Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2017 Aug 31;7:10204. doi: 10.1038/s41598-017-10761-9

Insect-bacteria parallel evolution in multiple-co-obligate-aphid association: a case in Lachninae (Hemiptera: Aphididae)

Rui Chen 1,#, Zhe Wang 2,#, Jing Chen 1,, Li-Yun Jiang 1, Ge-Xia Qiao 1,3,
PMCID: PMC5579299  PMID: 28860659

Abstract

Parallel phylogenies between aphid and its obligate symbiont Buchnera are hot topics which always focused on aphid lower taxonomic levels. Symbionts in the subfamily Lachninae are special. Buchnera in many lachnine species has undergone functional and genome size reduction that was replaced by other co-obligate symbionts. In this study, we constructed the phylogenetic relationships of Lachninae with a combined dataset of five genes sequenced from Buchnera to estimate the effects of a dual symbiotic system in the aphid-Buchnera cospeciation association. The phylogeny of Buchnera in Lachninae was well-resolved in the combined dataset. Each of the genera formed strongly supported monophyletic groups, with the exception of the genus Cinara. The phylogeny based on sequences from Buchnera was divided into five tribes according to the clades of the Lachninae hosts tree, with the phylogenies of Buchnera and Lachninae being generally congruent. These results first provided evidence of parallel evolution at the aphid subfamily level comprehensively and supported the view that topological congruence between the phylogenies of Buchnera and Lachninae would not be interfered with the other co-obligate symbionts, such as Sarretia, in aphid-entosymbiont association. These results also provided new insight in understanding host-plant coevolution in lachnine lineages.

Introduction

Symbiosis reflects the most prominent aspect of biological complexity affecting the ecological and evolutionary diversification of many eukaryotic groups1. Endosymbionts play important roles in the evolution of interacting partners involving long-term cospeciation with their hosts1. As one of the most representative insect groups with mutualistic associations with endosymbionts, aphids show a highly diverse assemblage of heritable bacteria2. Aphids harbor an obligate symbiont, Buchnera aphidicola, as well as many species of facultative symbionts, including Serratia symbiotica, Regiella insecticola, and Hamiltonella defensa 3. These symbionts have a close association with their aphid hosts. For example, Buchnera supplies essential nutrients to its hosts for normal development and is the obligate symbiont in nearly all aphid species47. Compared with Buchnera, facultative symbionts are not required for host survival and/or reproduction and are distributed in different aphid hosts810.

As an obligate symbiont, Buchnera underwent a rapid genome erosion early in its evolutionary history with aphids11, 12, and the ancient association in the aphid-Buchnera symbiosis dates back to 100–250 million years ago. Since then, Buchnera has evolved in synchrony with aphid hosts. Previous studies that focused on lower taxonomic levels (e.g., closely related species or intraspecific lineages) usually supported parallel phylogenies and cospeciation in aphid-Buchnera associations1320. Considering that respective life cycles correspond to different aphid lineages, the evolutionary rates of the genomes of Buchnera in different lineages are likely to be variable21, 22. Different evolutionary pressures may lead to phylogenetic incongruences across long evolutionary time scales. Thus, phylogenetic incongruence may be observed at higher taxonomic levels, while phylogenetic congruence is always observed at lower levels19, 20. However, few studies have involved aphid-Buchnera phylogenetic relationships at higher taxonomic levels.

Lachninae (Insecta: Hemiptera: Aphididae) have complex yet common relationships with endosymbionts. The evidence shows that the evolutionary rates accelerated quicker in Buchnera from lachnine species than Buchnera from species of Aphidinae and Eriosomatinae23. The genome size of Buchnera varies in different lachnine lineages as well24. For example, the genome of Buchnera of one lachnine species, Cinara cedri, is the smallest one of all known genomes in the genus25. In another lachnine species, Tuberolachnus salignus, a convergence in functional and genome size reduction has also been found26. Buchnera in many lachnines have lost some metabolic functions, which were replaced by the other co-obligate symbiont27, 28. This indicates that the mutualistic relationship between Buchnera and its aphid host may be occasionally supplemented or supplanted by other symbionts20, 24, 25, 27, 28. Moreover, some lachnine species produce dwarf males that may lack Buchnera 29. Thus, if some lost or replaced events occur, the phylogenetic relationships between Buchnera and aphid hosts may be affected.

Lachnine aphids feed on Coniferae and some broad-leaved plants with complicated host associations. The debate about ancestral feeding conditions of the Lachninae was a subject of great interest for many studies3033. Using mitochondrial and nuclear genes, Chen et al.34 first suggested the common ancestor of Lachninae fed on the woody part of an angiosperm host in the mid-Cretaceous and then switched to conifer hosts34. According to phylogenetic analyses, this study provided a stable, cladistic, five-tribe classification of the subfamily: Lachnini, Stomaphidini, Tramini, Tuberolachnini and Eulachnini34.

In this study, we used sequences of five genes from Buchnera (groEL, trpB, dnaB, ilvD and 16S rRNA) sampled from 52 aphid species spanning 14 genera in the subfamily Lachninae to reconstruct phylogenetic relationships. We combined the resulting topologies to the reported phylogenetic tree of Lachninae, and (1) examined the monophyly of each tribe; (2) evaluated phylogenetic congruence between Buchnera and Lachninae species; (3) estimated the effects of two co-obligate endosymbionts in aphid-Buchnera cospeciation association; and (4) explored the evolutionary relationships among lachnine aphids, Buchnera, and host plants.

Results

Phylogenetic analyses of single-gene

For each gene, the analyses yielded similar results from the ML, MP, and BI analyses (Figures S1S5). Strains of Buchnera from different samples of the same species were clustered in the same clades. All topologies derived from the single-gene datasets placed most aphid species into clades corresponding to genus level except Cinara, Lachnus, and Longistigma. The genus Cinara did not form a monophyletic group in any of the single-gene analyses. The genera Longistigma and Lachnus were resolved as monophyletic in all analyses except in the 16S and groEL single-gene analyses. For higher taxonomic levels, the results were less conclusive, and node support values were weaker. However, the two tribes Tuberolachnini and Stomaphidini were recovered as monophyletic across different analyses with strong support. Tramini formed a monophyletic clade in the analyses of 16S, groEL and ilvD. Eulachnini and Lachnini were recovered as monophyletic only in analyses of the groEL and dnaB datasets.

Phylogenetic analyses of concatenated dataset

Maximum-likelihood, maximum-parsimony and Bayesian methods resulted in similar topologies. Here, we use the consensus tree from the combined five-gene ML analysis to summarize the results (Fig. 1). The five-gene combined analyses provided a well-resolved phylogeny. For those genera with more than one species in the analysis, average node support was also very strong (96/0.98/97, ML/MP/BI), although the genus Cinara was recovered as paraphyletic. The Buchnera tree was also divided into 5 tribes, reflecting the clades of Lachninae host phylogeny of Chen et al.34. All the tribes formed strongly supported monophyletic groups except Lachnini. Eulachnini consisted of the sister groups Cinara and Essigella + Eulachnus, both with strong support. Stomaphidini included all representatives of Stomaphis. Lachnini was divided into two groups: the genus Longistigma formed a monophyletic clade placed at the root of tree, and the remaining genera of Lachnus, Maculolachnus, Pterochloroides formed the sister-group of Stomaphidini. Tuberolachnini (Tuberolachnus + Nippolachnus + Pyrolachnus) and the Tramini (Protrama + Trama) were resolved as sister groups.

Figure 1.

Figure 1

ML phylogram of Buchnera based on the combined dataset. The sequences of Buchnera species are represented by the names of their host species. The outgroup strains are designated by the names of the bacteria. The three numbers near nodes refer to ML bootstrap support, Bayesian posterior probability, and MP bootstrap support, respectively.

Parasite-host cophylogeny analyses

To identify the relationship between Buchnera and Lachninae aphid hosts, we performed one reduced analysis between genera and an analysis of each tribe of Lachninae in addition to the full dataset. The cophylogeny maps were built in Jane 4.0 (Figs 2 and 3). The parameters of the coevolutionary events and ParaFit are presented in Tables 1 and 2, respectively. Analyses with ParaFit detected a significant global congruence (P = 0.001 < 0.02) between Buchnera and Lachninae hosts (34/50 significant links). The signal of global congruence was significant at the generic and tribal levels (Table 2). Four duplications and host switch events were detected between Cinara and Essigella + Eulachnus, Stomaphis and Cinara, Stomaphis and Lachnini (not including Longistima), and Longistima and Stomaphis + Protrama + Trama + Tuberolachnus + Nippolachnus + Pyrolachnus at the genus level (Fig. 2). The topology of Buchnera was in accordance with its hosts in Lachnini, Stomaphidini, and Tramini + Tuberolachnini (Fig. 3). Note that the genus Longistigma was excluded from the cophylogenetic analysis at the tribal level because it formed a clade that was placed at the root of the Buchnera phylogeny. Four duplications and host switch events were detected in Eulachnini, with three of them occurring in Cinara and one of them occurring between Cinara and Essigella + Eulachnus.

Figure 2.

Figure 2

Cophylogeny of aphid and Buchnera from Jane at the generic level, with the reconciled trees based on the molecular-based aphid tree and the combined genes Buchnera tree. Blue and black lines indicate the phylogenies of the Buchnera and aphids, respectively. Hollow red circles indicate cospeciation events; solid red and yellow circles indicate duplications; arrows indicate host switch events; dotted lines indicate loss events.

Figure 3.

Figure 3

Cophylogeny of aphid and Buchnera from Jane at the tribe level with the reconciled trees based on the molecular-based aphid tree and the combined genes Buchnera tree: (A) Stomaphidini; (B) Tramini + Tuberolachnini; (C) Lachnini; (D) Eulachini. Blue and black lines indicate the phylogenies of the Buchnera and aphids, respectively. Hollow red circles indicate cospeciation events; solid red and yellow circles indicate duplications; arrows indicate host switch events; dotted lines indicate loss events.

Table 1.

The parameters obtained from event-based cophylogenetic analysis with the programs Jane and TreeMap.

Jane TreeMap
cospeciation duplication duplications & host switch loss cospeciation duplication host switch sorting events
Genera 9 0 4 0 9 4 0 13
Tribes Eulachnini 24 0 4 2 24 0 0 15
Lachnini 8 0 0 0 8 0 0 0
Stomaphidini 4 0 0 0 4 0 0 0
Tramini + Tuberolachnini 6 0 0 0 6 0 0 0
All 48 0 7 2

Table 2.

Results of the distance-based cophylogenetic analyses with ParaFit.

P-value for global fit Number of significant links*/total
Genera 0.002 4/12
Tribes Eulachnini 0.001 11/25
Lachnini 0.00 4/4
Stomaphidini 0.00 8/8
Tramini + Tuberolachnini 0.00 6/6
All 0.001 34/50

*refer to individual Buchnera -aphid associations.

Discussion

Dual co-obligate symbiont association would not break the phylogenetic congruence between Lachninae and Buchnera

The phylogenies of Buchnera and Lachninae were generally congruent. These results provided new evidence of parallel evolution at the aphid subfamily level. The Buchnera phylogeny reflected major features of the Lachninae phylogeny, including the monophyly of Tuberolachnini, Eulachnini, Tramini and Stomaphidini as well as the sister relationship between Tuberolachnini and Tramini, with strong support. These relationships are congruent with those presented by Chen et al.34, which used mitochondrial and nuclear genes to reconstruct the phylogenetic relationships of Lachninae. In addition, two methods of cophylogeny analyses all detected significant patterns of cophylogeny between Buchnera and its aphid hosts. These results supported the view that topological congruence between Buchnera and Lachninae trees would not be interfered with the other co-obligate symbionts such as Sarretia in aphid-entosymbiont associations. The strong cospeciation signals detected between Buchnera and Lachninae species could be indicative of a specialized interaction. Although the Lachninae last common ancestor lost the riboflavin biosynthetic capability by Buchnera that promoted the settlement of a co-obligate secondary endosymbiont2628, clearly the mutualistic relationship between Buchnera and its aphid host has not in fact been supplanted by other symbionts. In dual symbiont associations, Buchnera follows a vertical mode of transmission from mother to daughter, even though certain functional genes were lost or underwent pseudogenization in evolutionary history2628, 35. The species with smaller Buchnera genomes, such as Cinara cedri and Tuberolachnus salignus 25, 26, display the same relationship with other species in all aphid and Buchnera trees based on the combined dataset. All analyses indicated that Buchnera diversified in parallel with the radiation of lachnines.

Some slight incongruence between analyses based on Buchnera and aphid combined datasets were observed in the tribe Lachnini and the genus Cinara. Lachnini and Cinara (Schizolachnus) + Cinara were monophyletic in all aphid trees34. Based on the combined datasets of Buchnera, Lachnini was polyphyletic, and the Longistigma was basal to the other genera. Cinara (Schizolachnus) was nested within Cinara, and Cinara (Schizolachnus) + Cinara form two lineages branching from basal nodes in Eulachnini. Four host switch events were detected in genera Cinara (Figs 2 and 3). Four host switch events were also found among genera of Lachninae (Fig. 2). If the host switches occurred at deeper levels of evolutionary divergence, the aphid–Buchnera phylogenies should show significant incongruence. Thus, we suggest that the slight conflict between aphid and Buchnera trees in Lachninae may be caused by methodological artifacts, including the inadequacy of the models of evolution or limited taxon sampling as well as the lack of adequate signal for certain nodes13, 20, 36.

Buchnera confirmed the evolutionary relationship between Lachninae and its host plants

The congruence in the phylogenetic trees of Lachninae and Buchnera supports cospeciation of lachnines and their primary endosymbionts following the common ancestor of aphid-Buchnera association. Research dated the cospeciation of Buchnera and the common ancestor of aphids approximately 100–250 Ma37, 38, and the most recent common ancestor of Lachninae dates to approximately 95 Ma34. These results suggested a model of a single infection in the common ancestor of modern lachnines and then stable vertical transmission of Buchnera from mothers to daughters. Thus, Buchnera genes have the potential to be used to investigate aphid-plant evolutionary history.

Lachninae show complicated host associations with multiple host switches over evolutionary history. The ancestral feeding condition of Lachninae from angiosperm or conifer host is a controversial topic receiving much attention3033. Analyses of mitochondrial and nuclear genes provide strong evidence that the Lachninae common ancestor fed on the woody part of an angiosperm host, and the subsequent radiation on conifers was a derived condition34. In this study, endosymbiont genes provide new insight in understanding host-plant associated evolution in lachnine lineages.

Based on the gene sequences from Buchnera, Longistigma was basal within Lachninae and formed the sister group to the rest of the Lachninae. As a typical aphid group from deciduous trees, Longistigma feeds on bark in broad-leaved trees such as Juglans and Liquidambar 34, 39. This is attributed to the recurring view that angiosperm-feeding is an ancient habit in Lachninae. Moreover, the more derived position of the conifer-feeding species of Eulachnini in the Buchnera tree suggest a shift from angiosperm-feeding to conifer-feeding. Feeding-site specificity in Eulachnini has been suggested as a means towards reproductive isolation and thus speciation in this tribe34, 36, 40. Three needle-feeding taxa, including Cinara (Schizolachnus), Eulachnus and Essigella, display two clades with a more derived position in Eulachnini. It provides new evidence that needle-feeding may be a synapomorphy and has evolved more than once in Eulachnini34.

The close relationship between Tuberolachnini and Tramini has been confirmed, which is consistent with previous results33, 34. Tuberolachnini originated in East Asia and feeds on Pyrus and Eriobotrya (Rosaceae)34. Tramini consists of root-feeders with strictly asexual reproduction in the Palearctic region34. However, the evolution of the aphid niche between the bark in Rosaceae and the root from Asteraceae is unclear. In addition, the monophyly of Stomaphidini was supported in our results with strong support. The trunk-feeding Stomaphidini show strict host specialization and are diversified from a common ancestor of aphid-Buchnera association.

In summary, we propose an evolutionary relationship between Buchnera and its host Lachninae. Our findings provide the first powerful evidence of parallel evolution at the aphid subfamily level. We believe that topological congruence between Buchnera and Lachninae trees would not be interfered with the other co-obligate symbionts, such as Sarretia, in aphid-entosymbiont associations. Buchnera played an important role in understanding host-plant-associated evolution in lachnine lineages.

Methods

Taxon Sampling and data collection

The samples included most genera recognized in Lachninae. For each genus, as many species as possible were sampled, with two or more individuals of each species included. Information about aphid samples, including locations and host plants, is listed in Table S1. All samples were preserved in 95% or 100% ethanol. Three to five individuals per sample were used as slide-mounted specimens for morphological identification. Voucher specimens were identified by their main morphological diagnostic features and were compared to previously identified specimens. All samples and voucher specimens were deposited in the National Zoological Museum of China, Institute of Zoology, Chinese Academy of Sciences, Beijing, China.

DNA extraction and sequencing

DNA extraction was performed with the whole body of single aphids using a Qiagen DNeasyTM extraction kit (Qiagen, Germany) following the manufacturer’s instructions. Five genes, 16S rRNA, dnaB, groEL, ilvD, and trpB, were amplified in this study. Information about the primers is listed in Table 3. The PCR amplifications were performed in a 30-μl reaction volume consisting of 3.0 μl 10 × PCR buffer, 2.4 μl dNTPs (10 mM each), 20 μl dd H2O, 0.6 μl of each 10 μM forward and reverse primer, and 1 unit of Taq DNA polymerase. Every PCR included a negative control (double-distilled water instead of DNA) to detect the contamination of reagents. The PCR conditions were as follows: 95 °C for 5 min; 35 cycles consisting of denaturation at 95 °C for 1 min, annealing temperature (Table 3) for 30 sec and extension at 72 °C for 2 min; and a final extension period at 72 °C for 10 min. The PCR products of 16S rRNA gene were purified and ligated into the plasmid vector pMD19-T (TaKaRa, Dalian, China), and at least 20 clones from each product were sequenced on an ABI 3730 automated sequencer. Both strands of the plasmids were sequenced using universal primers (M13+, M13–) with forward and reverse reads. The PCR products of the other four genes were sequenced directly. Sequences were assembled and manually verified in SeqMan in the DNAStar* software package (DNASTAR, Inc., Madison, WI, USA). Multiple alignments were conducted with ClustalX in Mega 6.041 and subsequently reduced to 1380 bp (16S), 1187 bp (dnaB), 1016 bp (groEL), 908 bp (ilvD), and 467 bp (trpB). These sequences were uploaded to GenBank (see Table S1 for accession numbers).

Table 3.

List of primers used in PCR reactions and sequencing in this study.

Gene Direction Primer Name Sequences (5′-3′) Anneal. Temp. (°C) Reference
16S rRNA Forward 8–30 AGAGTTTGATCATGGCTCAGATTG 65 12
Reverse 1507–1484 TACCTTGTTACGACTTCACCCCAG 12
dnaB Forward dnaBF70 CCWHATTCWYTAGAAGCWGAACAAT 50 58
Reverse dnaBR1348 TCAAATCKWGACCADTGWCCRTT 58
groEL Forward groELF3080 ATGGGHRCWCARATGGT 50 58
Reverse groELR4231 GACGWARWGGMGMTTCCAT 58
ilvD Forward ilvD716F GARTTWGCTGTRAACATWCCWGAACA 53 58
Reverse ilvD1640R GGTAGAGYATCGGTCTCCAA 58
trpD Forward trpD104F GMAATTAATGGGWGCWRAAGTWAT 53 58
Reverse trpD586R ARCCAAGMATGTTCAGGDC 58

Phylogenetic analyses

Phylogenetic analyses were conducted on each of the five genes individually and the combined gene dataset (16S + dnaB + groEL + ilvD + trpB) using maximum-likelihood (ML), maximum-parsimony (MP), and Bayesian inference (BI) methods. To estimate congruence between datasets, we performed 100 replicates of the partition homogeneity test42 as implemented in PAUP*4.043. The results indicated that the sequence data for the five genes were congruent (P > 0.01). ML analyses were conducted in RAxML 7.2.8 using a heuristic search with the GTRCAT model and 1000 bootstrap replicates44, 45. MP analyses were conducted in TNT v1.1 under equal weights46. New technology searches consisting of 10,000 random addition sequence replicates, each employing default sectorial, ratchet, drift and tree-fusing parameters, were applied. The best trees were then resubmitted for tree bisection and reconnection (TBR) branch swapping to check for additional most parsimonious trees. Clade support was assessed with 1000 bootstrap replicates47. The Bayesian phylogenetic analysis was conducted in MrBayes 3.1.248. Appropriate evolution models were identified by evaluating the selected parameters using the Bayesian Information Criterion (BIC) in jModelTest 0.1.149, 50. In MrBayes, trees were sampled every 100 generations, and the first 25% of samples were discarded as burn-in. From the post-burn-in trees, a 50% majority-rule consensus tree was generated and posterior probabilities were calculated. The sequences of Buchnera species are represented by the names of their host species in the phylogenetic trees.

Sequences of Buchnera in Lachninae from other studies downloaded from GenBank were selected as reference sequences, and Ishikawaella capsulata, Salmonella enterica, Escherichia coli, and Serratia symbiotica were chosen as outgroups (Table S2)51.

Parasite-host cophylogeny analyses

Cophylogenetic analysis methods can be classified into event-based methods and distance-based methods52. The aim of event-based methods are to reconcile the topologies of the host and symbiont trees by adequately mixing general kinds of coevolutionary events, such as cospeciation, host-switching, duplication, etc., and finding the best reconstructions by minimizing the global cost53. Distance-based methods use distance matrices rather than tree topologies to test the null hypothesis that the diversification of hosts and parasites is independent. The null hypothesis is tested by permuting a host–parasite association matrix. Each individual host–parasite association can also be tested. Two event-base methods (Jane 4.0 and TreeMap v1.0)54, 55 and a distance-based method (ParaFit)56 implemented in CopyCat57 were used in this study. Phylogenetic relationships among the aphid species in Lachninae used in this study came from the study of Chen et al.34.

In Jane, the following event-cost scheme was used with 100 generations and a population size of 50: Cospeciation = 0, Duplication = 1, Duplication and Host switching = 2, Loss = 1, Failure to diverge = 1. Randomizations of the tips of the trees and the parasite tree topology were run in a configuring statistical test with a sample size of 1000. In TreeMap, exact and heuristic searches were used to find the best reconstructions that attempt to maximize the number of cospeciation events and minimize the number of non-cospeciation events. One thousand random replicates were run on each reconstruction to test whether the two observed phylogenies contain more cospeciation events than randomly expected by chance. ParaFit used matrices of phylogenetic distances for both hosts and parasites. Three types of information are used to describe the situation in matrix form: a matrix of phylogenetic distances among parasites, a matrix of phylogenetic distances among hosts, and a matrix of the observed host-parasite associations. All the combined data of parasitoids and hosts were used to statistically assess the global fit between trees and the significance of the contribution of each individual link between taxa to this global congruence. Tests of significance were performed using 999 permutations.

Electronic supplementary material

Supplementary materials (816.9KB, pdf)

Acknowledgements

We gratefully thank all collectors for their assistance in aphid sampling, Fen-Di Yang for making slides of the voucher specimens, and Colin Favret for his providing lachnine specimens. The work was supported by National Natural Sciences Foundation of China (Nos 31430078, 31372237, 31620103916, 31561163002), and the External Cooperation Program of BIC, Chinese Academy of Sciences (Grant No. 152111KYSB20130012).

Author Contributions

R. Chen and Z. Wang performed most of the laboratory and analytical work, and participated in conceptual design and manuscript preparation; J. Chen participated in conceptual design; L.Y. Jiang performed identifications; G.X. Qiao coordinated the study, performed most of the identifications, and participated in conceptual design. All authors contributed to revising the manuscript.

Competing Interests

The authors declare that they have no competing interests.

Footnotes

Rui Chen and Zhe Wang contributed equally to this work.

Electronic supplementary material

Supplementary information accompanies this paper at doi:10.1038/s41598-017-10761-9

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Jing Chen, Email: chenjing@ioz.ac.cn.

Ge-Xia Qiao, Email: qiaogx@ioz.ac.cn.

References

  • 1.Takiya D, Tran P, Dietrich CH, Moran NA. Co-cladogenesis spanning three phyla: leafhoppers (Insecta: Hemiptera: Cicadellidae) and their dual bacterial symbionts. Mole. Ecol. 2006;15:4175–4191. doi: 10.1111/j.1365-294X.2006.03071.x. [DOI] [PubMed] [Google Scholar]
  • 2.Clark EL, Karley AJ, Hubbard SF. Insect endosymbionts: manipulators of insect herbivore trophic interactions? Protoplasma. 2010;244:25–51. doi: 10.1007/s00709-010-0156-2. [DOI] [PubMed] [Google Scholar]
  • 3.Oliver KM, Degnan PH, Burke GR, Moran NA. Facultative symbionts in aphids and the horizontal transfer of ecologically important traits. Annu. Rev. Entomol. 2010;55:247–266. doi: 10.1146/annurev-ento-112408-085305. [DOI] [PubMed] [Google Scholar]
  • 4.Unterman BM, Baumann P, McLean DL. Pea aphid symbiont relationships established by analysis of 16S ribosomal-RNAs. J. Bacteriol. 1989;171:2970–2974. doi: 10.1128/jb.171.6.2970-2974.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Munson MA, Baumann P, Kinsey MG. Buchnera gen. nov. and Buchnera aphidicola sp. nov., a taxon consisting of the mycetocyte associated, primary endosymbionts of aphids. Int. J. Syst. Evol. Microbiol. 1991;41:566–568. [Google Scholar]
  • 6.Douglas AE, Prosser WA. Synthesis of the essential amino acid tryptophan in the pea aphid (Acyrthosiphon pisum) symbiosis. J. Insect Physio. 1992;38:565–568. doi: 10.1016/0022-1910(92)90107-O. [DOI] [Google Scholar]
  • 7.Nakabachi A, Ishikawa H. Differential display of mRNAs related to amino acid metabolism in the endosymbiotic system of aphids. Insect Biochem. Molec. Bio. 1997;27:1057–1062. doi: 10.1016/S0965-1748(97)00092-1. [DOI] [PubMed] [Google Scholar]
  • 8.Baumann P. Biology of bacteriocyte-associated endosymbionts of plant sap sucking insects. Annu. Rev. Microbiol. 2005;59:155–189. doi: 10.1146/annurev.micro.59.030804.121041. [DOI] [PubMed] [Google Scholar]
  • 9.Moran NA, Russell JA, Koga R, Fukatsu T. Evolutionary relationships of three new species of Enterobacteriaceae living as symbionts of aphids and other insects. Appl. Environ. Microbiol. 2005;71:3302–3310. doi: 10.1128/AEM.71.6.3302-3310.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Moya A, Peretó J, Gil R, Latorre A. Learning how to live together: genomic insights into prokaryote-animal symbioses. Nat. Rev. Genet. 2008;9:218–229. doi: 10.1038/nrg2319. [DOI] [PubMed] [Google Scholar]
  • 11.Tamas I, et al. 50 million years of genomic stasis in endosymbiotic bacteria. Science. 2002;296:2376–2379. doi: 10.1126/science.1071278. [DOI] [PubMed] [Google Scholar]
  • 12.van Ham RC, et al. Reductive genome evolution in Buchnera aphidicola. P. Natl. Acad. Sci. USA. 2003;100:581–586. doi: 10.1073/pnas.0235981100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Clark MA, Moran NA, Baumann P, Wernegreen JJ. Cospeciation between bacterial endosymbionts (Buchnera) and a recent radiation of aphids (Uroleucon) and pitfalls of testing for phylogenetic congruence. Evolution. 2000;54:517–525. doi: 10.1111/j.0014-3820.2000.tb00054.x. [DOI] [PubMed] [Google Scholar]
  • 14.Funk DJ, Helbling L, Wernegreen JJ, Moran NA. Intraspecific phylogenetic congruence among multiple symbiont genomes. P. Roy. Soc. B-Biol. Sci. 2000;267:2517–2521. doi: 10.1098/rspb.2000.1314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Wernegreen JJ, Richardson AO, Moran NA. Parallel acceleration of evolutionary rates in symbiont genes underlying host nutrition. Mole. Phylogenet. Evol. 2001;19:479–485. doi: 10.1006/mpev.2001.0929. [DOI] [PubMed] [Google Scholar]
  • 16.Jousselin E, Desdevised Y. & Coeur dácier, A. Fine-scale cospeciation between Brachycaudus and Buchnera aphidicola: Bacterial genome helps define species and evolutionary relationships in aphids. P. Roy. Soc. B-Biol. Sci. 2009;276:187–196. doi: 10.1098/rspb.2008.0679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Peccoud J, Ollivier A, Plantegenest M, Simon JC. A continuum of genetic divergence from sympatric host races to species in the pea aphid complex. P. Natl. Acad. Sci. USA. 2009;106:7495–7500. doi: 10.1073/pnas.0811117106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Peccoud J, Simon JC, McLaughlin HJ, Moran NA. Post-Pleistocene radiation of the pea aphid complex revealed by rapidly evolving endosymbionts. P. Natl. Acad. Sci. USA. 2009;106:16315–16320. doi: 10.1073/pnas.0905129106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Liu L, Huang XL, Zhang RL, Jiang LY, Qiao GX. Phylogenetic congruence between Mollitrichosiphum (Aphididae: Greenideinae) and Buchnera indicates insect-bacteria parallel evolution. Syst. Entomol. 2013;38:81–92. doi: 10.1111/j.1365-3113.2012.00647.x. [DOI] [Google Scholar]
  • 20.Liu L, Li XY, Huang XL, Qiao GX. Evolutionary relationships of Pemphigus and allied genera (Hemiptera: Aphididae: Eriosomatinae) and their primary endosymbiont, Buchnera aphidicola. Insect Sci. 2014;21:301–312. doi: 10.1111/1744-7917.12113. [DOI] [PubMed] [Google Scholar]
  • 21.Rispe C, Moran NA. Accumulation of deleterious mutations in endosymbionts: Muller’s ratchet with two levels of selection. Am. Nat. 2000;156:425–441. doi: 10.1086/303396. [DOI] [PubMed] [Google Scholar]
  • 22.Huang XL, Liu L, Qiao GX. Evolutionary relationships between aphids and their primary endosymbionts: hypotheses and mechanisms. Acta Entomol. Sin. 2011;54:582–588. [Google Scholar]
  • 23.Pérez-Brocal, V., Gil, R., Moya, A. & Latorre, A. New insights on the evolutionary history of aphids and their primary endosymbiont Buchnera aphidicola. Int. J. Evol. Biol. 2011, dio:10.4061/2011/250154 (2011). [DOI] [PMC free article] [PubMed]
  • 24.Moran NA, McCutcheon JP, Nakabachi A. Genomics and evolution of heritable bacterial symbionts. Annu. Rev. Genet. 2008;42:165–190. doi: 10.1146/annurev.genet.41.110306.130119. [DOI] [PubMed] [Google Scholar]
  • 25.Pérez-Brocal V, et al. A small microbial genome: the end of a long symbiotic relationship? Science. 2006;314:312–313. doi: 10.1126/science.1130441. [DOI] [PubMed] [Google Scholar]
  • 26.Manzano-Marín A, Simon JC, Latorre A. Reinventing the wheel and making it round again: evolutionary convergence in Buchnera-Serratia symbiotic consortia between the distantly related Lachninae Aphids Tuberolachnus salignus and Cinara cedri. Genome Biol. Evol. 2016;8:1440–1458. doi: 10.1093/gbe/evw085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Manzano-Marín A, Szabo G, Simon JC, Horn M, Latorre A. Happens in the best of subfamilies: Establishment and repeated replacements of co-obligate secondary endosymbionts within Lachninae aphids. Environ. Microbiol. 2016;19:393–408. doi: 10.1111/1462-2920.13633. [DOI] [PubMed] [Google Scholar]
  • 28.Meseguer AS, et al. Buchnera has changed flatmate but the repeated replacement of co-obligate symbionts is not associated with the ecological expansions of their aphid hosts. Mol. Ecol. 2017;26:2363–2378. doi: 10.1111/mec.13910. [DOI] [PubMed] [Google Scholar]
  • 29.Baumann P, et al. Genetics, physiology and evolutionary relationships of the genus Buchnera: intracellular symbionts of aphids. Ann. Rev. Microbiol. 1995;49:55–94. doi: 10.1146/annurev.mi.49.100195.000415. [DOI] [PubMed] [Google Scholar]
  • 30.Lampel, G. & Burgener, R. (1987) Genetic relationships between lachnid taxa as established by enzyme-gel-electrophoresis. 9–14, (1985).
  • 31.Heie, O. E. The Aphidoidea (Hemiptera) of Fennoscandia and Denmark V. Family Aphididea: Part 2 of tribe Macrosiphini of subfamily Aphidinae. 1–242 (1994).
  • 32.Blackman, R. L. & Eastop, V. F. Aphids on the World’s Trees In An Identification and Information Guide 987 (1994).
  • 33.Normark BB. Molecular systematics and evolution of the aphid family Lachnidae. Mole. Phylogenet. Evol. 2000;14:131–140. doi: 10.1006/mpev.1999.0699. [DOI] [PubMed] [Google Scholar]
  • 34.Chen R, Favret C, Jiang LY, Wang Z, Qiao GX. An aphid lineage (Aphididae: Lachninae) maintains a bark-feeding niche while switching to and diversifying on conifers. Cladistics. 2016;32:555–572. doi: 10.1111/cla.12141. [DOI] [PubMed] [Google Scholar]
  • 35.Moran NA, Wernegreen JJ. Lifestyle evolution in symbiotic bacteria: insights from genomics. Tree. 2000;8:321–326. doi: 10.1016/s0169-5347(00)01902-9. [DOI] [PubMed] [Google Scholar]
  • 36.Jousselin E, et al. Is ecological speciation a major trend in aphids? Insights from a molecular phylogeny of the conifer-feeding genus Cinara. Front. Zool. 2013;10 doi: 10.1186/1742-9994-10-56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Moran NA, Baumann P. Phylogenetics of cytoplasmically inherited microorganisms of arthropods. Trends Ecol. Evol. 1993;9:15–20. doi: 10.1016/0169-5347(94)90226-7. [DOI] [PubMed] [Google Scholar]
  • 38.Martìnez-Torres D, Buades C, Latorre A, Moya A. Molecular systematics of aphids and their primary endosymbionts. Mole. Phylogenet. Evol. 2001;20:437–449. doi: 10.1006/mpev.2001.0983. [DOI] [PubMed] [Google Scholar]
  • 39.Favret, C. Aphid Species File. URL http://Aphid.SpeciesFile.org (2016).
  • 40.Favret C, Voegtlin DJ. Speciation by host-switching in Cinara (Insecta: Hemiptera: Aphididae) Mole. Phylogenet. Evol. 2004;32:139–151. doi: 10.1016/j.ympev.2003.12.005. [DOI] [PubMed] [Google Scholar]
  • 41.Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mole. Biol. Evol. 2013;30:2725–2729. doi: 10.1093/molbev/mst197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Farris JS, Kallersjo M, Kluge AG, Bult C. Testing significance of incongruence. Cladistics. 1994;10:315–319. doi: 10.1111/j.1096-0031.1994.tb00181.x. [DOI] [Google Scholar]
  • 43.Swofford, D. PAUP*: Phylogenetic analysis using parsimony (*and other methods), version 4.0b.10. Sinauer Associates, Sunderland, Massachusetts (2002).
  • 44.Stamatakis A, Ludwig T, Meier H. RAxML-III: a fast program for maximum likelihood-based inference of large phylogenetic trees. Bioinformatics. 2005;21:456–463. doi: 10.1093/bioinformatics/bti191. [DOI] [PubMed] [Google Scholar]
  • 45.Stamatakis A, Hoover P, Rougemont J. A rapid bootstrap algorithm for the RAxML web servers. System. Biol. 2008;57:758–771. doi: 10.1080/10635150802429642. [DOI] [PubMed] [Google Scholar]
  • 46.Goloboff PA, Farris JS, Nixon KC. TNT, a free program for phylogenetic analysis. Cladistics. 2008;24:774–786. doi: 10.1111/j.1096-0031.2008.00217.x. [DOI] [Google Scholar]
  • 47.Felsenstein J. Confidence limits on phylogenies: an approach using the bootstrap. Evolution. 1985;39:783–791. doi: 10.1111/j.1558-5646.1985.tb00420.x. [DOI] [PubMed] [Google Scholar]
  • 48.Huelsenbeck JP, Ronquist F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics. 2001;17:754–755. doi: 10.1093/bioinformatics/17.8.754. [DOI] [PubMed] [Google Scholar]
  • 49.Guindon S, Gascuel O. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 2003;52:696–704. doi: 10.1080/10635150390235520. [DOI] [PubMed] [Google Scholar]
  • 50.Posada D. jModelTest: phylogenetic model averaging. Mole. Biol. Evol. 2008;25:1253–1256. doi: 10.1093/molbev/msn083. [DOI] [PubMed] [Google Scholar]
  • 51.Husník F, Chrudimský T, Hypša V. Multiple origins of endosymbiosis within the Enterobacteriaceae (g-Proteobacteria): convergence of complex phylogenetic approaches. BMC Biol. 2011;9 doi: 10.1186/1741-7007-9-87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.de Vienne DM, et al. Cospeciation vs host-shift speciation: methods for testing, evidence from natural associations and relation to coevolution. New Phytol. 2013;198:347–385. doi: 10.1111/nph.12150. [DOI] [PubMed] [Google Scholar]
  • 53.Bellec L, et al. Cophylogenetic interactions between marine viruses and eukaryotic picophytoplankton. BMC Evol. Biol. 2014;14 doi: 10.1186/1471-2148-14-59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Conow C, Fielder D, Ovadia Y, Libeskind-Hadas R. Jane: a new tool for the cophylogeny reconstruction problem. Algorithm.Mol. Biol. 2010;5:16–25. doi: 10.1186/1748-7188-5-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Page RD. Parallel phylogenies: reconstructing the history of host-parasite assemblages. Cladistics. 1994;10:155–173. doi: 10.1111/j.1096-0031.1994.tb00170.x. [DOI] [Google Scholar]
  • 56.Legendre P, Desdevises Y, Bazin E. A. statistical test for host-parasite coevolution. Syst. Biol. 2002;51:217–234. doi: 10.1080/10635150252899734. [DOI] [PubMed] [Google Scholar]
  • 57.Meier-Kolthoff J, Auch A, Huson D, Goker M. COPYCAT: cophylogenetic analysis tool. Bioinformatics. 2007;23:898–900. doi: 10.1093/bioinformatics/btm027. [DOI] [PubMed] [Google Scholar]
  • 58.Nováková E, et al. Reconstructing the phylogeny of aphids (Hemiptera: Aphididae) using DNA of the obligate symbiont Buchnera aphidicola. Mol. Phylogenet. Evol. 2013;68:12–54. doi: 10.1016/j.ympev.2013.03.016. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary materials (816.9KB, pdf)

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES