A., Busby,S., Buc,H., Garges,S. and Adhya,S. (1993) Transcriptional regulation by cAMP and its receptor protein. Annu. Rev. Biochem., 62, 749–795. [DOI] [PubMed] [Google Scholar]
  • 2.Postma P. (1986) Catabolite repression and related phenomena. Symp. Soc. Gen. Microbiol., 39, 21–49. [Google Scholar]
  • 3.Busby S. and Ebright,R. (1999) Transcription activation by catabolite activator protein (CAP). J. Mol. Biol., 293, 199–213. [DOI] [PubMed] [Google Scholar]
  • 4.Robison K., McGuire,A.M. and Church,G.M. (1998) A comprehensive library of DNA-binding site matrices for 55 proteins applied to the complete Escherichia coli K-12 genome. J. Mol. Biol., 284, 241–254. [DOI] [PubMed] [Google Scholar]
  • 5.Tan K., Moreno-Hagelsieb,G., Collado-Vides,J. and Stormo,G.D. (2001) A comparative genomics approach to prediction of new members of regulons. Genome Res., 11, 566–584. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Tao H., Bausch,C., Richmond,C., Blattner,F.R. and Conway,T. (1999) Functional genomics: expression analysis of Escherichia coli growing on minimal and rich media. J. Bacteriol., 181, 6425–6440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Oh M.K., Rohlin,L., Kao,K.C. and Liao,J.C. (2002) Global expression profiling of acetate-grown Escherichia coli. J. Biol. Chem., 277, 13175–13183. [DOI] [PubMed] [Google Scholar]
  • 8.Zheng M., Wang,X., Templeton,L.J., Smulski,D.R., LaRossa,R.A. and Storz,G. (2001) DNA microarray-mediated transcriptional profiling of the Escherichia coli response to hydrogen peroxide. J. Bacteriol., 183, 4562–4570. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Courcelle J., Khodursky,A., Peter,B., Brown,P.O. and Hanawalt,P.C. (2001) Comparative gene expression profiles following UV exposure in wild-type and SOS-deficient Escherichia coli. Genetics, 158, 41–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Arfin S., Long,A., Ito,E., Riehle,M., Paegle,E. and Hatfield,G. (2000) Global gene expression profiling in Escherichia coli K12. The effects of integration host factor. J. Biol. Chem., 275, 29672–29684. [DOI] [PubMed] [Google Scholar]
  • 11.Hommais F., Krin,E., Laurent-Winter,C., Soutourina,O., Malpertuy,A., Le Caer,J.P., Danchin,A. and Bertin,P. (2001) Large-scale monitoring of pleiotropic regulation of gene expression by the prokaryotic nucleoid-associated protein, H-NS. Mol. Microbiol., 40, 20–36. [DOI] [PubMed] [Google Scholar]
  • 12.Cao M., Kobel,P.A., Morshedi,M.M., Wu,M.F., Paddon,C. and Helmann,J.D. (2002) Defining the Bacillus subtilis σW regulon: a comparative analysis of promoter consensus search, run-off transcription/macroarray analysis (ROMA), and transcriptional profiling approaches. J. Mol. Biol., 316, 443–457. [DOI] [PubMed] [Google Scholar]
  • 13.Blattner F.R., Plunkett,G.,III, Bloch,C.A., Perna,N.T., Burland,V., Riley,M., Collado-Vides,J., Glasner,J.D., Rode,C.K., Mayhew,G.F., Gregor,J., Davis,N.W., Kirkpatrick,H.A., Goeden,M.A., Rose,D.J., Mau,B. and Shao,Y. (1997) The complete genome sequence of Escherichia coli K-12. Science, 277, 1453–1474. [DOI] [PubMed] [Google Scholar]
  • 14.Datsenko K.A. and Wanner,B.L. (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl Acad. Sci. USA, 97, 6640–6645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Sambrook J., Fritsch,E.F. and Maniatis,T. (1989) Molecular cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [Google Scholar]
  • 16.Tang H., Severinov,K., Goldfarb,A. and Ebright,R.H. (1995) Rapid RNA polymerase genetics: one-day, no-column preparation of reconstituted recombinant Escherichia coli RNA polymerase. Proc. Natl Acad. Sci. USA, 92, 4902–4906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Rhodius V.A., West,D.M., Webster,C.L., Busby,S.J. and Savery,N.J. (1997) Transcription activation at class II CRP-dependent promoters: the role of different activating regions. Nucleic Acids Res., 25, 326–332. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Loos A., Glanemann,C., Willis,L.B., O'Brien,X.M., Lessard,P.A., Gerstmeir,R., Guillouet,S. and Sinskey,A.J. (2001) Development and validation of Corynebacterium DNA microarrays. Appl. Environ. Microbiol., 67, 2310–2318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Britton R.A., Eichenberger,P., Gonzalez-Pastor,J.E., Fawcett,P., Monson,R., Losick,R. and Grossman,A.D. (2002) Genome-wide analysis of the stationary-phase sigma factor (sigma-H) regulon of Bacillus subtilis. J. Bacteriol., 184, 4881–4890. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Rhodius V. and Busby,S. (2000) Transcription activation by the Escherichia coli cyclic AMP receptor protein: determinants within activating region 3. J. Mol. Biol., 299, 295–310. [DOI] [PubMed] [Google Scholar]
  • 21.Valentin-Hansen P., Holst,B., Josephsen,J., Hammer,K. and Albrechtsen,B. (1989) CRP/cAMP- and CytR-regulated promoters in Escherichia coli K12: the cdd promoter. Mol. Microbiol., 3, 1385–1390. [DOI] [PubMed] [Google Scholar]
  • 22.Kallipolitis B.H. and Valentin-Hansen,P. (1998) Transcription of rpoH, encoding the Escherichia coli heat-shock regulator σ32, is negatively controlled by the cAMP-CRP/CytR nucleoprotein complex. Mol. Microbiol., 29, 1091–1099. [DOI] [PubMed] [Google Scholar]
  • 23.Jayaraman P.S., Peakman,T.C., Busby,S.J., Quincey,R.V. and Cole,J.A. (1987) Location and sequence of the promoter of the gene for the NADH-dependent nitrite reductase of Escherichia coli and its regulation by oxygen, the Fnr protein and nitrite. J. Mol. Biol., 196, 781–788. [DOI] [PubMed] [Google Scholar]
  • 24.Wubbolts M.G., Terpstra,P., van Beilen,J.B., Kingma,J., Meesters,H.A. and Witholt,B. (1990) Variation of cofactor levels in Escherichia coli. Sequence analysis and expression of the pncB gene encoding nicotinic acid phosphoribosyltransferase. J. Biol. Chem., 265, 17665–17672. [PubMed] [Google Scholar]
  • 25.Lobell R. and Schleif,R. (1991) AraC-DNA looping: orientation of distance-dependent loop breaking by the cyclic AMP receptor protein. J. Mol. Biol., 218, 45–54. [DOI] [PubMed] [Google Scholar]
  • 26.Busby S., Truelle,N., Spassky,A., Dreyfus,M. and Buc,H. (1984) The selection and characterization of two novel mutation in overlapping promoters of the Escherichia coli galactose operon. Gene, 28, 201–209. [DOI] [PubMed] [Google Scholar]
  • 27.Ishizuka H., Hanamura,A., Inada,T. and Aiba,H. (1994) Mechanism of the down-regulation of cAMP receptor protein by glucose in Escherichia coli: role of autoregulation of the crp gene. EMBO J., 13, 3077–3082. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Ebright R. (1993) Transcription activation at Class I Cap-dependent promoters. Mol. Microbiol., 8, 797–802. [DOI] [PubMed] [Google Scholar]
  • 29.Ushida C. and Aiba,H. (1990) Helical phase dependent action of CRP: effect of the distance between the CRP site and the -35 region on promoter activity. Nucleic Acids Res., 18, 6325–6330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Belyaeva T., Rhodius,V., Webster,C. and Busby,S. (1998) Transcription activation at promoters carrying tandem DNA sites for the Escherichia coli cyclic AMP receptor protein: organisation of the RNA polymerase α subunits. J. Mol. Biol., 277, 789–804. [DOI] [PubMed] [Google Scholar]
  • 31.Law E., Savery,N. and Busby,S. (1999) Interactions between the Escherichia coli cAMP receptor protein and the C-terminal domain of the α subunit of RNA polymerase at class I promoters. Biochem. J., 337, 415–423. [PMC free article] [PubMed] [Google Scholar]
  • 32.Tebbutt J., Rhodius,V.A., Webster,C.L. and Busby,S.J. (2002) Architectural requirements for optimal activation by tandem CRP molecules at a class I CRP-dependent promoter. FEMS Microbiol. Lett., 210, 55–60. [DOI] [PubMed] [Google Scholar]
  • 33.Belyaeva T., Wade,J., Webster,C., Howard,V., Thomas,M., Hyde,E. and Busby,S. (2000) Transcription activation at the Escherichia coli melAB promoter: the role of MelR and the cyclic AMP receptor protein. Mol. Microbiol., 36, 211–222. [DOI] [PubMed] [Google Scholar]
  • 34.Kimata K., Inada,T., Tagami,H. and Aiba,H. (1998) A global repressor (Mlc) is involved in glucose induction of the ptsG gene encoding major glucose transporter in Escherichia coli. Mol. Microbiol., 29, 1509–1519. [DOI] [PubMed] [Google Scholar]
  • 35.Plumbridge J. (1998b) Expression of ptsG, the gene for the major glucose PTS transporter in Escherichia coli, is repressed by Mlc and induced by growth on glucose. Mol. Microbiol., 29, 1053–1063. [DOI] [PubMed] [Google Scholar]
  • 36.Plumbridge J. (1998a) Control of the expression of the manXYZ operon in Escherichia coli: Mlc is a negative regulator of the mannose PTS. Mol. Microbiol., 27, 369–380. [DOI] [PubMed] [Google Scholar]
  • 37.Decker K., Plumbridge,J. and Boos,W. (1998) Negative transcriptional regulation of a positive regulator: the expression of malT, encoding the transcriptional activator of the maltose regulon of Escherichia coli, is negatively controlled by Mlc. Mol. Microbiol., 27, 381–390. [DOI] [PubMed] [Google Scholar]
  • 38.Lee S.J., Boos,W., Bouche,J.P. and Plumbridge,J. (2000) Signal transduction between a membrane-bound transporter, PtsG, and a soluble transcription factor, Mlc, of Escherichia coli. EMBO J., 19, 5353–5361. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Shin D., Cho,N., Heu,S. and Ryu,S. (2003) Selective regulation of ptsG expression by Fis. Formation of either activating or repressing nucleoprotein complex in response to glucose. J. Biol. Chem., 278, 14776–14781. [DOI] [PubMed] [Google Scholar]
  • 40.Gosset G., Zhang,Z., Nayyar,S., Cuevas,W.A. and Saier,M.H. (2004) Transcriptome analysis of crp-dependent catabolite control of gene expression in Escherichia coli. J. Bacteriol., 186, 3516–3524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Li B., Wing,H., Lee,D., Wu,H.C. and Busby,S. (1998) Transcription activation by Escherichia coli FNR protein: similarities to, and differences from, the CRP paradigm. Nucleic Acids Res., 26, 2075–2081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Sawers G., Kaiser,M., Sirko,A. and Freundlich,M. (1997) Transcriptional activation by FNR and CRP: reciprocity of binding-site recognition. Mol. Microbiol., 23, 835–845. [DOI] [PubMed] [Google Scholar]
  • 43.Valentin-Hansen P., Søgaard-Anderson,L. and Petersen,H. (1996) A flexible partnership: the CytR ant-activator and the cAMP-CRP activator protein, comrades in transcriptional control. Mol. Microbiol., 20, 461–466. [DOI] [PubMed] [Google Scholar]
  • 44.Perini L.T., Doherty,E.A., Werner,E. and Senear,D.F. (1996) Multiple specific CytR binding sites at the Escherichia coli deoP2 promoter mediate both cooperative and competitive interactions between CytR and cAMP receptor protein. J. Biol. Chem., 271, 33242–33255. [DOI] [PubMed] [Google Scholar]
  • 45.Yamamoto K. and Ishihama,A. (2003) Two different modes of transcription repression of the Escherichia coli acetate operon by IclR. Mol. Microbiol., 47, 183–194. [DOI] [PubMed] [Google Scholar]
  • 46.Müller-Hill B. (1998) Some repressors of bacterial transcription. Curr. Opin. Microbiol., 1, 145–151. [DOI] [PubMed] [Google Scholar]
  • 47.Roy S., Garges,S. and Adhya,S. (1998) Activation and repression of transcription by different contact: two sides of a coin. J. Biol. Chem., 273, 14059–14062. [DOI] [PubMed] [Google Scholar]
  • 48.Monsalve M., Calles,B., Mencia,M., Salas,M. and Rojo,F. (1997) Transcription activation or repression by phage Ψ29 protein p4 depends on the strength of the RNA polymerase-promoter interactions. Mol. Cell, 1, 99–107. [DOI] [PubMed] [Google Scholar]
  • 49.Gulati A. and Mahadevan,S. (2000) Mechanism of catabolite repression in the bgl operon of Escherichia coli: involvement of the anti-terminator BglG, CRP-cAMP and EIIAGlc in mediating glucose effect downstream of transcription initiation. Genes Cells, 5, 239–250. [DOI] [PubMed] [Google Scholar]
  • 50.Davies S.J., Golby,P., Omrani,D., Broad,S.A., Harrington,V.L., Guest,J.R., Kelly,D.J. and Andrews,S.C. (1999) Inactivation and regulation of the aerobic C(4)-dicarboxylate transport (dctA) gene of Escherichia coli. J. Bacteriol., 181, 5624–5635. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Bell A.W., Buckel,S.D., Groarke,J.M., Hope,J.N., Kingsley,D.H. and Hermodson,M.A. (1986) The nucleotide sequences of the rbsD, rbsA, and rbsC genes of Escherichia coli K12. J. Biol. Chem., 261, 7652–7658. [PubMed] [Google Scholar]
  • 52.Holcroft C.C. and Egan,S.M. (2000) Interdependence of activation at rhaSR by cyclic AMP receptor protein, the RNA polymerase α subunit C-terminal domain, and rhaR. J. Bacteriol., 182, 6774–6782. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Cunningham L. and Guest,J.R. (1998) Transcription and transcript processing in the sdhCDAB-sucABCD operon of Escherichia coli. Microbiology, 144, 2113–2123. [DOI] [PubMed] [Google Scholar]
  • 54.Deeley M.C. and Yanofsky,C. (1982) Transcription initiation at the tryptophanase promoter of Escherichia coli K-12. J. Bacteriol., 151, 942–951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Klein W., Horlacher,R. and Boos,W. (1995) Molecular analysis of treB encoding the Escherichia coli enzyme II specific for trehalose. J. Bacteriol., 177, 4043–4052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Weickert M.J. and Adhya,S. (1993) Control of transcription of gal repressor and isorepressor genes in Escherichia coli. J. Bacteriol., 175, 251–258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Larson T.J., Cantwell,J.S. and van Loo-Bhattacharya,A.T. (1992) Interaction at a distance between multiple operators controls the adjacent, divergently transcribed glpTQ-glpACB operons of Escherichia coli K-12. J. Biol. Chem., 267, 6114–6121. [PubMed] [Google Scholar]
  • 58.Otsuka J., Watanabe,H. and Mori,K.T. (1996) Evolution of transcriptional regulation system through promiscuous coupling of regulatory proteins with operons; suggestion from protein sequence similarities in Escherichia coli. J. Theor. Biol., 178, 183–204. [DOI] [PubMed] [Google Scholar]
  • 59.Webster C., Gaston,K. and Busby,S. (1988) Transcription from the Escherichia coli melR promoter is dependent on the cyclic AMP receptor protein. Gene, 68, 297–305. [DOI] [PubMed] [Google Scholar]
  • 60.Ryu S., Ramseier,T.M., Michotey,V., Saier,M.H.,Jr and Garges,S. (1995) Effect of the FruR regulator on transcription of the pts operon in Escherichia coli. J. Biol. Chem., 270, 2489–2496. [DOI] [PubMed] [Google Scholar]
  • 61.Hanamura A. and Aiba,H. (1991) Molecular mechanism of negative autoregulation of Escherichia coli crp gene. Nucleic Acids Res., 19, 4413–4419. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Golby P., Kelly,D.J., Guest,J.R. and Andrews,S.C. (1998) Transcriptional regulation and organization of the dcuA and dcuB genes, encoding homologous anaerobic C4-dicarboxylate transporters in Escherichia coli. J. Bacteriol., 180, 6586–6596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Plumbridge J. and Kolb,A. (1991) CAP and Nag repressor binding to the regulatory regions of the nagE-B and manX genes of Escherichia coli. J. Mol. Biol., 217, 661–679. [DOI] [PubMed] [Google Scholar]
  • 64.Craig J.E., Zhang,Y. and Gallagher,M.P. (1994) Cloning of the nupC gene of Escherichia coli encoding a nucleoside transport system, and identification of an adjacent insertion element, IS 186. Mol. Microbiol., 11, 1159–1168. [DOI] [PubMed] [Google Scholar]
  • 65.Munch-Petersen A. and Jensen,N. (1990) Analysis of the regulatory region of the Escherichia coli nupG gene, encoding a nucleoside-transport protein. Eur. J. Biochem., 190, 547–551. [DOI] [PubMed] [Google Scholar]
  • 66.Gerlach P., Søgaard-Andersen,L., Pedersen,H., Martinussen,J., Valentin-Hansen,P. and Bremer,E. (1991) The cyclic AMP (cAMP)-cAMP receptor protein complex functions both as an activator and as a corepressor at the tsx-p2 promoter of Escherichia coli K-12. J. Bacteriol., 173, 5419–5430. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES