Skip to main content
Biodiversity Data Journal logoLink to Biodiversity Data Journal
. 2017 Jan 12;(5):e10792. doi: 10.3897/BDJ.5.e10792

Arthropod and oligochaete assemblages from grasslands of the southern Kenai Peninsula, Alaska

Matthew L Bowser 1, John M Morton 1, John Delton Hanson 2, Dawn R Magness 1, Mallory Okuly 1
PMCID: PMC5345024  PMID: 28325976

Abstract Abstract

Background

By the end of this century, the potential climate-biome of the southern Kenai Peninsula is forecasted to change from transitional boreal forest to prairie and grasslands, a scenario that may already be playing out in the Caribou Hills region. Here, spruce (Picea × lutzii Little [glauca × sitchensis]) forests were heavily thinned by an outbreak of the spruce bark beetle (Dendroctonus rufipennis (Kirby, 1837)) and replaced by the native but invasive grass species, Calamagrostis canadensis (Michx.) P. Beauv. As part of a project designed to delimit and characterize potentially expanding grasslands in this region, we sought to characterize the arthropod and earthworm communities of these grasslands.

We also used this sampling effort as a trial of applying high-throughput sequencing metabarcoding methods to a real-world inventory of terrestrial arthropods.

New information

We documented 131 occurrences of 67 native arthropod species at ten sites, characterizing the arthropod fauna of these grasslands as being dominated by Hemiptera (60% of total reads) and Diptera (38% of total reads). We found a single exotic earthworm species, Dendrobaena octaedra (Savigny, 1826), at 30% of sites and one unidentified enchytraeid at a single site. The utility of high-throughput sequencing metabarcoding as a tool for bioassessment of terrestrial arthropod assemblages was confirmed.

Keywords: metagenomics, Arthropoda , exotic earthworms, Illumina MiSeq

Introduction

Background

By the end of this century, the potential climate-biome of the southern Kenai Peninsula is forecasted to change from transitional boreal forest to prairie and grasslands (Scenarios Network for Arctic Planning and EWHALE lab 2012). This may be happening presently in the Caribous Hills region on the southern Kenai Peninsula between Tustumena Lake and Kachemak Bay, where Lutz spruce (Picea × lutzii Little [glauca × sitchensis]) forests were heavily thinned by a massive outbreak of the spruce bark beetle (Dendroctonus rufipennis (Kirby, 1837)) in the 1990s (Berg et al. 2006, Boucher and Mead 2006, Sherriff et al. 2011). Between 1987 and 2000, basal area of Lutz and white spruce >12.7 cm diameter-at-breast height decreased by 87% in this region (Boucher and Mead 2006).

Following this outbreak, the native but invasive herbaceous species Calamagrostis canadensis (Michx.) P. Beauv. and Chamerion angustifolium (L.) Holub increased in abundance (Boucher and Mead 2006). Although initial recruitment of spruce seedlings following this outbreak was sufficient to restock these forests (Boggs et al. 2008), large areas were subsequently burned in the 1990s and 2000s, potentially killing tree seedlings and further contributing to a transition from spruce forest to grassland.

Of the fauna of northern grasslands, arthropods are among the most abundant, diverse, and ecologically important (see Shorthouse and Larson 2010). Though Steppe bison (Bison priscus Bojanus, 1827) and mammoths (Mammuthus primigenius (Blumenbach, 1799)) existed on the Kenai Peninsula in the Pleistocene (Klein and Reger 2015) and Dall sheep (Ovis dalli Nelson, 1884) inhabit the Kenai Mountains, no large, mammalian grass-grazing herbivores remain in the Caribou Hills, leaving arthropods as the most ecologically important herbivores in grass- and forb-dominated habitats.

With the exception of Teraguchi et al. (1981), who sampled terrestrial arthropods from a C. canadensis-dominated grassland in Interior Alaska but did not obtain species identifications, we were able to find scant data on the arthropod communities of this habitat type in Alaska. We sought to characterize the arthropod assemblages of this potentially expanding grassland community on the Kenai Peninsula.

Lumbricid earthworms are relatively recent arrivals to Alaska translocated from the Palearctic by human activities (Hendrix and Bohlen 2002). They are at present more common near roads than in more remote areas on the Kenai Peninsula (Saltmarsh et al. 2016). As potential agents of change that can alter soil properties when introduced into new areas (Hale et al. 2005, Frelich et al. 2006, Hale et al. 2006, Holdsworth et al. 2007), we were interested in documenting the current distribution of earthworms in Kenai grasslands. We also wanted to determine the identities of the worms because the effects of earthworm invasions are dependent on the species composition of earthworm assemblages (Hale et al. 2005, Frelich et al. 2006).

Metabarcoding as a tool for assessing terrestrial arthropod assemblages

The investigator seeking to characterize assemblages of arthropods or of other diverse groups is currently presented with a wide and growing range of options for obtaining species identifications including traditional, specimen-based, morphological identifications; Sanger sequencing of individual specimens using DNA barcodes (Hebert et al. 2003) or similar short marker sequences; High-throughput sequencing (HTS) of individual specimens targeting short marker sequences (Shokralla et al. 2014, Meier et al. 2015); PCR-based HTS of mixed environmental samples from homogenized specimens (Hajibabaei et al. 2011) or preservative fluid (Hajibabaei et al. 2012); and PCR-free HTS (Zhou et al. 2013, Shokralla et al. 2016).

High-throughput sequencing metabarcoding methods have been advocated for biomonitoring of arthropod communities because they have the potential to be quick and comparatively inexpensive (Hajibabaei et al. 2011, Baird and Hajibabaei 2012). Several recent studies (Hajibabaei et al. 2012, Carew et al. 2013, Elbrecht and Leese 2015, Gibson et al. 2015, Aylagas et al. 2016) have demonstrated the utility of metagenomic HTS for characterizing mixed samples of invertebrates.

Obtaining correct species identifications from HTS methods requires a well-curated library of sequences from identified specimens (Hajibabaei et al. 2011, Dowle et al. 2015). Toward this end the first and second authors have been contributing arthropod sequences from specimens in the entomology collection of the Kenai National Wildlife Refuge to the BOLD database (Ratnasingham and Hebert 2007) beginning in 2007. Sikes et al. (in press) greatly expanded this work, sequencing specimens from the University of Alaska Museum's entomology collection, contributing to an Alaska DNA barcode library with the explicit purpose of enabling identification of Alaskan terrestrial arthropods by DNA barcoding.

In this small project we applied HTS metabarcoding methods to a real-world inventory with a vision of applying similar methods to future biomonitoring efforts.

Materials and Methods

Study area and study design

Our study area was a 37,790 ha union of major fire polygons south of Tustumena Lake on the southern Kenai Peninsula. This included the 1994 Windy Point Fire, 1996 Crooked Creek Fire, 2005 Fox Creek Fire, and 2007 Caribou Hills Fire.

Within this area, we chose as a sample frame to use centroids of the 250 m pixels from the Alaska eMODIS product (Jenkerson et al. 2010​), selecting every 12th pixel in both north-to-south and east-to-west axes, making a grid of 58 points spaced at 3 km intervals (Fig. 1).

Figure 1.

Figure 1.

Map of the study area, southern Kenai Peninsula, Alaska.

Field methods

Sampling sites were accessed using a Bell 206B Jetranger on July 18-19, 2015. Only when a site was determined from the air to be a non-wetland grassland as defined by Viereck et al. (1992) did we land.

All plant species within a 5.64 m radius, 100 m2 circular plot centered on the plot coordinates were recorded. Plants that could not be identified in the field were collected.

Earthworms were collected at each plot using methods similar to those of Saltmarsh et al. (2016). First, vegetation was removed from a small area within the plot using clippers, then a 50 cm × 50 cm aluminum quadrat frame was set on the ground. We searched through surface litter and organic material for earthworms by hand, then we extracted additional earthworms with a liquid mustard solution of 40 g yellow mustard seed powder (Monterey Bay Spice Company, Watsonville, California, http://www.herbco.com) in 3.8 L water (Lawrence and Bowers 2002). Earthworm specimens were collected into Uni-Gard -100 propylene glycol antifreeze.

At ten sites we collected a single sample of arthropods by sweeping the same 5.64 m radius plot in under five minutes using a BioQuip™ model 7112CP net with 30.5 cm diameter, approximately 24 × 20 per inch mesh BioQuip™ model 7112CPA net bag and a BioQuip™ model 7312AA 30.5 cm extension handle. Sweep net samples were placed in 250 ml Nalgene® vials filled with Uni-Gard -100 propylene glycol antifreeze, then stored in a -23°C freezer.

Laboratory methods

Plant specimens were identified in the laboratory using the keys of Hultén (1968), Welsh (1974), Tande and Lipkin (2003), and Skinner et al. (2012).

We identified earthworm specimens visually using the key of Reynolds (1977). Worm specimens were deposited in the entomology collection of the Kenai National Wildlife Refuge (coden: KNWR) and specimen data were made available via Arctos (http://arctos.database.museum/). One small worm that we could not identify morphologically we submitted for DNA barcoding via a LifeScanner kit (http://lifescanner.net/).

Arthropods were separated from vegetation and debris by hand under a dissecting microscope. At the same time, all athropods were tallied and coarsely identified, generally to orders but sometimes to families, genera, and species that could be quickly identified by sight. We made no attempt to account for the varying sizes of different arthropods.

Specimen data (Table 1) were entered into Arctos, where all data including site photographs from this project are available via an Arctos project entitled "Southern Kenai Peninsula grassland study" (http://arctos.database.museum/ProjectDetail.cfm?project_id=10002178). Corresponding records were entered into GenBank as BioSamples (BioProject PRJNA321553, https://www.ncbi.nlm.nih.gov/bioproject?term=PRJNA321553).

Table 1.

Sample collection data. Complete collection data including photographs of the sampling sites are available from Arctos. Dates are given in ISO 8601 format.

Arctos GUID BioSample latitude longitude date
KNWR:Ento:10838 SAMN04999859 59.96477475 -151.1925941 2015-07-19
KNWR:Ento:10839 SAMN04999860 60.03624489 -151.1865056 2015-07-19
KNWR:Ento:10840 SAMN04999861 59.96580488 -151.2419688 2015-07-19
KNWR:Ento:10841 SAMN04999862 60.08219062 -151.1374512 2015-07-18
KNWR:Ento:10842 SAMN04999863 60.05857897 -151.1845976 2015-07-18
KNWR:Ento:10843 SAMN04999864 60.05961196 -151.2341125 2015-07-18
KNWR:Ento:10844 SAMN04999865 60.10452370 -151.1355072 2015-07-18
KNWR:Ento:10845 SAMN04999866 60.10547999 -151.1805821 2015-07-18
KNWR:Ento:10846 SAMN04999867 59.92113378 -151.2456943 2015-07-19
KNWR:Ento:10847 SAMN04999868 59.94346937 -151.2438328 2015-07-19

Samples were shipped in propylene glycol to RTL Genomics in Lubbock, Texas for sequencing. Upon arrival, samples were removed from propylene glycol and rinsed with 100% ethanol. Ethanol rinse was decanted and enough 100% ethanol was added to the container to cover the arthropods. Samples were stored in Ethanol for 21 days. Samples were then rinsed in PBS, then 400 μl of PBS was added to the sample and the sample was ground using an Omni Tissue Homogenizer. Extraction was performed using MoBioPower soil extraction kit with an overnight incubation at 37°C. To elute the sample 50 μl of prewarmed elution buffer was added to the column membrane and incubated at room temperature for 2 min, then spun down. The elutate was place back on the column and incubated another 2 min, then spun down.

We used the forward primer mlCOIintF (GGWACWGGWTGAACWGTWTAYCCYCC) and reverse primer HCO2198 (TAAACTTCAGGGTGACCAAAAAATCA). These primers used previously by Leray et al. (2013) and Brandon-Mong et al. (2015), yielding a 313 bp fragment from the Cytochrome oxidase I DNA barcoding region. Primers were ordered with a 5' extension following the Illumina 2-step amplicon protocol. Samples were amplified in 25 μl reactions with Qiagen HotStar Taq master mix (Qiagen Inc, Valencia, California), 1 μl of each 5 μM primer, and 1 μl of template. Reactions were performed on ABI Veriti thermocyclers (Applied Biosytems, Carlsbad, California) under the following thermal profile: 95°C for 5 min, then 25 cycles of 94°C for 30 sec, 54°C for 40 sec, 72°C for 1 min, followed by one cycle of 72°C for 10 min and 4°C hold. Following amplification, reactions were separated on 2% agarose gels (Egels; Invitrogen, Carlsbad, California) and added to the next reaction based on band strength. A second amplification was performed using primers based on the Illumina Nextera PCR primers as follows: Forward - AATGATACGGCGACCACCGAGATCTACAC-[i5index]-TCGTCGGCAGCGTC and Reverse - CAAGCAGAAGACGGCATACGAGT-[i7index] GTCTCGTGGGCTCGG. Following amplification reactions were separated on 2% agarose gels (Egels; Invitrogen, Carlsbad California) and pooled equimolar based on band strength. Pools were run through a Qiagen Qiaquick gel column (Qiagen Inc, Valencia, California) and eluted in 50 μl, followed by small fragment removal using Agencourt AMPure XP beads at 75% (BeckmanCoulter, Indianapolis, Indiana). The pool was run on a Fragment Analyzer (Advanced Analytical, Ankeny, Iowa) and quantified using Qubit (Invitrogen, Carlsbad, California). The pool was prepared for sequencing using Illumina MiSeq V3 chemistry following manufacturer instructions, sequenced for 500 flows (2x250) and demultiplexed by on board software.

Sequence data were submitted to GenBank's Sequence Read Archive (BioProject: PRJNA321553).

Total molecular lab processing cost was $1,115 ($111.50 per sample) and sequencing results were delivered 68 days after samples had been received by RTL Genomics.

Library construction and metagenomic analysis

For the present study, we constructed an Alaska vicinity reference library by downloading publicly available COI data from BOLD on January 20-21, 2016, entering the search terms "Arthropoda[tax] Alaska[geo]" and similarly structured searches for arthropod sequences from the Yukon Territory, British Columbia, Chukot Autonomous Okrug, and Kamchatka Krai, yielding an initial library of 236,830 records including 6,677 unique species name strings.

A metagenomic analysis was performed using the cloud-based Galaxy platform (Giardine 2005, Blankenberg et al. 2010, Goecks, J. et al. 2010), generally following the simple metagenomics pipeline of Brandon-Mong et al. (2015) as an example.

Where one of a pair of reads had a read length less than 250 bp, these were filtered out using R version 3.2.2 (R Core Team 2015) and the ShortRead package (Morgan et al. 2009), then the resulting FASTQ files were uploaded to Galaxy. FASTQ files were merged using PEAR version 0.9.6.0 (Zhang et al. 2013), accepting default settings. Merged sequences were converted to sanger format using FASTQ Groomer version 1.0.4 (Blankenberg, Daniel et al. 2010). We used Filter by quality version 1.0.0 from the FASTX-toolkit (Gordon 2010) to filter reads by quality using default settings (cut-off=20, percent=90). Filtered reads were converted to FASTA file format using Galaxy's FASTQ to FASTA converter version 1.0.0 (Blankenberg et al. 2010). Chimeric sequences were removed using VSearch chimera detection version 1.9.7.0 (Rognes et al. 2016), accepting default settings. Sequences were then dereplicated using VSearch dereplication version 1.9.7.0 (Rognes et al. 2016), accepting default settings except that cluster abundances were written to the output files. Clustering was performed using VSearch clustering version 1.9.7.0 (Rognes et al. 2016), CD-HIT method with minimum identity set at 0.90.

Identifications were improved iteratively. First, initial identifications were obtained by querying the cluster centroids against our reference library using VSearch search version 1.9.7.0 (Rognes et al. 2016), accepting default parameters except that minimum similarity was set at 0.90. This yielded identifications at varying levels of taxonomic resolution because many identifications in our library were coarse identifications at the resolutions of genera, families, and orders. We chose to retain all library records, even those missing species names because we wanted to represent the assemblages as well as possible, including taxa for which we could not obtain Linnaean names with currently available information.

For all library records that were matched by our queries and that lacked species names we added identifications by submitting them to BOLD's Identification Request service and updating our library records with any identification improvements. In cases where no species names were available, we constructed provisional names incorporating BOLD BIN URIs (Ratnasingham and Hebert 2013), for example "Anthomyiidae sp. BOLD:AAG2469" corresponding to BIN BOLD:AAG2469. In cases where our library sequences closely matched multiple Linnaean species names on BOLD, the corresponding BIN generally including multiple Linnaean species, we again reverted to BIN resolution identifications or appropriate Linnaean names where these were available, e.g. "Simulium venustum complex" corresponding to BIN BOLD:AAA4264.

For cluster centroids that were not matched by our library, we queried these against the BOLD database using the bold() function from the bold package for R, version 0.3.5 (Chamberlain 2016). Where we found problematic records, especially those tagged as contaminated, we removed these from our library. The resulting library included 236,837 records (Table 2). Where matches were found among publicly available BOLD records, we downloaded these sequences and added them to our library, resulting in inclusion of a small number of sequences from Alberta, Manitoba, Northwest Territories, Ontario, Prince Edward Island, and Quebec.

Table 2.

Library composition by country and province/state. Country and province values of NA indicate sequences lacking corresponding geographic data.

Country Province Number of records
Canada Alberta 2
Canada British Columbia 193,410
Canada Manitoba 4
Canada Newfoundland and Labrador 2
Canada Northwest Territories 1
Canada Ontario 2
Canada Prince Edward Island 2
Canada Quebec 3
Canada Yukon Territory 35,406
Russia Chukot Autonomous Okrug 406
Russia Kamchatka Krai 665
United States Alaska 6,923
NA NA 11
Total 236,837

The VSearch step was repeated using the improved library and the resulting occurrence data were submitted to Arctos as observation records (GUIDs: UAMObs:Ento:235609UAMObs:Ento:235739).

We repeated the VSearch search identification step against our improved library using the same parameters. For the purpose of reporting species occurrence we exlcuded all clusters where read counts were four or less and all clusters where the VSearch search similarity values were less than 0.91. Clusters matching human COI were dropped.

Results

Vegetation

The ten plots were dominated by herbaceous plants, characterized by Calamagrostis canadensis (Michx.) P.Beauv. and Chamerion angustifolium (L.) J. Holub, species present at all sites (Fig. 2). Streptopus amplexifolius (L.) DC., Sanguisorba canadensis L., Veratrum viride Aiton, Dryopteris expansa (C. Presl) Fraser-Jenk. & Jermy, Geranium erianthum DC., and Lupinus nootkatensis Sims were found at six or more of the ten sites (Table 5, Suppl. material 1).

Figure 2.

Figure 2.

Study site 73F (60.1055°N, 151.1806°W), a site characteristic of our study area dominated by Calamagrostis canadensis and Chamerion angustifolium, photographed on July 18, 2015. Note the fire-scarred remains of a Lutz spruce forest that was culled by an extensive spruce bark beetle outbreak in the 1990s and subsequently burned in 2007.

Table 5.

Summary of plant species occurrences. GBIF ID: GBIF (http://www.gbif.org/) taxon identifier. f: frequency of occurrence, the proportion of all samples in which each taxonomic unit was detected.

order family scientific name GBIF ID f
Apiales Apiaceae Conioselinum chinense (L.) Britton, Sterns & Poggenb. 3034690 0.1
Apiales Apiaceae Heracleum maximum Bartr. 3034826 0.3
Asterales Asteraceae Achillea borealis Bong. 3120086 0.3
Asterales Asteraceae Senecio triangularis Hook. 3108906 0.1
Caryophyllales Caryophyllaceae Moehringia lateriflora (L.) Fenzl 3085371 0.1
Dipsacales Adoxaceae Sambucus racemosa L. 2888723 0.2
Equisetales Equisetaceae Equisetum arvense L. 7924597 0.4
Equisetales Equisetaceae Equisetum L. 2687913 0.5
Equisetales Equisetaceae Equisetum sylvaticum L. 2687929 0.2
Ericales Ericaceae Pyrola asarifolia Michx. 2888271 0.2
Ericales Ericaceae Vaccinium caespitosum Michaux 2882860 0.1
Ericales Ericaceae Vaccinium vitis-idaea L. 2882835 0.1
Ericales Polemoniaceae Polemonium acutiflorum Willd. ex Roem. & Schult. 2927866 0.1
Ericales Primulaceae Trientalis europaea L. 3169295 0.1
Fabales Fabaceae Lupinus nootkatensis Sims 2964525 0.6
Fagales Betulaceae Alnus Mill. 2876099 0.1
Gentianales Gentianaceae Swertia perennis L. 5414540 0.2
Gentianales Rubiaceae Galium L. 2913027 0.2
Geraniales Geraniaceae Geranium erianthum DC. 2890394 0.6
Lamiales Orobanchaceae Castilleja unalaschcensis (Cham. & Schltdl.) Malte 3170721 0.4
Liliales Liliaceae Streptopus amplexifolius (L.) DC. 2752734 0.9
Liliales Melanthiaceae Veratrum viride Aiton 7575112 0.7
Malpighiales Salicaceae Populus tremuloides Michx. 3040215 0.1
Malpighiales Salicaceae Salix barclayi Anderss. 5372597 0.1
Malpighiales Salicaceae Salix L. 3039576 0.2
Malpighiales Violaceae Viola L. 2874237 0.1
Myrtales Onagraceae Chamerion angustifolium (L.) J. Holub 3188783 1.0
Pinales Pinaceae Picea lutzii Little 5284875 0.1
Poales Cyperaceae Carex macrochaeta C.A.Mey. 2723223 0.1
Poales Cyperaceae Carex mertensii J.D.Prescott ex Bong. 2722481 0.2
Poales Juncaceae Luzula parviflora (Ehrh.) Desv. 2700961 0.2
Poales Poaceae Alopecurus magellanicus Lam. 4107552 0.1
Poales Poaceae Calamagrostis canadensis (Michx.) P.Beauv. 2704895 1.0
Poales Poaceae Festuca altaica Trin. 7720963 0.1
Poales Poaceae Phleum alpinum L. 2706012 0.1
Poales Poaceae Poa arctica R.Br. 2704207 0.1
Polypodiales Athyriaceae Athyrium filix-femina (L.) Roth 5275044 0.5
Polypodiales Cystopteridaceae Gymnocarpium dryopteris (L.) Newm. 2650832 0.1
Polypodiales Dryopteridaceae Dryopteris expansa (C. Presl) Fraser-Jenk. & Jermy 5275102 0.6
Ranunculales Ranunculaceae Aconitum delphiniifolium Hort.Prag. ex Steud. 7994520 0.4
Rosales Rosaceae Rubus arcticus L. 2992051 0.1
Rosales Rosaceae Rubus idaeus L. 2993094 0.1
Rosales Rosaceae Rubus L. 2988638 0.1
Rosales Rosaceae Rubus pedatus Sm. 2993074 0.2
Rosales Rosaceae Sanguisorba canadensis L. 3029411 0.7
Rosales Rosaceae Spiraea stevenii (Schneid.) Rydb. 3026628 0.2

Oligochaetes

At three sites (30% of sites) we detected a single earthworm species, Dendrobaena octaedra (Savigny, 1826). From another site a single specimen (Arctos GUID: KNWR:Ento:10822) was identified as an enchytraeid based on its COI sequence (BOLD Process ID: MOBIL1272-16). This sequence differed from all other sequences on BOLD, founding a new BIN (BOLD:ADC0663) with a nearest neighbor identified as Mesenchytraeus orcae Eisen, 1904 (pairwise-distance: 3.51%). Collection data for oligochaetes are provided in Suppl. material 2.

Arthropod morphological identifications

Based on tallies of the sample contents by sight identifications, the sweep net samples contained 22–325 (mean=103, SE=26) individuals per sample, a total of 1,029 specimens (Table 3). Identifications were made at varying taxonomic resolutions: 416 specimens only to orders, 580 specimens only to families, 18 only to genera, and 15 to species. Eight orders (Fig. 3), 27 families, six genera, and two species were represented. Complete occurrence data based on sight identifications are included as supplementary material (Suppl. material 3).

Table 3.

Composition of sweep net samples as determined by sight identifications.

Class Order Family Genus Species Quantity
Arachnida Acari 1
Total Acari 1
Arachnida Araneae 2
Arachnida Araneae Tetragnathidae Tetragnatha 2
Arachnida Araneae Thomisidae Misumena Misumena vatia (Clerck, 1757) 1
Total Araneae 5
Insecta Coleoptera 6
Insecta Coleoptera Elateridae 1
Insecta Coleoptera Staphylinidae 2
Total Coleoptera 9
Insecta Diptera 135
Insecta Diptera Agromyzidae 2
Insecta Diptera Bibionidae 1
Insecta Diptera Chironomidae 23
Insecta Diptera Culicidae 3
Insecta Diptera Empididae 45
Insecta Diptera Ephydridae 1
Insecta Diptera Lauxaniidae Lauxania Lauxania shewelli Perusse & Wheeler, 2000 14
Insecta Diptera Phoridae 30
Insecta Diptera Pipunculidae 2
Insecta Diptera Rhagionidae Symphoromyia 5
Insecta Diptera Scathophagidae 4
Insecta Diptera Simuliidae 13
Insecta Diptera Sphaeroceridae 2
Insecta Diptera Syrphidae 1
Total Diptera 281
Insecta Hemiptera 238
Insecta Hemiptera Aphididae 39
Insecta Hemiptera Cicadellidae 257
Insecta Hemiptera Miridae 29
Insecta Hemiptera Miridae Irbisia 28
Insecta Hemiptera Nabidae Nabis 9
Insecta Hemiptera Psyllidae 80
Total Hemiptera 680
Insecta Hymenoptera 27
Insecta Hymenoptera Ichneumonidae 9
Insecta Hymenoptera Sphecidae 2
Insecta Hymenoptera Tenthredinidae 6
Insecta Hymenoptera Torymidae Torymus 2
Total Hymenoptera 46
Insecta Lepidoptera 3
Total Lepidoptera 3
Insecta Psocoptera 4
Total Psocoptera 4

Figure 3.

Figure 3.

Percentages of total specimens collected by orders identified by sight.

The samples were dominated by Hemiptera (66% of total specimens), especially the family Cicadellidae (25% of total specimens), and by Diptera (27% of total specimens). Hymenoptera represented only 4.5% of the specimens while Acari, Araneae, Coleoptera, Lepidoptera, and Psocoptera each represented less than 1% of specimens.

Arthropod metagenomic identifications

Sequencing yielded 30,672–54,228 reads per sample (mean=45,194, SD=7,601), a total of 451,941 reads. At the end of analysis and filtering steps, 391,316 identified reads were included in the occurrence data, 26,066–47,402 reads per sample (mean=39,132, SD=7,064) representing seven orders (Fig. 4). Data for all identified clusters are included as supplementary material (Suppl. material 4).

Figure 4.

Figure 4.

Percentages of the total numbers of reads by orders.

Of the 391,316 reads included in the occurrence data, these were dominated by Hemiptera (60%) and Diptera (38%). Coleoptera made up 1.6% of the reads while Araneae, Hymenoptera, Lepidoptera, and Psocoptera each included less than 1% of reads. No reads of Acari were identified.

Including provisional names, the metagenomic analysis yielded 67 unique taxon names (Table 4), 5–19 names per sample (mean=13.2, SD=4.7, see Suppl. material 5. The identifications represented 63 unique BINs. Four of the matched taxa lacked corresponding BINs.

Table 4.

Summary of occurrence data from the metagenomic analysis. BIN: BOLD Barcode Index Numbers from matched sequences. f: frequency of occurrence, the proportion of all samples in which each taxonomic unit was detected.

Order Family Species BIN f
Araneae Thomisidae Misumena vatia BOLD:AAA6275 0.1
Coleoptera Chrysomelidae Altica tombacina BOLD:AAG3656 0.2
Coleoptera Elateridae Hypnoidus bicolor BOLD:AAH2367 0.1
Diptera Anthomyiidae Anthomyiidae sp. BOLD:AAG2469 BOLD:AAG2469 0.3
Diptera Anthomyiidae Botanophila relativa BOLD:ACG5832 0.1
Diptera Anthomyiidae Botanophila rubrigena BOLD:ABX5204 0.1
Diptera Anthomyiidae Delia echinata BOLD:ACT6183 0.1
Diptera Anthomyiidae Hylemya variata BOLD:AAG2478 0.4
Diptera Anthomyiidae Paradelia brunneonigra BOLD:ACB1112 0.1
Diptera Anthomyiidae Pegomya sp. BOLD:AAG2506 BOLD:AAG2506 0.1
Diptera Anthomyzidae Anthomyza sp. BOLD:AAL8100 BOLD:AAL8100 0.2
Diptera Bibionidae Bibionidae sp. BOLD:ACG6252 BOLD:ACG6252 0.2
Diptera Chironomidae Metriocnemus sp. BOLD:ACB8808 BOLD:ACB8808 0.1
Diptera Chironomidae Smittia sp. 16ES BOLD:AAB0375 0.1
Diptera Chironomidae Smittia sp. ES12 BOLD:AAB0377 0.1
Diptera Culicidae Aedes pullatus BOLD:AAM4536 0.1
Diptera Empididae Empididae sp. BOLD:AAF9792 BOLD:AAF9792 0.3
Diptera Fanniidae Fannia aethiops BOLD:AAM6399 0.5
Diptera Fanniidae Fannia serena BOLD:AAG6901 0.1
Diptera Heleomyzidae Suillia convergens BOLD:AAV8347 0.1
Diptera Hybotidae Euthyneura sp. BOLD:AAF9859 BOLD:AAF9859 0.1
Diptera Lauxaniidae Lauxania shewelli BOLD:AAH3531 0.4
Diptera Muscidae Coenosia impunctata BOLD:AAQ0758 0.5
Diptera Muscidae Hydrotaea militaris BOLD:AAG1771 0.3
Diptera Muscidae Muscidae sp. BOLD:ACL9946 BOLD:ACL9946 0.1
Diptera Muscidae Myospila meditabunda BOLD:AAD7145 0.1
Diptera Phoridae Megaselia diversa BOLD:ACX1594 0.2
Diptera Phoridae Phoridae sp. BOLD:AAG3234 BOLD:AAG3234 0.1
Diptera Phoridae Phoridae sp. BOLD:AAL9069 BOLD:AAL9069 0.1
Diptera Pipunculidae Pipunculus campestris BOLD:AAD0917 0.2
Diptera Pipunculidae Pipunculus hertzogi BOLD:AAE4793 0.5
Diptera Pipunculidae Tomosvaryella sp. BOLD:AAG3766 BOLD:AAG3766 0.1
Diptera Psychodidae Psychoda phalaenoides BOLD:AAF9317 0.1
Diptera Rhagionidae Symphoromyia sp. BOLD:AAP6399 BOLD:AAP6399 0.4
Diptera Scathophagidae Scathophaga furcata BOLD:ACX4405 0.2
Diptera Scathophagidae Scathophaga suilla BOLD:AAN6699 0.1
Diptera Sciaridae Cratyna sp. BOLD:AAP6470 BOLD:AAP6470 0.1
Diptera Sciaridae Sciaridae sp. BOLD:AAH3999 BOLD:AAH3999 0.1
Diptera Sepsidae Sepsis neocynipsea BOLD:ABY4960 0.5
Diptera Simuliidae Simulium arcticum complex BOLD:AAA8954 0.1
Diptera Simuliidae Simulium venustum complex BOLD:AAA4264 0.2
Diptera Syrphidae Hiatomyia sp. BOLD:AAZ5940 BOLD:AAZ5940 0.1
Hemiptera Aphididae Macrosiphum euphorbiae BOLD:AAA6213 0.2
Hemiptera Cicadellidae Balclutha sp. BOLD:AAG8963 BOLD:AAG8963 0.1
Hemiptera Cicadellidae Boreotettix sp. 0.1
Hemiptera Cicadellidae Diplocolenus evansi 0.1
Hemiptera Cicadellidae Empoasca luda BOLD:AAG8683 0.1
Hemiptera Cicadellidae Euscelis monodens sp. nov BOLD:ACG7815 0.5
Hemiptera Cicadellidae Idiocerus sp. BOLD:ACB0208 BOLD:ACB0208 0.2
Hemiptera Cicadellidae Latalus tatraensis 0.1
Hemiptera Cicadellidae Limotettix dasidus BOLD:AAG8684 0.1
Hemiptera Cicadellidae Sonronius dahlbomi BOLD:AAN8426 0.8
Hemiptera Cicadellidae Twiningia fasciata 0.1
Hemiptera Miridae Irbisia sericans BOLD:AAZ2844 0.1
Hemiptera Miridae Mecomma gilvipes BOLD:AAZ6451 0.3
Hemiptera Miridae Salignus tahoensis BOLD:AAF9947 0.2
Hemiptera Psyllidae Craspedolepta alaskensis BOLD:ACM1279 0.9
Hemiptera Psyllidae Craspedolepta subpunctata BOLD:AAV0232 0.3
Hymenoptera Braconidae Microgaster jft23 BOLD:AAB8447 0.1
Hymenoptera Ichneumonidae Mesochorus prolatus BOLD:ACE4725 0.1
Hymenoptera Ichneumonidae Orthocentrinae sp. BOLD:AAH1521 BOLD:AAH1521 0.1
Hymenoptera Ichneumonidae Polysphincta limata BOLD:AAH1739 0.1
Hymenoptera Tenthredinidae Amauronematus fallax BOLD:ABU5508 0.1
Lepidoptera Noctuidae Alypia langtoni BOLD:AAD5114 0.1
Lepidoptera Plutellidae Plutella hyperboreella BOLD:AAC3387 0.1
Lepidoptera Tortricidae Argyrotaenia occultana BOLD:AAA2955 0.1
Psocoptera Caeciliusidae Valenzuela flavidus BOLD:AAN8447 0.1

Of the two species identifications we were able to make by sight, both were detected and identified by the metagenomic analysis. Misumena vatia (Clerck, 1757) was detected in the same sample in both the sight identifications and the metegomic data. Lauxania shewelli Perusse & Wheeler, 2000 was recorded at six sites in the sight identifications and detected at five of these same six sites in the metagenomic analysis.

Scrutiny of the remaining sequences that did not match anything in our reference database revealed a total of ten reads of human sequences from three sites.

Discussion

General characterization

Within the Calamagrostis-dominated grasslands of the Caribou Hills region we documented an entomofauna dominated by Hemiptera and Diptera, comparable to the general composition of sweep net samples collected in a Montana grassland by Spafford and Lortie (2013). Teraguchi et al. (1981) collected arthropods from a recently burned, Calamagrostis-dominated grassland similar to the sites we sampled in the Caribou Hills, but meaningful comparisons between our datasets are problematic due to the lack of details provided by Teraguchi et al. (1981).

We collected a similar number of specimens in ten 100 m2 sweep net samples over two days as Teraguchi et al. (1981), who collected 1,112 arthropod specimens in 18 0.43 m2 samples over three months from a recently burned Calamagrostis canadensis grassland in the vicinity of Fairbanks, Alaska. Their field collecting method of sampling arthropods from vegetation using a D-Vac vacuum insect collector would have been expected to obtain results generally comparable to our sweep net sampling method (Schotzko and O'Keeffe 1989) although vacuum collectors do tend to collect a greater numbers of individuals (Schotzko and O'Keeffe 1989, Buffington and Redak 1998, Doxon et al. 2011), lower biomass (Doxon et al. 2011), smaller size classes (Doxon et al. 2011), and similar (Doxon et al. 2011) to higher (Buffington and Redak 1998) species diversity compared to sweep net sampling per unit effort. The overall composition of the communities collected by Teraguchi et al. (1981) cannot be directly compared to ours because they did not provide the numbers of individuals collected for each order.

Teraguchi et al. (1981) recognized “about 265” morphospecies, four times more than the 67 taxon names yielded by our metagenomic analysis. This difference may have been at least partially due the much longer temporal sampling window of June through August used by Teraguchi et al. (1981), where they would have been able to collect arthropods species having varying seasonal phenologies. Some of the difference is attributable to the ability of the D-Vac vacuum to collect a greater diversity of arthropods than sweep net sampling, but most of the difference is likely due to the identification methods used. Few species, even rare species, would have been missed by morphological identifications; our metagenomic methods likely failed to detect rare species as was the case for Hajibabaei et al. (2012). With the exception of the Coleoptera, of which they collected none, Teraguchi et al. (1981) found a greater diversity of species within all orders of arthropods compared to our data. Particularly notable was the Hymenoptera, of which Teraguchi et al. (1981) recognized over 140 morphospecies; we found five. However, Teraguchi et al. (1981) obtained no species identifications using recogized scientific names, greatly limiting the usefulness of their results. In contrast, our methods yielded identifications that can be related to described species or at least recognizable molecular operational taxonomic units (MOTUs) (Blaxter et al. 2005).

Although our arthropod sampling methods captured only a portion of the total arthropod fauna that would have been present, our results portrayed a reasonable snapshot of at least the fauna present on vegetation. All arthropods we documented are believed to be native to Alaska.

Comments on selected taxa

The single exotic earthworm species we collected, Dendrobaena octaedra, present at 30% of sites in our study area, was already known to be widespread on the Kenai Peninsula. This species was found at 70% of sites sampled on the Kenai National Wildlife Refuge, adjacent to our present study area, by Saltmarsh et al. 2016. A parthenogenetic, epigeic species, D. octaedra is believed to be spread easily by vehicle tires (Cameron et al. 2007), but it causes little change in soil properties as compared with earthworm assemblages that include anecic and endogeic earthrworms (Hale et al. 2005, Frelich et al. 2006). Based on our finding of only a single exotic earthworm species, a species known to have little effect on soils, exotic earthworms are likely to contribute relatively little to changes in grasslands of the southern Kenai Peninsula in the near future unless anecic or endogeic earthworms become established.

We assume that the single enchytraeid we collected was native because enchytraeids are widespread and diverse in southern Alaska (see Timm 1999).

The chrysomelid beetle Altica tombacina was documented at two sites in the metagenomic analysis. Review of the notes associated with the specimen records on Arctos showed that these had been larvae when collected and so would have been unlikely to be identifiable based on morphology. Altica tombacina is to be expected in the study area, having been described from the Russian River vicinity (Mannerheim 1853) about 70 km to the northwest.

The two staphylinid beetles seen in our samles were missed by our metagenomic methods likely due to their generally small size, primer bias, or a combination of these two reasons.

One of the more frequently detected species was Coenosia impunctata Malloch, 1920 (Diptera: Muscidae), found at seven sites. This species, described from Mount Katmai, Alaska (Malloch 1920), is distribubted from the Aleutian Islands to British Columbia based on data in BOLD.

Pipunculidae, specialist parasitoids on Cicadellidae and Delphacidae that are easly recognized at the family level, were seen in only two of the samples, but reads were detected in six samples in the metagenomic analysis, representing three species. At least some of these reads almost certainly came from pipunculid larvae within their cicadellid hosts.

Cicadellidae were well represented in our metagenomic data both in terms of read abundance and diversity, consistent with the high abundance and diversity of cicadellids documented from Canadian grasslands (Hamilton and Whitcomb 2010).

Of the Cicadellidae, the most common was Sonronius dahlbomi (Zetterstedt, 1840), detected at eight out of ten sites. According to Beirne (1956), this is a locally common species ranging from Alaska to Newfoundland and Labrador.

An entity bearing the provisional name of "Euscelis monodens sp. nov" (BIN BOLD:ACG7815) was the next most common cicadellid, detected at five sites. This provisional species is currently represented on BOLD by 15 specimens from British Columbia and the Yukon.

Delphacidae, herbivores of graminoids previously found by Bowser (2009) in 18% of sweep net samples from all habitat types on the Kenai National Wildlife Refuge, adjacent to our study area, were conspicuously absent from these Calamagrostis-dominated post-fire grassland samples.

It was noteworthy that Nabis (Nabidae) specimens were seen in the samples at four sites, but these were not detected by the metagenomic analysis despite these being some of the largest specimens in the samples, representing a significant portion of the material by body mass.

Irbisia sericans (Stål, 1858) (Hemiptera: Miridae), which we detected at one site, had previously been documented from Calamagrostis-dominiated grassland on the southern Kenai Peninsula where they had caused chlorosis of Calamagrostis leaves and stunting of the plants (McKendrick and Bleicher 1980).

Human COI sequences in our data may have been due to contamination in our processing steps, but these may alternatively have come from human blood within biting flies collected in our samples. Biting flies (Simulium or Symphoromyia) were detected in all three samples where human sequences were detected (see Suppl. material 4).

Metabarcoding as an identification method

The overall metagenomic results were consistent with our accounting of the specimens by eye, consistently portraying a community dominated by Hemiptera and Diptera. Our metagenomic methods under-represented the Araneae, Hemiptera, Hymenoptera, Lepidoptera, and Psocoptera while over-representing Coleoptera and Diptera relative to the proportions of specimens, likely due to primer bias during the PCR step. This is consistent with the experience of Brandon-Mong et al. (2015) and Aylagas et al. (2016), who documented some PCR bias using the same mlCOIintF/HCO2198 313 bp region but found that it generally performed well over a broad range of invertebrate taxa compared to other regions that they tested.

To date, the purpose of most studies of involving HTS metabarcoding of arthropods has generally been to test and refine these methods (see Hajibabaei et al. 2011, Hajibabaei et al. 2012, Carew et al. 2013, Brandon-Mong et al. 2015, Elbrecht and Leese 2015, Aylagas et al. 2016). Ours is among the first studies to apply these methods to a real-world inventory effort (but see Gibson et al. 2015).

Our metabarcoding methods yielded timely (about 80 days including lab processing, shipping time, and analysis steps) and relatively inexpensive identifications ($US 1,115 for 131 sample × taxon identifications, $US 8.51 per identification). This is considerably more expensive than the < $US 0.40 chemical cost per identification of Meier et al. (2015) and the < $US 1 cost per morphological identification cost of Meierotto and Sikes (2015), but in both of these cases there would have been additional time and expense required for curating and archiving individual arthropod specimens. In contrast, our methods required only that vegetation and debris be separated from arthropods prior to forwarding samples to the metagenomics lab, a step that took < 1 hr. per sample.

There is an obvious trade-off between curating individual specimens for long-term deposition in an institutional repository and homogenizing specimens for HTS. Archiving individual specimens would have the potential to yield the most information as the specimens can be photographed, identified, and sequenced individually, and the specimens remain available for use in subsequent work. Rare and small species, easily missed by our HTS metagenomic methods, would be more likely to be detected using specimen-based, morphological methods.

However, processing and identification of thousands of specimens is time-consuming (Marshall et al. 1994). In addition, many specimens may remain unidentified if they are immature, damaged, or members of groups for which taxonomic expertise is unavailable. Metabarcoding can be more taxonomically comprehensive than morphological methods (Ji et al. 2013), providing identifications over a broad range of taxa.

A non-destructive metabarcoding method (Hajibabaei et al. 2012) would appear to be ideal for rapid bioassessments, providing rapid identifications while leaving specimens intact, but most arthropod metabarcoding studies to date have relied on extraction of DNA from homogenized tissue. We chose this method simply because it was already available as a service from a metagenomics lab.

Conclusions

We documented a native grassland arthropod fauna dominated by Hemiptera and Diptera. We found a single, epigeic, exotic earthworm species, but earthworms are unlikely to significantly alter these grassland communities unless additional exotic earthworms become established. We also demonstrated the usefulness of high-throughput sequencing metabarcoding as a tool for bioassessment of terrestrial arthropod assemblages.

Supplementary Material

Supplementary material 1

Vegetation data

Matthew L. Bowser, John M. Morton

Data type: occurrences

Brief description: Observation-based occurrences of vascular plant species. Dates are given in ISO 8601 format.

File: oo_106140.xlsx

bdj-05-e10792-s001.xlsx (21.2KB, xlsx)
Supplementary material 2

Earthworm specimen data

Matthew L. Bowser, John M. Morton

Data type: occurrences

Brief description: Earthworm specimen data. Dates are given in ISO 8601 format.

File: oo_106202.xlsx

bdj-05-e10792-s002.xlsx (11.5KB, xlsx)
Supplementary material 3

Arthropod sight identification occurrences

Matthew L. Bowser

Data type: Occurrence

Brief description: Arthropod specimen counts by sight identification and sample. Columns labeled KNWR:Ento:10838–KNWR:Ento:10847 are GUIDs of corresponding records on Arctos.

File: oo_90113.xlsx

bdj-05-e10792-s003.xlsx (12.9KB, xlsx)
Supplementary material 4

Cluster identification data from metagenomic analysis

Matthew L. Bowser

Data type: Occurrences

Brief description: GUID: Arctos globally unique identifiers for the arthropod samples. Cluster label: illumina labels of centroid sequence clusters. Read count: cluster read counts. Process id: BOLD process IDs for matched database sequences. Similarity: similarity value from VSearch search. BIN: BOLD Barcode Index Numbers. Nucleotides: cluster centroid sequences.

File: oo_95375.xlsx

bdj-05-e10792-s004.xlsx (73.7KB, xlsx)
Supplementary material 5

Read counts by species and samples

Matthew L. Bowser

Data type: occurrences

Brief description: Arthropod occurrence data from the metagenomic analysis expressed as read counts. BIN: BOLD Barcode Index Number. Columns labeled KNWR:Ento:10838–KNWR:Ento:10847 are GUIDs of corresponding specimen records on Arctos.

File: oo_95376.xlsx

bdj-05-e10792-s005.xlsx (16.3KB, xlsx)

Acknowledgements

We thank the Alaska Department of Natural Resources and Cook Inlet Region, Inc. for permission to collect samples on their lands. Derek S. Sikes (University of Alaska Museum, Fairbanks, Alaska), Bruce A. Snyder (Georgia College, Milledgeville, Georgia), and an anonymous reviewer provided comments that substantially improved this manuscript.

References

  1. Aylagas Eva, Borja Ángel, Irigoien Xabier, Rodríguez-Ezpeleta Naiara. Benchmarking DNA metabarcoding for biodiversity-based monitoring and assessment. Frontiers in Marine Science. 2016;3:96. doi: 10.3389/fmars.2016.00096. [DOI] [Google Scholar]
  2. Baird Donald J., Hajibabaei Mehrdad. Biomonitoring 2.0: a new paradigm in ecosystem assessment made possible by next-generation DNA sequencing. Molecular Ecology. 2012;21(8):2039–2044. doi: 10.1111/j.1365-294x.2012.05519.x. [DOI] [PubMed] [Google Scholar]
  3. Beirne Bryan P. Leafhoppers (Homoptera: Cicadellidae) of Canada and Alaska. Memoirs of the Entomological Society of Canada. 1956;88:1–180. doi: 10.4039/entm8802fv. [DOI] [Google Scholar]
  4. Berg Edward E., Henry J. David, Fastie Christopher L., De Volder Andrew D., Matsuoka Steven M. Spruce beetle outbreaks on the Kenai Peninsula, Alaska, and Kluane National Park and Reserve, Yukon Territory: relationship to summer temperatures and regional differences in disturbance regimes. http://dx.doi.org/10.1016/j.foreco.2006.02.038. Forest Ecology and Management. 2006;227(3):219–232. doi: 10.1016/j.foreco.2006.02.038. [DOI] [Google Scholar]
  5. Blankenberg Daniel, Von Kuster Gregory, Coraor Nathaniel, Ananda Guruprasad, Lazarus Ross, Mangan Mary, Nekrutenko Anton, Taylor James. Galaxy: A web-based genome analysis tool for experimentalists. Current Protocols in Molecular Biology. 2010 doi: 10.1002/0471142727.mb1910s89. [DOI] [PMC free article] [PubMed]
  6. Blankenberg Daniel, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A, Team the Galaxy. Manipulation of FASTQ data with Galaxy. http://dx.doi.org/10.1093/bioinformatics/btq281. Bioinformatics. 2010;26(14):1783–1785. doi: 10.1093/bioinformatics/btq281. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Blaxter M., Mann J., Chapman T., Thomas F., Whitton C., Floyd R., Abebe E. Defining operational taxonomic units using DNA barcode data. Philosophical Transactions of the Royal Society B: Biological Sciences. 2005;360(1462):1935–1943. doi: 10.1098/rstb.2005.1725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Boggs Keith, Sturdy Michelle, Rinella Daniel J., Rinella Matthew J. White spruce regeneration following a major spruce beetle outbreak in forests on the Kenai Peninsula, Alaska. http://dx.doi.org/10.1016/j.foreco.2008.02.039. Forest Ecology and Management. 2008;255(10):3571–3579. doi: 10.1016/j.foreco.2008.02.039. [DOI] [Google Scholar]
  9. Boucher Tina V., Mead Bert R. Vegetation change and forest regeneration on the Kenai Peninsula, Alaska following a spruce beetle outbreak, 1987–2000. http://dx.doi.org/10.1016/j.foreco.2006.02.051. Forest Ecology and Management. 2006;227(3):233–246. doi: 10.1016/j.foreco.2006.02.051. [DOI] [Google Scholar]
  10. Bowser Matthew L. Modeling and Monitoring Terrestrial Arthropod Biodiversity on the Kenai National Wildlife Refuge, Alaska. University of Alaska Fairbanks; Fairbanks, Alaska: 2009. 155. [Google Scholar]
  11. Brandon-Mong G. J., Gan H. M., Sing K. W., Lee P. S., Lim P. E., Wilson J. J. DNA metabarcoding of insects and allies: an evaluation of primers and pipelines. http://dx.doi.org/10.1017/s0007485315000681. Bulletin of Entomological Research. 2015;105(6):717–727. doi: 10.1017/s0007485315000681. [DOI] [PubMed] [Google Scholar]
  12. Buffington M. L., Redak R. A. A comparison of vacuum sampling versus sweep-netting for arthropod biodiversity measurements in California coastal sage scrub. Journal of Insect Conservation. 1998;2(2):99–106. doi: 10.1023/a:1009653021706. [DOI] [Google Scholar]
  13. Cameron Erin K., Bayne Erin M., Clapperton M. Jill. Human-facilitated invasion of exotic earthworms into northern boreal forests. Ecoscience. 2007;14(4):482–490. doi: 10.2980/1195-6860(2007)14[482:hioeei]2.0.co;2. [DOI] [Google Scholar]
  14. Carew Melissa E, Pettigrove Vincent J, Metzeling Leon, Hoffmann Ary A. Environmental monitoring using next generation sequencing: rapid identification of macroinvertebrate bioindicator species. Frontiers in Zoology. 2013;10(1):45. doi: 10.1186/1742-9994-10-45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Chamberlain Scott. bold: Interface to Bold Systems 'API'. http://CRAN.R-project.org/package=bold. 2016 0.3.5.
  16. Dowle Eddy J., Pochon Xavier, Banks Jonathan C., Shearer Karen, Wood Susanna A. Targeted gene enrichment and high-throughput sequencing for environmental biomonitoring: a case study using freshwater macroinvertebrates. Molecular Ecology Resources. 2015;16(5):1240–1254. doi: 10.1111/1755-0998.12488. [DOI] [PubMed] [Google Scholar]
  17. Doxon Elizabeth D., Davis Craig A., Fuhlendorf Samuel D. Comparison of two methods for sampling invertebrates: vacuum and sweep-net sampling. Journal of Field Ornithology. 2011;82(1):60–67. doi: 10.1111/j.1557-9263.2010.00308.x. [DOI] [Google Scholar]
  18. Elbrecht Vasco, Leese Florian. Can DNA-based ecosystem assessments quantify species abundance? Testing primer bias and biomass—sequence relationships with an innovative metabarcoding protocol. PLoS ONE. 2015;10(7):e0130324. doi: 10.1371/journal.pone.0130324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Frelich Lee E., Hale Cindy M., Scheu Stefan, Holdsworth Andrew R., Heneghan Liam, Bohlen Patrick J., Reich Peter B. Earthworm invasion into previously earthworm-free temperate and boreal forests. Biological Invasions. 2006;8(6):1235–1245. doi: 10.1007/s10530-006-9019-3. [DOI] [Google Scholar]
  20. Giardine B. Galaxy: a platform for interactive large-scale genome analysis. http://dx.doi.org/10.1101/gr.4086505. Genome Research. 2005;15(10):1451–1455. doi: 10.1101/gr.4086505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Gibson Joel F., Shokralla Shadi, Curry Colin, Baird Donald J., Monk Wendy A., King Ian, Hajibabaei Mehrdad. Large-scale biomonitoring of remote and threatened ecosystems via high-throughput sequencing. PLOS ONE. 2015;10(10):e0138432. doi: 10.1371/journal.pone.0138432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Goecks J., Nekrutenko A., Taylor J., Team the Galaxy. Galaxy: a comprehensive approach for supporting accessible, reproducible, and transparent computational research in the life sciences. http://dx.doi.org/10.1186/gb-2010-11-8-r86. Genome Biology. 2010;11(8):R86. doi: 10.1186/gb-2010-11-8-r86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Gordon Assaf. The Hannon laboratory, Cold Spring Harbor laboratory; 2010. FASTX-Toolkit: FASTQ/A short-reads pre-processing tools. 1.0.0. [Google Scholar]
  24. Hajibabaei Mehrdad, Spall Jennifer L, Shokralla Shadi, Konynenburg Steven van. Assessing biodiversity of a freshwater benthic macroinvertebrate community through non-destructive environmental barcoding of DNA from preservative ethanol. BMC Ecology. 2012;12(1):28. doi: 10.1186/1472-6785-12-28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Hajibabaei Mehrdad, Shokralla Shadi, Zhou Xin, Singer Gregory A. C., Baird Donald J. Environmental barcoding: a next-generation sequencing approach for biomonitoring applications using river benthos. PLoS ONE. 2011;6(4):e17497. doi: 10.1371/journal.pone.0017497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Hale Cindy M., Frelich Lee E., Reich Peter B. Changes in hardwood forest understory plant communities in response to European earthworm invasions. Ecology. 2006;87(7):1637–1649. doi: 10.1890/0012-9658(2006)87[1637:cihfup]2.0.co;2. [DOI] [PubMed] [Google Scholar]
  27. Hale Cindy M., Frelich Lee E., Reich Peter B., Pastor John. Effects of European Earthworm Invasion on Soil Characteristics in Northern Hardwood Forests of Minnesota, USA. http://dx.doi.org/10.1007/s10021-005-0066-x. Ecosystems. 2005;8(8):911–927. doi: 10.1007/s10021-005-0066-x. [DOI] [Google Scholar]
  28. Hamilton K. G. Andrew, Whitcomb Robert F. Leafhoppers (Homoptera: Cicadellidae): a major family adapted to grassland habitats. Arthropods of Canadian Grasslands (Volume 1): Ecology and Interactions in Grassland Habitats. 2010 doi: 10.3752/9780968932148.ch8. [DOI]
  29. Hebert P. D. N., Cywinska A., Ball S. L., deWaard J. R. Biological identifications through DNA barcodes. Proceedings of the Royal Society B: Biological Sciences. 2003;270(1512):313–321. doi: 10.1098/rspb.2002.2218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Hendrix Paul F., Bohlen Patrick J. Exotic earthworm invasions in North America: ecological and policy implications. http://bioscience.oxfordjournals.org/content/52/9/801.short. BioScience. 2002;52(9):801. doi: 10.1641/0006-3568(2002)052[0801:eeiina]2.0.co;2. [DOI] [Google Scholar]
  31. Holdsworth Andrew R., Frelich Lee E., Reich Peter B. Effects of earthworm invasion on plant species richness in northern hardwood orests. Conservation Biology. 2007;21(4):997–1008. doi: 10.1111/j.1523-1739.2007.00740.x. [DOI] [PubMed] [Google Scholar]
  32. Hultén E. Flora of Alaska and Neighboring Territories. Stanford University Press; Stanford, California: 1968. xxii + 1008. [Google Scholar]
  33. Jenkerson C. B., Maiersperger Thomas, Schmidt Gail. eMODIS: a user-friendly data source, U.S. Geological Survey Open-File Report 2010–1055. U.S. Department of the Interior, U.S. Geological Survey; Reston, Virginia: 2010. 10. [Google Scholar]
  34. Ji Yinqiu, Ashton Louise, Pedley Scott M., Edwards David P., Tang Yong, Nakamura Akihiro, Kitching Roger, Dolman Paul M., Woodcock Paul, Edwards Felicity A., Larsen Trond H., Hsu Wayne W., Benedick Suzan, Hamer Keith C., Wilcove David S., Bruce Catharine, Wang Xiaoyang, Levi Taal, Lott Martin, Emerson Brent C., Yu Douglas W. Reliable, verifiable and efficient monitoring of biodiversity via metabarcoding. Ecology Letters. 2013;16(10):1245–1257. doi: 10.1111/ele.12162. [DOI] [PubMed] [Google Scholar]
  35. Klein Janet R., Reger Richard D. A late Pleistocene megafauna, Kenai Peninsula, southcentral Alaska. https://www.alaskaanthropology.org/product/volume-131-2015-pdf/ Alaska Journal of Anthropology. 2015;13(1):57–68. [Google Scholar]
  36. Lawrence Amy Paulson, Bowers Michael A. A test of the ‘hot’ mustard extraction method of sampling earthworms. http://dx.doi.org/10.1016/s0038-0717(01)00211-5. Soil Biology and Biochemistry. 2002;34(4):549–552. doi: 10.1016/s0038-0717(01)00211-5. [DOI] [Google Scholar]
  37. Leray Matthieu, Yang Joy Y, Meyer Christopher P, Mills Suzanne C, Agudelo Natalia, Ranwez Vincent, Boehm Joel T, Machida Ryuji J. A new versatile primer set targeting a short fragment of the mitochondrial COI region for metabarcoding metazoan diversity: application for characterizing coral reef fish gut contents. http://dx.doi.org/10.1186/1742-9994-10-34. Frontiers in Zoology. 2013;10(1):34. doi: 10.1186/1742-9994-10-34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Malloch J. R. Descriptions of new North American Anthomyiidae (Diptera) http://www.biodiversitylibrary.org/part/70436 Transactions of the American Entomological Society. 1920;46(2):133–196. [Google Scholar]
  39. Mannerheim G. C. G. Dritter nachtrag zur kaefer-fauna der Nord-Amerikanischen laender des Russichen Reiches. Bulletin de la Société Impériale des Naturalistes de Moscou. 1853;26:95–273. [Google Scholar]
  40. Marshall S. A., Anderson R. S., Roughley R. E., Behan-Pelletier V. M., Danks H. V. Terrestrial arthropod biodiversity: planning a study and recommended sampling techniques. http://www.biology.ualberta.ca/bsc/briefs/brterrestrial.htm Supplement to the Bulletin of the Entomological Society of Canada. 1994;26(1):1–33. [Google Scholar]
  41. McKendrick J. D., Bleicher D. P. Observations of a grass bug on native bluejoint ranges. http://hdl.handle.net/11122/1675 Agroborealis. 1980;12(1):15–18. [Google Scholar]
  42. Meierotto Sarah, Sikes Derek S. The DNA barcoding UAMU Project: Testing the insect identification power of DNA barcoding technology. http://www.akentsoc.org/doc/AKES_newsletter_2015_I.pdf Newsletter of the Alaska Entomological Society. 2015;8(1):14–17. [Google Scholar]
  43. Meier Rudolf, Wong Winghing, Srivathsan Amrita, Foo Maosheng. $1 DNA barcodes for reconstructing complex phenomes and finding rare species in specimen-rich samples. Cladistics. 2015;32(1):100–110. doi: 10.1111/cla.12115. [DOI] [PubMed] [Google Scholar]
  44. Morgan M., Anders S., Lawrence M., Aboyoun P., Pages H., Gentleman R. ShortRead: a bioconductor package for input, quality assessment and exploration of high-throughput sequence data. http://dx.doi.org/10.1093/bioinformatics/btp450. Bioinformatics. 2009;25(19):2607–2608. doi: 10.1093/bioinformatics/btp450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Ratnasingham Sujeevan, Hebert Paul D. N. BOLD: the Barcode of Life Data System (http://www.barcodinglife.org) http://dx.doi.org/10.1111/j.1471-8286.2007.01678.x. Molecular Ecology Notes. 2007;7(3):355–364. doi: 10.1111/j.1471-8286.2007.01678.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Ratnasingham Sujeevan, Hebert Paul D. N. A DNA-based registry for all animal species: he Barcode Index Number (BIN) system. PLoS ONE. 2013;8(7):e66213. doi: 10.1371/journal.pone.0066213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Team R Core. R Foundation for Statistical Computing; 2015. [2015-08-14T00:00:00+03:00]. R: a language and environment for statistical computing. 3.2.2. [Google Scholar]
  48. Reynolds John W. The earthworms (Lumbricidae and Sparganophilidae) of Ontario. Royal Ontario Museum; Toronto, Ontario: 1977. ix + 141. [DOI] [Google Scholar]
  49. Rognes Torbjørn, Flouri Tomáš, Nichols Ben, Quince Christopher, Mahé Frédéric. VSEARCH: a versatile open source tool for metagenomics. PeerJ. 2016;4:e2584. doi: 10.7717/peerj.2584. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Saltmarsh Deanna Marie, Bowser Matthew L., Morton John M., Lang Shirley, Shain Daniel, Dial Roman. Distribution and abundance of exotic earthworms within a boreal forest system in southcentral Alaska. http://dx.doi.org/10.3897/neobiota.28.5503. NeoBiota. 2016;28:67–86. doi: 10.3897/neobiota.28.5503. [DOI] [Google Scholar]
  51. Planning Scenarios Network for Arctic, lab EWHALE. Predicting Future Potential Climate-Biomes for the Yukon, Northwest Territories, and Alaska. University of Alaska Fairbanks; Fairbanks, Alaska: 2012. 105. [Google Scholar]
  52. Schotzko D. J., O'Keeffe L. E. Comparison of sweep net., D-Vac., and absolute sampling., and diel variation of sweep net sampling estimates in lentils for pea aphid (Homoptera: Aphididae), nabids (Hemiptera: Nabidae), lady beetles (Coleoptera: Coccinellidae), and lacewings (Neuroptera: Chrysopidae) http://jee.oxfordjournals.org/content/82/2/491. Journal of Economic Entomology. 1989;82(2):491–506. doi: 10.1093/jee/82.2.491. [DOI] [Google Scholar]
  53. Sherriff Rosemary L., Berg Edward E., Miller Amy E. Climate variability and spruce beetle (Dendroctonus rufipennis) outbreaks in south-central and southwest Alaska. Ecology. 2011;92(7):1459–1470. doi: 10.1890/10-1118.1. [DOI] [PubMed] [Google Scholar]
  54. Shokralla Shadi, Gibson Joel F., Nikbakht Hamid, Janzen Daniel H., Hallwachs Winnie, Hajibabaei Mehrdad. Next-generation DNA barcoding: using next-generation sequencing to enhance and accelerate DNA barcode capture from single specimens. Molecular Ecology Resources. 2014;14(5):892–901. doi: 10.1111/1755-0998.12236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Shokralla Shadi, Gibson Joel, King Ian, Baird Donald, Janzen Daniel, Hallwachs Winnie, Hajibabaei Mehrdad. Environmental DNA barcode sequence capture: targeted, PCR-free sequence capture for biodiversity analysis from bulk environmental samples. http://www.biorxiv.org/content/early/2016/11/13/087437. bioRxiv. 2016;n/a doi: 10.1101/087437. [DOI] [Google Scholar]
  56. Shorthouse Joseph D., Larson David J. Introduction to the grasslands and grassland arthropods of Canada. In: Shorthouse J. D., Floate K. D., editors. Arthropods of Canadian Grasslands (Volume 1): Ecology and Interactions in Grassland Habitats. Biological Survey of Canada; 2010. 1-24. [DOI] [Google Scholar]
  57. Sikes D. S., Bowser M., Morton J. M., Bickford C. Building a DNA barcode library of Alaska’s nonmarine arthropods. Genome. in press;NA doi: 10.1139/gen-2015-0203. [DOI] [PubMed] [Google Scholar]
  58. Skinner Q., Wright S., Henszey R., Henszey J., Wyman S. A Field Guide to Alaska Grasses. Education Resources Publishing; Cumming, Georgia: 2012. xix + 384. [Google Scholar]
  59. Spafford Ryan D., Lortie Christopher J. Sweeping beauty: is grassland arthropod community composition effectively estimated by sweep netting? Ecology and Evolution. 2013;3(10):3347–3358. doi: 10.1002/ece3.688. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Tande Gerald, Lipkin Robert. Wetland Sedges of Alaska. Alaska Natural Heritage Program, Environmental and Natural Resources Institute, University of Alaska Anchorage; Anchorage, Alaska: 2003. 138. [Google Scholar]
  61. Teraguchi S., Stenzel J., Sedlacek J., Deininger R. Arthropod-grass communities: comparison of communities in Ohio and Alaska. http://www.jstor.org/stable/2844592. Journal of Biogeography. 1981;8(1):53. doi: 10.2307/2844592. [DOI] [Google Scholar]
  62. Timm Tarmo. Distribution of freshwater oligochaetes in the west and east coastal regions of the North Pacific Ocean. In: Healy B. M., Reynoldson T. B., Coates K. A., editors. Aquatic Oligochaetes: Proceedings of the 7th International Symposium on Aquatic Oligochaetes held in Presque Isle, Maine, USA, 18–22 August 1997. Springer Netherlands; Dordrecht: 1999. [DOI] [Google Scholar]
  63. Viereck Leslie A., Dyrness C. T., Batten A. R., Wenzlick K. J. The Alaska Vegetation Classification. U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station; Portland, Oregon: 1992. 278. [Google Scholar]
  64. Welsh S. L. Anderson's Flora of Alaska. Brigham Young University Press; Provo, Utah: 1974. xvi + 724. [Google Scholar]
  65. Zhang J., Kobert K., Flouri T., Stamatakis A. PEAR: a fast and accurate Illumina Paired-End reAd mergeR. http://dx.doi.org/10.1093/bioinformatics/btt593. Bioinformatics. 2013;30(5):614–620. doi: 10.1093/bioinformatics/btt593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Zhou Xin, Li Yiyuan, Liu Shanlin, Yang Qing, Su Xu, Zhou Lili, Tang Min, Fu Ribei, Li Jiguang, Huang Quanfei. Ultra-deep sequencing enables high-fidelity recovery of biodiversity for bulk arthropod samples without PCR amplification. GigaScience. 2013;2(1) doi: 10.1186/2047-217x-2-4. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary material 1

Vegetation data

Matthew L. Bowser, John M. Morton

Data type: occurrences

Brief description: Observation-based occurrences of vascular plant species. Dates are given in ISO 8601 format.

File: oo_106140.xlsx

bdj-05-e10792-s001.xlsx (21.2KB, xlsx)
Supplementary material 2

Earthworm specimen data

Matthew L. Bowser, John M. Morton

Data type: occurrences

Brief description: Earthworm specimen data. Dates are given in ISO 8601 format.

File: oo_106202.xlsx

bdj-05-e10792-s002.xlsx (11.5KB, xlsx)
Supplementary material 3

Arthropod sight identification occurrences

Matthew L. Bowser

Data type: Occurrence

Brief description: Arthropod specimen counts by sight identification and sample. Columns labeled KNWR:Ento:10838–KNWR:Ento:10847 are GUIDs of corresponding records on Arctos.

File: oo_90113.xlsx

bdj-05-e10792-s003.xlsx (12.9KB, xlsx)
Supplementary material 4

Cluster identification data from metagenomic analysis

Matthew L. Bowser

Data type: Occurrences

Brief description: GUID: Arctos globally unique identifiers for the arthropod samples. Cluster label: illumina labels of centroid sequence clusters. Read count: cluster read counts. Process id: BOLD process IDs for matched database sequences. Similarity: similarity value from VSearch search. BIN: BOLD Barcode Index Numbers. Nucleotides: cluster centroid sequences.

File: oo_95375.xlsx

bdj-05-e10792-s004.xlsx (73.7KB, xlsx)
Supplementary material 5

Read counts by species and samples

Matthew L. Bowser

Data type: occurrences

Brief description: Arthropod occurrence data from the metagenomic analysis expressed as read counts. BIN: BOLD Barcode Index Number. Columns labeled KNWR:Ento:10838–KNWR:Ento:10847 are GUIDs of corresponding specimen records on Arctos.

File: oo_95376.xlsx

bdj-05-e10792-s005.xlsx (16.3KB, xlsx)

Articles from Biodiversity Data Journal are provided here courtesy of Pensoft Publishers

RESOURCES