Skip to main content
NCBI home page
BioMed Research International logoLink to BioMed Research International
. 2017 Mar 9;2017:9584703. doi: 10.1155/2017/9584703

Inhibition of Pseudomonas aeruginosa Biofilm Formation by Traditional Chinese Medicinal Herb Herba patriniae

Bo Fu 1, Qiaolian Wu 1, Minyan Dang 1, Dangdang Bai 1, Qiao Guo 1, Lixin Shen 1,*, Kangmin Duan 1,2,*
PMCID: PMC5362711  PMID: 28377931

Abstract

New antimicrobial agents are urgently needed to treat infections caused by drug-resistant pathogens and by pathogens capable of persisting in biofilms. The aim of this study was to identify traditional Chinese herbs that could inhibit biofilm formation of Pseudomonas aeruginosa, an important human pathogen that causes serious and difficult-to-treat infections in humans. A luxCDABE-based reporter system was constructed to monitor the expression of six key biofilm-associated genes in P. aeruginosa. The reporters were used to screen a library of 36 herb extracts for inhibitory properties against these genes. The results obtained indicated that the extract of Herba patriniae displayed significant inhibitory effect on almost all of these biofilm-associated genes. Quantitative analysis showed that H. patriniae extract was able to significantly reduce the biofilm formation and dramatically altered the structure of the mature biofilms of P. aeruginosa. Further studies showed H. patriniae extract decreased exopolysaccharide production by P. aeruginosa and promoted its swarming motility, two features disparately associated with biofilm formation. These results provided a potential mechanism for the use of H. patriniae to treat bacterial infections by traditional Chinese medicines and revealed a promising candidate for exploration of new drugs against P. aeruginosa biofilm-associated infections.

1. Introduction

Pseudomonas aeruginosa is a remarkably adaptive bacterial pathogen which can cause persistent infections in burn patients, immune-compromised patients, and individuals with the genetic disease cystic fibrosis. It is one of the most prevalent nosocomial pathogens, and the infections caused by P. aeruginosa can be very serious and life-threatening [1].

Biofilm formation is a major characteristic of P. aeruginosa chronic infections [2, 3]. P. aeruginosa cells in biofilms are surrounded by exopolysaccharides and form a structured aggregates, and these cells exhibit increased resistance to antibiotics and other adversary agents [3–6]. Infections caused by biofilm-forming P. aeruginosa, such as those in cystic fibrosis lung, are almost impossible to eradicate [7]. There is an urgent need to find novel antimicrobial agents to control such infections [8, 9].

Traditional Chinese medicines (TCMs) have been widely used to treat infectious diseases for more than a thousand years in China. Many components constituents of TCMs have been found to be very effective in treating bacterial infections such as gastritis, stomatitis, dermatitis, and bacterial pneumonia [10]. However, the mechanisms of these herbs in treatment infectious diseases are mostly unknown.

Herba patriniae is a perennial herbal of TCM, which contains various beneficial ingredients such as amino acids, vitamins, minerals, alkaloids, tannins, and saponins. It has been reported to have functions of antioxidant, antibacterial, antiviral, blood-activating and stasis-eliminating, promoting regeneration of liver cells, and anxiety-alleviating. The boiling water extracts of H. patriniae had been identified having anticyanobacteria activity against Microcystis aeruginosa [11].

In this study, 36 extracts of 18 Chinese herbs that are commonly used for treating infection-like symptoms were screened for inhibitory effect against P. aeruginosa biofilms. We found that the extract of the Chinese herb H. patriniae significantly inhibited the expression of the genes associated with biofilm formation in P. aeruginosa PAO1. It reduced exopolysaccharide production and biofilm formation and then altered the structure of the mature biofilms.

2. Materials and Methods

2.1. Bacterial Strains and Culture Conditions

Bacterial strains used in this study are listed in Table 1. All the strains were cultured in LB (Luria Bertani) broth at 37°C with orbital shaking at 200 rpm or on LB agar plates supplemented with antibiotic of kanamycin (Kan, 50 μg/mL) or trimethoprim (Tmp, 300 μg/mL) where appropriate.

Table 1.

Bacterial strains used in this study.

Strains/plasmids Description Source
E. coli DH10B F-mcrA(mrr-hsdRMS-mcrBC)80dlacZ ΔM15ΔlacX74 deoR
recA1 endA1 araD139 Δ(ara leu)7697 galU galKλ-rpsl nupG		 Invitrogen
P. aeruginosa PAO1 Wild type This lab
pMS402 Expression reporter plasmid carrying the promoterless
luxCDABE; Kanr, Tmpr 		This lab
pKD-pslM pMS402 containing pslM promoter region; Kanr, Tmpr This study
pKD-pelA pMS402 containing pelA promoter region; Kanr, Tmpr This study
pKD-algU pMS402 containing algU promoter region; Kanr, Tmpr This study
pKD-ppyR pMS402 containing ppyR promoter region; Kanr, Tmpr This study
pKD-algA pMS402 containing algA promoter region; Kanr, Tmpr This study
pKD-bdlA pMS402 containing bdlA promoter region; Kanr, Tmpr This study
Open in a new tab

2.2. Traditional Chinese Medicine Extraction

Traditional Chinese medicinal herbs were selected according to their efficacy in treatment of infection-like symptoms in Chinese medicine. They were obtained from local pharmacy (Yikang Pharm chain store, China). The pulverized herb was firstly immerged in 75% ethanol or deionized water, respectively, for 2 h and then boiled for 2 h additionally (weight to solvent volume was 1 : 5). The extracts were filtered by filter paper and were evaporated under vacuum at 35°C using a rotary evaporator (Buchi, Switzerland). The concentrated extracts were then freeze-dried using a lyophilizer and stored at −80°C. The water extracts were redissolved in deionized water and ethanol extracts were redissolved in methanol and then sterilized immediately with 0.22 μm Iwaki filter before use.

2.3. Gene Expression Assay

Key genes algU [12], pslM [13, 14], pelA [15], algA [16], ppyR [17], and bdlA [18] that are known to be involved in biofilm formation in P. aeruginosa were selected to construct luxCDABE-based promoter-reporter fusions (Table 2). The reporters were constructed as previously described [19, 20] and were subsequently transformed into PAO1. Using luxCDABE-based reporters, gene expression in liquid cultures was measured by light luminescence (in counts per second) in a Victor3 multilabel plate reader (Perkin-Elmer). Strains containing different reporters were cultivated overnight in LB broth supplemented with Tmp (300 μg/mL) and then diluted to an optical density at 600 nm of 0.2. The diluted cultures were used as inoculants. After additional 2 h incubation, 5 μL cultures were inoculated into parallel wells on a 96-well black plate containing 93 μL medium and 2 μL herbal extract in different concentrations. 50 μL mineral oil was added to the wells to prevent evaporation. Promoter activities were measured every 30 min for 24 h in a Victor multilabel plate reader and bacterial growth was monitored by measuring OD600 at the same time.

Table 2.

Reporter genes and primer sequences used.

PA 
number		 Gene Function Primer Sequence (5′ → 3′)
PA0762 algU RNA polymerase sigma factor pKD-algU-S GCACTCGAGAGGATGCCTGAAGACCTC
pKD-algU-A GTAGGATCCGATGGCGATCCGATACAG
PA2243 pslM Succinate dehydrogenase;
fumarate reductase flavoprotein		 pKD-pslM-S ATCCTCGAGCGGTGCGCAAGAAGACC
pKD-pslM-A GTTGGATCCCGTAACGCTCGCCCAGTT
PA3064 pelA Glycoside hydrolase;
deacetylase		 pKD-pelA-S CGTCTCGAGCTTTCCACTTTGCCACAG
pKD-pelA-A TACGGATCCTACCAGAACGCCACGCT
PA3551 algA Phosphomannose isomerase; guanosine 5′-diphospho-D-mannose pyrophosphorylase pKD-algA-S TGACTCGAGTGAAGGCGGACTGAGAC
pKD-algA-A TATGGATCCGCGACCAGTTTCATC
PA2663 ppyR psl and pyoverdine operon regulator pKD-ppyR-S GCACTCGAGCACTTCTTCTGCTACAGC
pKD-ppyR-A GTAGGATCCAGCACTTGCACAGCAGAC
PA1423 bdlA Biofilm dispersion locus A pKD-bdlA-S GCACTCGAGCGTCATATTTCCGACGAA
pKD-bdlA-A TCAGGATCCGTAGTCTTCCGATTGCG
Open in a new tab

2.4. Gene Expression Measurement by Real-Time Quantitative PCR (RT-qPCR)

Bacterial RNA was extracted using RNAprep Pure Cell/Bacteria Kit (TIANGEN). 1 μg of RNA sample was reverse transcribed to cDNA using 1st Strand cDNA Synthesis Kit (Takara). Real-time qPCR was performed using SuperReal PerMix Plus (SYBR Green/probe) (TIANGEN) and primers specific for algU (Forward: 5′-AACACCGCGAAGAACCACCT-3′, Reverse: 5′-ATCTCATCCCGCAACATCGCG-3′), algA (Forward: 5′-AGAACTGAAGAAGCACGACG-3′, Reverse: 5′-TTCTCCATCACCGCGTAGT-3′), pelA (Forward: 5′-ATGGCTGAAGGTATGGCTG-3′, Reverse: 5′-AGGTGCTGGAGGACTTCATC-3′), and pslM (Forward: 5′-CTATGACGCACGGCAACTGG-3′, reverse: 5′-CGCCATTGACCAGGTGCAT-3′). The values obtained were normalized to the housekeeping gene proC (Forward: 5′-CAGGCCGGGCAGTTGCTGTC-3′, reverse: 5′-GGTCAGGCGCGAGGCTGTCT -3′).

2.5. Quantification of the Biofilm Formation

Biofilm formation was measured in 96-well polystyrene microtiter plate as described previously with minor modifications [21]. 10 μL of overnight cultures of PAO1 was added to 90 μL fresh LB broth containing 160 μg H. patriniae water extract. Same volume of deionized water was used as control. After being cultured with shaking at 200 rpm for 1 h the plates were kept at stationary state at 37°C for 3 days and 7 days with a medium replacement at every 24 h interval. Then wells were washed twice with deionized water gently to remove the planktonic cells. The sedentary cells were stained with 1% (v/v) crystal violet solution for 15 min. Unbound dye in the wells were washed off by deionized water before 200 μL of 95% ethanol was added to dissolve the crystal violet stains. The absorbance of the solutions was then measured at 570 nm [7, 22].

2.6. Biofilm Imaging by Silver Staining Method

To examine the biofilm structure, silver staining method was used as described previously with some modifications [23, 24]. Similar to the above described biofilm assay, biofilms were grown on cover slip (8 mm diameter) placed at bottom of the wells of 24-well plates. 200 μL of fresh bacterial culture was inoculated to 1.8 mL TSB supplemented with 3.2 mg H. patriniae. The plates were incubated at 37°C with TSB medium replaced every 24 h. After 3 days or 7 days of cultivation, the cover slip was taken out and washed three times with saline water to remove the planktonic cells. The cover slip was immersed in 2.5% glutaraldehyde for 1 h for the cells fixation and rinsed with distilled water for 1 min. Then the cover slip was immersed in saturated calcium chloride solution for 15 min and rinsed with distilled water for 5 min. The biofilms on the cover slip were then stained with 5% silver nitrate for 15 min, followed by 1% hydroquinone colour-rendering for 2 min and then rinsed with distilled water for 1 min. Fixation was treated with 5% sodium thiosulfate for 1 min, followed by a final water rinse. The cover slip was placed on an inverted optical microscope for biofilm structure observation.

2.7. Swarming Motility Assay

Swarming assay was carried out as previously reported [25]. The medium used for swarming motility assay consists of nutrient broth (0.8%), glucose (0.5%), and agar (0.5%). The plates were dried at room temperature overnight before being used. 2 μL of P. aeruginosa PAO1 culture (OD600 = 0.5) mixed with 106.67 μg of H. patriniae water extract was spotted onto the swarming plate and the one with deionized water was used as blank control. Plates were incubated at 37°C for 24 h before the swarming diameter was measured.

2.8. Measurement of Exopolysaccharide Production

Overnight culture of PAO1 (OD600 = 0.005) was spotted onto Congo red plates (1% Tryptone, 1% agar, 4% Congo red, and 2% Coomassie blue) with or without H. patriniae water extract. The amount of H. patriniae water extract was 64 μg. The colony morphology and staining were observed after 3 days of incubation at 37°C [22].

3. Results and Discussion

3.1. Screening for Herbs with Inhibitory Effect on P. aeruginosa Biofilm-Associated Genes

Eighteen traditional Chinese medicinal herbs were selected because of their common usage for infection-like symptoms. Both boiling water extracts and ethanol extracts were obtained and used to screen for antibiofilm activities. Since P. aeruginosa biofilm formation is directly associated with the activity of several known genes, we constructed luxCDABE-based reporters to examine the effect of herb extracts on these genes. The effects of the crude extracts on the expression of these biofilm-associated genes (algU, pslM, pelA, algA, ppyR, and bdlA) are presented in Table 3. The results indicate that different herbal extracts exhibited various degrees of inhibitory effects on these genes. The water extract of H. patriniae showed the most significant effect on the expression of algU, algA, pslM, and bdlA. Examples of the gene expression profiles in the presence of H. patriniae are shown in Figure 1.

Table 3.

Effect of water and ethanolic herb extracts on biofilm-associated genes expression.

The English name of herbs Water extract The English name of herbs Ethanolic extract
algU pslM pelA algA ppyR bdlA algU pslM pelA algA ppyR bdlA
Atractylodes lancea +1.5 0 −2.5 0 0 0 Atractylodes lancea 0 0 0 0 0 0
Cortex fraxini 0 −3 −1.5 −1 0 0 Cortex fraxini −1.8 −2.5 −0.5 −1.5 0 0
Cyrtomium fortunei 0 −1.5 −2 −1 0 0 Cyrtomium fortunei 0 0 0 0 0 0
Erodium stephanianum Willd. a a a a a a Erodium stephanianum willd a a a a a a
Folium artemisiae Argyi −2 0 −2 0 −1.5 0 Folium artemisiae argyi 0 0 −2 0 −1.5 0
Fructus quisqualis a a a a a a Fructus quisqualis a a a a a a
Herba agrimoniae a a a a a a Herba agrimoniae a a a a a a
Herba patriniae −2 −2.5 −0.5 −2.5 0 −2 Herba patriniae 0 0 0 0 −1.5 −1
Herba scutellariae barbatae 0 0 0 −1 0 0 Herba scutellariae barbatae 0 0 0 0 0 −1.5
Pomegranate rind −1.5 −1.2 0 −1 0 0 Pomegranate rind −1.5 −1 −1 −0.5 0 0
Portulacae herba +1 0 0 +1.5 0 0 Portulacae herba 0 0 0 0 0 0
Radix paeoniae −0.5 −0.5 0 0 −1 0 Radix paeoniae 0 0 0 0 0 0
Radix sanguisorbae −1.5 −1 −1.5 −1 −0.5 0 Radix sanguisorbae −1.6 −1.5 0 0 −0.5 0
Radix lithospermi 0 −1.2 −2 0 −1 0 Radix lithospermi 0 0 0 0 0 0
Scrophulariae −2 +1.5 0 0 0 0 Scrophulariae −0.5 0 −1 0 0 0
Smoked plum a a a a a a Smoked plum a a a a a a
Taraxacum mongolicum 0 0 0 0 0 0 Taraxacum mongolicum 0 +2 0 0 0 0
Tripterygium −1.5 0 −2.5 0 0 0 Tripterygium 0 0 −2 0 −2.5 0
Open in a new tab

Note: herbal extracts were used at 1.6 mg/mL. The values shown represent maximal inhibition (fold changes between experiments with and without herb extract). “+” represents induction of gene expression by herb extracts; “−” represents inhibition of biofilm gene expression by herb extracts; “0” represents no effect of biofilm gene expression by herb extracts; “a” represents inhibition of the growth of bacteria. Numbers represent fold changes at the time points where maximal expression was reached in the absence of herbal extract.

Figure 1.

Figure 1

Open in a new tab

Expressions of algU, algA, pslM, and bdlA in medium with water extract of Herba patriniae. Expressions of algU (a), algA (b), pslM (c), and bdlA (d) in medium (total volume of 100 μL) with 160 μg H. patriniae extract and the controls were the ones without herbal extract.

To confirm the results obtained from the lux-based reporter assay, real-time qPCR was carried out using bacterial RNA samples isolated in the presence and absence of H. patriniae. The results are shown in Table 4. In agreement with the results from the reporter assay, the mRNA levels of algU, algA, pslM, and bdlA in PAO1 were all significantly decreased in the presence of H. patriniae extract (at 1.6 mg/mL) compared with those in the absence of H. patriniae extract. It is noted that the inhibition of algU and algA was more pronounced in the qPCR assay.

Table 4.

The transcriptional levels of selected genes in PAO1 and PAO1 treated with H. patriniae.

Gene Relative mRNA level determined by ΔCt calculation
Without H. patriniae With H. patriniae P value
algU 1.00 0.192 0.014
algA 1.00 0.090 0.011
pslM 1.00 0.695 0.043
bdlA 1.00 0.412 0.036
Open in a new tab

Note: the mRNA level of each gene was normalized to that of proC. The values shown represent the mean of three different tests.

The results indicate that many of these herbs have an inhibitory effect on the genes associated with biofilm formation in P. aeruginosa. This is somewhat not surprising because they all have been used for treatment of chronic bacterial infections in traditional Chinese medicine.

The effect from the water extract of H. patriniae was remarkable as it inhibited five genes tested. It has been reported that the herb had antibacterial and antiviral activity. However, it was noted that the water extract did not inhibit the growth of P. aeruginosa (Figure 1). Even though conventional antibiotic compounds may exist in H. patriniae against other bacteria, this result indicates no such component was present against P. aeruginosa, at least not at the concentrations used in our experiments.

Lacking of bacterial killing or growth inhibition activity, however, may not be a weakness of such herbs in treating infectious diseases. As discussed in previous reports [26–29], a promising new class of antipathogenic drugs that target virulence factors and/or biofilm formation instead of killing the pathogens has many advantages in clinical use. First, these antipathogenic drugs theoretically are less likely to render drug resistance in the pathogens because they do not assert a selective pressure on the pathogen's survival. Second, such therapeutics would unlikely affect other nonpathogenic or beneficial bacteria, that is, the microbiome in the host.

3.2. Extract of H. patriniae Inhibits P. aeruginosa Biofilm Formation

From the gene expression results, the extract of H. patriniae presumably would inhibit the biofilm formation of P. aeruginosa. To verify such an effect, P. aeruginosa biofilm formation was compared in the presence and absence of H. patriniae extract. As shown in Figure 2(a), significantly less biofilm was formed in the presence of the herb extract than that without the extract at the irreversible attachment stage (1 d) and mature stage (3 d and 7 d) after inoculation. The result is in agreement with the gene expression data, suggesting the H. patriniae extract could reduce biofilm formation through inhibiting the genes associated with biofilm formation.

Figure 2.

Figure 2

Open in a new tab

(a) Inhibition of biofilm production of PAO1 by H. patriniae extract. The control did not contain any herb extract. “∗” indicates significant difference between the herb group and the control group (P < 0.05). “∗∗” indicates very significant difference (P < 0.01). (b) Micrographs of biofilms formed with and without H. patriniae. Top row, PAO1 silver stained biofilms in the presence of extract of H. patriniae after 3 days and 7 days of incubation. Bottom row, PAO1 silver stained biofilms without H. patriniae.

Importantly, the addition of the H. patriniae also dramatically altered the structure of the biofilms (Figure 2(b)). It appears that the herb extract prevented the formation of mature biofilms, only allowing P. aeruginosa to form smaller cell clusters. These results indicate that the water extract of H. patriniae indeed was able to inhibit P. aeruginosa biofilm formation.

3.3. Water Extract of H. patriniae Inhibited P. aeruginosa Exopolysaccharide Production

The exopolysaccharide (EPS) matrix is an important component of biofilm structure [30]. We compared the exopolysaccharide production in the presence of H. patriniae extract to those without H. patriniae extract. As shown in Figure 3, P. aeruginosa PAO1 cells produced more EPS shown in red by Congo red staining than the cells with H. patriniae extract. This result indicates that H. patriniae inhibited P. aeruginosa exopolysaccharide production and hence affected biofilm formation.

Figure 3.

Figure 3

Open in a new tab

Photograph of exopolysaccharide production on Congo red plates. (a) Without H. patriniae. (b) With H. patriniae. The colony morphology and staining were observed after 3 days of incubation at 37°C.

3.4. H. patriniae Water Extract Promoted PAO1 Swarming Motility

Upon encountering a surface, the surface-associated behaviors of P. aeruginosa, such as biofilm formation and swarming, are often coregulated [31]. In P. aeruginosa, swarming motility is reversely correlated with biofilm formation. Examination of the swarming motility of PAO1 in the presence and absence of the water extract of H. patriniae showed that H. patriniae promoted P. aeruginosa swarming motility (Figure 4(a)). The diameter of PAO1 grown with 106.67 μg H. patriniae was almost 5.60 cm, while the control was less than 2.0 cm (Figure 4(b)). Considering the reverse relationship between swarming motility and biofilm formation, the enhanced swarming motility by H. patriniae extract could have contributed the inhibition of biofilm formation.

Figure 4.

Figure 4

Open in a new tab

Swarming motility of PAO1. (a) PAO1 grown with H. patriniae was at right; the one without herb was at left. (b) The swarming diameter of PAO1 with H. patriniae, the control was the one without herb. “∗∗” indicates significant difference (P < 0.01).

Taken together, the extract of H. patriniae clearly inhibited the biofilm formation of P. aeruginosa. It inhibited several key genes algU, pslM, pelA, algA, and bdlA that are involved in biofilm formation. H. patriniae reduced exopolysaccharide production and promoted swarming motility. Increased motility may reduce adhesion and enable bacteria to actively escape the biofilm matrix to become planktonic bacteria [13, 31, 32]. As depicted in Figure 5, multiple factors/pathways probably have contributed to the reduction of biofilm formation and the altered biofilm structure in the presence of H. patriniae.

Figure 5.

Figure 5

Open in a new tab

P. aeruginosa biofilm formation and swarming motility in the influence of H. patriniae.

In a time of resistance to multiple antimicrobial agents in pathogenic bacteria being spread, there is an urgent need to develop new antibacterial agents [1, 32]. Drugs against infections that involve biofilms are particularly required. Pathogens in biofilm formation are more resistant to conventional antibiotics and other adversary conditions such as nutritional stress. Biofilms also protect bacterial cells from the activity of host immune response [33, 34].

Traditional Chinese medicines are a valuable source for novel antibacterial agents [35–37]. The inhibitory effect of the water extract of H. patriniae against P. aeruginosa biofilms and biofilm-related phenotypes signifies that H. patriniae is a promising candidate for treatment of infections caused by P. aeruginosa biofilms. It could be used in the way of traditional Chinese medicine or it can be explored for active compounds.

4. Conclusions

Our results indicate H. patriniae extract could significantly inhibit the expression of P. aeruginosa genes associated with biofilm formation, alter the structure, and prevent the formation of mature biofilms. It also decreased exopolysaccharide production and promoted swarming motility. These results provided a potential underlying mechanism for the use of H. patriniae to treat bacterial infections in traditional Chinese medicine and revealed a promising candidate for exploration of new drugs against P. aeruginosa biofilm-associated infections.

Acknowledgments

This work was supported by grants from the NSFC (31570131), NSERC (402943-2011 RGPIN), CPSF (2014M562444), and PCSIRT (IRT 15R55).

Competing Interests

The authors declare that they have no competing interests regarding the publication of this paper.

References

  • 1.Zowawi H. M., Harris P. N. A., Roberts M. J., et al. The emerging threat of multidrug-resistant Gram-negative bacteria in urology. Nature Reviews Urology. 2015;12(10):570–584. doi: 10.1038/nrurol.2015.199. [DOI] [PubMed] [Google Scholar]
  • 2.Bjarnsholt T. The role of bacterial biofilms in chronic infections. APMIS. Supplementum. 2013;(136):1–51. doi: 10.1111/apm.12099. [DOI] [PubMed] [Google Scholar]
  • 3.Rybtke M., Hultqvist L. D., Givskov M., Tolker-Nielsen T. Pseudomonas aeruginosa biofilm infections: community structure, antimicrobial tolerance and immune response. Journal of Molecular Biology. 2015;427(23):3628–3645. doi: 10.1016/j.jmb.2015.08.016. [DOI] [PubMed] [Google Scholar]
  • 4.Head N. E., Yu H. Cross-sectional analysis of clinical and environmental isolates of Pseudomonas aeruginosa: biofilm formation, virulence, and genome diversity. Infection and Immunity. 2004;72(1):133–144. doi: 10.1128/iai.72.1.133-144.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Mah T.-F., Pitts B., Pellock B., Walker G. C., Stewart P. S., O'Toole G. A. A genetic basis for Pseudomonas aeruginosa biofilm antibiotic resistance. Nature. 2003;426(6964):306–310. doi: 10.1038/nature02122. [DOI] [PubMed] [Google Scholar]
  • 6.Whiteley M., Bangera M. G., Bumgarner R. E., et al. Gene expression in Pseudomonas aeruginosa biofilms. Nature. 2001;413(6858):860–864. doi: 10.1038/35101627. [DOI] [PubMed] [Google Scholar]
  • 7.Guo Q., Kong W., Jin S., Chen L., Xu Y., Duan K. PqsR-dependent and PqsR-independent regulation of motility and biofilm formation by PQS in Pseudomonas aeruginosa PAO1. Journal of Basic Microbiology. 2014;54(7):633–643. doi: 10.1002/jobm.201300091. [DOI] [PubMed] [Google Scholar]
  • 8.Rasamiravaka T., Labtani Q., Duez P., El Jaziri M. The formation of biofilms by pseudomonas aeruginosa: a review of the natural and synthetic compounds interfering with control mechanisms. BioMed Research International. 2015;2015:17. doi: 10.1155/2015/759348.759348 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Talbot G. H., Bradley J., Edwards J. E., Jr., Gilbert D., Scheid M., Bartlett J. G. Bad bugs need drugs: an update on the development pipeline from the antimicrobial availability task force of the infectious diseases society of America. Clinical Infectious Diseases. 2006;42(5):657–668. doi: 10.1086/499819. [DOI] [PubMed] [Google Scholar]
  • 10.Guo Q., Jin S., Xiao J., Zhang D., Shen L., Duan K. Inhibition of quorum sensing-associated virulence factors in Pseudomonas aeruginosa PAO1 by Folium artemisiae argyi extract. Journal of Pure and Applied Microbiology. 2013;7(1):261–270. [Google Scholar]
  • 11.Yang J.-D., Hu L.-B., Zhou W., Yin Y.-F., Chen J., Shi Z.-Q. Lysis of Microcystis aeruginosa with extracts from chinese medicinal herbs. International Journal of Molecular Sciences. 2009;10(9):4157–4167. doi: 10.3390/ijms10094157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Bazire A., Shioya K., Soum-Soutéra E., et al. The sigma factor AlgU plays a key role in formation of robust biofilms by nonmucoid Pseudomonas aeruginosa. Journal of Bacteriology. 2010;192(12):3001–3010. doi: 10.1128/jb.01633-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Jackson K. D., Starkey M., Kremer S., Parsek M. R., Wozniak D. J. Identification of psl, a locus encoding a potential exopolysaccharide that is essential for Pseudomonas aeruginosa PAO1 biofilm formation. Journal of Bacteriology. 2004;186(14):4466–4475. doi: 10.1128/jb.186.14.4466-4475.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Ma L., Conover M., Lu H., Parsek M. R., Bayles K., Wozniak D. J. Assembly and development of the Pseudomonas aeruginosa biofilm matrix. PLoS Pathogens. 2009;5(3) doi: 10.1371/journal.ppat.1000354. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Friedman L., Kolter R. Genes involved in matrix formation in Pseudomonas aeruginosa PA14 biofilms. Molecular Microbiology. 2004;51(3):675–690. doi: 10.1046/j.1365-2958.2003.03877.x. [DOI] [PubMed] [Google Scholar]
  • 16.Remminghorst U., Rehm B. H. A. In vitro alginate polymerization and the functional role of Alg8 in alginate production by Pseudomonas aeruginosa. Applied and Environmental Microbiology. 2006;72(1):298–305. doi: 10.1128/AEM.72.1.298-305.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Attila C., Ueda A., Wood T. K. PA2663 (PpyR) increases biofilm formation in Pseudomonas aeruginosa PAO1 through the psl operon and stimulates virulence and quorum-sensing phenotypes. Applied Microbiology and Biotechnology. 2008;78(2):293–307. doi: 10.1007/s00253-007-1308-y. [DOI] [PubMed] [Google Scholar]
  • 18.Morgan R., Kohn S., Hwang S.-H., Hassett D. J., Sauer K. BdlA, a chemotaxis regulator essential for biofilm dispersion in Pseudomonas aeruginosa. Journal of Bacteriology. 2006;188(21):7335–7343. doi: 10.1128/jb.00599-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Duan K., Dammel C., Stein J., Rabin H., Surette M. G. Modulation of Pseudomonas aeruginosa gene expression by host microflora through interspecies communication. Molecular Microbiology. 2003;50(5):1477–1491. doi: 10.1046/j.1365-2958.2003.03803.x. [DOI] [PubMed] [Google Scholar]
  • 20.Liang H., Li N., Dong Z., Surette M. G., Duan K. The YebC family protein PA0964 negatively regulates the Pseudomonas aeruginosa quinolone signal system and pyocyanin production. Journal of Bacteriology. 2008;190(18):6217–6227. doi: 10.1128/JB.00428-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.O'Toole G. A., Kolter R. Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signalling pathways: a genetic analysis. Molecular Microbiology. 1998;28(3):449–461. doi: 10.1046/j.1365-2958.1998.00797.x. [DOI] [PubMed] [Google Scholar]
  • 22.Kong W., Chen L., Zhao J., et al. Hybrid sensor kinase PA1611 in Pseudomonas aeruginosa regulates transitions between acute and chronic infection through direct interaction with RetS. Molecular Microbiology. 2013;88(4):784–797. doi: 10.1111/mmi.12223. [DOI] [PubMed] [Google Scholar]
  • 23.Passariello C., Berlutti F., Selan L., Thaller M. C., Pezzi R. A rapid staining procedure to demonstrate glycocalyx production and bacterial biofilms. New Microbiology. 1994;17(3):225–230. [PubMed] [Google Scholar]
  • 24.Zhao J., Jiang H., Cheng W., et al. The role of quorum sensing system in antimicrobial induced ampC expression in Pseudomonas aeruginosa biofilm. Journal of Basic Microbiology. 2015;55(5):671–678. doi: 10.1002/jobm.201300987. [DOI] [PubMed] [Google Scholar]
  • 25.Liang H., Duan J., Sibley C. D., Surette M. G., Duan K. Identification of mutants with altered phenazine production in Pseudomonas aeruginosa. Journal of Medical Microbiology. 2011;60(1):22–34. doi: 10.1099/jmm.0.022350-0. [DOI] [PubMed] [Google Scholar]
  • 26.Yang S., Guo Q., Duan K. Perspectives on antibacterial activities of traditional Chinese medicine and its potential mechanisms. Chinese Journal of Biochemical and Pharmaceutics. 2016;36(4):15–20. [Google Scholar]
  • 27.Otto M. Quorum-sensing control in Staphylococci—a target for antimicrobial drug therapy? FEMS Microbiology Letters. 2004;241(2):135–141. doi: 10.1016/j.femsle.2004.11.016. [DOI] [PubMed] [Google Scholar]
  • 28.Hauser A. R., Mecsas J., Moir D. T. Beyond antibiotics: new therapeutic approaches for bacterial infections. Clinical Infectious Diseases. 2016;63(1):89–95. doi: 10.1093/cid/ciw200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Wagner S., Sommer R., Hinsberger S., et al. Novel strategies for the treatment of Pseudomonas aeruginosa infections. Journal of Medicinal Chemistry. 2016;59(13):5929–5969. doi: 10.1021/acs.jmedchem.5b01698. [DOI] [PubMed] [Google Scholar]
  • 30.Davies D. G., Parsek M. R., Pearson J. P., Iglewski B. H., Costerton J. W., Greenberg E. P. The involvement of cell-to-cell signals in the development of a bacterial biofilm. Science. 1998;280(5361):295–298. doi: 10.1126/science.280.5361.295. [DOI] [PubMed] [Google Scholar]
  • 31.Caiazza N. C., Merritt J. H., Brothers K. M., O'Toole G. A. Inverse regulation of biofilm formation and swarming motility by Pseudomonas aeruginosa PA14. Journal of Bacteriology. 2007;189(9):3603–3612. doi: 10.1128/JB.01685-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Zhou Y.-M., Shao L., Li J.-A., et al. An efficient and novel screening model for assessing the bioactivity of extracts against multidrug-resistant pseudomonas aeruginosa using caenorhabditis elegans. Bioscience, Biotechnology and Biochemistry. 2011;75(9):1746–1751. doi: 10.1271/bbb.110290. [DOI] [PubMed] [Google Scholar]
  • 33.Ochoa S. A., Cruz-Córdova A., Rodea G. E., et al. Phenotypic characterization of multidrug-resistant Pseudomonas aeruginosa strains isolated from pediatric patients associated to biofilm formation. Microbiological Research. 2015;172:68–78. doi: 10.1016/j.micres.2014.11.005. [DOI] [PubMed] [Google Scholar]
  • 34.Bala M., Gupte S., Aggarwal P., Kaur M., Manhas A. Biofilm producing multidrug resistant Acinetobacter species from a tertiary care hospital: a therapeutic challenge. International Journal of Research in Medical Sciences. 2016;4(7):3024–3026. doi: 10.18203/2320-6012.ijrms20161997. [DOI] [Google Scholar]
  • 35.Anani K., Adjrah Y., Ameyapoh Y., et al. Effects of hydroethanolic extracts of Balanites aegyptiaca (L.) Delile (Balanitaceae) on some resistant pathogens bacteria isolated from wounds. Journal of Ethnopharmacology. 2015;164:16–21. doi: 10.1016/j.jep.2015.01.051. [DOI] [PubMed] [Google Scholar]
  • 36.Marasini B. P., Baral P., Aryal P., et al. Evaluation of antibacterial activity of some traditionally used medicinal plants against human pathogenic bacteria. BioMed Research International. 2015;2015:6. doi: 10.1155/2015/265425.265425 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Zuo G. Y., Wang G. C., Zhao Y. B., et al. Screening of Chinese medicinal plants for inhibition against clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA) Journal of Ethnopharmacology. 2008;120(2):287–290. doi: 10.1016/j.jep.2008.08.021. [DOI] [PubMed] [Google Scholar]

Articles from BioMed Research International are provided here courtesy of Wiley

RESOURCES