Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2017 Apr 3;114(16):4219–4224. doi: 10.1073/pnas.1615970114

Trio-based exome sequencing arrests de novo mutations in early-onset high myopia

Zi-Bing Jin a,1,2, Jinyu Wu b,1, Xiu-Feng Huang a, Chun-Yun Feng a, Xue-Bi Cai a, Jian-Yang Mao a, Lue Xiang a, Kun-Chao Wu a, Xueshan Xiao c, Bethany A Kloss d, Zhongshan Li b, Zhenwei Liu b, Shenghai Huang a, Meixiao Shen a, Fei-Fei Cheng a, Xue-Wen Cheng a, Zhi-Li Zheng a, Xuejiao Chen a, Wenjuan Zhuang e, Qingjiong Zhang c, Terri L Young d, Ting Xie f, Fan Lu a,2, Jia Qu a,2
PMCID: PMC5402409  PMID: 28373534

Significance

Because preschool children encounter fewer risks from environmental pressures, we propose that the condition of early-onset high myopia (EOHM) is driven by a genetic predisposition more than by environmental factors. In this study, we recruited 18 familial trios to decipher the genetic predisposition using whole-exome sequencing. We identified a cluster of unique genes linked to EOHM, as well as mutations in the reported genes. Notably, we showed that both rare inherited mutations and de novo mutations significantly contributed to EOHM. Expression profiling in ocular tissues and mutant mouse phenotyping demonstrated the pathogenicity of mutations in a unique gene, BSG. Our results provide insights into the genetic basis and molecular mechanisms of childhood high myopia.

Keywords: early-onset high myopia, de novo mutations, BSG, rare inherited mutations

Abstract

The etiology of the highly myopic condition has been unclear for decades. We investigated the genetic contributions to early-onset high myopia (EOHM), which is defined as having a refraction of less than or equal to −6 diopters before the age of 6, when children are less likely to be exposed to high educational pressures. Trios (two nonmyopic parents and one child) were examined to uncover pathogenic mutations using whole-exome sequencing. We identified parent-transmitted biallelic mutations or de novo mutations in as-yet-unknown or reported genes in 16 probands. Interestingly, an increased rate of de novo mutations was identified in the EOHM patients. Among the newly identified candidate genes, a BSG mutation was identified in one EOHM proband. Expanded screening of 1,040 patients found an additional four mutations in the same gene. Then, we generated Bsg mutant mice to further elucidate the functional impact of this gene and observed typical myopic phenotypes, including an elongated axial length. Using a trio-based exonic screening study in EOHM, we deciphered a prominent role for de novo mutations in EOHM patients without myopic parents. The discovery of a disease gene, BSG, provides insights into myopic development and its etiology, which expands our current understanding of high myopia and might be useful for future treatment and prevention.


Myopia is the most common ocular disease, with an increasing global prevalence, especially in East Asia (1–3). Uncorrected myopia is the leading cause of vision impairment worldwide, according to a report by the World Health Organization (4). High myopia (HM) is very severe myopia, which is defined as less than or equal to −6.00 diopters (D) (5). HM is clinically associated with severe ocular complications, such as macular degeneration, retinal detachment, cataract, and glaucoma, which make HM the leading cause of irreversible blindness in East Asia (1, 6).

Myopia is etiologically heterogeneous because both environmental factors and genetic factors are involved (1, 7). Epidemiological surveys show that outdoor activity reduces the prevalence of myopia, decreasing the risk of myopia associated with short-distance work (8, 9). Myopia often exhibits apparent familial aggregation (10–12), and the number of myopic parents is significantly correlated with myopic onset and progression in children (13). Twin studies and population-based epidemiological investigations show that genetic factors significantly contribute to the development of myopia (6, 14, 15), particularly HM (5). Genome-wide association studies (GWAS) and subsequent metaanalyses have identified dozens of loci and genes that are associated with general myopia or HM (16, 17). Of note, the identified genetic contributions of the dozens of loci and genes to myopia are very limited. To date, based on pedigree studies with next-generation sequencing, several disease-causing genes have been discovered, including two recessive genes, LRPAP1 (18) and LEPREL1 (19); four dominant genes, ZNF644 (20), SCO2 (21), SLC39A5 (22), and P4HA2 (23); and one X-linked gene, ARR3 (24). However, a large-scale screening of these genes in HM cohorts provided evidence that only a small proportion (<5%) of HM patients harbor mutations in these known genes, which can be attributed to as-yet-unidentified causative genes (25).

Because preschool children encounter fewer risks from environmental pressures, we proposed that the condition of early-onset high myopia (EOHM) is driven by a genetic predisposition more than by environmental factors. In this study, we recruited 18 familial trios (healthy parents and an EOHM child) to decipher the genetic predisposition using whole-exome sequencing (WES). We identified a cluster of unique genes linked to EOHM, as well as mutations in the reported genes. Notably, we showed that both rare inherited mutations and de novo mutations significantly contributed to EOHM. Expression profiling in ocular tissues and mutant mouse phenotyping demonstrated the pathogenicity of the mutations in a unique gene, BSG. Our results provide insights into the genetic basis and molecular mechanisms of childhood HM.

Results

EOHM Samples and WES.

In this study, we recruited a cohort of 54 individuals, including 18 children with EOHM and their unaffected parents. The ages at examination of all probands were less than 6, indicating EOHM. The refraction of each patient was less than or equal to −6.00 diopters (D) (Table S1).

Table S1.

The clinical information of 18 probands

Subject Age, y Sex Refractive errors (DS) BCVA Parents’ reproductive age
OD OS OD OS Father Mother
H1 5 M 6.00 6.00 0.70 0.70 34 32
H5 5 F 6.00 6.00 0.60 0.60 33 31
H9 6 M 7.00 6.50 0.90 0.90 28 26
H13 6 F 9.00 8.50 0.60 0.60 36 34
H16 6 F 9.00 8.00 0.90 0.90 27 25
H22 5 M 6.00 6.00 0.30 0.30 31 29
H25 3 F 10.00 11.00 0.80 0.80 28 27
H29 3 M 7.00 8.00 0.20 0.20 32 31
H33 6 F 9.00 7.50 0.30 0.50 27 26
H39 6 M 8.75 8.75 0.80 0.80 29 27
H42 4 M 11.50 9.00 0.40 0.50 34 29
H45 4 M 8.00 8.50 0.50 0.50 36 33
H53 5 M 7.50 6.50 0.40 0.40 32 29
H60 4 F 10.00 10.00 0.80 0.80 26 25
H63 4 F 10.00 10.50 0.50 0.50 27 27
H66 5 M 7.00 6.50 0.30 0.30 28 25
H70 2 M 6.00 6.00 0.80 0.80 31 29
H74 6 M 6.00 6.00 0.80 0.80 24 23

Abbreviations are as follows: BCVA, best-corrected visual acuity; DS, diopters; F, female; M, male; ND, not determined; OD, right eye; and OS, left eye.

WES was performed for all probands and the parents of the 18 trios to investigate the genetic basis. Burrows–Wheeler transform (26) and Genome Analysis Toolkit (GATK) (27) were used for the data analyses. The detailed statistical information of the WES data from the 18 HM trios is summarized in the Table S2.

Table S2.

Detailed statistic information of the WES data from the 18 HM trios

Sample Raw_data, Mb Clean_data, Mb Aligned, % Total effective yield, Mb Effective sequence on target, Mb Capture rate, % Sequencing depth >4X, % >10X, % >20X, % Duplication rate, %
H1 6,188.57 6,158.08 99.68 5,674.2 3,159.74 55.7 62.97 96.6 93.5 85.8 5.6547
H1F 4,290.07 4,270.19 99.63 3,948.61 2,176.68 55.1 43.38 95.9 90.9 77.8 5.2961
H1M 5,069.07 5,027.3 99.57 4,302.98 2,595.41 60.3 51.72 95.8 91.3 81 12.1196
H5 8,687.68 8,636.75 99.6 7,686.4 4,291.06 55.8 85.52 97.1 95.1 90.3 9.4936
H5F 6,864.29 6,820.95 99.77 6,190.2 3,541.41 57.2 70.58 96.8 94.1 87.6 2.1401
H5M 5,381.27 5,347.96 99.55 4,889.87 2,721.99 55.7 54.25 96.3 92.2 82.5 6.1083
H9 4,986.87 4,960.22 99.56 4,542.39 2,545.39 56 50.73 95.9 91.1 80.1 5.7649
H9F 5,539.92 5,506.2 99.55 5,019.89 2,819.93 56.2 56.2 96.1 92 82.5 6.4125
H9M 5,523.98 5,494.43 99.55 5,061.34 2,804.32 55.4 55.89 96.1 91.9 82.4 5.4215
H13 4,966.37 4,941.25 99.6 4,609.03 2,561.1 55.6 51.04 96 91.5 81 4.4622
H13F 5,236.36 5,209.61 99.59 4,767.53 2,721.79 57.1 54.24 96.2 92 82.2 6.1021
H13M 5,240.13 5,215.06 99.64 4,790.69 2,715.17 56.7 54.11 96.3 92.5 83 5.8597
H16 6,074.89 6,040.94 99.62 5,479.63 3,163.31 57.7 63.04 96.4 93 85.3 6.9266
H16F 6,306.13 6,275 99.61 5,757.15 3,231.67 56.1 64.4 96.6 93.5 85.9 5.6811
H16M 7,661.89 7,623.89 99.6 6,960.67 3,824.79 54.9 76.22 96.9 94.5 88.7 6.3291
H22 7,848.02 7,810.16 99.54 7,190.29 4,397.35 61.2 87.36 96.4 94.2 89.4 5.3947
H22F 10,038.38 9,990.12 99.58 9,206.96 5,609.92 60.9 111.45 96.8 95.1 91.5 5.4212
H22M 5,813.61 5,785.37 99.58 5,339.18 3,269.65 61.2 64.96 95.7 92.3 84.8 5.3391
H25 3,678.21 3,661.09 99.85 3,385.18 1,920.69 56.7 38.28 95.7 89.8 74.6 5.3405
H25F 4,277.34 4,257.23 99.86 3,784.06 2,182.36 57.7 43.49 96 91.1 78.4 8.879
H25M 4,985.69 4,962.33 99.86 4,362.59 2,533.38 58.1 50.49 96.1 92.1 81.9 10.0414
H29 4,693.86 4,671.66 99.86 4,301.64 2,472.31 57.5 49.27 96.2 92 81.5 5.6805
H29F 4,439.79 4,418.91 99.87 3,550.24 2,063.17 58.1 41.12 95.1 88.2 72.6 7.2768
H29M 4,095.63 4,076.3 99.86 3,834.09 2,225.19 58 44.35 95.9 91.1 79 3.8859
H33 4,223.78 4,203.77 99.86 3,855.05 2,220.67 57.6 44.26 95.9 91 78.9 6.2414
H33F 4,586.36 4,564.09 99.85 4,043.99 2,363.64 58.4 47.1 95.9 91.1 79.4 5.4823
H33M 4,449.31 4,428.06 99.86 4,094.93 2,340.32 57.2 46.64 96 91.5 80.1 3.9528
H39 4,900.75 4,877.46 99.85 4,302.09 2,483.68 57.7 49.5 96.2 92 81.4 9.5148
H39F 4,669.56 4,647.28 99.87 4,292.86 2,470.46 57.5 49.23 96.1 91.9 81.4 5.2823
H39M 4,086.96 4,067.44 99.86 3,505.56 2,034.55 58 40.55 95.6 90 76.1 11.8002
H42 7,649.6 7,612 99.58 7,006.19 4,333.43 61.9 86.09 96.3 93.8 88.6 5.4646
H42F 8,892.8 8,849.14 99.58 8,139.62 5,025.5 61.7 99.84 96.6 94.6 90.4 5.5364
H42M 9,856.92 9,808.76 99.6 9,025.55 5,533.45 61.3 109.93 96.6 94.9 91.2 5.5895
H45 5,215.83 5,190.89 99.85 3,032.29 1,768.14 58.3 35.24 94.9 87.7 70.5 4.4962
H45F 4,567.97 4,546.31 99.83 4,146.39 2,377.98 57.4 47.39 96.1 91.7 80.5 6.4063
H45M 4,536.14 4,513.6 99.85 4,188.58 2,429.23 58 48.41 96 91.7 81.1 5.1039
H53 6,684.85 6,652.53 99.61 6,132.08 3,757.43 61.3 74.65 96.1 93 86.6 5.4567
H53F 7,989.36 7,950.38 99.59 7,320.22 4,478.32 61.2 88.97 96.5 94.1 89.1 5.4575
H53M 7,283.67 7,248.55 99.62 6,740.25 4,152.52 61.6 82.49 96.2 93.8 88.5 4.5884
H60 8,349.31 8,308.23 99.6 7,733.53 4,766.63 61.6 94.69 96.4 94.3 89.9 4.4892
H60F 7,239.25 7,203.18 99.61 6,719.78 4,145.91 61.7 82.36 96.2 93.5 87.9 4.4525
H60M 7,488.72 7,452.39 99.58 6,922.9 4,271.09 61.7 84.85 96.2 93.8 88.7 4.6273
H63 7,791.5 7,755 99.58 7,195.62 4,322.47 60.1 85.87 96.5 94.5 89.8 4.4493
H63F 9,742.23 9,693.54 99.59 9,007.08 5,597.33 62.1 111.2 96.7 94.9 91.1 4.5376
H63M 7,307 7,271.09 99.61 6,761.53 4,183.13 61.9 83.1 96.2 93.7 88.5 4.4767
H66 10,304.11 10,252.81 99.58 9,538.47 5,972.02 62.6 118.64 96.8 95.1 91.8 4.249
H66F 9,589.37 9,542.14 99.58 8,890.81 5,501.52 61.9 109.29 96.7 94.8 91 4.1816
H66M 7,681.05 7,643.32 99.59 7,126.86 4,418.22 62 87.77 96.3 94 89 4.1142
H70 7,972.06 7,837.52 99.57 6,168.79 3,008.11 48.8 59.76 96.5 93.2 84.4 6.5063
H70F 11,315.56 11,198.43 99.56 6,515.67 3,525.6 54.1 70.04 96.4 93.3 86.2 7.536
H70M 11,260.45 11,148.82 99.51 7,361.2 3,750.88 51 74.52 96.2 93.1 86.1 6.3171
H74 12,375.53 12,259.35 99.47 7,511.69 3,879.37 51.6 77.07 96.3 93.3 86.8 9.0173
H74F 10,344.6 10,229.01 99.63 7,789.15 4,207.64 54 83.59 96.4 93.7 87.4 5.9639
H74M 9,995.07 9,871.08 99.56 6,597.1 3,227.56 48.9 64.12 96.4 93.4 85.5 6.1123
Average 6,782.18 6,740.50 99.66 5,857.42 3,409.16 57.93 67.82 96.22 92.71 84.40 5.97
SD 2,262.83 2,240.04 0.13 1,752.11 1,112.63 3.33 22.05 0.40 1.68 5.10 1.91

Rare Inherited Mutations in EOHM.

Rare inherited mutations cause HM in an autosomal recessive, dominant, or X-linked manner. Based on the sporadic EOHM patients used in this study, we first tried to identify biallelic mutations using mirTrios (28). We identified two known HM candidate genes (LEPREL1 and GRM6), three oculopathy-related genes (FAM161A, GLA, and CACNA1F), and a further possible gene (MAOA) in six different individuals, which accounted for one-third of the EOHM samples (Dataset S1 and Table S3).

Table S3.

Summary of identified variations associated with HM

Patients Origin Gene symbol Cytoband Mutational effect Function and disease
De novo mutations
 H1 DN TENM4 11q14.1 c.6173G>A, p.R2058H Neural development
DN ATP8B1 18q21.31 c.86C>T, p.T29I Transport of aminophospholipids
 H13 DN BSG 19p13.3 c.889G>A, p.G297S Development and maturation of the retina
 H29 DN FOXP4 6p21.1 c.1286C>T, p.S429F Regulation of tissue- and cell type-specific gene transcription
 H33 DN TPSG1 16p13.3 c.550G>A, p.V184I Heparin-stabilized tetramers
 H42 DN EPHB2 1p36.12 c.667C>T, p.R223W Subpopulation of retinal ganglion cell axons
 H70 DN CSMD1 8p23.2 c.1789T>C, p.S597P Schizophrenia
DN HIST1H3B 6p22.2 c.226G>T, p.A76S Nucleosomes wrap and compact DNA into chromatin.
Homozygous
 H16 F, M LEPREL1 3q28 c.1046T>C, p.L349P Collagen chain assembly, stability, and cross-linking, HM
 H33 F, M GRM6 5q35.3 c.2124G>T, p.Q708H G-protein–coupled receptor for glutamate, HM, night blindness
 H45 F, M FAM161A 2p15 c.904C>T, p.Q302X Involved in microtubule stabilization, autosomal recessive retinitis pigmentosa-28
Hemizygous (X-linked)
 H1 M MAOA Xp11.3 c. 53T>A, p.V18E Oxidative deamination of amines, such as 5-hydroxytryptamine, which involved in development retinal ganglion cells
 H9 M GLA Xq22.1 c.647A>T, p.Y216F Hydrolyses the terminal α-galactosyl moieties. Fabry disease, which accompany eye phenotype, corneal dystrophy
 H29 M CACNA1F Xp11.23 c.3145C>T, p.R1049W Eye disease, including congenital stationary night blindness type 2A, cone–rod dystrophy, night blindness
 H42 M ABCB7 Xq13.3 c.1294G>A, p.V432M ATP-binding cassette (ABC) transporters, mitochondrial iron accumulation and isodicentric
 H45 M PLXNA3 Xq28 c.196C>T, p.H66Y Development of retina and neuron

In proband H16, we detected a damaging biallelic mutation (p.L530P) in LEPREL1, which is involved in collagen chain assembly, stability, and cross-linking. Mutations in this gene have been reported in patients with HM in western Asia (19, 29) and China (30). Leprel1 knockout (KO) mice with abnormal collagen chemistry partially recapitulate the myopic changes (31). Proband H33 carries a homozygous mutation (p.Q708H) in the GRM6 gene. Mutations in GRM6 are reported in HM (32) and nyctalopia (33). In addition to these two known genes, we identified a unique candidate gene, FAM161A, which is involved in microtubule stabilization (34, 35). Proband H45 harbors a nonsense mutation (p.Q302X) in FAM161A. Loss-of-function mutations in this gene are reported to cause autosomal recessive retinitis pigmentosa (36, 37). Interestingly, HM is coupled with these diseases in patients (38).

In another three unrelated patients, we detected mutations in three candidate genes, including MAOA, GLA, and CACNA1F. A boy (H1) harbored a hemizygous mutation in MAOA (p.V18E), which encodes an oxidative deaminase for amines. It is reported that 5-hydroxytryptamine is involved in the development of retinal ganglion cells (39, 40). In addition, we identified a hemizygous mutation (p.Y216F) in the galactosidase α (GLA) gene in proband H9. This gene is a known candidate gene for Fabry disease with an ocular pathology (41) and corneal dystrophy (42). Furthermore, a hemizygous mutation in the CACNA1F gene (p.R1060W) was discovered in proband H29. CACNA1F mutations are reported in patients with HM, congenital stationary night blindness type 2A (43), cone–rod dystrophy (44), and nyctalopia (45).

Contribution of the de Novo Mutation to EOHM.

With the exception of the rare inherited mutations described above, we propose that de novo germline mutations may contribute to the genetic architecture of EOHM, which has not been fully studied. Using the Burrows–Wheeler Aligner (BWA)/GATK/mirTrios, we identified a total of 29 de novo single-nucleotide variants (SNVs) within the coding regions. We confirmed that 20 of the 29 de novo SNVs were genuine de novo mutations by direct PCR sequencing, and 17 were identified as nonsynonymous mutations (Dataset S2). Overall, 13 of the 18 probands (72%) carried at least one de novo mutation, and 7 probands harbored (39%) more than two de novo mutations.

The overall de novo mutation rate in the probands (1.11 events per proband on average) was consistent with a background de novo mutation rate of ∼0.91–1.07 that was estimated from previous studies (46–48). To determine whether the EOHM probands had elevated de novo mutations compared with the controls, we obtained the de novo mutation rates in the normal individuals from the NPdenovo database (49). As a result, we found an increased trend of the overall de novo mutation rate in the HM patients (1.11 events per proband on average) compared with that in the normal individuals (0.74 events per individual on average) with an HM/control rate ratio (RR) of 1.51 (P = 0.05) (Fig. 1A). Interestingly, we observed a significantly elevated de novo missense mutation rate in the patients compared with that in the normal individuals (RR = 1.98, 0.94 vs. 0.48, P = 0.008), and this difference was even greater (RR = 3.74, 0.39 vs. 0.1, P = 0.004) when only the damaging de novo missense mutations were considered. In addition, the number of de novo SNVs in each proband was significantly correlated with the paternal age (r = 0.491, P = 0.019) (Fig. 1B) using a Pearson correlation analysis, which is consistent with previous findings (50, 51). We correlated the number of de novo mutations detected and the degree of myopic refraction in each eye to analyze the possible direct contributions of the de novo mutations to the HM phenotypes. We observed a trend of a higher degree of myopia as the number of de novo mutations increased (0, one, and two) (Fig. 1 C and D).

Fig. 1.

Fig. 1.

Patterns of de novo mutations in HM patients and their contribution to disease risk. (A) Plot of the mean de novo mutation rate of HM patients (HM) and normal individuals (control). The de novo mutation rate for normal individuals was calculated based on 982 normal individuals from the NPdenovo database (www.wzgenomics.cn/NPdenovo/). The statistical significance of the differences in the de novo mutation rates between the HM patients and the controls was tested using a two-sample Poisson rate test. (B) The relationship between the number of de novo mutations and the paternal age. (C) The relationship between the number of de novo mutations in the proband and the diopter sphere–oculus dexter (DS-OD). (D) The relationship between the number of de novo mutations in the proband and the diopter sphere–oculus sinister (DS-OS). (E) A scatter diagram of the total damaging scores and the expected de novo mutation rate (expected DNMR) of the genes with de novo mutations. The total damaging score was calculated by 14 generic functional prediction tools, and the expected DNMR was used for each gene DNMR average from the mirDNMR database (www.wzgenomics.cn/mirdnmr/).

Candidate Genes with Damaging de Novo Mutations.

The detection of recurrent de novo mutations is a commonly used method to identify disease-causing genes. However, in this study, we found that the de novo mutations occurred in different genes in all cases, which prevented us from performing a statistical analysis of any of the specific genes. Therefore, we used 14 bioinformatics tools to predict the damaging effects of all missense de novo mutations detected and identified mutations that were more likely to confer a disease risk (Fig. 1E). One de novo missense mutation in the EPHB2 gene was identified in proband H42, and the mutation was predicted to be damaging by 10 bioinformatics tools. The EPHB2 gene is involved in retinal axon projections via interactions with ephrin-B proteins (52). In addition, it was reported that the growth cone collapse and axon retraction of retinal ganglion cells could be induced by EPHB2 gene expression (53). Therefore, the direct evidence of the contribution of the EPHB2 gene to retinal axon projections suggests that the EPHB2 mutations may be a possible cause of the optical problems observed in the proband. One de novo missense mutation in the CSMD1 gene was identified in proband H70, which is related to several neuron function-related disorders, such as schizophrenia, autism, sclerosis, etc. (54). One de novo missense mutation in the TENM4 gene was identified in proband H1. Notably, the TENM4 gene is also associated with neuron function-related disorders based on the genome sequencing of cases and controls (55) and a GWAS study (56). In addition, the TENM4 gene is essential for embryonic mesoderm development in mouse model studies (57). One de novo missense mutation in the BSG gene was identified in proband H13. The BSG gene encodes a photoreceptor-specific transmembrane protein, Basigin, which cross talks with rod-derived cone viability factor (RdCVF) (58, 59). The BSG gene will be discussed further in the subsequent sections as a unique candidate gene for EOHM.

Expanded Screening Identified BSG Mutations.

A mutation in the BSG gene (c.889G>A, p.G297S) identified in the EOHM patient (Fig. 2) showed strong pathogenicity, according to computational predictions. Moreover, it is completely absent in Exome Variant Server (EVS) and 1000 Genomes Project (1000G) and exhibits a very rare frequency in Exome Aggregation Consortium (ExAC) (1/115742, 8.64e-06). We further screened the entire coding region of the BSG gene in a large cohort of 1,040 unrelated patients with HM, none of which had mutations in the known genes, to determine the replication of the BSG mutations. Interestingly, we also identified one different missense mutation (c.661C>T, p.P221S), one nonsense mutation (c.205C>T, p.Q69X), and one splicing mutation (c.415+1G>A) in the BSG gene (Table 1 and Fig. 2) in a total of four unrelated families. All of these mutations were absent in the ExAC database and either led to a protein coding change (c.205C>T, p.Q69X; c.415+1G>A) or displayed strong pathogenicity according to the computational assessment (c.889G>A, p.G297S; c.661C>T, p.P221S). Furthermore, both of the missense mutation (G297S and P221S) sites are located in highly conserved amino acids across different species (Fig. 2). However, because the parental DNA was unavailable, it is not clear whether these mutations are de novo mutations. Taken together, these results confirmed the recurrence of the BSG mutations by expanded screening in an additional HM cohort, which supported the pathogenicity of this gene for HM.

Fig. 2.

Fig. 2.

Identification of mutations in the BSG gene. (A) Identification of mutations in the BSG gene in five unrelated patients. (B) Schematic of the BSG gene and its domains with the sites of the variants identified in this study. (C) Both missense mutations (G297S and P221S) are located in highly conserved regions.

Table 1.

Summary of BSG mutations and the associated phenotypes identified in this study

Patient ID Mutation (zygosity) ExAC EVS 1000G Type (damaging score*) Refractive errors (DS) BCVA
OD OS OD OS
H13 c.889G>A, p.G297S (het) 1/115742 None None Missense (12/14) −9.00 −8.50 0.6 0.6
T100 c.661C>T, p.P221S (het) None None None Missense (9/14) −6.00 −7.00 0.8 0.8
HM850 c.415+1G>A (het) None None None Splicing −11.50 −12.00 0.3 0.3
M487 c.205C>T, p.Q69X (het) None None None Nonsense −11.00 −9.25 1.0 1.0
M813 c.205C>T, p.Q69X (het) None None None Nonsense −7.25 −9.00 1.0 1.0

BCVA, best-corrected visual acuity; DS, diopters; EVS, Exome Variant Server; ExAC, Exome Aggregation Consortium; 1000G, 1000 Genomes Project; OD, right eye; OS, left eye.

*

Damaging score: Damage prediction of missense mutation using 14 online tools (Polyphen2_HDIV, Polyphen2_HVAR, MutationTaster, SIFT, LRT, MutationAssessor, FATHMM, RadialSVM, LR, VEST3, CADD, GERP++, phyloP100way, and SiPhy_29way).

Bsg Mutant Mice Display Typical Myopic Phenotypes in the Axial Length.

We generated knockin mice (Fig. S1) with a c.901G>A mutation corresponding to the c.889G>A mutation identified in the EOHM patient to further investigate the functional impact of the BSG mutation. The total axial length (AL) and vitreous chamber depth (VCD) were measured in variant ages (4, 6, 8, and 10 wk) of the mutant mice and wild-type (WT) siblings. The results showed that the ΔAL significantly changed with group (F = 51.26, P = 1.63e-10) and time (F = 42.36, P = 6.50e-14) overall, and there were no interactions between group and time (F = 2.35, P = 0.1012) (Fig. 3). The heterozygous mutant group had an increased AL in the subsequent 2 wk compared with the WT group (Tukey multiple comparison, Δmean = 0.015 mm, P < 1e-50). The ΔAL in the subsequent 2 wk also changed with time (peaks at 6 wk, and then the ΔAL decreased slightly). However, there were no significant differences with group (F = 0.47, P = 0.49) and time (F = 1.86, P = 0.16) in ΔVCD (Fig. S2). The trend of the AL and VCD of the WT mice was consistent with the previous studies as follows: AL increases during postnatal development, whereas the VCD decreases (60, 61).

Fig. S1.

Fig. S1.

Bsg knockin mutant mice were generated by a homologous recombination approach and genotyped by PCR using tail genomic DNA.

Fig. 3.

Fig. 3.

Clinical features of the Bsg mutant mice. Comparisons of the ALs in the WT and mutant mice at each time point [week 6 (w6)–w4, w8–w6, w10–w8]. HET, heterozygous mutant mice; WT, wild-type mice.

Fig. S2.

Fig. S2.

Comparisons of the ALs in the WT and mutant mice at each time point [week 6 (w6)–w4, w8–w6, w10–w8]. HET, heterozygous mutant mice; WT, wild-type mice.

To test whether retinal function was affected in the mutant mice, we performed an electroretinogram (ERG). The results showed that both the photopic and scotopic ERG responses of the mutant mice were normal compared with those of their WT siblings (Fig. S3). This result indicated that the retinal function was not affected by the Bsg mutation, which was consistent with the clinical manifestation in the patients. Taken together, the results showed that the Bsg mutant mice displayed typical HM phenotypes with a longer AL but no retinal dysfunction.

Fig. S3.

Fig. S3.

The electroretinogram responses in the mutant mice were normal compared with their WT siblings. (A) The scotopic ERG response of the WT and mutant mice. (B) The photopic ERG response of the WT and mutant mice.

Spatial Expression Patterns of the Bsg Gene in Mice.

Next, we wanted to determine the Bsg expression patterns in different tissues. Therefore, we investigated the spatial expression patterns of Bsg in various mouse tissues. Interestingly, two known myopia-related genes, Sco2 and Sntb1, exhibited patterns similar to that of Bsg (Fig. S4).

Fig. S4.

Fig. S4.

Bsg expression patterns. (A) Expression patterns of the Bsg gene in different mouse tissues. (B and C) Expression patterns of known myopia-related genes in different mouse tissues.

Discussion

Both myopia and HM are etiologically heterogeneous disorders. It is commonly known that both genetic factors and environmental factors contribute to the etiology (1). Population-based epidemiological investigations found that the disease is associated with environmental risk factors, such as a close reading distance and less outdoor activity (8, 9). With the advent of next-generation sequencing, a few of disease genes have been discovered in recent years (18–24). Because myopia is dependent on both genetics and lifestyle and preschool children have less exposure to environmental risks, we designed this study using a special cohort with EOHM. Each trio has one EOHM child and two unaffected parents, with or without another unaffected sibling. Through this design, we were able to focus on the genetic cause of the newly created EOHM in each family.

Our study used a trio-based WES strategy to dissect the genetic basis of EOHM. Based on WES and the subsequent validation, we deciphered the genetic causes of 4 known genes and discovered 12 unique candidate genes. A total of 16 biallelic or de novo mutations were identified in the present study. To date, cohort-based genetic studies have identified several genes that contribute to myopic development. Jiang et al. (25) comprehensively screened the LRPAP1, CTSH, LEPREL1, ZNF644, SLC39A5, and SCO2 genes in 298 families with EOHM and identified potential pathogenic mutations in 9 patients, with a detection rate of 3.02% (9/298). Among these genes, ZNF644 was the major gene of EOHM (1.67%, 5/298), whereas no mutations were identified in CTSH and LEPREL1. Collectively, these results suggested that the genetic defects responsible for most cases remain to be determined. Strikingly, we deciphered a significant rate of the genetic causes in these trios, supporting our initial hypothesis that EOHM is mainly driven by genetic predisposition.

Among the rare inherited biallelic mutations, three mutations were identified in the known genes GRM6, CACNA1F, and FAM161A that are responsible for inherited retinal dystrophy (IRD) (Dataset S1). Interestingly, HM occurs concomitantly in IRD patients with GRM6 or CACNA1F mutations (32, 62). Our findings are consistent with a previous study showing that 23.8% (71/298) of patients with EOHM actually harbor mutations in IRD genes (38).

The role of de novo mutations in EOHM onset has never been explored. In this study, a total of 20 de novo mutations in the coding regions were validated in 12 EOHM probands. Interestingly, the de novo mutation rate was significantly elevated in the probands compared with that in the normal subjects (RR = 1.51, 1.11 vs. 0.74, P = 0.05), in particular damaging missense mutations (RR = 3.74, 0.39 vs. 0.1, P = 0.004). In addition, the de novo mutation rate was positively correlated with paternal age in this study (Fig. 1B). Children’s refractive changes decrease with parental reproductive age (63), and thus, we speculate that the increased de novo mutation rate in the subjects with aged parents may be the underlying reason for the disease. In fact, we successfully identified several EOHM candidate genes with identified de novo mutations, such as BSG, EPHB2, CSMD1, and TENM4. These findings suggest that de novo mutations contribute substantially to the genetic etiology of EOHM.

The identification of recurrent de novo mutations serves as a useful method to identify disease-causing genes. However, we found that all of the de novo mutations occurred in different genes, which prevented us from performing a statistical analysis of these genes. Then, we searched the genes carrying damaging de novo missense mutations against the literature and found that none of them was associated with HM in previous reports, which can be explained by the fact that de novo mutations are extremely rare events that cannot be identified by GWAS or a linkage analysis. We subsequently asked whether there are any functional categories or cellular pathways enriched in this study. Despite the substantial genetic heterogeneity in HM, closely interconnected protein–protein interactions (PPIs) were identified by integrating the HM risk genes obtained from this and previous studies (Table S4). A gene ontology (GO) enrichment analysis showed that 43 of 62 genes were jointly clustered in four GO biological processes (Table S5). The results suggest that these genes play important roles in disease predisposition. The PPI analysis of these genes revealed a highly connected network, implying that EOHM is associated with visual perception, transcriptional regulation, and cell morphogenesis and homeostasis (Fig. 4).

Table S4.

Candidate genes of HM in other studies

Gene symbol Function Disease
P4HA2 Posttranslational modifications of collagen HM
MYCBP2 Ubiquitination and subsequent proteasomal degradation Optic disk anomaly associated with HM
BBS4 Sorting of specific membrane proteins to the primary cilia Bardet–Biedl syndrome associated with HM
LRPAP1 Interacts with low-density lipoprotein receptor-related protein, LRP1/α-2-macroglobulin receptor and glycoprotein 330 EOHM
COL18A1 Encodes the α-chain of type XVIII collagen Knobloch syndrome
RPGR Guanine-nucleotide releasing factor, plays a role in ciliogenesis X-linked retinitis pigmentosa (XLRP) associated with severe visual impairment in women
PRIMPOL Influence affinities for DNA and nucleotides HM
OPN1LW, OPN1MW Encodes for light-absorbing visual pigments of the opsin gene Nystagmus and poor vision
ZNF644 Eye development HM
C8orf37 Retinal function Early-onset retinal dystrophy and HM
SLC39A5 Interference with the BMP/TGF-β pathway, controlling organismal zinc status Nonsyndromic HM
PROM1 Retinal development Pediatric cone–rod dystrophy with HM
LEPREL1 Collagen chain assembly Nonsyndromic HM
LRP2 Reuptake of numerous ligands, including lipoproteins Stickler syndrome, adult-onset ocular pathogenesis with HM
SLITRK6 Control neurite outgrowth and regulate synaptic development Progressive auditory neuropathy associated with HM
ZNF469 Transcriptional regulation Brittle cornea syndrome (BCS) associated with HM
SCO2 Mitochondrial cytochrome c oxidase activity Autosomal-dominant high-grade myopia
CCDC111 Influences amino acid substitutions HM
UHRF1BP1L, PTPRR, PPFIA2 In MYP3 genetic locus, eye development High-grade myopia
NYX Retinal development HM
TGFB1 Proliferation, differentiation, adhesion, migration HM
CYP4V2 Metabolism of fatty acid precursors Retinitis pigmentosa (RP) associated with HM
TCF4 Initiation of neuronal differentiation Pitt–Hopkins syndrome with HM
STK11 Metabolism, cell polarity, apoptosis, and DNA damage response Peutz–Jeghers syndrome (PJS) associated with HM
RPGR Ciliogenesis, photoreceptor integrity Female RP carriers associated with HM
ADAMTS18 Retinal development Knobloch syndrome characterized by HM
PTPN11 Ocular development Noonan syndrome with HM
COL9A2 Structural component of hyaline cartilage and vitreous of eye Stickler syndrome with HM
PRDM5 Extracellular matrix development and maintenance Brittle cornea syndrome with HM
MYP1 Color visual and optic disk Nonsyndromic HM
COL2A1, COL11A1 Embryonic development of the skeleton Cleft palate and HM
RP2 Between the Golgi and the ciliary membrane X-linked retinitis pigmentosa with HM
GRM6 G protein coupled receptor for glutamate HM
OPTC Binds collagen fibrils HM
CLDN16 Paracellular magnesium reabsorption Nephrocalcinosis and HM
PAX6 Development of the eye, nose, central nervous system HM
FBN1 Regulates osteoblast maturation HM
CACNA1F A variety of calcium-dependent processes HM
ZFHX1B Eye development HM with Hirschsprung disease

Table S5.

GO biological process enrichment of HM candidate genes

GO terms P value FDR
GO:0007601∼visual perception 1.41E-10 2.24E-10
GO:0050953∼sensory perception of light stimulus 1.41E-10 2.24E-10
GO:0050877∼neurological system process 4.00E-04 0.0012
GO:0050890∼cognition 2.68E-04 0.0012
GO:0000904∼cell morphogenesis involved in differentiation 3.00E-04 0.0019
GO:0007600∼sensory perception 2.79E-04 0.0022
GO:0000902∼cell morphogenesis 3.47E-04 0.0033
GO:0032989∼cellular component morphogenesis 7.25E-04 0.0080

Fig. 4.

Fig. 4.

PPI of the HM genes. PPI network of the genes related to HM identified in this study and previous studies.

Among these genes with de novo mutations, we discovered a de novo mutation in a unique gene, BSG, in patient H13, and identified three different BSG mutations in an expanded screen of 1,040 patients with HM. We further verified its functional impact by generating knockin mice carrying the same BSG mutation identified in the first EOHM patient. Strikingly, the mutant mice displayed the myopic feature of an enlarged AL. In addition, our results showed that the spatial expression pattern of Bsg is similar to other known genes, such as Sco2 and Sntb1 (64, 65). BSG encodes basigin, which is associated with retinal development and function. A previous study showed that Bsg KO mice led to defective function and photoreceptor degeneration in the retina (58, 59). Interestingly, Basigin plays an important role in mediating the binding of rod-derived cone viability factor (RdCVF) to the glucose transporter GLUT1, which increases glucose influx into cone photoreceptors (66). This evidence indicated that the retina might be one of the disease target tissues in EOHM driven by the BSG mutation. In this study, the Bsg mutant mice displayed the typical HM phenotypes with AL. As AL is responsible for myopia development (67), our results indicate that the Bsg mutation predisposed typical myopic phenotypes.

In summary, we performed a trio-based study to genetically dissect EOHM using next-generation sequencing and deciphered an important role for de novo mutations in this disease. The discovery of a disease gene, BSG, provides insight into myopia development and etiology, which expands our current understanding of HM and might be useful for future treatment and prevention.

Methods

The human subjects were recruited from The Eye Hospital of Wenzhou Medical University in accordance with a protocol approved by the Ethics Committee of the hospital. Written informed consent was provided by the parents and on behalf of their children before the peripheral blood, and clinical data were collected from the myopia patients and their parents. The experimental procedures are described in detail in SI Methods.

SI Methods

HM Human Subjects.

This study included a total of 18 unrelated trios (29 males and 25 females) of Han Chinese ancestry with HM, and all of the probands have an onset age of <6 y. The human subjects were recruited from The Eye Hospital of Wenzhou Medical University in accordance with a protocol approved by the Ethics Committee of the hospital. In total, 1,040 patients with HM were recruited for expanded screening of BSG gene. Written informed consent was provided by the parents and on behalf of their children before peripheral blood and clinical data were collected from the myopia patients and their parents. A team of HM specialists diagnosed the patients based on comprehensive analyses of the refractive errors and best corrected visual acuity. The refractive errors of all patients were greater than −6.00 diopters (D).

WES and Variant Detection.

Genomic DNA was extracted from the peripheral blood of 54 samples (18 trios) using the Genomic DNA Extraction Kit (Invitrogen). The exome DNA was enriched using the SureSelect Human All Exon Kit (Agilent), and paired-end sequencing was performed on the Illumina HiSeq 2000 sequencing system.

Raw sequencing reads were filtered using the FastQC program (www.bioinformatics.babraham.ac.uk/projects/fastqc/) to remove reads with a sequencing quality lower than 20, and the 3′/5′ adapter sequences on each read were trimmed using the Cutadapt program (https://cutadapt.readthedocs.io/en/stable/). The clean reads were mapped to human reference genome (hg19/GRCH37) by the BWA software, and PCR duplications were removed by the Sequence Alignment/Map tools (SAMtools). Local realignments of reads, quality recalibration, and variant calling (VCF format) were performed by the Genome Analysis Toolkit (GATK). De novo and rare inherited mutations (including SNVs and small indels) in each trio were detected by the mirTrios program based on the VCF files produced by GATK. Annotation of the detected variants with respect to the consequences of their mutation on known genes (gene name, functional effect, amino acid change, etc.), mutation effect predicted by multiple computational methods (SIFT, Polyphen2, MutationTaster, etc.), and population allele frequency (from 1000 Genomes, EVS, and ExAC database) were performed using the ANNOVAR software. The sequencing data have been deposited in the figshare database (DOI: 10.6084/m9.figshare.3497660; https://figshare.com/s/0eab58f90f3b1b20a181).

Pathway and Network Analyses.

Protein interaction relationship data were obtained from the BioGrid (V33) (https://thebiogrid.org/) and STRING (V34) (string-db.org/) databases. Protein–protein interactions (PPIs) and gene coexpression networks for the HM-relevant genes were constructed using the Cytoscape software tool (V3.1 36) (cytoscape.org/).

BSG Amplification and Genotyping.

An additional cohort with HM was selected, and their DNA was submitted for Sanger sequencing. Primers were designed to amplify all coding regions and the intron–exon boundaries of the BSG gene. The PCR products were purified and sequenced on an ABI 3500 Genetic Analyzer (Applied Biosystems).

Generation of Bsg Knockin Mice.

This study was approved by the animal care and ethics committee at Wenzhou Medical University and was conducted according to the Association for Research in Vision and Ophthalmology guidelines. Bsg knockin mice were generated using a homologous recombination approach. The targeting vector was transfected into ES cells. The ES clones were then screened by Southern blotting for correct targeting and injected into C57BL/6J blastocysts; the chimeric mice were bred with C57BL/6J WT mice to produce heterozygous Bsg mice. All mice were maintained under a standard light–dark cycle in Wenzhou Medical University and had free access to food in specific pathogen-free facility. Newborn mice were genotyped by PCR using tail genomic DNA. The primer sequences were as follows: Bsg-WT-F, ATGAGTGTTGAGGTCATATACAGGAGG; Bsg-WT-R, CCAGCCAGATCAGTACTAGGCT; and Bsg-Mut-R, CAGAGGCCACTTGTGTAGCG.

Biometric Measurements.

The total axial length (AL) and vitreous chamber depth (VCD) were measured in variant ages (4, 6, 8, and 10 wk) of the mutant mice and age-matched WT siblings. The center wavelength in this system was 840 nm. The system was mounted onto a traditional slit lamp to image the mouse eyes, and two central crossing lines were set and were applied to align the scanning position. The ocular axial resolution of the spectral domain optical coherence tomography (SD-OCT) instrument was 6 μm and the prolonged scan depth was 7.2 mm. The mice were weighed and then anesthetized by i.p. injections (4 mL/kg) of a mixture of xylazine (4 mg/kg) and ketamine (75 mg/kg). Generally, the animal’s eyes were wide open naturally, with pupils pointing laterally and upward. Subsequently, the mice were placed over a self-made polystyrene box in front of the modified slit lamp. One operator adjusted the mouse eye position until the beam was roughly incident on the central cornea, and the OCT beam was visualized with an infrared sensor card. Then, another operator precisely aligned the optical axis of the image until the specular reflex on the corneal apex was observed, after which it was moved from the anterior surface of the cornea to the retinal pigment epithelium layer. The intersection of the two crossed lines with maximal intensity on the apices of the corneal surface confirmed the perpendicularity of the OCT beam to the whole eyeball. When the specular reflex was detected on all curved surfaces, the operator manually recorded the OCT image. All of the manipulations of the mice (anesthetization and orientation) were performed by a single operator, and another operator recorded the positions of the ocular reflective surfaces. The raw OCT data were exported, and the axial components were measured using custom-designed software. All distances were measured by passing through the center of the pupil on the OCT image.

Statistical Analysis.

Measurement data were expressed as mean ± SD (*P < 0.05, **P < 0.01, ***P < 0.001). The de novo mutation rates were tested by two-sample Poisson rate test (one-tail), and Pearson correlation analysis was performed between the number of de novo mutations in HM patients and other association factors like age, DS-OD, and DS-OS. In Bsg knockin mice model, P value was calculated by one-way ANOVA in each age, and post hoc pairwise comparison was tested by Tukey’s honest significant difference method. All statistical calculations were performed using R, version 3.3.0, software. A value of P < 0.05 was considered as statistically significant.

We defined ΔAL as the change of the AL in subsequent 2 wk (positive value means increase and negative value means decrease), and ΔVCD as the change of the VCD in subsequent 2 wk, and thus got three groups of ΔAL and ΔVCD at each time point (6–4 wk, 8–6 wk, and 10–8 wk). We performed analysis of variance (ANOVA) with group and time as two fixed factors. F test was used to evaluate whether there exists difference overall. The F ratio is significant at the 5% significance level. After performing the F test, “post hoc” analysis was carried out to assess the between-group differences.

Real-Time Quantitative PCR.

The expression of the Bsg gene in different mouse tissues was determined by real-time quantitative PCR using a 7500 Real-Time PCR system (ABI). The β-actin gene was used as an endogenous control. The 20-μL reaction contained 10 μL of 2× fast start universal SYBR Green Master (ROX) (Roche), 10 μM each primer, and 1 μL of genomic DNA as the template. The following thermal cycling conditions were used: 10 min of preheating at 95 °C, followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C. For normalization, the threshold cycle (CT) values of the endogenous control were subtracted from the corresponding CT values of the candidate genes, generating ΔCT values. All relative expression values of the genes were reported as means ± SEs of the means on a 2-log scale.

Supplementary Material

Supplementary File
Supplementary File
pnas.1615970114.sd02.xls (33.5KB, xls)

Acknowledgments

We thank the families for participation in this study. This study was supported by National Key Basic Research Program Grant 2013CB967502; National Natural Science Foundation of China Grants 81522014, 81371059, and 81500741; Zhejiang Provincial Natural Science Foundation of China Grant LR13H120001; Zhejiang Provincial Key Research and Development Program Grant 2015C03029; Wenzhou Science and Technology Innovation Team Project Grant C20150004; MOST Projects Grant 2012YQ12008004; National Institutes of Health/National Eye Institute (NIH/NEI) Grants 1R0 1EY018246-01 and R01 EY014685; Research to Prevent Blindness, Inc.; and University of Wisconsin School of Medicine and Public Health Centennial Scholars Fund.

Footnotes

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

Data deposition: The sequencing data have been deposited in the figshare database, https://figshare.com/s/0eab58f90f3b1b20a181 (DOI: 10.6084/m9.figshare.3497660).

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1615970114/-/DCSupplemental.

References

  • 1.Morgan IG, Ohno-Matsui K, Saw SM. Myopia. Lancet. 2012;379:1739–1748. doi: 10.1016/S0140-6736(12)60272-4. [DOI] [PubMed] [Google Scholar]
  • 2.Morgan I, Rose K. How genetic is school myopia? Prog Retin Eye Res. 2005;24:1–38. doi: 10.1016/j.preteyeres.2004.06.004. [DOI] [PubMed] [Google Scholar]
  • 3.Pan CW, Ramamurthy D, Saw SM. Worldwide prevalence and risk factors for myopia. Ophthalmic Physiol Opt. 2012;32:3–16. doi: 10.1111/j.1475-1313.2011.00884.x. [DOI] [PubMed] [Google Scholar]
  • 4.Bourne RR, et al. Vision Loss Expert Group Causes of vision loss worldwide, 1990–2010: A systematic analysis. Lancet Glob Health. 2013;1:e339–e349. doi: 10.1016/S2214-109X(13)70113-X. [DOI] [PubMed] [Google Scholar]
  • 5.Young TL, Metlapally R, Shay AE. Complex trait genetics of refractive error. Arch Ophthalmol. 2007;125:38–48. doi: 10.1001/archopht.125.1.38. [DOI] [PubMed] [Google Scholar]
  • 6.Hornbeak DM, Young TL. Myopia genetics: A review of current research and emerging trends. Curr Opin Ophthalmol. 2009;20:356–362. doi: 10.1097/ICU.0b013e32832f8040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Saw SM, Katz J, Schein OD, Chew SJ, Chan TK. Epidemiology of myopia. Epidemiol Rev. 1996;18:175–187. doi: 10.1093/oxfordjournals.epirev.a017924. [DOI] [PubMed] [Google Scholar]
  • 8.He M, et al. Effect of time spent outdoors at school on the development of myopia among children in China: A randomized clinical trial. JAMA. 2015;314:1142–1148. doi: 10.1001/jama.2015.10803. [DOI] [PubMed] [Google Scholar]
  • 9.Rose KA, et al. Outdoor activity reduces the prevalence of myopia in children. Ophthalmology. 2008;115:1279–1285. doi: 10.1016/j.ophtha.2007.12.019. [DOI] [PubMed] [Google Scholar]
  • 10.Lee KE, Klein BE, Klein R, Fine JP. Aggregation of refractive error and 5-year changes in refractive error among families in the Beaver Dam Eye Study. Arch Ophthalmol. 2001;119:1679–1685. doi: 10.1001/archopht.119.11.1679. [DOI] [PubMed] [Google Scholar]
  • 11.Wojciechowski R, et al. Heritability of refractive error and familial aggregation of myopia in an elderly American population. Invest Ophthalmol Vis Sci. 2005;46:1588–1592. doi: 10.1167/iovs.04-0740. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Fotouhi A, et al. Familial aggregation of myopia in the Tehran eye study: Estimation of the sibling and parent offspring recurrence risk ratios. Br J Ophthalmol. 2007;91:1440–1444. doi: 10.1136/bjo.2007.120162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Lam DS, et al. The effect of parental history of myopia on children’s eye size and growth: Results of a longitudinal study. Invest Ophthalmol Vis Sci. 2008;49:873–876. doi: 10.1167/iovs.06-1097. [DOI] [PubMed] [Google Scholar]
  • 14.Lopes MC, Andrew T, Carbonaro F, Spector TD, Hammond CJ. Estimating heritability and shared environmental effects for refractive error in twin and family studies. Invest Ophthalmol Vis Sci. 2009;50:126–131. doi: 10.1167/iovs.08-2385. [DOI] [PubMed] [Google Scholar]
  • 15.Wojciechowski R. Nature and nurture: The complex genetics of myopia and refractive error. Clin Genet. 2011;79:301–320. doi: 10.1111/j.1399-0004.2010.01592.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Verhoeven VJ, et al. Consortium for Refractive Error and Myopia (CREAM); Diabetes Control and Complications Trial/Epidemiology of Diabetes Interventions and Complications (DCCT/EDIC) Research Group; Wellcome Trust Case Control Consortium 2 (WTCCC2); Fuchs’ Genetics Multi-Center Study Group Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. Nat Genet. 2013;45:314–318. doi: 10.1038/ng.2554. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Fan Q, et al. Genetic variants on chromosome 1q41 influence ocular axial length and high myopia. PLoS Genet. 2012;8:e1002753. doi: 10.1371/journal.pgen.1002753. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Aldahmesh MA, et al. Mutations in LRPAP1 are associated with severe myopia in humans. Am J Hum Genet. 2013;93:313–320. doi: 10.1016/j.ajhg.2013.06.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Mordechai S, et al. High myopia caused by a mutation in LEPREL1, encoding prolyl 3-hydroxylase 2. Am J Hum Genet. 2011;89:438–445. doi: 10.1016/j.ajhg.2011.08.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Shi Y, et al. Exome sequencing identifies ZNF644 mutations in high myopia. PLoS Genet. 2011;7:e1002084. doi: 10.1371/journal.pgen.1002084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Tran-Viet KN, et al. Mutations in SCO2 are associated with autosomal-dominant high-grade myopia. Am J Hum Genet. 2013;92:820–826. doi: 10.1016/j.ajhg.2013.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Guo H, et al. SLC39A5 mutations interfering with the BMP/TGF-β pathway in non-syndromic high myopia. J Med Genet. 2014;51:518–525. doi: 10.1136/jmedgenet-2014-102351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Guo H, et al. Mutations of P4HA2 encoding prolyl 4-hydroxylase 2 are associated with nonsyndromic high myopia. Genet Med. 2015;17:300–306. doi: 10.1038/gim.2015.28. [DOI] [PubMed] [Google Scholar]
  • 24.Xiao X, Li S, Jia X, Guo X, Zhang Q. X-linked heterozygous mutations in ARR3 cause female-limited early onset high myopia. Mol Vis. 2016;22:1257–1266. [PMC free article] [PubMed] [Google Scholar]
  • 25.Jiang D, et al. Detection of mutations in LRPAP1, CTSH, LEPREL1, ZNF644, SLC39A5, and SCO2 in 298 families with early-onset high myopia by exome sequencing. Invest Ophthalmol Vis Sci. 2014;56:339–345. doi: 10.1167/iovs.14-14850. [DOI] [PubMed] [Google Scholar]
  • 26.Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 2009;25:1754–1760. doi: 10.1093/bioinformatics/btp324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.McKenna A, et al. The Genome Analysis Toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 2010;20:1297–1303. doi: 10.1101/gr.107524.110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Li J, et al. mirTrios: An integrated pipeline for detection of de novo and rare inherited mutations from trios-based next-generation sequencing. J Med Genet. 2015;52:275–281. doi: 10.1136/jmedgenet-2014-102656. [DOI] [PubMed] [Google Scholar]
  • 29.Khan AO, Aldahmesh MA, Alsharif H, Alkuraya FS. Recessive mutations in LEPREL1 underlie a recognizable lens subluxation phenotype. Ophthalmic Genet. 2015;36:58–63. doi: 10.3109/13816810.2014.985847. [DOI] [PubMed] [Google Scholar]
  • 30.Guo H, et al. Homozygous loss-of-function mutation of the LEPREL1 gene causes severe non-syndromic high myopia with early-onset cataract. Clin Genet. 2014;86:575–579. doi: 10.1111/cge.12309. [DOI] [PubMed] [Google Scholar]
  • 31.Hudson DM, et al. Post-translationally abnormal collagens of prolyl 3-hydroxylase-2 null mice offer a pathobiological mechanism for the high myopia linked to human LEPREL1 mutations. J Biol Chem. 2015;290:8613–8622. doi: 10.1074/jbc.M114.634915. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Xu X, et al. Sequence variations of GRM6 in patients with high myopia. Mol Vis. 2009;15:2094–2100. [PMC free article] [PubMed] [Google Scholar]
  • 33.Sergouniotis PI, et al. A phenotypic study of congenital stationary night blindness (CSNB) associated with mutations in the GRM6 gene. Acta Ophthalmol. 2012;90:e192–e197. doi: 10.1111/j.1755-3768.2011.02267.x. [DOI] [PubMed] [Google Scholar]
  • 34.Langmann T, et al. Nonsense mutations in FAM161A cause RP28-associated recessive retinitis pigmentosa. Am J Hum Genet. 2010;87:376–381. doi: 10.1016/j.ajhg.2010.07.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Bandah-Rozenfeld D, et al. Homozygosity mapping reveals null mutations in FAM161A as a cause of autosomal-recessive retinitis pigmentosa. Am J Hum Genet. 2010;87:382–391. doi: 10.1016/j.ajhg.2010.07.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Zach F, et al. The retinitis pigmentosa 28 protein FAM161A is a novel ciliary protein involved in intermolecular protein interaction and microtubule association. Hum Mol Genet. 2012;21:4573–4586. doi: 10.1093/hmg/dds268. [DOI] [PubMed] [Google Scholar]
  • 37.Zhou Y, et al. Whole-exome sequencing reveals a novel frameshift mutation in the FAM161A gene causing autosomal recessive retinitis pigmentosa in the Indian population. J Hum Genet. 2015;60:625–630. doi: 10.1038/jhg.2015.92. [DOI] [PubMed] [Google Scholar]
  • 38.Sun W, et al. Exome sequencing on 298 probands with early-onset high myopia: Approximately one-fourth show potential pathogenic mutations in RetNet genes. Invest Ophthalmol Vis Sci. 2015;56:8365–8372. doi: 10.1167/iovs.15-17555. [DOI] [PubMed] [Google Scholar]
  • 39.Upton AL, et al. Excess of serotonin (5-HT) alters the segregation of ispilateral and contralateral retinal projections in monoamine oxidase A knock-out mice: Possible role of 5-HT uptake in retinal ganglion cells during development. J Neurosci. 1999;19:7007–7024. doi: 10.1523/JNEUROSCI.19-16-07007.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Salichon N, et al. Excessive activation of serotonin (5-HT) 1B receptors disrupts the formation of sensory maps in monoamine oxidase A and 5-HT transporter knock-out mice. J Neurosci. 2001;21:884–896. doi: 10.1523/JNEUROSCI.21-03-00884.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Desnick RJ, Banikazemi M. Fabry disease: Clinical spectrum and evidence-based enzyme replacement therapy. Nephrol Ther. 2006;2:S172–S185. [PubMed] [Google Scholar]
  • 42.Bruner WE, Dejak TR, Grossniklaus HE, Stark WJ, Young E. Corneal alpha-galactosidase deficiency in macular corneal dystrophy. Ophthalmic Paediatr Genet. 1985;5:179–183. doi: 10.3109/13816818509006131. [DOI] [PubMed] [Google Scholar]
  • 43.Michalakis S, et al. Mosaic synaptopathy and functional defects in Cav1.4 heterozygous mice and human carriers of CSNB2. Hum Mol Genet. 2014;23:1538–1550. doi: 10.1093/hmg/ddt541. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Hauke J, et al. A novel large in-frame deletion within the CACNA1F gene associates with a cone-rod dystrophy 3-like phenotype. PLoS One. 2013;8:e76414. doi: 10.1371/journal.pone.0076414. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Vincent A, Wright T, Day MA, Westall CA, Héon E. A novel p.Gly603Arg mutation in CACNA1F causes Åland island eye disease and incomplete congenital stationary night blindness phenotypes in a family. Mol Vis. 2011;17:3262–3270. [PMC free article] [PubMed] [Google Scholar]
  • 46.O’Roak BJ, et al. Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations. Nat Genet. 2011;43:585–589. doi: 10.1038/ng.835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Samocha KE, et al. A framework for the interpretation of de novo mutation in human disease. Nat Genet. 2014;46:944–950. doi: 10.1038/ng.3050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Girard SL, et al. Increased exonic de novo mutation rate in individuals with schizophrenia. Nat Genet. 2011;43:860–863. doi: 10.1038/ng.886. [DOI] [PubMed] [Google Scholar]
  • 49.Li J, et al. Genes with de novo mutations are shared by four neuropsychiatric disorders discovered from NPdenovo database. Mol Psychiatry. 2016;21:298. doi: 10.1038/mp.2015.58. [DOI] [PubMed] [Google Scholar]
  • 50.Michaelson JJ, et al. Whole-genome sequencing in autism identifies hot spots for de novo germline mutation. Cell. 2012;151:1431–1442. doi: 10.1016/j.cell.2012.11.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Francioli LC, et al. Genome of the Netherlands Consortium Genome-wide patterns and properties of de novo mutations in humans. Nat Genet. 2015;47:822–826. doi: 10.1038/ng.3292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Kleinberger J, Maloney KA, Pollin TI, Jeng LJ. An openly available online tool for implementing the ACMG/AMP standards and guidelines for the interpretation of sequence variants. Genet Med. 2016;18:1165. doi: 10.1038/gim.2016.13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Richards S, et al. ACMG Laboratory Quality Assurance Committee Standards and guidelines for the interpretation of sequence variants: A joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med. 2015;17:405–424. doi: 10.1038/gim.2015.30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Hon GC, et al. 5mC oxidation by Tet2 modulates enhancer activity and timing of transcriptome reprogramming during differentiation. Mol Cell. 2014;56:286–297. doi: 10.1016/j.molcel.2014.08.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Ament SA, et al. Bipolar Genome Study Rare variants in neuronal excitability genes influence risk for bipolar disorder. Proc Natl Acad Sci USA. 2015;112:3576–3581. doi: 10.1073/pnas.1424958112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Anonymous; Psychiatric GWAS Consortium Bipolar Disorder Working Group Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. Nat Genet. 2011;43:977–983. doi: 10.1038/ng.943. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Nakamura H, Cook RN, Justice MJ. Mouse Tenm4 is required for mesoderm induction. BMC Dev Biol. 2013;13:9. doi: 10.1186/1471-213X-13-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Philp NJ, Ochrietor JD, Rudoy C, Muramatsu T, Linser PJ. Loss of MCT1, MCT3, and MCT4 expression in the retinal pigment epithelium and neural retina of the 5A11/basigin-null mouse. Invest Ophthalmol Vis Sci. 2003;44:1305–1311. doi: 10.1167/iovs.02-0552. [DOI] [PubMed] [Google Scholar]
  • 59.Chen S, et al. Effects of flanking genes on the phenotypes of mice deficient in basigin/CD147. Biochem Biophys Res Commun. 2004;324:147–153. doi: 10.1016/j.bbrc.2004.08.232. [DOI] [PubMed] [Google Scholar]
  • 60.Zhou X, et al. The development of the refractive status and ocular growth in C57BL/6 mice. Invest Ophthalmol Vis Sci. 2008;49:5208–5214. doi: 10.1167/iovs.07-1545. [DOI] [PubMed] [Google Scholar]
  • 61.Chou TH, et al. Postnatal elongation of eye size in DBA/2J mice compared with C57BL/6J mice: In vivo analysis with whole-eye OCT. Invest Ophthalmol Vis Sci. 2011;52:3604–3612. doi: 10.1167/iovs.10-6340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Hemara-Wahanui A, et al. A CACNA1F mutation identified in an X-linked retinal disorder shifts the voltage dependence of Cav1.4 channel activation. Proc Natl Acad Sci USA. 2005;102:7553–7558. doi: 10.1073/pnas.0501907102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Lin Z, et al. The association between maternal reproductive age and progression of refractive error in urban students in Beijing. PLoS One. 2015;10:e0139383. doi: 10.1371/journal.pone.0139383. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Khor CC, et al. Nagahama Study Group Genome-wide association study identifies ZFHX1B as a susceptibility locus for severe myopia. Hum Mol Genet. 2013;22:5288–5294. doi: 10.1093/hmg/ddt385. [DOI] [PubMed] [Google Scholar]
  • 65.Shi Y, et al. A genome-wide meta-analysis identifies two novel loci associated with high myopia in the Han Chinese population. Hum Mol Genet. 2013;22:2325–2333. doi: 10.1093/hmg/ddt066. [DOI] [PubMed] [Google Scholar]
  • 66.Aït-Ali N, et al. Rod-derived cone viability factor promotes cone survival by stimulating aerobic glycolysis. Cell. 2015;161:817–832. doi: 10.1016/j.cell.2015.03.023. [DOI] [PubMed] [Google Scholar]
  • 67.Benjamin B, Davey JB, Sheridan M, Sorsby A, Tanner JM. Emmetropia and its aberrations; a study in the correlation of the optical components of the eye. Spec Rep Ser Med Res Counc (G B) 1957;11:1–69. [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary File
Supplementary File
pnas.1615970114.sd02.xls (33.5KB, xls)

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES