Reduced skeletal muscle fiber size following caloric restriction is associated with calpain-mediated proteolysis and attenuation of IGF-1 signaling

Abstract

Caloric restriction decreases skeletal muscle mass in mammals, principally due to a reduction in fiber size. The effect of suboptimal nutrient intake on skeletal muscle metabolic properties in neonatal calves was examined. The longissimus muscle (LM) was collected after a control (CON) or caloric restricted (CR) diet was cosnumed for 8 wk and muscle fiber size, gene expression, and metabolic signal transduction activity were measured. Results revealed that CR animals had smaller (P < 0.05) LM fiber cross-sectional area than CON, as expected. Western blot analysis detected equivalent amounts of peroxisome proliferator-activated receptor-γ coactivator-1α (PGC1α) but reduced (P < 0.05) amounts of the splice-variant, PGC1α-4 in CR LM. Expression of IGF-1, a PGC1α-4 target gene, was 40% less (P < 0.05) in CR than CON. Downstream mediators of autocrine IGF-1 signaling also are attenuated in CR by comparison with CON. The amount of phosphorylated AKT1 was less (P < 0.05) in CR than CON. The ratio of p4EBP1^T37/46 to total 4EBP1, a downstream mediator of AKT1, did not differ between CON and CR. By contrast, protein lysates from CR LM contained less (P < 0.05) total glycogen synthase kinase-3β (GSK3β) and phosphorylated GSK3β than CON LM, suggesting blunted protein synthesis. Smaller CR LM fiber size associates with increased (P < 0.05) calpain 1 (CAPN1) activity coupled with lower (P < 0.05) expression of calpastatin, the endogenous inhibitor of CAPN1. Atrogin-1 and MuRF expression and autophagy components were unaffected by CR. Thus CR suppresses the hypertrophic PGC1α-4/IGF-1/AKT1 pathway while promoting activation of the calpain system.

modification of skeletal muscle growth in both young and old can be achieved by diet, hormones, and exercise (21, 64, 71). Caloric restriction (CR), a dietary regimen low in calories without undernutrition, extends longevity in animal models through both metabolic alterations and epigenome modifications (for review see Ref. 17). In adult skeletal muscle, CR (60~70% of ad libitum) is associated with a reduction in fiber size, reduced reactive oxygen species production within the mitochondria (8, 9), improved metabolic flexibility (73), and an increased reliance on mitochondrial oxidative phosphorylation (OXPHOS) energy generation (15). Peroxisome proliferator-activated receptor-γ coactivator-1α (PGC1α) is a critical mediator of muscle metabolism through its ability to stimulate both mitochondria biogenesis and gene transcription (18). Differential promoter use coupled with alternative mRNA splicing leads to four distinct isoforms of PGC1α with each demonstrating unique functions (53). PGC1α1 is primarily responsible for transcription of genes involved in mitochondria function and oxidative phosphorylation. By contrast, PGC1α4 does not regulate most known PGC1α1 target genes but does serve as positive regulator of myofiber hypertrophy (14, 57, 75). The isoform increases in response to resistance exercise and ectopic expression of PGC1α4 in mice increases myofiber size and power output (57). The underlying mechanism of action for PGC1α4 likely is linked to its ability to upregulate IGF-1 expression and suppression of myostatin transcription in the muscle fiber.

During periods of hypertrophy, insulin-like growth factor (IGF-1) is a critical purveyor of glucose and amino acids to meet the protein synthetic demands of the tissue. Ablation of the IGF-1 receptor in skeletal muscle results in smaller myofibers in young mice (39). In a similar manner, gain of function studies demonstrate that ectopic IGF-1 delivery increases muscle size, accelerates muscle repair, and counteracts partially the effects of sarcopenia (45, 69, 76). The mechanism by which IGF-1 elicits its promyogenic effects includes signaling through the phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT)/mammalian target of rapamycin complex (mTOR) pathway. Upon activation by 3-phosphoinositide-dependent protein kinase 1 (PDK1), AKT phosphorylates mTORC1, a primary driver of nutrient-regulated protein synthesis. mTORC1 serves to phosphorylate S6 kinase (S6K1), which in turn modifies components of the ribosomal translational machinery (24, 37). The kinase complex also phosphorylates the binding proteins of eIF4 (4EBP), thus eliminating their repressive hold on the translation elongation factor (23).

The actions of the IGF-1/AKT/mTOR pathway may be blunted and protein degradation signaling activated during muscle loss. Coincident with the loss of hypertrophic signaling is an increase in negative regulatory signals that limit muscle size. Muscle atrophy as a consequence of cachexia, disuse, or denervation often is associated with an increase in myostatin (MSTN) expression and activity (35, 60). Originally identified in excessively muscled cattle, MSTN is a potent inhibitor of myoblast proliferation and fiber hypertrophy (41, 54, 70). Inhibition of MSTN bioactivity through activin receptor IIb disruption (49, 78), overexpression of latent-associated peptide (LAP), or ectopic follistatin (6) is sufficient to augment muscle loss and increase protein synthesis. Moreover, IGF-I can inhibit MSTN-induced Smad2 signaling during myofiber formation providing evidence for a counterregulatory loop that suppresses proteolysis during periods of hypertrophy (55).

There are three well-known intracellular systems that participate in skeletal muscle proteolysis: ubiquitin-proteasome system (UPS), autophagy, and calpain-calpastatin system (5, 7). Both UPS and autophagy can be suppressed by AKT/mTOR signaling (62). Atrogin-1 and MuRF-1 are E3 ubiquitin ligases found in skeletal muscle that catabolize proteins (28); expression of these ligases is mediated by the transcription factor FOXO3 (33). Microtubule-associated protein 1A/1B light chain 3 (LC3) is used as readout of autophagic activity. Cytosolic LC3-I is conjugated to phosphatidylethanolamine to produce LC3-II, a protein enriched in autophagosomes and autolysosomes (74). Under conditions of nutrient deprivation, LC3-II amounts exceed those of LC3-I and vice versa during periods of sufficient cellular and tissue nutrient availability (9). The final muscle protein catabolism system includes the ubiquitous calpain-1 and -2, also referred to as µ- and M-calpain, and their endogenous inhibitor, calpastatin (26). Although both are Ca²⁺-activated proteases, only calpain 1 (CAPN1) is bioactive at physiological concentrations of Ca²⁺ in skeletal muscle (47). Substrates for CAPN1 include titin, desmin and a-actinin suggesting a role for the protease during myofibrillar protein turnover (26). Moreover, genetic ablation of CAPN1 in mice disrupts skeletal muscle proteostasis and increases the size of type II fibers (30). Calpain 3 (CAPN3), also a Ca²⁺-activated protease found in skeletal muscle, can degrade muscle proteins in vitro and mutations of the gene cause limb girdle muscle dystrophy (31, 32). A role for CAPN3 during normal muscle protein turnover remains unclear due to an absence of phenotype in transgenic mice ectopically expressing the protein and undetermined in vivo substrates (20, 68).

Nutritional insults, such as CR, early in life may deter muscle growth and alter metabolism during adolescence and adulthood. Although a prevalence of data exists supporting diminished AKT/mTOR activity and accelerated protein degradation signaling during muscle atrophy in adults (reviewed in Refs. 59, 61, 64), little information exists regarding the status of the intracellular signaling pathway during suboptimal muscle growth in neonates. The hypothesis that neonatal muscle responds to reduced caloric intake by suppression of protein synthesis signaling pathways was tested. Specifically, muscle sample analyses were designed to examine the impact of CR on muscle size, IGF-1 signaling systems, PGC1α-directed gene transcription, and protein degradation system in neonatal calves.

MATERIALS AND METHODS

Animals and husbandry.

Animal experiments were completed in accordance with and with the approval of the Virginia Polytechnic Institute and State University Institutional Animal Care and Use Committee (No. 14-045-DASC). Muscle samples were obtained from heifers participating in an experiment designed to examine the effect of diet on prepubertal mammary gland development (22). In summary, 1-wk-old female calves (39.0 ± 4.4 kg) were assigned randomly to a control [CON, n = 5; 28.9% crude protein (CP), 26.2% fat; 5.2 Mcal/kg] or caloric restricted (CR, n = 5; 20.9% CP, 19.8% fat; 4.8 Mcal/kg) milk replacer diet for 8 wk. Total daily caloric intake of CR was 50% of CON. Grain (25% CP, 4% fat) was pair fed beginning at week 5. These diets resulted in average daily gain of 771 and 220 g/day for CON and CR calves, respectively (22). Upon weaning at 8 wk of age, the animals were euthanized humanely by phenobarbital overdose (Fatal-Plus; Vortech Pharmaceuticals, Dearborn, MI). Two subsamples of the longissimus thoracis muscle (LM) were collected and snap-frozen in liquid nitrogen for protein and gene expression assays. An additional LM subsample was fixed in 4% paraformaldehyde in PBS (vol/vol) overnight at 4°C for histology and immunocytochemistry. The Virginia Polytechnic Institute and State University Institutional Animal Care and Use Committee approved this study.

Histology.

A subsample of the LM was fixed in 4% formaldehyde followed by overnight immersion in 30% sucrose at 4°C. The specimens were embedded in optimal cutting temperature medium (Tissue-Tek OCT; VWR Scientific, Radnor, PA) and nonserial 10-μm cryosections were collected onto glass slides (Superfrost; ThermoFisher Scientific, Willmington, MA). Cryosections (4/animal) were incubated with 1% bovine serum albumin in phosphate-buffered saline (PBS) containing 0.1% Triton X-100 for 20 min at room temperature. Texas Red conjugated wheat germ agglutinin (WGA) (1:200) was used to stain the basal lamina. Hoechst 33342 (1 μg/ml; Life Technologies) was used for the detection of nuclei. After being washed with PBS, the slides were coverslipped and were visualized by epifluorescence (Nikon Eclipse Ti-U; Nikon Instruments, Melville, NY). Representative images were captured at 200-fold magnification and digitized with a charge-coupled camera (DS-QiMC; Nikon) and NIS Elements software (Nikon). The region constrained by WGA labeled basal lamina border was measured for CSA. A minimum of 500 muscle fibers from nonserially collected cryosections was analyzed for CSA for each individual.

Quantitative real-time PCR.

Total RNA was extracted from the LM using TRIzol (ThermoFisher) and isolated by spin column technology (PureLink Mini Kit; ThermoFisher). Contaminating DNA was removed with DNase I (ThermoFisher). A High Capacity cDNA Reverse Transcription kit (Invitrogen, Carlsbad, CA) was used to convert RNA into cDNA, according to the manufacturer’s instructions. Real-time PCR reactions were performed with Power SYBR Green PCR Master mix (Invitrogen) using gene-specifc primers (Table 1) in an Eppendorf Realplex thermocycler (Eppendorf, Hamburg, Germany). The optimum thermal cycling parameters included 95°C for 10 min, 40 cycles of 95°C for 15 s, 60°C for 1 min, 95°C for 15 s, 60°C for 15 s, and 95°C for 15 s. The fold change for all the samples was calculated by 2^−△△CT methods. Cyclophilin B was used as housekeeping gene.

Table 1.

Real-time PCR primer sequences

Gene	Sequence (5′-3′)	Product Size, bp
Cyclophilin β		121
Forward	GGCTCCCAGTTCTTCATCAC
Reverse	CGTCAGTCTTGGTGCTCTCT
PGC1α		122
Forward	ATCTTCCTGAACTTGACCTT
Reverse	CTCGTTGTTGTACTGATTAG
FOXO3		178
Forward	CAAACCCTCTCGGACTCTGT
Reverse	AATCCAACCCATCAGCATCC
Atrogin-1		133
Forward	CTGGTGGGGAACATCAACAT
Reverse	GAAGCACAAAGGCAGTCT
MuRF1		183
Forward	TCAACATCTACTGCCTCACG
Reverse	GCTGAGTGATGATGGTCTGC
IGF-I		248
Forward	ATCACATCCTCCTCGCATCT
Reverse	TACATCTCCAGCCTCCTCAG
Myostatin		162
Forward	ACAACCTGAATCCAACTTAG
Reverse	TCAAGCCCAAAATCTCTCCT
Follistatin		178
Forward	GCTGTGCCCTGAGAGTAAGT
Reverse	GTCTTCATCTTCCTCCTCGT

Western blot analysis.

To determine protein expression, flash-frozen LM were homogenized in ice-cold RIPA buffer (Sigma-Aldrich, St. Louis, MO) containing protease and phosphatase inhibitor cocktail (Pierce, Rockford, IL). Homogenates were cleared by centrifugation at 10,000 g for 10 min at 4°C. Protein concentrations were determined using a BCA protein assay kit (Pierce). Samples were electrophoresed in Novex Tris-Glycine gels (Invitrogen) and transferred onto nitrocellulose membranes using an iBlot transfer system (Invitrogen). Positive controls included bovine satellite cell lysates and lysates from COS cells ectopically expressing PGC1α1 (KP9804-1EA; EMD Millipore, Billerica, MA). Membranes were blocked for 1 h at room temperature in Tris-buffered saline (TBS) containing 5% nonfat dry milk and 0.1% Tween-20 and subsequently were incubated with primary antibodies diluted 1:1,000 in TBS containing 5% BSA and 0.1% Tween-20 overnight at 4°C. Anti-PGC1α (cat. no. ST1202) and anti-myostatin (cat. no. AB3239) were purchased from EMD Millipore. Anti-LC3B (cat. no. NB600-1384) was purchased from Novus (Littleton, CO). Anti-AKT1 (cat. no. 4691s), anti-phospho-AKT1^S473 (cat. no. 4060s), anti-phospho-AKT1^T308 (cat. no. 9275s), anti-glycogen synthase kinase-3β (anit-GSK3β; cat. no. 9832s), anti-phospho-GSK3β^S9 (cat. no. 5558s), anti-4EBP1 (cat. no. 9452), anti-phospho-4EBP1^T37/46 (cat. no. 2855s), anti-S6K1 (cat. no. 2708s), anti-phospho-S6K1^T389 (cat. no. 9234s), anti- AMP kinase-α (anit-AMPKα; cat. no. 5832s), anti-phospho-AMPKα^Thr172 (cat. no. 2535s), anti-calpain 1 (cat. no. 2556), anti-calpain 2 (cat. no. 2539), and anti-α/β tubulin (cat. no. 2148) were purchased from Cell Signaling Technologies (Danvers, MA). After being washed, immunoreactive bands were detected with appropriate peroxidase-conjugated goat anti-mouse IgG (cat. no. 62–6520) or goat anti-rabbit IgG (cat. no. 65–6120) antibodies (1:1,000; Invitrogen) diluted in TBS containing 5% BSA and 0.1% Tween-20 and visualized with Novex ECL HRP chemiluminescent substrate reagent kit (Invitrogen). Densitometry analysis was performed using Chemi Doc MP system with Image Laboratory software (Bio-Rad).

Statistical analysis.

Results were analyzed in SAS 9.2 (SAS Institute, Cary, NC) using a general linear model for separation of means. Comparisons were considered significant at P < 0.05. Data are shown as means ± SE.

RESULTS

The effect of 8-wk CR was examined in the LM of young female calves. Subsamples of CON and CR LM were stained with fluorescent-labeled WGA and the area was constrained by the basal lamina was measured (Fig. 1A). CON animals exhibited a larger (P < 0.05) LM CSA than the CR animals (Fig. 1B), which translated into fewer fibers per unit area (Fig. 1C). These results provide evidence that the CR diet was sufficient to limit LM fiber hypertrophy in neonates.

Fig. 1.

Caloric restriction restricts longissimus muscle fiber growth. Cyrosections from the longissimus of control (CON; n = 5) and calorie-restricted (CR; n = 5) animals were analyzed by wheat germ agglutinin (WGA) histology (A) for the measurement of cross-sectional area (CSA; B). C: fiber number per unit area was calculated. Scale bar = 100 μm. Values are means ± SE. *P < 0.05, significant difference.

The reduction in caloric intake may cause an alteration in energy status in the muscle. CON and CR LM lysates were analyzed by Western blot for total and phosphorylated AMP kinase (AMPK), a recognized cellular energy sensor in eukaryotes. Results demonstrate that CON and CR LM lysates contain equivalent amounts of the kinase (Fig. 2A). Phosphorylated AMPK, a readout of elevated AM-to-ATP ratio, did not differ between CON and CR lysates. Calculation of the ratio of phosphorylated to total AMPK did not differ between the groups suggesting that enzymatic activities were equivalent (Fig. 2B).

Fig. 2.

Caloric restriction does not initiate AMPK activation. A: CON (n = 5) and CR (n = 5) longissimus lysates were analyzed by Western blot for activity of total and phosphorylated AMPK^T172. Representative blots from 2 animals per treatment are shown. B: α/β-tubulin content was used for densitometry normalization. CR lysates contained similar amount of total AMPK and pAMPK^T172 as CON. Values are means ± SE.

CR of adult mice causes an increase in PGC1α expression and mitochondria biogenesis leading to improved metabolic efficiency (34). The effect of CR on PGC1α expression in muscle tissue was examined in growing calves. Expression of the total PGC1α mRNA content was first measured by quantitative (q)PCR using primers designed to amplify all four PGC1α isoforms. The LM in CR animals exhibited a 40% reduction (P < 0.05) in total PGC1α mRNA content by comparison with CON (Fig. 3A). Decreased PGC1α was confirmed by Western blot using equivalent amounts of protein. Muscle isolates from CON and CR animals contained similar amounts of the splice variants, PGC1α-1, α-2, and α-3, but substantially (P < 0.05) less PGC1α-4 was detected in the CR LM lysates (Fig. 3B). Quantification of PGC1α-4 in the two groups revealed that CR protein lysates contained nearly 50% less than CON (Fig. 3C). Because PGC1α-4 drives transcription of IGF-1 in skeletal muscle (57), expression of the target gene was examined in total RNA isolates from CR and CON muscle. Quantitative (q)PCR results demonstrate that IGF-1 transcripts were less abundant (P < 0.05) in CR than CON (Fig. 3D).

Fig. 3.

Caloric restriction reduces PGC1α-4 protein abundance and expression of the downstream target gene, IGF-1. CON (n = 5) and CR (n = 5) longissimus lysates were analyzed for total peroxisome proliferator-activated receptor-γ coactivator-1α (PGC1α) mRNA (A) and PGC1α protein isoform expression (B). Representative Western blots of 2 animals per treatment are shown. Whole cell lysates of COS1 cells transfected with wild-type PGC1α-1 was used as the positive control. C: the relative abundance of PGC1α-4 protein normalized to α/β tubulin was lower in CR lysates. D: quantitative (q)RT-PCR demonstrates a reduction in IGF-1 mRNA expression in CR. Values are means ± SE. *P < 0.05, significant difference.

Signal transduction elicited in response to IGF-1 includes sequential phosphorylation and activation of AKT, S6K1, and 4EBP1. The effects of reduced autocrine IGF-1 were examined in CON and CR muscle lysates by Western blot detection of the activated forms of key intracellular kinases and proteins (Fig. 4A). Activation of AKT was blunted in CR muscle as denoted by a reduction (P < 0.05) in phospho-AKT1^S473 (Fig. 4B). Phospho-AKT^T308 was absent in both CON and CR (Fig. 4A). No differences were noted in the absolute amounts of the kinase. Neither CR nor CON lysates contained detectable amounts of phosphorylated S6K1 (data not shown). In addition to altered signaling through AKT, distinctive phosphorylation patterns at the level of 4EBP1 also were noted. By comparison with CON, CR protein lysates contained greater (P < 0.05) amounts of total 4EBP1 (Fig. 4, A and C). The greater total content also resulted in more (P = 0.07) phosphorylated forms of the protein (Fig. 4C). However, the ratio of phospho to total 4EBP1 did not differ between CON and CR (Fig. 4C). The IGF-1/AKT signaling axis affects protein synthesis through the phosphorylation and subsequent inactivation of glycogen synthase kinase-3β (GSK3β), which in turn releases eIF2B for use in mRNA translation. The phosphorylation status of GSK3β was examined in muscle lysates from CON and CR animals. Western blot demonstrated that both total and phosphorylated forms of the protein were lower (P < 0.05) in CR by comparison with CON (Fig. 4A). The ratio of phospho:total GSK3β did not differ between the groups (Fig. 4D). These results demonstrate that the attenuated PGC1α-4/IGF-1/AKT signaling may contribute to the suboptimal protein synthesis in skeletal muscle upon CR, through an S6K1- and 4EBP1-independent mechanism.

Fig. 4.

Signaling through AKT is disrupted in CR skeletal muscle. A: CON (n = 5) and CR (n = 5) longissimus lysates were analyzed by Western blot for activity of the IGF-1 signaling intermediates, AKT1, 4EBP1, and glycogen synthase kinase-3β (GSK3β). B: representative blots of 2 animals per treatment are shown. Bovine satellite cell lysates were used as a positive control (+). CR lysates contained less pAKT1^S473 by comparison with CON. C: the abundance of total and phosphorylated 4EBP1 normalized to tubulin was greater in CR. D: tubulin-normalized amounts of total and pGSK3β^S9 were lower in CR (D). Values are means ± SE. *P < 0.05, significant difference.

Myostatin (MSTN) is a negative regulator of muscle mass (57). MSTN can block AKT/mTOR activity and is associated with increased expression of ubiquitin ligases (4, 27). Quantitative PCR was used to measure expression of MSTN, follistatin, a MSTN antagonist, and atrogin, MuRF, and FOXO3, downstream mediators of MSTN activity in CON and CR muscle lysates (Fig. 5A). Results indicate that MSTN mRNA abundance was less (P < 0.05) in CR than in CON, while no difference in expression of follistatin, atrogin, MuRF, or FOXO3 was observed. MSTN requires proteolytic processing into NH₂-terminal LAP, an inhibitor of MSTN and the bioactive COOH-terminal mature myostatin peptide (19). LM content of the various forms of MSTN was measured by Western blot and densitometry. Very small amounts of precursor or mature MSTN proteins were found in the CON and CR lysates (Fig. 5B). By contrast, ample quantities of LAP were present in the CON and CR LM lysates. Densitometry revealed no difference in the amount of LAP or mature MSTN between CON and CR (Fig. 5C). The amount of MSTN precursor was insufficient for reliable quantification. Thus excess MSTN expression and activity do not contribute to reduced muscle size in CR animals.

Fig. 5.

Myostatin gene expression in the longissimus is reduced by CR. A: total RNA from CR (n = 5) and CON (n = 5) longissimus was analyzed by quantitative (q)PCR for expression of myostatin (MSTN), follistatin, FOXO3, atrogin-1, and MuRF-1. B: CR and CON longissimus lysates were analyzed by Western blot to detect the total and processed forms of myostatin. C: representative blots from 2 animals per treatment are shown. Densitometry reveals no difference in latent-associated peptide (LAP) and mature MSTN content between CR and CON. LAP, latency-associated peptide. Values are means ± SE. *P < 0.05, significant difference.

Skeletal muscle protein turnover represents the combined efforts of protein synthesis and degradation. The limited amount of hypertrophy, and subsequent protein accretion, in CR LM may be due to altered protein degradation and autophagic flux. LC3, a marker protein of autophagosomes, was measured in CON and CR LM lysates by Western blot (Fig. 6A). No difference in LC3-I amount was noted between CON and CR (Fig. 6A). The absence of LC3-II in both CON and CR LM lysates (Fig. 6A) suggests the presence of few autophagosomes. Calpain 1 and 2 (CAPN1 and CAPN2), key proteases involved in myofibrillar protein degradation, were examined in the lysates. Both CAPN1 and CAPN2 undergo autolysis to yield a bioactive protease (Fig. 6A). Lysates from CR animals contained greater (P < 0.05) amounts of autolyzed CAPN1 than CON lysates indicating increased activity of the protease (Fig. 6B). Reduced (P < 0.05) amounts of unprocessed CAPN2 were observed in CR LM lysates that did not translate to increased amounts of autolyzed, active enzyme (Fig. 6C). In the absence of a suitable calpastatin antibody, expression of the CAPN1/2 inhibitor was measured by qPCR. Results demonstrated a 30% reduction (CON = 1.01 ± 0.07, CR = 0.71 ± 0.03, P = 0.035) in the CR LM by comparison with CON counterparts. Summation of these results indicate that CR causes an increase in CAPN1 proteolysis that may underlie the blunted hypertrophic response in the LM.

Fig. 6.

Muscle proteolysis is affected by CR. A: autophagic flux in CON (n = 5) and CR (n = 5) muscle lysates was measured by Western blot using anti-LC3. Bovine satellite cell lysates were used as a positive control (+) for expression of LC3-I and LC3-II. Representative blots from 2 animal per treatment are shown. LC3-II was not detected in the muscle lysates. calpain 1 (CAPN1) and CAPN2 content and activation was measured by Western blot. B: representative blots of 2 animals per treatment are shown. α/β tubulin was used as a loading and normalization control. CR lysates contain greater amounts of autolyzed (active) CAPN1 than CON lysates. C: no difference in the amount of CAPN2 was noted between CR and CON. Values are means ± SE. *P < 0.05, significant difference.

DISCUSSION

CR in neonatal mammals has not been extensively studied and may elicit a very different effect in growing animals by comparison with adults. The young animal is programmed for rapid protein accretion and growth while the adult is primarily focused on maintenance of muscle mass (10, 56). CR in adults suppresses AKT/mTOR signaling and protein synthesis and increases autophagy possibly to remove damaged organelles and limit further damage due to reactive oxygen species (33, 43). Our results indicate that hypertrophy predominates in young calves and suppression of AKT1 signaling neither initiates transcription of protein degradation genes nor stimulates autophagy. In most model systems (mice, Caenorhabditis elegans, and Drosophila), CR is 30% of ad libitum feeding of a common diet and is implemented to extend the adult lifespan (16, 42, 44, 67). By definition, the extent of dietary restriction used herein was 50% less than CON, which was sufficient to limit body weight gain and muscle growth. A similar result was reported for young lambs fed 65% of recommended caloric intake (77). Calorie restricted lambs gained less body weight, had smaller muscle fiber CSAs, and contained less phosphorylated AKT in the muscle. Although CR results in a similar muscle phenotype, young animals appear to lack the autophagic and proteolytic response of adults.

The reduced myofiber hypertrophy in CR animals was correlated with a decrease in IGF-1 mRNA content and subsequently blunted AKT1 phosphorylation and activation. This suggests that the autocrine pathway is intact in the muscle but insufficient to support optimal growth. The cause of the reduced IGF-1 expression may be due to lower amounts of the transcriptional activator PGC1α-4. The PGC1α splice variant is upregulated during exercise-induced hypertrophy wherein it positively affects IGF-1 transcription with no demonstrable effects on mitochondria biogenesis (57). The truncated form of PGC1α is induced following both resistance and endurance exercise in men, with resistance exercise typically considered a hypertrophic stimulus (66). PGC1α-4 also represses expression of MSTN, which may further assist fiber growth. Rapidly growing CON animals contained abundant amounts of both PGC1α-4 and IGF-1 mRNA supporting a role for the splice variant during the normal fiber growth processes typified in young animals. It is interesting to note, however, that CR muscle cells expressed very low levels of MSTN, which is counter to our expectation that low PGC1α-4 and a smaller fiber diameter would be associated with increased MSTN. Although MSTN expression in skeletal muscle is increased after extreme food restriction such as fasting (3), others report MSTN expression is attenuated by chronic mild food restriction (12). Neonatal rat pups maintained as a large litter (22–24 pups) contained lower levels of MSTN mRNA at weaning by comparison with controls (12). Thus it remains unclear if lower levels of MSTN in CR muscle are a result of downregulation of the gene or if CON muscle content is inflated due to excess nutrient stimulation of the gene. The interplay between caloric intake and MSTN expression is intriguing and requires additional experiments.

AKT1 phosphorylation underlies its ability to transmit downstream signals. Two key events lead to full activation; first is phosphorylation of the catalytic domain on threonine 308 (T308) and the second is phosphorylation of serine 473 (S473). In skeletal muscle, PDK1 is responsible for phosphorylation of T308 and PDK1 mediates the effects of insulin on the tissue (2). Although the identity of the kinase responsible for S473 phosphorylation in skeletal muscle remains unresolved, this regulatory site within the hydrophobic motif of AKT is phosphorylated by mTORC2 in cardiomyocytes (46). Phosphorylation of AKT1^T308 is a driving force behind activation of mTORC1 and subsequent protein synthesis (1). In both CON and CR skeletal muscle protein lysates, phosphorylated AKT1^T308 was absent. This is likely attributed to the fasted condition of the animals before euthanasia. Rats fasted for 90 min contained undetectable amounts of phospho-AKT^T308 in the soleus, which became readily apparent following treatment with insulin (63). Young men fasted overnight contain very low amounts of phospho-AKT^S473 and undetectable amounts of phospho-p70S6K1^T389, both of which become activated (phosphorylated) in response to exercise (25). Thus there is evidence for fasting effects on protein synthesis biomarkers. Independent of the fasting effects, CR muscle lysates contained smaller amounts of phospho-AKT^S473 and a lower phospho:total AKT indicating compromised protein synthesis in the restricted animals. Reduced protein synthesis, in turn, contributes to the smaller muscle fibers observed following CR.

Signaling through AKT in response to IGF-1 causes an increase in phosphorylation of GSK3β and a subsequent release of eIF2B (62). The end result is repression of GSK3β and increased availability of the ribosome component for protein synthesis and cell survival (51). Muscle lysates from CR animals contained lower amounts of phosphorylated GSK3β, which is expected to serve as a block to muscle protein synthesis and compromise muscle fiber growth. Interestingly, the total amounts of enzyme also were lower in CR lysates making the ratio of inactive to total GSK3β similar in CON and CR. This suggests that transcription and/or translation of the enzyme are regulated in part by caloric intake. The amounts of phosphorylated and total GSK3β were equivalent in soleus muscles before and immediately after hindlimb suspension, a model of atrophy (72). Regrowth following unloading resulted in an increase in the amounts of both total and phosphoGSK3b in support of our findings that absolute amounts of the enzyme are correlated with hypertrophy. However, the authors also report that amounts of total and inactive GSK3β remained unchanged in the plantaris at initiation of suspension, at postsuspension (atrophy), and during muscle regrowth. Skeletal muscle-specific ablation of GSK3β demonstrates that an absence of the protein does not affect regrowth of either the gastrocnemius or soleus following hindlimb suspension (50). A modest improvement in rate of hypertrophy was noted, which could be attributed to enhanced satellite cell activity. Thus we conclude that the absence of a consistent correlation between muscle size and GSK3β strongly suggests that the enzyme plays a minor role modulating muscle mass.

Protein accretion in muscle occurs when synthesis rates exceed those of degradation. The minimal amount of hypertrophy exhibited by the CR muscle may be attributed to elevated protein degradation. CAPN1, or µ-calpain, activity is a major contributor to skeletal muscle proteolysis. Increased autolysis and activation of CAPN1 occur during hindlimb suspension leading to muscle atrophy (19, 29), short-term exposure to cold temperature (36), denervation (38), and mouse models of aging (48). Suppression of CAPN1 by ectopic calpastatin expression (30, 58) or chemicals (65) partially prevents or restores muscle morphology and normal physiology. The results of this study demonstrate that reduced dietary energy levels are sufficient to increase CAPN1 activity in muscle. Increased CAPN1 bioactivity coupled with decreased calpastatin expression likely contributes to the lower amounts of muscle protein deposition and subsequent smaller fiber size in CR muscle. Although the calpain-calpastatin system is affected, neither autophagic flux nor ubiquitin ligase gene expression is affected by CR. Skeletal muscle autophagy is critical to tissue metabolism and delays the onset of sarcopenia and loss of muscle size and power (13). The positive influences of autophagy on muscle health are further noted by ability of CR to offset the detriments of sarcopenia in rats (52) and monkeys (40). The absence of LC3-II in both CON and CR muscle lysates may reflect positive nitrogen balance (hypertrophy), energy status (sufficient ATP:AMP) and animal age. Prolonged CR leading to complete suppression of fiber growth and or atrophy may be required to promote autophagy.

Perspectives and Significance

The results presented herein support the hypothesis that a protracted reduction in caloric intake will suppress both body and muscle fiber growth during early postnatal development. Reduced fiber hypertrophy by CR is due, in part, to attenuated PGC1α-4/IGF-1/AKT1-signaling and increased calpain directed proteolysis. Blunted protein synthesis coupled with elevated protein degradation leads to suboptimal protein accretion and diminished muscle hypertrophy.

GRANTS

This material is based on work that is supported by the National Institute of Food and Agriculture, US Department of Agriculture, under award number 2014-67015-21605.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the author(s).

AUTHOR CONTRIBUTIONS

Y.L., J.S.B., S.R.M., and J.M.G. performed experiments; Y.L., J.S.B., and J.M.G. analyzed data; Y.L., J.M.G., A.D.E., and S.E.J. interpreted results of experiments; Y.L. prepared figures; Y.L., S.R.M., J.M.G., A.D.E., and S.E.J. edited and revised manuscript; Y.L., J.S.B., S.R.M., J.M.G., A.D.E., and S.E.J. approved final version of manuscript; S.E.J. drafted manuscript.