A Serendipitous Mutation Reveals the Severe Virulence Defect of a Klebsiella pneumoniae fepB Mutant

In addition to having a reputation as the causative agent of several types of hospital-acquired infections, Klebsiella pneumoniae has gained widespread attention as a pathogen with a propensity for acquiring antibiotic resistance. It is capable of causing a range of infections, including urinary tract infections, pneumonia, and sepsis. Because of the rapid emergence of carbapenem resistance among Klebsiella strains, there is a dire need for a better understanding of virulence mechanisms and identification of new drug targets. Here, we identify the periplasmic transporter FepB as one such potential target.

ABSTRACT

Klebsiella pneumoniae is considered a significant public health threat because of the emergence of multidrug-resistant strains and the challenge associated with treating life-threatening infections. Capsule, siderophores, and adhesins have been implicated as virulence determinants of K. pneumoniae, yet we lack a clear understanding of how this pathogen causes disease. In a previous screen for virulence genes, we identified a potential new virulence locus and constructed a mutant (smr) with this locus deleted. In this study, we characterize the smr mutant and show that this mutation renders K. pneumoniae avirulent in a pneumonia model of infection. The smr mutant was expected to have a deletion of three genes, but subsequent genome sequencing indicated that a much larger deletion had occurred. Further analysis of the deleted region indicated that the virulence defect of the smr mutant could be attributed to the loss of FepB, a periplasmic protein required for import of the siderophore enterobactin. Interestingly, a ΔfepB mutant was more attenuated than a mutant unable to synthesize enterobactin, suggesting that additional processes are affected. As FepB is highly conserved among the members of the family Enterobacteriaceae, therapeutic targeting of FepB may be useful for the treatment of Klebsiella and other bacterial infections.

IMPORTANCE In addition to having a reputation as the causative agent of several types of hospital-acquired infections, Klebsiella pneumoniae has gained widespread attention as a pathogen with a propensity for acquiring antibiotic resistance. It is capable of causing a range of infections, including urinary tract infections, pneumonia, and sepsis. Because of the rapid emergence of carbapenem resistance among Klebsiella strains, there is a dire need for a better understanding of virulence mechanisms and identification of new drug targets. Here, we identify the periplasmic transporter FepB as one such potential target.

INTRODUCTION

Klebsiella pneumoniae is a Gram-negative bacterium commonly classified as an opportunistic nosocomial pathogen capable of causing a variety of infections, including urinary tract infections, pneumonia, and sepsis (1–5). It is often found as a commensal resident of the gastrointestinal tract, and this is believed to be a primary source of infection (2, 6–8). Recently, K. pneumoniae also has been shown to be capable of causing community-acquired infections such as pyogenic liver abscesses, meningitis, and endophthalmitis (9–11). The increasing prevalence of antibiotic-resistant strains only serves to compound the clinical importance of K. pneumoniae and the difficulty of treating those infected with extended-spectrum β-lactamase-resistant or carbapenem-resistant strains (12–16). Resistance to carbapenems is of particular concern, as they are used as drugs of last resort to treat Gram-negative infections (12, 17).

During infection, sequestration of iron by the host limits the availability of free iron, and as a result, bacteria produce their own chelators to scavenge iron. Iron acquisition is an essential component of most bacterial pathogens, as iron is required for cellular and metabolic activities (18). Siderophores are small secreted molecules with a high affinity for ferric iron; these are classified on the basis of the chemical nature of the Fe³⁺ coordination (19). The catecholate-type siderophore enterobactin is produced by most K. pneumoniae strains (20, 21). However, community-acquired isolates and those that cause invasive disease typically encode additional siderophore systems (salmochelin, yersiniabactin, aerobactin) (22). Salmochelin is a C-glucosylated enterobactin produced by some isolates of Salmonella, Escherichia coli, and Klebsiella, and its synthesis is dependent on enterobactin. Mutants unable to produce enterobactin are also unable to produce salmochelin (23, 24). The iroA locus encodes enzymes necessary to modify enterobactin, as well as proteins required for salmochelin transport (25). The yersiniabactin locus is found in many invasive K. pneumoniae isolates and encodes a phenolate-type siderophore that was first identified as part of a pathogenicity island in Yersinia (26). Interestingly, in a genome-wide association study of a broad range of K. pneumoniae isolates, yersiniabactin was found to be the most prevalent virulence-associated locus and was found to be a predictor of infection versus carriage (22). Aerobactin is yet another siderophore produced by a smaller fraction of K. pneumoniae strains than either enterobactin or yersiniabactin (22). Although aerobactin has a lower affinity for Fe³⁺ than enterobactin or yersiniabactin, it is frequently produced by isolates from pyogenic liver abscesses (27).

To date, the identified virulence factors of K. pneumoniae primarily include capsule, lipopolysaccharide (LPS), fimbriae, and siderophores, and these factors also have been identified as virulence factors in the strain used for the studies presented here (4, 28–34). Several high-throughput studies have been done with mouse models to identify additional bacterial virulence factors (34–40). Two of these screens were signature-tagged mutagenesis (STM) screens for factors affecting gastrointestinal colonization and/or infection of the urinary tract (36, 37). These studies identified adhesins, LPS, and capsule. Another screen for gain of function when Klebsiella genes were expressed in E. coli identified a response regulator, AcrA, and LPS (40). A screen for genes expressed in vivo during septicemia identified genes involved in the use of siderophores (aerobactin and enterobactin) (39), and an STM screen in a model of liver abscess formation identified adhesins and regulators (38). Two of these studies focused on the identification of bacterial genes needed for survival in the lung; one approach used STM, and the other used transposon insertion site sequencing (34, 35). These screens identified capsule, LPS, siderophores, and transcriptional regulators. All of these screens also identified genes predicted to contribute generally to growth, as well as genes of unknown function.

Overall, there has been a lack of overlap in identified genes among the different screens conducted with lung, urinary tract, liver infection, and gastrointestinal colonization models. This may be due to the fact that none of the screens were saturating, or it could be indicative of mechanisms that compensate for the loss of individual genes. These findings are further complicated by the use of different infection models and different pathogen and host strain backgrounds. While typically focused on the goal of identifying previously unknown bacterial factors contributing to disease, these screens primarily identified known virulence factors of K. pneumoniae, as well as metabolic functions generally contributing to growth.

We previously conducted an STM screen of K. pneumoniae in an intranasal model of pneumonia to identify virulence genes (34). From this screen, yersiniabactin was identified as important for the abilities of our strain to colonize the lungs and to cause disseminated infection (33). In addition, a number of mutants with insertions in or near ramA were identified (34). RamA has been implicated in virulence and multidrug resistance in other pathogenic bacteria, and mutations in ramA have been associated with fluoroquinolone resistance in K. pneumoniae (41–44). Furthermore, a recent study reported that overexpression of RamA affects virulence and results in modified LPS (45). Thus, we sought to determine if RamA is a virulence determinant for a highly virulent K. pneumoniae strain. These studies found no role for ramA or nearby genes for virulence in a pneumonia model of infection. However, a serendipitous secondary mutation was identified, and further analysis of this mutation indicates that FepB, a periplasmic protein required for transport of enterobactin and salmochelin, is essential for virulence. Surprisingly, there were interesting differences in virulence between enterobactin synthesis mutants and the ΔfepB mutant.

RESULTS

The smr mutant is severely attenuated in a mouse model of pneumonia.

A previous screen of strain KPPR1 transposon mutants identified genes required for colonization and survival in the lungs of infected mice (34). Thirteen mutants containing disruptions within ramA or an adjacent gene, orf82, failed to be recovered from the lungs and spleens of infected mice. RamA is a transcriptional regulator linked to Salmonella survival in RAW 264.7 macrophages and virulence in BALB/c ByJ mice (41, 42). This led us to hypothesize that the ramA locus is important for the ability of K. pneumoniae to infect the lungs. To test this, we constructed the smr (spontaneous multidrug resistance) mutant, where ramA and the two flanking genes (orf82 and romA) were targeted for deletion, and tested this strain in a mouse model of pneumonia (Fig. 1). The smr mutant caused slightly lower bacterial burdens at 24 h postinoculation (hpi) than KPPR1 (wild type [WT]). At 72 hpi, nearly 5 logs fewer CFU were recovered from mice infected with the smr mutant than from WT-infected mice. The spleens of mice infected with the WT strain had nearly 10⁷ CFU/g of tissue, while the smr mutant was rarely detectable in the spleen at 72 hpi, reflecting a dissemination or systemic survival defect. Together, these data indicate that the smr mutant is essentially avirulent in this infection model.

FIG 1 .

The smr mutant is attenuated in a mouse model of pneumonia. Mice were inoculated i.n. with 2 × 10⁴ CFU of either the WT strain (KPPR1S; black circles) or the Δsmr mutant (VK82; white squares). At 24 or 72 hpi, mice were euthanized and their lungs and spleens were homogenized and plated for bacterial enumeration. Each symbol represents one mouse. The dotted line indicates the limit of detection, and symbols on the dotted line indicate that CFU counts were below the limit of detection. Data are from an individual representative experiment. Mann-Whitney tests were performed for statistical analysis. *, P < 0.05.

Deletions of individual genes in the targeted smr locus do not recapitulate the phenotype of the smr mutant.

To identify the gene(s) responsible for the phenotype of the smr mutant, we made in-frame deletions of each of the three genes (ΔramA, ΔromA, and Δorf82) in the smr locus and tested them in our pneumonia model (Fig. 2A). The phenotype of all three mutant strains resembled that of the WT, suggesting that the loss of a single gene was not sufficient to affect virulence (Fig. 2B). We concluded that neither ramA, orf82, nor romA, individually contributed to virulence in this model or was responsible for the phenotype of the smr mutant.

FIG 2 .

Schematic of smr targeted region and in vivo phenotypes of mutants. (A) Schematic depicting open reading frames within or adjacent to the smr target region (not to scale). Lines indicate the regions deleted in the mutants indicated. (B) Mice were inoculated i.n. with 2 × 10⁴ CFU of the WT strain (KPPR1S; black circles) or the Δsmr (VK082; white squares), ΔramA (VK174; black diamonds), Δorf82 (VK270; white circles), ΔromA (VK131; black squares), Δorf82 ramA romA (VK266; white diamonds), or Δrnd (VK269; inverted triangles) mutant. At 24 or 72 hpi, mice were sacrificed and their lungs and spleens were homogenized and plated for bacterial enumeration. Each symbol represents one mouse. The dotted line indicates the limit of detection, and symbols on the dotted line indicate that CFU counts were below the limit of detection. These data were compiled from several independent experiments. Mann-Whitney tests were performed for statistical analysis. ***, P < 0.001; ****, P < 0.0001.

In examining the region more closely, we noted that an RND (resistance-nodulation-division superfamily) efflux pump system was encoded just upstream of orf82 and that the smr deletion could have impacted the promoter driving the expression of this locus (Fig. 2A). RND efflux systems have been shown to play roles ranging from resistance to human antimicrobial peptides in Pseudomonas to flagellar motility in Burkholderia (46). Thus, we constructed two additional mutants, one with the rnd genes and the other with orf82, ramA, and romA deleted but with the putative rnd promoter intact (Δrnd and Δorf82 ramA romA). The Δrnd mutant colonized mice as efficiently as the WT strain (Fig. 2B). Intriguingly, the second mutant lacking the same three genes as the smr mutant (Δorf82 ramA romA) also had no virulence defect.

Sequencing of the smr mutant reveals a large deletion.

As targeted genetic mutations in the smr locus failed to recapitulate the smr phenotype, we hypothesized that the smr mutant contained a secondary mutation. Whole-genome sequencing revealed that the deletion in the smr mutant was larger than intended. Instead of the targeted deletion of orf82, ramA, and romA, a single segment of 87,290 bp spanning 78 putative open reading frames was deleted.

A component of the enterobactin transport system contributes to virulence.

To identify the factor(s) responsible for the virulence defect of the smr mutant, we constructed three mutants (Δsmr_A, Δsmr_B, and Δsmr_C) each with a deletion of approximately one-third of the genes deleted in the smr mutant (Fig. 3A). The putative orf genes in each mutant are listed in Table 1. In our pneumonia model at 24 and 72 hpi, both Δsmr_A and Δsmr_B mutant-infected mice had bacterial burdens comparable to those of mice infected with the WT (Fig. 3B). However, the mice infected with Δsmr_C mutant had >1 log fewer CFU/g at 24 hpi and nearly 6 logs fewer CFU/g at 72 hpi than mice infected with the WT. Thus, the Δsmr_C mutant recapitulated the phenotype of the smr mutant, whereas the Δsmr_A and Δsmr_B mutants behaved like the WT strain.

FIG 3 .

The smr mutant phenotype is recapitulated by a smaller targeted deletion. (A) Schematic depicting targeted subregions of the smr mutant (not to scale). (B) Mice were inoculated i.n. with 2 × 10⁴ CFU of the WT (KPPR1S; black circles) or the Δsmr (VK082; open squares), Δsmr_A (VK274; black triangles), Δsmr_B (VK275; open diamonds), or Δsmr_C (VK276; black squares) mutant. At 24 or 72 hpi, mice were sacrificed and their lungs and spleens were homogenized and plated for bacterial enumeration. Each symbol represents one mouse. The dotted line indicates the limit of detection, and symbols on the dotted line indicate that CFU counts were below the limit of detection. X indicates a mouse that succumbed to infection prior to 72 hpi. These data are from an individual representative experiment. Mann-Whitney tests were performed for statistical analysis. *, P < 0.05.

TABLE 1 .

Genes deleted in breakdown mutants

Strain	Locus tag	Annotated gene product
Δsmr_A mutant	VK055_1987	Oxygen-insensitive NADPH nitroreductase
	VK055_1986	Hypothetical protein
	VK055_1985	Bacterial transcriptional regulator, TetR family
	VK055_1984	Metallo-beta-lactamase superfamily protein (RomA)
	VK055_1983	Bacterial regulatory helix-turn-helix, AraC family protein (RamA)
	VK055_1982	Hypothetical protein (Orf82)
	VK055_1981	Putative aldo/keto reductase
	VK055_1980	HADa ATPase, P type
	VK055_1979	Efflux transporter, RND family, MFP subunit
	VK055_1978	Efflux pump membrane transporter, BepE
	VK055_1977	Hypothetical protein
	VK055_1976	Gamma-glutamyl cysteine ligase YbdK
	VK055_1975	Hypothetical protein
	VK055_1974	Bacterial extracellular solute-binding protein
	VK055_1973	Binding-protein-dependent transport system inner membrane component
	VK055_1972	Binding-protein-dependent transport system inner membrane component
	VK055_1971	Oligopeptide/dipeptide ABC transporter, ATP binding
	VK055_1970	Oligopeptide/dipeptide ABC transporter, ATP binding
	VK055_1969	Amidase. Hydatoinase/carbamoylase family protein
	VK055_1968	EamA-like transporter family protein
	VK055_1967	Bacterial transcriptional regulator, GntR family protein
	VK055_1966	Bacterial transcriptional regulator, GntR family protein
	VK055_1965	Bacterial extracellular solute-binding
	VK055_1964	ABC transporter, permease
	VK055_1963	ABC-type amino acid transport system, permease
	VK055_1962	ABC transporter family protein
	VK055_1961	Serine 3-dehydrogenase
	VK055_1960	Aminotransferase class III family protein
Δsmr_B mutant	VK055_1959	ABC transporter family protein
	VK055_1958	ABC transporter family protein
	VK055_1957	Oligopeptide transport permease family protein
	VK055_1956	Binding protein-dependent transport system inner membrane component family protein
	VK055_1955	Bacterial extracellular solute-binding protein
	VK055_1954	Acetyltransferase family protein
	VK055_1953	Choline dehydrogenase
	VK055_1952	Betaine aldehyde dehydrogenase
	VK055_1951	Transcriptional repressor BetI
	VK055_1950	Transporter, betaine/carnitine/choline transporter family protein
	VK055_1949	ykfE, inhibitor of vertebrate C-type lysozyme
	VK055_1948	Bacterial regulatory helix-turn-helix, LysR family protein
	VK055_1947	Mechanosensitive ion channel family protein
	VK055_1946	Hypothetical kinase
	VK055_1945	Glycerol kinase
	VK055_1944	l-Fucose isomerase, C-terminal domain protein
	VK055_1943	Transketolase, pyrimidine binding domain protein
	VK055_1942	Thiamine pyrophosphate enzyme, C-terminal TPPb binding domain protein
	VK055_1941	Hypothetical protein
	VK055_1940	Putative transcriptional regulator
	VK055_1939	Branched-chain amino acid transport system/permease component family protein
	VK055_1938	Heme ABC exporter, ATP-binding protein CcmA
	VK055_1937	Hypothetical protein
	VK055_1936	Periplasmic binding and sugar binding domain of LacI family protein
	VK055_1935	4′-Phosphopantetheinyl transferase superfamily protein, EntD
	VK055_1934	TonB-dependent siderophore receptor family protein, FepA
Δsmr_C mutant	VK055_1933	Fes
	VK055_1932	MbtH-like family protein
	VK055_1931	EntF
	VK055_1930	FepC
	VK055_1929	FepG
	VK055_1928	FepD
	VK055_1927	EntS
	VK055_1926	FepB
	VK055_1925	EntC
	VK055_1924	EntE
	VK055_1923	EntB
	VK055_1922	EntA
	VK055_1921	Proofreading thioesterase in enterobactin biosynthesis, YbdB2
	VK055_1920	Carbon starvation CstA family protein
	VK055_1919	Helix-turn-helix family protein
	VK055_1918	Hypothetical protein
	VK055_1917	Plasmid stabilization system family protein
	VK055_1916	Short-chain dehydrogenase family protein
	VK055_1915	Iron-containing alcohol dehydrogenase family protein
	VK055_1914	ABC transporter family protein
	VK055_1913	Branched-chain amino acid transport system/permease component family protein
	VK055_1912	Periplasmic binding and sugar binding domain of LacI family protein
	VK055_1911	LVIVD repeat family protein

^aHAD, haloacid dehalogenase.

^bTPP, thiamine pyrophosphate.

Located within the region deleted in the Δsmr_C mutant are genes necessary for the synthesis, export, and import of the siderophore enterobactin. We therefore hypothesized that a component of the enterobactin transport system was responsible for the virulence defect of the smr mutant. We did not believe that the siderophore itself was responsible, as an ΔentB mutant, which is unable to synthesize enterobactin and salmochelin, is only modestly attenuated in this mouse pneumonia model (33). The enterobactin receptor FepA also was not implicated, as FepA is encoded within the region deleted in the Δsmr_B mutant.

Siderophore transport involves several membrane proteins. For enterobactin, EntS and TolC are required for export, whereas FepA, FepDGC, and Fes are required for import. In addition, the periplasmic protein FepB is required for the import of both enterobactin and salmochelin. Because previous studies had implicated siderophore transport components in virulence (47), we targeted specific components of the enterobactin siderophore transport system and tested loss-of-function (ΔentS, Δfes, ΔfepB, and fepD::pKAS46) mutants in our pneumonia model (Fig. 4A). We included a different enterobactin synthesis (ΔybdB2 entABEC [referred to as Δentsyn]) mutant to confirm our previous findings obtained with the ΔentB mutant (33). We found that only the ΔfepB mutant recapitulated the phenotype of the smr mutant, as demonstrated by the attenuation in the lungs and the lack of dissemination at 24 and 72 hpi (Fig. 4B). Consistent with previously studies, neither the Δentsyn mutant (Fig. 4B) nor the ΔentB mutant (Fig. 5) recapitulated the smr phenotype (33). In addition, loss of fepB did not affect the expression of the yersiniabactin system (Fig. 6), consistent with results previously obtained with an enterobactin synthesis mutant (33). Thus, the periplasmic transport protein FepB contributes to virulence in a manner distinct from that of enterobactin and salmochelin uptake alone.

FIG 4 .

FepB is responsible for the smr mutant’s phenotype. (A) Schematic of the enterobactin genes located in the Δsmr_C region. (B) Mice were inoculated i.n. with 2 × 10⁴ CFU of the WT (KPPR1S; black circles) or the Δsmr (VK082; open squares), ΔfepB (VK412; black diamonds), Δent syn (VK321; open circles), ΔentS (VK411; black squares), Δfes (VK320; black inverted triangles), or fepD::kan (VK413; open triangles) mutant. At 24 or 72 hpi, mice were sacrificed and their lungs and spleens were homogenized and plated for bacterial enumeration. Each symbol represents one mouse. The dotted line indicates the limit of detection, and symbols on the dotted line indicate that CFU counts were below the limit of detection. The data are from an individual representative experiment. Mann-Whitney tests were performed for statistical analysis. *, P < 0.05. **, P < 0.01.

FIG 5 .

A ΔfepB mutant resembles a triple siderophore mutant in vivo. Mice were inoculated i.n. with 2 × 10⁴ CFU of the WT (KPPR1S; black circles) or the ΔfepB (VK412; open squares, small closed circles), ΔentB mutant (VK087; open diamonds), or ΔentBybtS (VK089; black squares) mutant. At 24 or 72 hpi, mice were sacrificed and their lungs and spleens were homogenized and plated for bacterial enumeration. Each symbol represents one mouse. The dotted line indicates the limit of detection, and symbols on the dotted line indicate that CFU counts were below the limit of detection. The data are from an individual representative experiment. Mann-Whitney tests were performed for statistical analysis. *, P < 0.05.

FIG 6 .

ybtA expression is unchanged in the ΔfepB mutant. The WT strain and a ΔfepB mutant containing the yersiniabactin synthesis gene, ybtA, promoter cloned into the pPROBE gfp reporter plasmid were grown overnight, subcultured to an OD₆₀₀ of 0.2, and grown in LB medium for 6 h with or without 200 µM DP. These data are from strains grown in triplicate in an individual experiment. Student t tests were performed for statistical analysis. ***, P < 0.0001; ns, not significant. RFU, relative fluorescence units.

A variety of different approaches were used to complement the ΔfepB mutant, but all were unsuccessful. Plasmid-based approaches failed to complement growth under iron-depleted conditions, despite the constitutive expression of fepB (data not shown). We also attempted to repair the deletion, but this strain could not be obtained, for reasons we do not understand. Problems with fepB complementation are not unprecedented and were also reported for a Salmonella fepB mutant (47). To ensure that the observed phenotype of the ΔfepB mutant was not a consequence of secondary mutations, a second fepB mutant (fepB2) was constructed and found to recapitulate the virulence and growth phenotypes of the original fepB mutant (Fig. 5). Additionally, we sequenced across the deletion junction of both of the ΔfepB mutants and obtained the expected sequence, suggesting that a larger deletion of the region surrounding fepB had not occurred (data not shown). Expression of the genes adjacent to fepB, entC and entS, was assessed by quantitative reverse transcription-PCR. Expression of entC and entS was not detected in the ΔfepB mutant but was in the WT (data not shown). EntC and EntS may be needed for growth under low-iron conditions, and their lack of expression provides a possible explanation for failed complementation in trans. However, this alone cannot explain the attenuation in vivo, as a ΔentS mutant was not attenuated and a ΔentC mutant (enterobactin synthesis) had a more modest attenuation level than the ΔfepB mutant (Fig. 4A) (33). Thus, we conclude that deletion of fepB results in a phenotype distinct from that of other enterobactin system mutants.

A fepB mutant resembles a ΔentB ΔybtS double mutant.

We previously showed that a ΔentB ΔybtS mutant that is deficient in all siderophore production was severely attenuated (33). In comparing the defect of the ΔfepB mutant strain to those of other siderophore mutants, we noticed that the phenotype of the ΔfepB mutant was similar to that of the ΔentB ΔybtS mutant. Because the attenuation of the ΔfepB mutant was much greater than that of the ΔentB mutant, we hypothesized that the role of FepB is not limited to enterobactin import and that it might be involved in an additional iron acquisition system. To gain a better understanding of the relationship between the phenotypes of these mutants, we tested the ΔfepB mutant together with the ΔentB ΔybtS mutant to determine if its virulence defect resembles that of a ΔentB ΔybtS mutant in vivo and included a ΔentB mutant as a control (Fig. 5). The ΔfepB and ΔentB ΔybtS mutants had similar attenuation levels, which were more severe than that of the ΔentB mutant. This finding raises the question of whether FepB may be required for iron acquisition via systems other than enterobactin and salmochelin.

To address the role of FepB in iron uptake and to determine if the virulence defect could be due to reduced iron acquisition, we used an in vitro growth model. The ΔfepB, ΔentB, and ΔentB ΔybtS mutants were grown in defined medium with or without the iron-chelating agent 2,2′-dipyridyl (DP). All of the strains had similar growth rates in the absence of DP, indicating that the mutants grow normally when iron levels are sufficient (Fig. 7A). However, in the presence of DP, the growth of the ΔfepB and ΔentB ΔybtS mutants was severely restricted (Fig. 7B). Interestingly, the growth of the ΔentB mutant was restricted compared to that of the WT strain, but the triple siderophore (ΔentB ΔybtS) mutant and the ΔfepB mutant grew even more slowly than the ΔentB mutant. These data suggest that FepB contributes to growth in an iron-dependent manner that is distinct from its known role in enterobactin and salmochelin uptake.

FIG 7 .

The ΔfepB mutant has a growth defect under iron-limited conditions. The WT strain (KPPR1S; black circles) and the ΔfepB (VK412; open squares), ΔentB (VK087; open circles), and ΔentBybtS (VK089; black diamonds) mutants were grown in M9-CAA (A) or in M9-CAA supplemented with 100 µM DP (B). The OD₆₀₀ was monitored for 6 h. The data shown are from an individual representative experiment.

Yersiniabactin import is unaffected in a ΔfepB mutant.

The ΔfepB mutant had a stronger phenotype than an enterobactin/salmochelin synthesis mutant, and it resembled that of a triple siderophore mutant in both virulence and growth under iron limitation. Yersiniabactin is the only known siderophore produced by the ΔentB mutant but not the ΔentB ΔybtS mutant. Thus, we wanted to assess if the ΔfepB mutant is defective in yersiniabactin uptake. To do this, we performed a cross-feeding experiment to determine if the growth defect of the ΔfepB mutant under iron-limited conditions could be restored in the presence of yersiniabactin by coculturing the ΔfepB mutant with a yersiniabactin-producing strain. We predicted that if FepB is required for yersiniabactin import, a feeder strain producing yersiniabactin would be unable to restore the growth of the ΔfepB mutant. In this assay, test strains were spread onto M9 medium supplemented with 0.4% glucose and 0.2% Casamino acids (M9-CAA) agar containing DP and feeder strains were then spotted onto the surface of the plates. The WT and ΔentB, ΔentB ΔybtS, and ΔfepB mutant strains were used as test strains, and the WT and the ΔentB (capable of producing yersiniabactin) and ΔybtS (does not produce yersiniabactin) mutants were used as feeder strains. As expected, the ΔybtS mutant was not able to complement the growth defect of the ΔfepB mutant, as the ΔfepB mutant should not be able to use the enterobactin produced by this strain (Fig. 8A). The WT and the ΔybtS mutant were able to complement the growth of the ΔentB ΔybtS mutant, as expected (Fig. 8B). Importantly, the ΔentB mutant and the WT were able to restore the growth of the ΔentB mutant (as expected), as well as the ΔfepB mutant. This finding suggests that yersiniabactin can still be imported by a ΔfepB mutant.

FIG 8 .

Addition of yersiniabactin restores the growth defect of the ΔfepB mutant under iron-limited conditions. Test strains were grown in M9-CAA and spread plated onto M9-CAA agar containing 100 µM DP. (A) Plate testing of the ΔfepB mutant (spread plated). Feeder (WT and ΔentB and ΔybtS mutant) strains were then spot plated to test for complementation (growth restoration around the feeder spot). (B) Summary of results represented as + for growth and – for no growth of the WT strain, the ΔfepB mutant, the ΔentB mutant, or the ΔentB ΔybtS double mutant. (C) Addition of purified yersiniabactin (1 mM or 100 µM) or the dH₂O vehicle to the WT strain, the ΔfepB mutant, or the ΔentB ΔybtS double mutant. Shown are data from an individual experiment that are representative of data obtained from several independent experiments.

To determine if the complementation of the ΔfepB mutant’s growth defect by a yersiniabactin-producing strain in the cross-feeding experiment was due to yersiniabactin production rather than the production of other secreted bacterial products, we performed a similar experiment by spotting purified apo-yersiniabactin instead of feeder strains. As described above, test strains (WT strain and ΔfepB and ΔentB ΔybtS mutants) were spread onto M9-CAA agar containing DP. Various concentrations of apo-yersiniabactin were applied to paper discs that were placed on the agar plate to test for growth restoration and thus the ability to utilize yersiniabactin (Fig. 8C). The WT strain was able to grow even without yersiniabactin supplementation. The ΔentB ΔybtS and ΔfepB mutants did not grow around the vehicle control (distilled H₂O [dH₂O]) disc. However, upon the addition of yersiniabactin, the growth defect of the ΔentB ΔybtS mutant was restored in a concentration-dependent manner; this is an expected result because this strain is still able to import exogenous yersiniabactin. Addition of apo-yersiniabactin also restored the growth of the ΔfepB mutant (Fig. 8C). Together, these data suggest that FepB is not required for yersiniabactin import in vitro and that the virulence defect of the ΔfepB mutant is due to a mechanism unrelated to yersiniabactin import.

Capsule production is not responsible for the ΔfepB mutant’s phenotype.

Capsule is considered a primary virulence factor of K. pneumoniae (reviewed in reference 4). Therefore, to test if there was a change in capsule production that could contribute to the ΔfepB mutant’s phenotype, we measured its uronic acid content. When the ΔfepB mutant and the WT strain were grown in Luria-Bertani (LB) medium at 37°C, the same conditions used for the inoculum used in mouse experiments, there was no difference in capsule production (Fig. 9A). Similarly, when mucoviscosity was measured (another assay for capsule phenotypes), we saw no measureable difference between the WT and the ΔfepB mutant (Fig. 9B).

FIG 9 .

Capsule phenotype of the ΔfepB mutant. Overnight cultures of the WT strain, the ΔfepB mutant, and a capsule-deficient strain (cpsB::Tn5Kn2) were subcultured to an OD₆₀₀ of 0.2 and grown in LB medium for 6 h, and total capsule production was measured with the uronic acid assay (A) and the low-speed centrifugation assay to measure mucoviscosity (B). These data are from strains grown in triplicate in an individual experiment. One-way analysis of variance, followed by Dunnett’s multiple-comparison test, was performed for statistical analysis. ***, P < 0.001; ****, P < 0.0001; ns, not significant.

Because iron levels can affect K. pneumoniae capsule production (48), we decided to test if capsule production is altered in the ΔfepB mutant under low-iron conditions. All four siderophore system (ΔfepB, ΔentB, ΔybtS, and ΔentB ΔybtS) mutants had a modest, nonsignificant reduction in capsule production (Fig. 9C). The mucoviscosity of the siderophore system mutants was also lower than that of the WT (Fig. 9D). Importantly, there was no difference between the capsule production levels of the ΔfepB and ΔentB mutants. How FepB affects virulence is not clear, but it does not appear to be related to the amount of capsule produced (Fig. 9A and C)) or the mucoviscosity of the capsule (Fig. 9B and D), as the uronic acid content and sedimentation of the ΔfepB mutant were comparable to those of the enterobactin synthesis mutant, which is only modestly attenuated.

DISCUSSION

The repertoire of confirmed K. pneumoniae virulence factors has changed little during the past 2 decades (2, 4). Although a number of large screens for K. pneumoniae virulence determinants have been performed (34–40), unfortunately, there have been few follow-up analyses of the results of these screens. In a screen of signature-tagged mutants in a pneumonia model of infection, we identified a locus that included ramA as potentially important for virulence (34), and a recent study suggested that overexpression of ramA affects virulence and leads to LPS modifications (45). In this study, we constructed a mutant (smr) with this locus deleted and found that it was cleared from the lungs following intranasal inoculation and that it was unable to spread systemically. Why deletion of ramA or the surrounding genes did not result in a virulence defect in the lungs and/or spleen when 11 insertions in this region were identified in the STM screen remains a mystery (34). One possibility is that in the STM screen, each insertion mutant was screened essentially in competition with 95 other mutants, most of which behave like the WT strain. Therefore, a ramA mutant may have a competitive disadvantage when at a ratio of ~1:100 with the WT but will not exhibit a defect when inoculated on its own. RamA has been implicated in the regulation of pathways important for multidrug resistance (43, 44), and thus, it may still be important in the context of antibiotic treatment or in a strain background that is not hypervirulent.

Subsequent analysis of the smr mutant indicated that the virulence defect was due not to deletion of the ramA locus but rather to the deletion of fepB, a gene encoding a protein required for enterobactin and salmochelin import (49–51). The fepB mutant had a more severe growth defect in iron-limited medium and a more severe in vivo defect than an enterobactin synthesis (ΔentB) mutant; the ΔentB mutant would also be deficient in salmochelin production. The contributions of the siderophores enterobactin, salmochelin, and yersiniabactin to Klebsiella virulence have been examined previously, and individually, they were found to contribute only minimally to infection (32, 33, 52). The data presented here reveal that while enterobactin/salmochelin may be dispensable for the virulence of a strain also able to produce yersiniabactin in a K. pneumoniae lung infection model, the enterobactin/salmochelin importer FepB is necessary to establish infection. Furthermore, under both in vitro and in vivo conditions, the ΔfepB mutant resembles a ΔentB ΔybtS mutant, which is unable to produce any of the three siderophores encoded by this strain (enterobactin, salmochelin, and yersiniabactin). Together, these observations suggest that FepB contributes to virulence and growth under iron limitation in an unanticipated way.

Siderophores are synthesized in the cytoplasm and require machinery for export and subsequent import following iron sequestration. Enterobactin is synthesized by EntABCDEF and is exported to the periplasm via the inner membrane protein EntS and subsequently through the outer membrane via the membrane channel protein TolC (53). Once bound to ferric iron, enterobactin (enterobactin-Fe³⁺) binds the outer membrane siderophore receptor FepA and is translocated into the periplasm by a TonB-dependent mechanism. In the periplasm, enterobactin-Fe³⁺ then binds the periplasmic chaperone FepB and is shuttled to the inner membrane, where it interacts with the inner membrane transport complex FepDGC and is ultimately released into the cytoplasm (50, 54, 55). Salmochelin utilizes a similar export apparatus but is imported via the bacterial outer membrane receptor IroN, and then FepB shuttles it to FepDGC (56). Export and yersiniabactin import appear to be similar, although several steps in yersiniabactin transport remain to be elucidated (53). Specifically, no periplasmic protein (FepB equivalent) has been identified in the yersiniabactin import system. Because of the similarities in the phenotypes of the ΔfepB and triple siderophore mutants and because no FepB equivalent has been identified in the yersiniabactin import system, we initially hypothesized that FepB may be involved in yersiniabactin import. However, our results show that a ΔfepB mutant can still utilize yersiniabactin for growth in vitro, and thus, the role of FepB in growth under iron limitation and virulence remains unclear. A recent crystal structure of FepB indicates that it can form a trimer (57) and thus possibly could coordinate a target other than enterobactin-Fe³⁺, but this has yet to be demonstrated.

A contribution of the periplasmic enterobactin transporter FepB to pathogenesis also was observed in Salmonella enterica (47). Salmonella produces both enterobactin and salmochelin, and both siderophores require FepB for import (25). However, Nagy et al. found that a fepB mutant had lower colonization levels in mice than a fepA-iroN double mutant (encoding the outer membrane receptors for enterobactin and salmochelin) in a gastric model of infection (47, 58). This is comparable to our results obtained with K. pneumoniae and suggests that the role of FepB in virulence extends beyond siderophore transport. The fact that this phenomenon has been reported in two Gram-negative pathogens hints that this may be a conserved mechanism in other bacterial species. One possible explanation for this observation is that in a ΔfepB mutant, enterobactin is not recycled properly and accumulates extracellularly and perhaps this is detrimental to the bacteria, given that enterobactin can enhance copper toxicity (59). However, in this scenario, the Δsmr_C mutant (which is a ΔentB ΔfepB double mutant and has other genes [listed in Table 1] deleted) should not have this phenotype, as it would be unable to produce enterobactin. However, the data presented here suggest that this is not the case, as the Δsmr_C mutant has a virulence defect comparable to that of a ΔfepB mutant.

Interestingly, recent studies have noted that the complement of siderophore systems produced by an individual strain of K. pneumoniae has a significant impact on its ability to colonize versus its ability to cause an infection or its ability to cause invasive disease associated with the hypervirulence phenotype (22). In an analysis of a broad sampling of over 300 strains, only 33% of an individual strain’s genome is part of the core Klebsiella genome, and the remaining 67% is composed of “accessory” genes that vary significantly from strain to strain (22). Until recently, the gene profiles necessary to cause the different types of infections associated with K. pneumoniae were not clear. However, recent bioinformatics analyses of large strain collections, combined with information on the type of infection, have revealed that some specific gene profiles are associated with colonization versus infection versus invasive disease. For example, the presence of rmpA (a regulator of capsule), as well as the genes required for the production and use of the siderophores aerobactin, salmochelin, and yersiniabactin, was highly associated with strains isolated from infections versus carriage alone (22). Interestingly, an additional five loci were associated with invasive infections (versus noninvasive infections or carriage), including fepB. This is consistent with the requirement we observed for fepB to cause disseminated infection in mice and what has been observed in Salmonella (47).

With antibiotic resistance on the rise, the development of new therapeutics to combat infection by multidrug-resistant bacteria is an urgent need (60). Siderophore systems present an attractive target for drug development because of the conservation of these systems among Gram-negative pathogens (61). Immunization with the yersiniabactin receptor FyuA or the siderophores themselves (yersiniabactin and aerobactin) was protective when tested in a murine model of E. coli urinary tract infection (62–64). FepB may be an especially attractive target to consider for drug development, as it is required for disseminated infections and is found in a wide variety of bacteria. In addition to being potential targets for drug development, siderophores represent an attractive system to exploit as a drug delivery mechanism to overcome the permeability barrier of the outer membrane. In essence, the siderophore can be used as a “Trojan horse” to target a siderophore-drug conjugate to the siderophore-iron transport systems (61). This would allow the delivery of drugs to the periplasm and potentially to the cytoplasm. From the work presented here and with Salmonella, one such periplasmic target could be FepB itself. Drug-siderophore conjugates have been developed, and a catechol-cephalosporin conjugate, cefiderocol (S-649266), was found to have lower MIC₉₀s than the antibiotics cefepime, piperacillin-tazobactam, and meropenem when tested against several Gram-negative bacteria, including multidrug- and carbapenem-resistant strains (65–67). Cefiderocol displayed antibacterial properties when tested in vivo and is currently being tested in a phase 3 clinical trial against carbapenem-resistant Gram-negative infections in humans (66, 68). Thus, investigations probing the mechanisms of siderophore transport can provide the basis for promising new therapeutics.

MATERIALS AND METHODS

Ethics statement.

Mouse experiments were conducted in accordance with the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health (69). All animal studies were approved by the Institutional Animal Care and Use Committee at the University of North Carolina (UNC) at Chapel Hill (protocols 11-127 and 14-110). All efforts were made to minimize suffering. Animals were monitored daily following inoculation and were euthanized upon exhibiting signs of morbidity.

Bacterial strains and culture conditions.

The bacterial strains and plasmids used in this study are described in Table 2. The WT parental strains are KPPR1, a Rif^r derivative of ATCC 43816 (34), and KPPR1S, a Str^r derivative of KPPR1; they have identical growth characteristics in vitro and in vivo. K. pneumoniae strains were grown aerobically in LB medium or M9-CAA overnight at 37°C. Where indicated, 100 or 200 µM DP (Sigma-Aldrich, St. Louis, MO) was added to M9 or LB medium, respectively, to deplete the available iron. Antibiotics were added to the medium as appropriate at the following concentrations: kanamycin, 50 µg/ml (Kan₅₀); rifampin, 30 µg/ml (Rif₃₀); streptomycin, 500 µg/ml (Strep₅₀₀). Bacterial growth was monitored by measuring the optical density at 600 nm (OD₆₀₀).

TABLE 2 .

Bacterial strains and plasmids used in this work

Strain or plasmid	Description	Reference
E. coli
DH5α	F− ϕ80dlacZΔM15 Δ(lacZYA-argF)U169 deoP recA1 endA1 hsdR17(rK− mK−)	Invitrogen
S17-1 λpir	Tpr Strr recA thi pro hsdR hsdM+ RP4-2-Tc::Mu Km Tn7 λpir (lysogen)	72
K. pneumoniae
KPPR1	Rifr derivative of ATCC 43816	34
KPPR1S	Strr derivative of KPPR1	This work
VK060	KPPR1 cpsB::Tn5Kn2	34
VK082	smr mutant	This work
VK087	KPPR1 ΔentB	33
VK088	KPPR1 ΔybtS	33
VK089	KPPR1 ΔentB ΔybtS	33
VK131	KPPR1 ΔromA	This work
VK174	KPPR1S ΔramA	This work
VK266	KPPR1S Δorf82 ΔramA ΔromA	This work
VK269	KPPR1S Δrnd	This work
VK270	KPPR1S Δorf82	This work
VK274	KPPR1S Δsmr_A	This work
VK275	KPPR1S Δsmr_B	This work
VK276	KPPR1S Δsmr_C	This work
VK320	KPPR1S Δfes	This work
VK321	KPPR1S ΔybdB2 entABEC (Δentsyn)	This work
VK411	KPPR1S ΔentS	This work
VK412	KPPR1S ΔfepB	This work
VK413	KPPR1S fepD::pKAS46	This work
VK555	KPPR1S ΔfepB2	This work
Plasmids
pKAS46 vector	Kanamycin resistance, suicide vector, rpsL+	70
pK03 vector	sacB, temperature-sensitive origin of replication	73
pPROBE vector	Kmr, gfp expression vector	77
pKO3ΔromA	romA flanking region in pKO3	This work
pKO3ΔramKO	smr flanking region in pKO3	This work
pKAS46ΔramA	ramA flanking region in pKAS46	This work
pKAS46Δorf82	orf82 flanking region in pKAS46	This work
pKAS46Δorf82ramAromA	orf82 ramA romA flanking region in pKAS46	This work
pKAS46Δrnd	rnd flanking region in pKAS46	This work
pKAS46ΔfepB	fepB flanking region in pKAS46	This work
pKAS46Δsmr_A	smr_A flanking region in pKAS46	This work
pKAS46Δsmr_B	smr_B flanking region in pKAS46	This work
pKAS46Δsmr_C	smr_C flanking region in pKAS46	This work
pKAS46Δfes	fes flanking region in pKAS46	This work
pKAS46ΔentS	entS flanking region in pKAS46	This work
pKAS46ΔybdB2entABEC	ybdB2 entABEC (Δentsyn) flanking region in pKAS46	This work
pfepD::pKAS46	Disruption of fepD	This work
pY4	ybtA promoter in pPROBE	33

Construction of bacterial mutants.

Mutations in KPPR1S (ΔramA Δorf82, Δorf82ΔramAΔromA, ΔentS, ΔybdB2 entABEC [referred to as Δentsyn], Δfes, ΔfepB, Δsmr_A Δsmr_B, and Δsmr_C) were generated by allelic exchange by using pKAS46, a suicide vector that allows the use of streptomycin for counterselection (70, 71). Sequences up- and downstream (~500 bp each) were generated by PCR with the primer sets indicated in Table 3, cloned into pKAS46, and confirmed by sequence analysis. Overnight cultures of KPPR1S and E. coli S17-1 λpir (72) carrying a derivative of pKAS46 were mixed, collected by centrifugation, plated on LB agar (no antibiotics), and grown overnight at 37°C. Transconjugants were selected by plating on LB agar with Rif₃₀ and Kan₅₀. Several Rif^r Kan^r colonies were grown for 5 to 6 h in LB medium (no antibiotics) and then plated on LB agar with Strep₅₀₀ to select for transconjugants that had excised the plasmid. Kan^s clones were screened by PCR to verify the loss of the targeted gene(s).

TABLE 3 .

Primers used in this study

Primer	Sequencea (5′ to 3′)	Description
MP66	TGACTAGATATCGCTGATTACCGAAGCGGACTG	5′ flank forward ΔramA
MP67	TGCATATCTAGAGGAAATCGTCATATGCTCTCT	5′ flank reverse ΔramA
MP68	TGCATATCTAGACACTGAGGCGCGCCTCTCCTG	3′ flank forward ΔramA
MP69	TCGATAGCGGCCGCCGACTGGCGCTGTACATCGCG	3′ flank reverse ΔramA
MP114	TGACTAGATATCTCGCCCGAGGGCGTCGTAAAC	5′ flank forward Δorf82
MP71	TGCATATCTAGACTCGAGCGGTAAACCAGGAGA	5′ flank reverse Δorf82
MP72	TGCATATCTAGACAGTGGATGTTTCATGTCATG	3′ flank forward Δorf82
MP115	TCGATAGCGGCCGCGGGATGAACCGTATCAACGGC	3′ flank reverse Δorf82
MP124	TGACTAGATATCCGATTTTGCCTGCTATGCGCA	5′ flank forward Δrnd
MP125	TGCATATCTAGACATCGGCGGGGGTAAGCGCGG	5′ flank reverse Δrnd
MP126	TGCATATCTAGAGTTCACCCGGTCGCCCAGCGG	3′ flank forward Δrnd
MP127	TCGATAGCGGCCGCGCCACGGCAGGTCTGGCAGCA	3′ flank reverse Δrnd
MP103	TGACTAGATATCGGCGTCGTAAACTTTGGGTTA	5′ for Δorf82 ramA romA
MP104	TGCATATCTAGATTCCAGTGGATGTTTCATGTC	5′ rev Δorf82 ramA romA
MP105	TGCATATCTAGACTGACCAGACAAAAGCCCCCA	3′ for Δorf82 ramA romA
MP106	TCGATAGCGGCCGCCGACAGCTGGCACATTTCGTT	3′ rev Δorf82 ramA romA
MP171	TCGATAGCGGCCGCCTGTGCGCTCCCTGCGCCATG	5′ flank forward smrΔA
MP172	TGCATATCTAGACTGGCGAAGTAGGGGAGGGGG	5′ flank reverse smrΔA
MP173	TGCATATCTAGAACCGAGATTTAATCTCTCCAC	3′ flank forward smrΔA
MP174	TGACTAGATATCTCCAACTTTTGGGGTGCAGTC	3′ flank reverse smrΔA
MP175	TGACTAGATATCCCATGCGCTTGCGCGGGCCTA	5′ flank forward smrΔB
MP176	TGCATATCTAGAGCTTACGATATTTCCAATCCG	5′ flank reverse smrΔB
MP177	TGCATATCTAGATGCGCCTCATTAAGCGGGTCC	3′ flank forward smrΔB
MP178	TCGATAGCGGCCGCAATGACAGAATGTTAAGGACA	3′ flank reverse smrΔB
MP179	TGACTAGATATCTGCGCCTCATTAAGCGGGTCC	5′ flank forward smrΔC
MP180	TGCATATCTAGAAGTCACGCTATACATAGGGTT	5′ flank reverse smrΔC
MP181	TGCATATCTAGAGCGCACCCTGGCGGAGCCACT	3′ flank forward smrΔC
MP182	TCGATAGCGGCCGCATTAACGACAGGTTGCGCGAA	3′ flank reverse smrΔC
MP282	TGACTAGATATCAGAATTTAACAACACCGAAAC	5′ flank forward ΔybdB2 entABEC
MP192	TGCATATCTAGAACCGCGGTGCTGGGCTAAGAA	5′ flank reverse ΔybdB2 entABEC
MP193	TGCATATCTAGAAGCCAGTGACGTTTCCATATC	3′ flank forward ΔybdB2 entABEC
MP194	TCGATAGCGGCCGCGCAACCTCGCTCCACTGGCGC	3′ flank reverse ΔybdB2 entABEC
MP195	TGACTAGATATCGGATATAGAGCTCGGAAGGCT	5′ flank forward ΔfepB
MP196	TGCATATCTAGAGAAGTTCACGTCATCGCATCC	5′ flank reverse ΔfepB
MP197	TGCATATCTAGACTGTTCGGCTAACGCGGGCTG	3′ flank forward ΔfepB
MP198	TCGATAGCGGCCGCCGCTGGCGCTTGTCGGCGTGC	3′ flank reverse ΔfepB
MP199	TGACTAGATATCGCGCTCTGCTGGTGCTCCAGC	5′ flank forward ΔentS
MP200	TGCATATCTAGAATTGTCAACGAAAGTTAAGTA	5′ flank reverse ΔentS
MP201	TGCATATCTAGAGGATTGTCGGTTCATTACAGC	3′ flank forward ΔentS
MP202	TCGATAGCGGCCGCCGGGTGAGCGTCTGCATCAGC	3′ flank reverse ΔentS
MP207	TGACTAGATATCGCGCGGCAACCAGCGGTAAAC	5′ flank forward Δfes
MP208	TGCATATCTAGAGGCCAACGCGAACCGATTATT	5′ flank reverse Δfes
MP244	TGCATATCTAGATGCGCCTCATTAAGCGGGTCC	3′ flank forward Δfes
MP231	TCGATAGCGGCCGCAATGACAGAATGTTAAGGACA	3′ flank reverse Δfes
MP313	TGACTAGATATCCCTTAGCCGCCGCGCTTA	5′ forward fepD::kan
MP314	TGCATATCTAGATTGCGGGTGAGCGTCTGC	3′ reverse fepD::kan
ramKOA5′INsmaI	TCCCCCGGGACCGCTTTGACGGTCAT	5′ flank forward smr
ramKOA3′IN2	CGCGGTAGATTCCAAACATA	5′ flank reverse smr
ramKOB5′IN	ATCCTGACCAGACAAAAGCCCCATCC	3′ flank forward smr
ramKOB3′INSma	TCCCCCGGGGACAGCTGGCACATTTC	3′ flank reverse smr
romA5′inXba	GCTCTAGAGCCAGTCCGCTTCGGTAA	5′ flank forward ΔromA
romA5′in	CGACTTTCATCGCTTTCCTAATA	5′ flank reverse ΔromA
romA3′in	CGTCATATGCTCTCTCCTCTGAT	3′ flank forward ΔromA
romA3′inXbaI	GCTCTAGAGCACAGCTTAGCCAGGTG	3′ flank reverse ΔromA

^aRestriction sites are in bold.

An insertional disruption of the fepDCG operon was constructed in KPPR1S (fepD::pKAS46) by plasmid integration into the fepD gene. A DNA fragment generated by PCR with primers MP313 and MP314 (Table 3) was cloned into pKAS46. The resulting plasmid, pKAS46fepD::kan, was conjugated into KPPR1S as described above. Colonies with integration of the plasmid on the chromosome were identified by plating on LB agar with Rif₃₀ and Kan₅₀.

Isogenic mutants of KPPR1 (ΔromA and Δsmr) were generated by allelic exchange with pKO3 as previously described (73). pKO3 is a vector that allows the use of sucrose as a positive selection for the loss of the vector. DNA fragments were amplified by PCR with the primer sets indicated in Table 3 and cloned into pKO3, generating plasmids pKO3ΔromA and pKO3Δsmr.

Whole-genome sequencing of the smr mutant.

Total DNA from the smr mutant (VK82) was isolated with a genomic DNA purification kit (Qiagen), and the sample was submitted to the UNC High-Throughput Sequencing Facility for sequencing. An Illumina HiSeq 2000 instrument generated 2 × 75-bp paired-end reads. A mapped genome assembly was produced with the “Map Reads to Reference” tool in CLC Genomics Workbench v7.5.1 by using the published KPPR1 genome as the template (74). The smr mutant and KPPR1 parent strain genomes were then compared with the “Basic Variant Detection” tool in CLC Genomics Workbench to identify mutations in the smr strain. Mutations were visualized by aligning these genomes with Mauve (75).

Murine model of pneumonia.

Five- to 8-week-old, female C57BL/6 mice (Jackson Laboratories) were anesthetized by intraperitoneal injection with 200 µl of a mixture of ketamine (6.66 mg/kg) and xylazine (10.6 mg/kg). Overnight bacterial cultures were diluted in phosphate-buffered saline (PBS), and 20 µl was inoculated intranasally (i.n.) in two 10-µl aliquots for a total of ~2 × 10⁴ CFU/mouse as previously described (34). At 24, 48, or 72 hpi, mice were euthanized by a lethal injection of 200 µl of sodium pentobarbital (150 mg/kg). Organs were removed, homogenized in PBS, serially diluted, and plated to quantify the number of CFU/g of tissue.

Mucoviscosity assay.

Mucoviscosity was determined as previously described (35, 76). Briefly, overnight cultures were grown in LB medium, subcultured to an OD₆₀₀ of 0.2 in fresh medium, and grown at 37°C. After 6 h, cultures were normalized to 1.0 U of OD/ml and centrifuged for 5 min at 1,000 × g and the OD₆₀₀ of the supernatant was measured.

Extraction and quantification of capsule.

Uronic acid was extracted and quantified as previously described (28). Briefly, overnight cultures were grown in LB medium, subcultured to an OD₆₀₀ of 0.2 in fresh medium, and grown at 37°C. After 6 h, 500 µl of culture was added to 100 µl of 1% Zwittergent–100 mM citric acid and incubated at 50°C for 20 min. Cells were pelleted, and 300 µl of the supernatant was added to 1.2 ml of absolute ethanol, incubated at 4°C for 20 min, and centrifuged for 5 min at maximum speed. The pellet was resuspended in 200 µl of dH₂O, added to 1.2 ml of 12.5 mM sodium tetraborate in sulfuric acid, and incubated for 5 min at 100°C. A 20-µl volume of 0.15% 3-phenylphenol was added, and the absorbance at 520 nm was measured. The glucuronic acid content was determined from a standard curve of glucuronic acid (Sigma-Aldrich, St. Louis, MO) and expressed in micromoles per OD unit.

Measurement of promoter activity.

Expression of the yersiniabactin-encoding locus was assessed in vitro with a transcriptional gfp reporter containing the sequence 500 bp upstream of the ybtA promoter cloned into pPROBE (33, 77). The bacteria were grown overnight at 37°C in LB medium, subcultured to an OD₆₀₀ of 0.2, and grown for 6 h with or without 200 μM DP. All strains were assayed in triplicate. Fluorescence was detected with a Synergy HT microplate reader (BioTek Instruments, Winooski, VT) and measured in relative fluorescence units per OD₆₀₀ unit.

In vitro growth curves.

To monitor bacterial growth, bacterial strains were grown overnight in M9-CAA at 37°C, subcultured to an OD₆₀₀ of 0.05 in fresh medium in 250-ml flasks, and grown with aeration for 6 h at 37°C. OD₆₀₀ readings were recorded at the intervals indicated. Medium was supplemented with 100 μM DP to examine bacterial growth under iron-limiting conditions.

Cross-feeding assay.

To determine if secreted siderophores could restore the growth of siderophore mutants in iron-depleted medium, a cross-feeding assay was performed as previously described, with minor modifications (78). Bacteria were grown overnight at 37°C in M9-CAA. Approximately 1 × 10⁵ CFU of each test strain was spread onto M9-CAA agar plates containing 100 μM DP. Feeder strains were then spotted (2.5 µl of overnight culture) onto the agar, and the plates were incubated at 37°C overnight.

To determine if purified yersiniabactin could restore the growth of siderophore mutants in iron-depleted medium, test strains were spread on M9-CAA agar as described above. Iron-free yersiniabactin (EMC Microcollections, Germany) was resuspended in ethanol, and 10 µl of either 1 mM or 100 µM yersiniabactin (diluted in dH₂O) was spotted onto filter disks on the plate to assess yersiniabactin-dependent growth complementation.

Statistical analysis.

Statistical analyses were performed with GraphPad Prism, version 6.0 (GraphPad, San Diego, CA).