Skip to main content
Frontiers in Microbiology logoLink to Frontiers in Microbiology
. 2017 Sep 6;8:1713. doi: 10.3389/fmicb.2017.01713

Improving Acetic Acid Production by Over-Expressing PQQ-ADH in Acetobacter pasteurianus

Xuefeng Wu 1,2, Hongli Yao 1, Lili Cao 1,2, Zhi Zheng 1,2, Xiaoju Chen 3, Min Zhang 1, Zhaojun Wei 1, Jieshun Cheng 1,2, Shaotong Jiang 1,2, Lijun Pan 1,2, Xingjiang Li 1,2,*
PMCID: PMC5592214  PMID: 28932219

Abstract

Pyrroquinoline quinone-dependent alcohol dehydrogenase (PQQ-ADH) is a key enzyme in the ethanol oxidase respiratory chain of acetic acid bacteria (AAB). To investigate the effect of PQQ-ADH on acetic acid production by Acetobacter pasteurianus JST-S, subunits I (adhA) and II (adhB) of PQQ-ADH were over-expressed, the fermentation parameters and the metabolic flux analysis were compared in the engineered strain and the original one. The acetic acid production was improved by the engineered strain (61.42 g L−1) while the residual ethanol content (4.18 g L−1) was decreased. Analysis of 2D maps indicated that 19 proteins were differently expressed between the two strains; of these, 17 were identified and analyzed by mass spectrometry and two-dimensional gel electrophoresis. With further investigation of metabolic flux analysis (MFA) of the pathway from ethanol and glucose, the results reveal that over-expression of PQQ-ADH is an effective way to improve the ethanol oxidation respiratory chain pathway and these can offer theoretical references for potential mechanism of metabolic regulation in AAB and researches with its acetic acid resistance.

Keywords: Pyrroquinoline quinone-dependent alcohol dehydrogenase, Acetobacter pasteurianus JST-S, two-dimensional gel electrophoresis, metabolic flux analysis

Introduction

Acetic acid bacteria (AAB) are employed in the industrial production of acetic acid. Their characteristics directly affect the yield and flavor of vinegar (Quintero et al., 2009). The fermentative oxidation of ethanol to acetic acid has been shown to depend on two sequential reactions of membrane-bound pyrrpquinoline quinone-dependent alcohol dehydrogenase (PQQ-ADH) and aldehyde dehydrogenase (ALDH), both of which are localized on the periplasmic side of the inner membrane (Toyama et al., 2004; Yakushi and Matsushita, 2010; Trček and Matsushita, 2013). PQQ-ADH complex in Acetobacter pasteurianus consist in three subunits, a dehydrogenase subunit (subunit I), a cytochrome c subunit (subunit II), the smallest one (subunit III). The subunit I encoded by adhA contains pyrrpquinoline quinone and one heme c; the subunit II encoded by adhB contains three heme c and relates to membrane-binding and ubiquinone reduction; the smallest subunit is encoded adhS, far from the operon coding for adhA and adhB, seems not to be necessary for ethanol oxidation (Kondo et al., 1995; Toyama et al., 2004). Loss of membrane-bound ADH activity resulted in reduced acetic acid resistance (Chinnawirotpisan et al., 2003). Trček et al. (2006) showed that growth characteristics, acid-producing rate, and acetic acid resistance of different strains were closely linked to PQQ-ADH. PQQ-ADH is a unique member of the alcohol dehydrogenase family and is essential for AAB oxidation of ethanol into acetic acid (Chen et al., 2016).

Previous studies of membrane-dependent ethanol oxidation, together with two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) and mass spectrometry, have promoted the use of proteomic analysis to study acetic acid resistance by AAB (Trček et al., 2015; Wang et al., 2015). Proteomic analysis of Acetobacter aceti and Gluconobacter oxydans revealed that eight proteins were up-regulated under acetic acid stress conditions (Lasko et al., 1997). Additionally, at least 50 types of proteins were found to change significantly in response to acetic acid stress in a comprehensive protein expression analysis (Steiner and Sauer, 2001). In A. aceti, two proteins were seen to be significantly up-regulated by 2D-PAGE, one was aconitase and the other was a putative ABC transporter. Further investigations revealed that over-expression or absence of the genes encoding for these two proteins had an important influence on A. aceti acid resistance (Nakano and Fukaya, 2008). Fifty three relevant proteins were identified using 2D-PAGE for comparing the proteome of A. pasteurianus LMG1262T during acetic fermentation, growing A. pasteurianus in ethanol containing broth (Andrés-Barrao et al., 2012). These studies demonstrated the effectiveness of using 2D-PAGE to study the membrane-dependent pathway associated with acetic acid production.

The metabolism of acetic acid in A. pasteurianus mainly includes the Embden-Meyerhof-Parnas (EMP) pathway, pentose phosphate pathway (PPP), pyruvate metabolism pathway, ethanol oxidation respiratory chain pathway, and tricarboxylic acid cycle pathway (TCA) (Illeghems et al., 2013; Wang et al., 2015). The establishment of effective metabolic pathways is the basis of quantitative analysis of metabolic logistics and its regulation, which can provide a guarantee for the successful implementation of Metabolic Flux Analysis (MFA) (Dandekar et al., 2014).

Here, to investigate the effect of PQQ-ADH on acetic acid production, a strain that over-expressed PQQ-ADH subunits I (adhA) and II (adhB) was constructed, and the ethanol tolerance and acetic acid production of the engineered and original strains was compared. Furthermore, to find out differences in protein expression from the two strains, the type and function of the different proteins were inferred by comparison to mass spectrometry databases. And the MFA combined with proteomic analysis was performed to evaluate the relationship between the partial reformation of PQQ-ADH and whole metabolism of intrinsic cells, which was also the biggest innovation and highlights of this study.

Materials and methods

Materials

Acetobacter pasteurianus JST-S was previously identified in a screen performed in our laboratory from A. pasteurianus CICC 20001. 16S rDNA gene sequencing had been deposited in the GenBank database (accession number: MF457917). The plasmids used in this study are listed in Table 1 (Krahulec et al., 2003). All bacterial strains and plasmids were obtained from the Collection of the School of Food Science and Engineering, Hefei University of Technology, Hefei, China.

Table 1.

Bacterial strains and plasmids used in this study.

Strains or plasmids Relevant characteristicsa Source or references
STRAIN
Escherichia coli JM109 recA1, endA1, gyrA96, thi, hsdR17, supE44,relA1, λ, Δ(lac-proAB), [F′, traD36 proAB, lacIqZΔM15] Kanchanarach et al., 2010
PLASMIDS
pEASYTM-T1 Apr, Kmr, f1 ori TransGen Biotechb
PBBR1MCS-4c Apr, ColE1 ori PBBR1MCS-4 carrying Padh Yanisch-Perron et al., 1985; Kovach et al., 1995
PBBR-adhA PBBR1MCS-4 carrying adhA This study
PBBR-adhB PBBR1MCS-4 carrying adhB This study
PBBR-adhA-adhB PBBR1MCS-4 carrying adhA and adhB This study
a

Apr, ampicillin resistance; Kmr, kanamycin resistance.

b

TransGen Biotech, Beijing, China.

c

A 367-bp fragment containing Padh, the adh promoter was amplified by PCR and cloned into PBBR1MCS-4, as described in Kovach et al. (1995) (Figure 1).

Seeds medium (YG1) contained 11 g L−1 of glucose, 11 g L−1 of yeast extract, 1.1 g L−1 of MgSO4·7H2O, 3.3 g L−1 of K2HPO4, and 2% (v v−1) ethanol. Fermentation medium (YG2) contained 5 g L−1 of glucose, 5 g L−1 of yeast extract, 1.1 g L−1 of MgSO4·7H2O, 3.3 g L−1 of K2HPO4, and different concentrations of ethanol. YPGD medium contained 5 g L−1 yeast extract, 5 g L−1 peptone, 5 g L−1 glucose, 5 g L−1 glycerol, 17 g L−1 agar, and 3.5% (v v−1) ethanol. Media were divided into 50 ml and poured into 250-ml Erlenmeyer flask. Then, they were sterilized at 121°C for 20 min prior to the addition of ethanol. Cells were seeded in YG1 and cultured on intelligent thermostatic shaking incubator (ZHP-Y2102L, Shanghai Sanfa Scientific Instruments Co. Ltd., Shanghai, China) at 30°C for 36 h at 170 rpm. Fermentation cultivations were performed in YG2 medium at 32°C at 170 rpm.

Restriction enzymes, DNA ligases, low melting-point agarose, DNA gel extraction kit, polymerase chain reaction (PCR) purification kit, and other genetic engineering-related reagents were purchased from TaKaRa (TaKaRa Biotechnology Co., Ltd., Dalian, China). 2D-PAGE-related reagents, protein standards, and 17-cm (pH 4-7) IPG pre-prepared adhesive strips were obtained from Bio-Rad (Bio-Rad Laboratories, Inc., Hercules, USA). Chemicals used in this study were provided by Songong Biotech (Shanghai, China) Co., Ltd.

Construction of PQQ-ADH over-expression strain

E. coli plasmids were extracted with a MiniBEST Bacterial Genomic DNA extraction kit Ver.2.0 (TaKaRa Biotechnology Co., Ltd., Dalian, China) and stored at −20°C. A Mini BEST Plasmid Purification Kit Ver.4.0 (TaKaRa Biotechnology Co., Ltd., Dalian, China) was used for the preparation and transformation of E. coli competent cells. Standard methods were used for A. pasteurianus JST-S genomic DNA extraction, cell collection, and cell lysis. For amplification of Padh (the promoter region of the operon coding for subunits I and II of PQQ-ADH from A. pasteurianus), adhA and adhB, primer sequences were designed using Primer Premier 5.0 software (Premier Biosoft, CA) (Table 2). PCR and vector construction methods are detailed elsewhere (Matsushita et al., 1992; Krahulec et al., 2003; Andrés-Barrao et al., 2012; Zheng et al., 2014). The construction strategy and sketch map of recombinant plasmids are shown in Figure 1.

Table 2.

Primer sequences.

Primers Sequence Restriction site
adhA-P1 CGCGGATCCATGACCCGCCCCGCCTCCGCCAAGA BamH I
adhA-P2 TGCACTAGTTTAGGGGTTAATGCCAAGTGTCG Spe I
adhB-P1 CGCACTAGTGATGATGATGAACAGGCTAAAAACTGC Spe I
adhB-P2 AGCTCTAGATTACTGGGCTTCATCCACACCAGCA Xba I
Padh-P1 CGCGGATCC ATCCACCACAGCCTGCGTGCACCAGA BamH I
Padh-P2 AGCACTAGTGCGTTCATGTCCTCGACTATTATATA Spe I

The underlined sequences represent the restriction sites.

Figure 1.

Figure 1

Construction of recombinant plasmid PBBR-adhA-adhB.

Competent A. pasteurianus JST-S cells were prepared according to the references (Matsushita et al., 1992; Andrés-Barrao et al., 2012). Plasmids were introduced into A. pasteurianus JST-S by electroporation using a MicroPulser Electroporation Apparatus (Bio-Rad Laboratories, Inc., Hercules, USA) in an ice-water bath at 2.5 KV. After the shock, cells were quickly transferred to YG1 and cultured at 170 rpm for 2 h at 30°C. Subsequently, the samples were cultured in YPGD medium containing 100 μg ml−1 ampicillin, at 30°C for 48 h to select for strains which containing recombinant plasmid.

Determination of enzymatic activity

Strains were incubated in YG2 with a gradient ranging initial ethanol (0, 1, 2, 3, 4, 5, 6, 7, 8%) (v v−1) at 32°C for 48 h at 170 rpm. Then, the fermentation broth was centrifuged by centrifuge (HC-3018R, Anhui USTC Zonkia Scientific Instruments Co., Ltd., Anhui, China) at 8,000 × g for 10 min at 4°C to collect cells. The samples were washed three times with 0.1 M phosphate buffer saline (PBS pH 7.0, 3 ml buffer per one gram of wet bacteria) with the same centrifugal condition and resuspended in the same buffer. Subsequently, the suspension was broken into some active fragments by JY92-II ultrasonic disintegration (220 W, 3s 3s−1) (Ningbo Scientz biotechnology Co., Ltd, Zhejiang, China) for 10 min in ice-water bath. Fractured fluid was further centrifuged at 10,000 × g for 30 min at 4°C to get supernatant fraction as enzyme liquid. The activity of ADH was measured as previously described (Toyama et al., 2004; Trček et al., 2006; Matsushita et al., 2008; Qi et al., 2014). One unit of ADH enzyme activity is defined as the amount of enzyme demanded to catalyze the oxidation of 1 u mol of substrate per minute. Determination of ADH enzyme was performed at 25°C. The protein concentration was measured by the modified Lowry method, with bovine serum albumin as a standard protein (Trček et al., 2006; Yakushi and Matsushita, 2010).

Assays of total acid content and ethanol content

The fermentation cultivation was conducted in YG2 with 42 g L−1 ethanol content (EC) and 10 g L−1 acetic acid content, been shaked at 170 rpm at 32°C for 96 h. The acidity of fermentation broth was measured by 0.1 M NaOH with phenolphthalein as pH indicator (Chinnawirotpisan et al., 2003; Krusong et al., 2015). Ethanol content assays were performed by Agilent 7890A GC System (Agilent Technologies Investment Co., Ltd., Shanghai, China) with a 30 m × 1.25 mm × 0.4 μm DB624 capillary column. N-butyl alcohol (0.1 ml n-butyl alcohol per milliliter of fermentation broth) was added as an internal standard. The flow rate of carrier gas (nitrogen) was 30 ml min−1. Injector and detector temperatures were 200°C and 250°C, respectively. The temperature program of capillary column GC finally was set consisted of 100°C for 1 min, ramp to 190°C at 15°C min−1 and hold for 3 min. According to the internal standard curve and the peak area ratio of ethanol and n-butanol alcohol in the sample, ethanol content of fermentation broth was calculated.

Determination of glucose and acetic acid

High performance liquid chromatography (HPLC) was performed for determining the concentration of glucose and acetic acid in the fermentation broth. The sample was centrifuged at 25°C for 10 min at 10,000 × g, and 1 ml of the supernatant was diluted with distil-water and filtered through a 0.22 μm membrane. An Atlantis dC18 150 mm × 4.6 mm (3.0 um) chromatographic column (Waters, USA) was used as analytical column with a flow rate of 0.6 ml min−1, the column temperature was 30°C (Li et al., 2014; Qin et al., 2016; Zhang et al., 2017). 0.05 M NH4H2PO4 buffer adjusted to pH value 2.5 with phosphoric acid was conducted as mobile phase. Concentration of glucose was analyzed by HPLC Waters 600 (American Waters Co., Milford, USA) equipped with UV detector (Waters 2487) at 210 nm, and acetic acid production was measured by HPLC Waters 600 (American Waters Co., Milford, USA) equipped with refractive index detector (Waters 2414) at 40°C. The injection volume of samples was 10 μl.

2D-page analysis

Protein samples were extracted as indicated elsewhere (Nakano and Fukaya, 2008; Andrés-Barrao et al., 2012). The different steps of isoelectric focusing were performed as follows: 50 V hydration for 12 ~16 h, 250 V linear run for 30 min, 1,000 V fast run for 1 h, 8,000 V linear run for 5 h, and 8,000 V fast run until a total of 70,000 V h−1. The strips (17 cm, pH 4-7, Limiting current of each strip 30–50 μA) were incubated for 15 min in 10 ml equilibrium solution (0.375 M Tris-HCl pH 8.8, 6 M urea, 2% (w v−1) SDS, 20% (v v−1) glycerol), +2% (w v−1) DDT then, in equilibrium solution +2.5% (w v−1) iodoacetamide. SDS-PAGE was performed in a Protean II electrophoresis tank for 6–8 h at 30 m Agel−1, until the front of the bromophenol blue marker reached the bottom of the glass. After 2D-PAGE, the gel was stained immediately with Coomassie brilliant blue R-250 for 40 min at 25°C on a horizontal shaker, followed by destaining (three times, 30 min each). Once destaining was complete, 2D-PAGE maps were scanned and analyzed using a 2100XL-USB scanner (UMAX, Taiwan) and PDQuest 8.0 software (Bio-Rad, USA), respectively. Differentially expressed spots were sent to the Life Science Laboratory Center of the University of Science and Technology of China for mass spectrometry analysis.

Metabolic flux analysis

The suggested metabolic network was constructed by using the substrate utilization and combining our results on enzyme protein expression and genomic information from the Kyoto Encyclopedia of Genes and Genomes (http://www.kegg.jp) (Li et al., 2009; Antoniewicz, 2015; Wallenius et al., 2016). Metabolic flux (MF) analysis, which is based on the pseudo-steady-state assumption that there is no accumulation of any intermediates for a certain period of time, was performed for the calculation of volumetric rates of intracellular metabolite formation (Stephanopoulos, 1999). The total stoichiometric matrix of all reactants and reaction products (A) was calculated as follows:

ATB=R (1)

A represented the total stoichiometric matrix for all reactangts and products of reactions. B stood for the internal reaction rates (mmol gDW™1h−1), and R stood for the net formation rate of metabolites (mmol gDW™1h−1). MF was computed using MINVERSE and MMULT in Excel 2010 (Microsoft Co., Redmond, WA, USA) (Li et al., 2009).

Results and discussion

Over-expression of PQQ-ADH in A. pasteurianus JST-S

Cloning and analysis of padh, adhA, and adhB sequences

To over-express PQQ-ADH, we subcloned Padh, adhA, and adhB into a high-expression vector. Previous work had shown that Padh was essential for the expression of adhA and adhB, as its absence prevented acetic acid production. Accordingly, Padh (Zheng et al., 2014) was amplified from A. pasteurianus JST-S and cloned into PBBR1MCS-4 (5317 bp) as shown in Figure 1. Padh, adhA, and adhB were amplified from the genomic DNA of A. pasteurianus JST-S by PCR using previously published primers (Zheng et al., 2014). The PCR products were analyzed by electrophoresis. As shown in Figure 2, Padh, adhA, and adhB were about 367, 2,226, and 1,419 bp in length, respectively. Sequence analysis showed that the adhA fragment contained only a single reading frame (ORF) of 2,226 bp, with an ATG start codon and a TAA stop codon. We reasoned that adhA and adhB ORFs encoded 742 and 473 amino acid residues, respectively. The cloned adhA (GenBank database ID: 1992895 Seq1 KY643658) sequence had 98.7% of identity to the A. pasteurianus adhA sequence deposited in GenBank (GenBank database ID: 16503088) (Zheng et al., 2014), that indicated the cloned fragment was indeed the adhA fragment of A. pasteurianus. The same result of adhB (GenBank database ID: 1983884 Seq1 KY584296).

Figure 2.

Figure 2

PCR amplification products shown by agarose gel electrophoresis. Lanes M, marker (bp);1, Padh; 2, adhA; 3, adhB.

Construction and identification of recombinant plasmids

To assess cloning accuracy, the recombinant plasmids were verified by double digestion with restriction enzymes (Figure 3). As seen in Lane1, PBBR-adhA produced a band compatible with the expected 2,226-bp fragment. Digestion of PBBR-adhB (Lane 2) produced a band that also matched the expected size (1,419 bp). Finally, PBBR-adhA-adhB digestion with BamH I (Lane 3) generated a large fragment similar to the expected linear plasmid (8,962 bp). In summary, digestion patterns showed that the recombinant plasmids were constructed successfully.

Figure 3.

Figure 3

Verification of recombinant plasmids by restriction enzyme digeston. Lanes: M, 8-kbp marker, 1, PBBR-adhA digested with Bam HI and Spe I; 2, PBBR-adhB digested with Spe I and Xba I; and 3, PBBR-adhA-adhB digested with Bam H I.

Assessment of adhA-adhB over-expression

Verification of adhA-adhB over-expression

Total protein extracts from the original and engineered strains were separated by SDS-PAGE (Figure 4). As can be observed in Lane 3, the engineered strain displayed bands compatible with the size expected for ADH subunits I and II, indicating the successful expression of adhA and adhB.

Figure 4.

Figure 4

SDS-PAGE of recombinant protiens over-expressed in the genetically engineered strain Lanes: M, molecular weight marker (KDa); 1 and 2, original strain; 3, engineered strain.

Verification of ADH enzymatic activity in the engineered strain

ADH activity changed under different EC as shown in Figure 5. In the absence of ethanol, ADH activity was 0.40 U mg−1 for the original strain and 0.46 U mg−1 for the engineered one (Figure 5A). When EC increased from 1 to 4%, ADH activity of both strains also increased. The highest activity was observed at 4% of EC, corresponding to 4.23 U mg−1 and 5.28 U mg−1, respectively, for the original and engineered strains (Figure 5A). For EC above 4%, ADH activity decreased rapidly in both strains, reaching its lowest level at 8% of EC. At this point, ADH activity of the engineered strain (1.86 U mg−1) was ~1.9 times that of the original strain (0.96 U mg−1) (Figure 5A). In general, ADH activity of the engineered strain was higher than that of the original strain at any given EC, suggesting that ADH expression was also increased.

Figure 5.

Figure 5

Comparison of fermentation parameters in the original and engineered strains. ADH activity of the original strain(□) and engineered strain(■) were compared under the different content of ethanol in (A). In (B), white triangle and black triangle represent total acid content of the original strain and engineered strain, respectively. Similarly, white circle and black circle represent ethanol content of the original strain and engineered strain, respectively. Error bars show standard deviations of three replicated measurements.

Total acid content in the original and engineered strains

Total acid content and ethanol consumption in both strains were relatively low during the first 12 h of cultivation, probably due to A. pasteurianus having adapted to a high concentration of ethanol (Figure 5B). Between 12 and 72 h, acetic acid accumulated rapidly, while EC decreased with a steady rate. After 72 h, nearing the end of fermentation, accumulation of acetic acid slowed and EC remained almost unchanged. For the engineered strain, the final total acid content was 61.42 g L−1 and EC was 4.18 g L−1. For the original strain, total acid content was only 52.23 g L−1 and EC was 10.11 g L−1. This indicated that total acid content and ethanol conversion were higher in the engineered than the original strain under the same conditions. It also suggested that ADH activity was enhanced in the engineered strain.

Proteomic analysis of differentially expressed proteins

Proteomic analysis

Protein extracts from the original and engineered strains cultivated in YG2 at 170 rpm at 32°C for 48 h were analyzed by 2D-PAGE (IPG 4-7, 17-cm strips followed by SDS-PAGE) (Figure 6). Nineteen representative differentially expressed protein spots were identified.

Figure 6.

Figure 6

Comparison of 2D-PAGE patterns between original engineered strains. (A) Primary 2D-PAGE maps. (B) 2D-PAGE maps analyzed using PD Quest 8.0 software. Protein spots whose expression level changed more than 50% were identified as differentially expressed proteins.

Functional analysis of differentially expressed proteins

Differentially expressed protein spots were analyzed by tandem mass spectrometry (MS/MS) and the peptide fingerprint spectrum was identified. The Swiss-Prot protein database (http://www.uniprot.org/) was used to search for peptides; 17 of the 19 queried peptides matched those in the database.

Functional analysis of identified protein spots confirmed significantly higher levels of PQQ-ADH (adhA and adhB) in the engineered compared to the original strain. This was consistent with SDS-PAGE analysis (Figure 4). Overall, we identified 13 up-regulated and four down-regulated protein spots; two additional spots could not be identified (Table 3). PQQ-ADH, chaperonin, and acetaldehyde dehydrogenase were particularly up-regulated, indicating that PQQ-ADH over-expression enhanced the ethanol oxidation respiratory chain (Illeghems et al., 2013).

Table 3.

Protein identification using MS/MS peptide fragmentation and Swiss-Prot database search.

Spota Swiss-prot accession number Identified proteinb Fold changec Length Mass (kDa)d pIe Mascot scoref Functional classification
1 C7JC25 Heat shock protein DnaK 2.05 634 67.5 4.9 1965 coping with heat or external environmental pressure
2 C7JBN6 Trigger factor 4.52 444 49.3 4.78 580 peptidyl-prolyl cis-trans isomerase
3 C7JAP1 Thioredoxin 2.57 319 34.4 4.88 317 protein disulfide oxidoreductase activity
4 C7JDY6 Glutamine synthetase 3.64 481 53.1 5.34 147 ATP binding
5 C7JAQ5 Aldehyde dehydrogenase 6.32 463 50.6 5.27 1061 oxidoreductase activity
6 Q5HXK5 NAD(P)H-dependent 2-cyclohexen-1-one reductase −2.79 354 39.3 5.96 1056 oxidoreductase activity
7 C7JBD3 Alkyl hydroperoxide reductase AhpD 5.73 175 18.4 5.87 576 response to oxidative stress
8 C7JAW8 Alcohol dehydrogenase large subunit 5.05 742 81.6 6.77 305 oxidoreductase activity
9 C7JG48 Aconitate hydratase −2.34 897 97.7 6.21 1098 aconitate hydratase activity
10 C7JFQ0 50S ribosomal protein L1 4.17 230 23.9 6.87 702 direct binding to 23S rRNA
11 NI Uncharacterized protein NI NI NI NI NI NI
12 C7JG40 Transcription termination/antitermination protein NusA −2.46 514 57.6 4.61 348 translation elongation factor activity
13 C7JIQ0 NADH:flavin oxidoreductase −3.12 357 39.5 5.96 557 oxidoreductase activity
14 F1YU43 Chaperonin 5.32 546 58 5.49 576 ATP binding
15 M9WQJ0 Elongation factor Tu 2.69 836 74.9 5.22 158 translation elongation factor activity
16 C7JCS6 Thiosulfate sulfurtransferase 3.67 292 32.5 5.54 79 transferase activity
17 A0A0K0TA70 S-adenosylmethionine synthase 2.73 960 68.5 5.3 154 ATP+L-methionine+H2O = phosphate+diphosphate+S-adenosyl-L-methionine
18 C7JDV2 Esterase/lipase 3.12 388 40.8 4.98 254 lipolysis
19 NI Uncharacterized protein NI NI NI NI NI NI
a

Number as shown in Figure 6.

b

Protein spots whose expression level changed more than 50% as calculated by PDQuest 8.0 software. Nineteen spots were identified, of which 17 were researched and named as described in Table 3.

c

Fold changes in the expression of proteins between original and engineered strains. A minus sign indicates down-regulation, otherwise it denotes up-regulation.

d

Theoretical protein molecular mass as derived from amino acid sequences.

e

Isoelectric point of the protein as calculated from amino acid sequences.

f

Percentage of predicted protein sequence covered by matched peptides via MASCOT (http://www.matrixscience.com/).

NI represented the protein spot could not be identified.

Spot 1 in Table 3 was identified as a DnaK heat shock protein. DnaK plays an important role in preventing protein denaturation, and restoring the original structure and biological activity, especially under heat shock or other stressful conditions. Heat shock protein up-regulation has been shown to coincide with resistance to external stresses, such as high acetic acid or other harmful environmental factors (Welch, 1993; Hartl and Hayer-Hartl, 2002). The behavior of AAB heat-shock proteins, such as GroES, GroEL, DnaK, and DnaJ, in response to changes in temperature, alcohol content, acidity and prevent protein misfolding have been studied before (Okamoto-Kainuma et al., 2002, 2004). Accordingly, the increased ethanol tolerance of the engineered strain may be explained by the up-regulation of heat shock proteins.

Spot 2 corresponded to a trigger factor with peptidyl-prolyl cis-trans isomerase activity. This factor can interact with short peptide chains by binding to the ribosome and thus facilitate the correct folding of newly synthesized peptides (Hesterkamp et al., 1996; Hartl and Hayer-Hartl, 2002).

Spot 4 corresponded to glutamine synthetase. This enzyme catalyzes the conversion of ammonium and glutamic acid to glutamine, which is involved in protein synthesis and transport of ammonia. The catalytic reaction of glutamine synthetase can be divided in two steps. In the first, ATP reacts with glutamic acid to form γ-glutamic acid. In the second, the phosphate group is replaced by the ammonium ion to yield glutamine (Rhee and Chock, 1976). Recently, glutamine has been shown to control intracellular pH by neutralizing protons under highly acidic conditions in E. coli. The underlying mechanism depends on its conversion into glutamate and the release of ammonia (Lu et al., 2013). The up-regulation of glutamine synthetase may play an important role in preventing intracellular acidification under elevated acid stress.

We observed a down-regulation of oxidoreductases, such as NAD(P)H-dependent 2-cyclohexen-1-one reductase (spot 6) and NADH: flavin oxidoreductase (spot 13). These are known to be involved in bacterial growth; their down-regulation may indicate that ADH over-expression and increased acid production decrease cell growth. Some studies have suggested that the physiological effect induced by changes in environmental stress factors, such as temperature, salt ions, and acidity, is mediated by the oxidoreductase pathway (Richier et al., 2006; Ryter et al., 2007). Furthermore, increased acidity in the environment causes a metabolic imbalance, those results in the production of a large amount of oxygen free radicals, which cause oxidative damage in the cells. Consequently, oxidoreductase activity could be used as an indicator of an organism's response to environmental stress. The up-regulation of thioredoxin (spot 3) responsible for maintaining disulfide bonds, and the corresponding metabolic implications will require further research.

Spot 7 corresponded to alkyl hydroperoxide reductase, a member of the peroxiredoxin family responsible for the detoxification of active substances. To protect the cell and reduce peroxides, alkyl hydroperoxide reductase uses mainly the electrons donated by NADPH and the FAD reductase AhpF.

Aconitase (spot 9) is a coenzyme that catalyzes the conversion of citric acid to isocitrate and participates mainly in the tricarboxylic acid cycle (Nakano and Fukaya, 2008; Andrés-Barrao et al., 2012). Down-regulation of aconitase suggested reduced tricarboxylic acid cycle activity, possibly explaining why at the beginning of fermentation the engineered strain grew more slowly than the parent one. It has been suggested that improving aconitase expression could effectively increase acid producing by AAB (Nakano et al., 2004), however we found that PQQ-ADH over-expression actually down-regulated aconitase. Therefore, the link between aconitase levels and acid production in AAB will require further investigation.

Spot 15 was identified as a translation elongation factor Tu (EF-Tu) showed an up-regulated expression level, as shown in Table 3. It has a conserved structure spanning 836 amino acid residues. EF-Tu, an essential factor for protein synthesis promoted the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome (Lariviere et al., 2001). This differential expression was associated with the significant increase in protein translation by constructing a engineered strain that over-expressed PQQ-ADH subunits I (adhA) and II (adhB).

Proteomic analysis revealed that aldehyde dehydrogenase (ALDH) (spot 5), the large subunit of ethanol dehydrogenase (spot 8), and a chaperonin (spot 14) were up-regulated. This was likely due to PQQ-ADH over-expression and increased flux through the ethanol oxidation respiratory chain pathway. Heat shock protein (spot 1), trigger factor (spot 2), glutamine synthetase (spot 4), alkyl hydroperoxide reductase (spot 7), and elongation factor Tu (spot 15) were also up-regulated in the engineered strain, possibly explaining its improved tolerance of environment stresses, such as acid, heat, and alcohol. However, aconitase, a key enzyme of the tricarboxylic acid cycle, was down-regulated, which could lead to lower tricarboxylic acid cycle activity and lower growth of AAB.

Metabolic flux analysis

The suggested metabolic network of A. pasteurianus JST-S with ethanol and glucose was shown in Figure 7 (Illeghems et al., 2013). All the biochemical reactions and enzymes are presented in Table 4, metabolic flux equations of A. pasteurianus JST-S corresponding to these reactions are shown in Table 5. A total of 33 equations were obtained from those biochemical reactions, following the basal mass balance. The coefficient of nine equations was obtained from previous studies (Longacre et al., 1997; Li et al., 2014), whereas that of all others was computed by dividing the net change in the concentration of metabolite during a short period of the nearly stationary phase by the duration of this phase. At 48–60 h, the fermentation rate was very high (As shown in Figure 5B), but the synthesis of cell biomass was almost stationary (data not show). Therefore, we selected the fermentation time of original strain and engineered strain for 48 h for the analysis of fluxes and identified a total of 33 fluxes, a number that was equal to that of biochemical reactions.

Figure 7.

Figure 7

The metabolic network of A. pasteurianus JST-S Glc, glucose; G6P, glucose-6-phhospahte; F6P, fructose-6-phosphate; Ru5P, ribulose 5-posphate; G3P, glyceraldehydes-3-phosphate; PEP, poshonolpyruvate; Pyr, pyruvate; Pyr, pyruvate; AC.H., Acetaldehyde; OAA, oxaloacetate; Acetyl-CoA, acetyl coenzyme A; CoA, Coenzyme A; Lac, Lactate; Ace, Acetate; EtOH, ethanol; Cit, citrate; Isoc, Isocitrate; α-Ket, α-ketoglutaric acid; Suc, succinic acid; Fum, fumarate; Mal, Malate; BM, biomass.

Table 4.

Reactions and enzymes in the metabolic pathway of Acetic acid in A. pasteurianus JST-S.

NO. Enzyme Metabolic reactions
1 Glucokinase ATP + Glc = ADP + G6P
2 Glucose-phosphate-isomerase G6P = F6P
3 Glucose-6-phosphate dehydrogenase G6P + 2 × NADP+ = 2 × NADPH + Ru5P + CO2
4 Transketolase/Transaldolase 3 × Ru5P = 2 × F6P + G3P
5 Phosphofructokinase /Aldolase/ Triose-phosphate-isomerase ATP + F6P = ADP + 2 × G3P
6 Enolase /Phosphoglycerate-kinase / Phosphoglyceromutase /Glyceraldehydes -phosphate-dehydrogenase G3P + NAD+ + Pi + ADP = PEP + NADH + ATP + H2O + H+
7 Pyruvate-kinase ADP + PEP = ATP + Pyr
8 Phosphoenolpyruvate-carboxykinase CO2+ PEP + ADP = OAA + ATP
9 Pyruvate dehydrogenase Pyr + CoA + NAD+ = Ac-CoA + CO2+ NADH
10 Pyruvate decarboxylase Pyr = AC.H. + CO2
11 Lactate dehydrogenase Pyr + NADH + H+ = Lac + NAD+
12 Pyruvate carboxylase ATP + Pyr + HCO3- = ADP + Pi + OAA
13 Phosphotransacetylase /acetate kinase Ac-CoA + Pi + ADP = CoA + Ace + ATP
14 Alcohol dehydrogenase EtOH + NAD+ = AC.H. + NADH + H+
15 Acetaldehyde dehydrogenase AC.H. + NAD+ = Ace + NADH + H+
16 Citrate synthase Ac-CoA + H2O + OAA = Cit + CoA
17 Aconitase Cit = Isoc
18 Isocitrate dehydrogenase Isoc + NADP+ = α-Ket + NADPH + CO2
19 Oxoglutarate dehydrogenase complex α-Ket + NAD+ = Suc + NADH + H+ + CO2
20 Fumarate reductase Suc + FAD+ = Fum + FADH
21 Fumarate hydratase Fum + H2O = Mal
22 Malate dehydrogenase Mal + NAD+ = OAA + NADH + H+

Glc, glucose; G6P, glucose-6-phosphate; F6P, fructose-6-phosphate; Ru5P, ribulose 5-phosphate; G3P, glyceraldehydes-3-phosphate; PEP, phosphoenolpyruvate; Pyr, pyruvate; AC.H., Acetaldehyde; OAA, oxaloacetate; Acetyl-CoA, acetyl coenzyme A; CoA, Coenzyme A; Lac, Lactate; Ace, Acetate; EtOH, ethanol; Cit, citrate; Isoc, Isocitrate; α-Ket, α-ketoglutaric acid; Suc, succinic acid; Fum, fumarate; Mal, Malate.

Table 5.

Metabolic flux equations of A. pasteurianus JST-S.

Metabolic notes NO. Flux equations Metabolic notes NO. Flux equations
G6P 1 p1−p2−p3−p24 = 0 Fum 18 p21−p22 = 0
2 p2−p3 = 0 Mal 19 p22−p23 = 0
F6P 3 p2+p4−p6−p26 = 0 OAA 20 p9−p13−p17+p23−p31 = 0
Ru5P 4 p3−p4−p5−p25 = 0 BiomassG6P 21 p24−0.005349p33 = 0
5 p4−0.5 × p5 = 0 BiomassF6P 22 p25−0.001644p33 = 0
G3P 6 p5+p6−0.5 × p7−p27 = 0 BiomassRu5P 23 p26−0.008948p33 = 0
PEP 7 p7−p8−p9−p29 = 0 BiomassG3P 24 p27−0.001291p33 = 0
8 p8−6 × p9 = 0 BiomassPEP 25 p28−0.006889p33 = 0
Pyr 9 p8−p10−p11−p12+p13−p29 = 0 BiomassPyr 26 p29−0.03604p33 = 0
10 4 × p12−p13 = 0 BiomassAc−CoA 27 p30−0.004139p33 = 0
Pyr → Ace 11 p11−p14 = 0 BiomassOAA 28 p31−0.01959p33 = 0
Ac-CoA 12 p10−p17−p30 = 0 Biomassα−Ket 29 p32−0.002744p33 = 0
AC.H. 13 p15−p16 = 0 Substrates 30 p1 = ΔGlc
Cit 14 p17−p18 = 0 31 p15 = ΔEtOH
Isoc 15 p18−p19 = 0 Products 32 p14+p16 = ΔAce
a-Ket 16 p19−p20−p32 = 0 33 p33 = ΔBM
Suc 17 p20−p21 = 0

ΔGlc, the glucose consumption; ΔEtOH, the ethanol consumption; ΔAce, acetic acid production; ΔBM, the variation of biomass.

Wet body weight of original strain and engineered strain was respectively 1.6 g L−1 and 1.54 g L−1 when fermentation time was 48 h at 32°C for 170 rpm. Original flux data of engineered strain and original strain was shown as in Table 6. The total flux of acetic acid production in engineered strain (8.2110 mmol gDW™1h−1) was higher than that of the original strain (5.2586 mmol gDW™1h−1), this was the result of the modification of ADH genes in A. pasteurianus JST-S. Thus, this further explained that the up-regulated expression of key enzymes in ethanol oxidation respiratory chain was in accord with the total flux data of acetic acid production. In Table 6, the flux of ethanol uptake in the original strain (5.1262 mmol gDW™1h−1) was lower that of engineered strain (7.8889 mmol gDW™1h−1), which meant the ethanol tolerance of engineered strain was better than that of original strain. That was what heat shock protein, trigger factor, glutamine synthetase, alkyl hydroperoxide reductase, and elongation factor Tu were up-regulated in the engineered strain (as shown in Figure 6, Table 3). The flux of glucose uptake in the original strain (0.2574 mmol gDW™1h−1) was higher than that of engineered strain (0.2337 mmol gDW™1h−1), indicating that the biomass of original strain was higher than that of engineered strain in the same fermentation time, this was consistent with the analysis of down-regulated oxidoreductases, such as NAD(P)H-dependent 2-cyclohexen-1-one reductase and flavin oxidoreductase (as shown in Figure 6, Table 3). The alcohol dehydrogenase gene of A. pasteurianus JST-S was modified by gene engineering might disturb the integrity of a bacterial gene sequence so that cell growth rate slowed down and the fluxes of various organic acids in TCA decreased comparing with the original strain (as shown in Table 6). The decrease in the fluxes of various organic acids in TCA might be due to the down-regulation of aconitase as a key enzyme of the tricarboxylic acid cycle (as shown in Figure 6, Table 3). These studies, combining proteome analysis with MFA, will make us easier to understand the effect of over-expressed PQQ-ADH on the metabolism of internal substances and may provide a reference for theory analysis of the metabolic mechanism with AAB.

Table 6.

Original flux data of engineered strain and original strain.

Flux data Engineered strain Original strain Flux data Engineered strain Original strain
p1 0.2337 0.2574 p18 0.0814 0.3169
p2 0.1146 0.1265 p19 0.0814 0.3169
p3 0.1146 0.1265 p20 0.0791 0.3146
p4 0.0357 0.0397 p21 0.0791 0.3146
p5 0.0714 0.0793 p22 0.0791 0.3146
p6 0.1489 0.1647 p23 0.0791 0.3146
p7 0.4384 0.4859 p24 0.0045 0.0045
p8 0.3708 0.4115 p25 0.0075 0.0075
p9 0.0618 0.0686 p26 0.0014 0.0014
p10 0.0849 0.3204 p27 0.0011 0.0011
p11 0.3221 0.1324 p28 0.0058 0.0058
p12 0.0145 0.0162 p29 0.0072 0.0072
p13 0.0578 0.0646 p30 0.0035 0.0035
p14 0.3221 0.1324 p31 0.0016 0.0016
p15 7.8889 5.1262 p32 0.0023 0.0023
p16 7.8889 5.1262 p33 0.8401 0.8401
p17 0.0814 0.3169

mmol gDW−1h−1.

Conclusions

To study PQQ-ADH over-expression, A. pasteurianus JST-S adhA and adhB were amplified by PCR, subcloned into a vector, and transformed back into A. pasteurianus JST-S. A comparison of the fermentation parameters indicated that acid production and ethanol conversion were higher in the engineered than in the original strain. The metabolic network was constructed and the MFA of the pathway from ethanol and glucose was also further investigated by comparing with original strain and engineered strain. Our study demonstrated that PQQ-ADH over-expression is an effective way to improve the acetic acid production in A. pasteurianus. Future experiments should aim at finding and analyzing the relative metabolic mechanism that are responsible for the tolerance of environment stresses.

Author contributions

XW designed the study and wrote the protocol. HY conducted all experiments. MZ, XC, and JC took part in materials preparation. ZZ and LP took part in the manuscript preparation. LC and SJ performed the data analysis. ZW took part in polishing the manuscript. XL wrote and revised the manuscript.

Conflict of interest statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Footnotes

Funding. This work was supported by National Natural Science Foundation of China (31601465), Anhui Provincial Natural Science Foundation (1408085MKL17), Anhui Science and Technology Project (15CZZ03100), Projects of Hefei University of Technology (JZ2014HGQC0124, JZ2015HGBZ0524), and the Key Laboratory for Agricultural Products Processing of Anhui Province, School of Food Science and Engineering, Hefei University of Technology.

References

  1. Andrés-Barrao C., Saad M. M., Chappuis M. L., Boffa M., Perret X., Pérez R. O., et al. (2012). Proteome analysis of Acetobacter pasteurianus, during acetic acid fermentation. J. Proteomics 75, 1701–1717. 10.1016/j.jprot.2011.11.027 [DOI] [PubMed] [Google Scholar]
  2. Antoniewicz M. R. (2015). Methods and advances in metabolic flux analysis: a mini-review. J. Ind. Microbiol. Biotechnol. 42, 317–325. 10.1007/s10295-015-1585-x [DOI] [PubMed] [Google Scholar]
  3. Chen Y., Bai Y., Li D., Wang C., Xu N., Wu S., et al. (2016). Correlation between ethanol resistance and characteristics of PQQ-dependent ADH in acetic acid bacteria. Eur. Food. Res. Technol. 242, 837–847. 10.1007/s00217-015-2589-5 [DOI] [Google Scholar]
  4. Chinnawirotpisan P., Theeragool G., Limtong S., Toyama H., Adachi O. O., Matsushita K. (2003). Quinoprotein alcohol dehydrogenase is involved in catabolic acetate production, while NAD-dependent alcohol dehydrogenase in ethanol assimilation in Acetobacter pasteurianusSKU1108. J. Biosci. Bioeng. 96, 564–571. 10.1016/S1389-1723(04)70150-4 [DOI] [PubMed] [Google Scholar]
  5. Dandekar T., Fieselmann A., Majeed S., Ahmed Z. (2014). Software applications toward quantitative metabolic flux analysis and modeling. Brief. Bionform. 15, 91–107. 10.1093/bib/bbs065 [DOI] [PubMed] [Google Scholar]
  6. Hartl F. U., Hayer-Hartl M. (2002). Molecular chaperones in the cytosol: from nascent chain to folded protein. Science 295, 1852–1858. 10.1126/science.1068408 [DOI] [PubMed] [Google Scholar]
  7. Hesterkamp T., Hauser S., Lütcke H., Bukau B. (1996). Escherichia coli trigger factor is a prolyl isomerase that associates with nascent polypeptide chains. Proc. Natl. Acad. Sci. U.S.A. 93, 4437–4441. 10.1073/pnas.93.9.4437 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Illeghems K., De V. L., Weckx S. (2013). Complete genome sequence and comparative analysis of Acetobacter pasteurianus 386B, a strain well-adapted to the cocoa bean fermentation ecosystem. BMC Genomics 14:526. 10.1186/1471-2164-14-526 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Kanchanarach W., Theeragool G., Yakushi T., Toyama H., Adachi O., Matsushita K. (2010). Characterization of thermotolerant Acetobacter pasteurianus strains and their quinoprotein alcohol dehydrogenases. Appl. Microbiol. Biot. 85, 741–751. 10.1007/s00253-009-2203-5 [DOI] [PubMed] [Google Scholar]
  10. Kondo K., Beppu T., Horinouchi S. (1995). Cloning, sequencing, and characterization of the gene encoding the smallest subunit of the three-component membrane-bound alcohol dehydrogenase from Acetobacter pasteurianus. J. Bacteriol. 177, 5048–5055. 10.1128/jb.177.17.5048-5055.1995 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Kovach M. E., Elzer P. H., Hill D. S., Robertson G. T., Farris M. A., Roop II R. M., et al. (1995). Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166, 175–176. 10.1016/0378-1119(95)00584-1 [DOI] [PubMed] [Google Scholar]
  12. Krahulec J., Kretov M., Grones J. (2003). Characterisation of plasmids purified from Acetobacter pasteurianus 2374. Biochem. Biophys. Res. Commun. 310, 94–97. 10.1016/j.bbrc.2003.08.125 [DOI] [PubMed] [Google Scholar]
  13. Krusong W., Kerdpiboon S., Jindaprasert A., Yaiyen S., Pornpukdeewatana S., Tantratian S. (2015). Influence of calcium chloride in the high temperature acetification by strain Acetobacter aceti WK for vinegar. J. Appl. Microbiol. 119, 1291–1300. 10.1111/jam.12930 [DOI] [PubMed] [Google Scholar]
  14. Lariviere F. J., Wolfson A. D., Uhlenbeck O. C. (2001). Uniform binding of aminoacyl-tRNAs to elongation factor Tu by thermodynamic compensation. Science 294, 165–168. 10.1126/science.1064242 [DOI] [PubMed] [Google Scholar]
  15. Lasko D. R., Schwerdel C., Bailey J. E., Sauer U. (1997). Acetate-specific stress response in acetate-resistant bacteria: an analysis of protein patterns. Biotechnol. Progr. 13, 519–523. 10.1021/bp970075f [DOI] [PubMed] [Google Scholar]
  16. Li X. J., Liu Y., Yang Y., Zhang H., Wang H. L., Wu Y., et al. (2014). High levels of malic acid production by the bioconversion of corn straw hydrolyte using an isolated Rhizopus Delemar Strain. Biotechnol. Bioproce. E. 19, 478–492. 10.1007/s12257-014-0047-z [DOI] [Google Scholar]
  17. Li X. J., Zheng Z., Wei Z. J., Jiang S. T., Pan L. J., Weng S. B. (2009). Screening, breeding and metabolic modulating of a strain producing succinic acid with corn straw hydrolyte. World J. Microbiol. Biotechnol. 25, 667–677. 10.1007/s11274-008-9936-7 [DOI] [Google Scholar]
  18. Longacre A., Reimers J. M., Gannon J. E., Wright B. E. (1997). Flux analysis of glucose metabolism in Rhizopus oryzae for the purpose of increasing lactate yields. Fungal Genet. Biol. 21, 30–39. 10.1006/fgbi.1996.0952 [DOI] [PubMed] [Google Scholar]
  19. Lu P., Ma D., Chen Y., Guo Y., Chen G. Q., Deng H., et al. (2013). L-glutamine provides acid resistance for Escherichia coli through enzymatic release of ammonia. Cell Res. 23, 635–644. 10.1038/cr.2013.13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Matsushita K., Kobayashi Y., Mizuguchi M., Toyama H., Adachi O., Sakamoto K., et al. (2008). A tightly bound quinone functions in the ubiquinone reaction sites of quinoprotein alcohol dehydrogenase of an acetic acid bacterium, Gluconobacter suboxydans. Biosci. Biotech. Bioch. 72, 2723–2731. 10.1271/bbb.80363 [DOI] [PubMed] [Google Scholar]
  21. Matsushita K., Takaki Y., Shinagawa E., Ameyama M., Adachi O. (1992). Ethanol oxidase respiratory chain of acetic acid bacteria. reactivity with ubiquinone of pyrroloquinoline quinone-dependent alcohol dehydrogenases purified from Acetobacter aceti and Gluconobacter suboxydans. Biosci. Biotech. Bioch. 56, 304–310. 10.1271/bbb.56.304 [DOI] [Google Scholar]
  22. Nakano S., Fukaya M. (2008). Analysis of proteins responsive to acetic acid in acetobacter: molecular mechanisms conferring acetic acid resistance in acetic acid bacteria. Int. J. Food Microbio. 125, 54–59. 10.1016/j.ijfoodmicro.2007.05.015 [DOI] [PubMed] [Google Scholar]
  23. Nakano S., Fukaya M., Horinouchi S. (2004). Enhanced expression of aconitase raises acetic acid resistance in Acetobacter aceti. Fems. Microbio. Lett. 235, 315–322. 10.1111/j.1574-6968.2004.tb09605.x [DOI] [PubMed] [Google Scholar]
  24. Okamoto-Kainuma A., Wang Y., Ishikawa M. (2004). Cloning and characterization of the dnaKJ operon in Acetobacter aceti. J. Biosci. Bioeng. 97, 339–342. 10.1016/S1389-1723(04)70216-9 [DOI] [PubMed] [Google Scholar]
  25. Okamoto-Kainuma A., Yan W., Kadono S., Tayama K., Koizumi Y., Yanagida F. (2002). Cloning and characterization of groESL operon in Acetobacter aceti. J. Biosci. Bioeng. 94, 140–147. 10.1016/S1389-1723(02)80134-7 [DOI] [PubMed] [Google Scholar]
  26. Qi Z. L., Wang W., Yang H. L., Xia X. L., Yu X. B. (2014). Mutation of Acetobacter pasteurianus, by UV irradiation under acidic stress for high-acidity vinegar fermentation. Int. J. Food Sci. Techno. 49, 468–476. 10.1111/ijfs.12324 [DOI] [Google Scholar]
  27. Qin H., Sun Q., Pan X., Qiao Z., Yang H. (2016), Microbial diversity biochemical analysis of Suanzhou: a traditional Chinese fermented cereal gruel. Front. Microbiol. 7:1311. 10.3389/fmicb.2016.01311 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Quintero Y., Poblet M., Guillamón J. M., Mas A. (2009). Quantification of the expression of reference and alcohol dehydrogenase genes of some acetic acid bacteria in different growth condition. J. Appl. Microbio. 106, 666–674. 10.1111/j.1365-2672.2008.04046.x [DOI] [PubMed] [Google Scholar]
  29. Rhee S. G., Chock P. B. (1976). Mechanistic studies of glutamine synthetase from Escherichia coli: kinetic evidence for two reaction intermediates in biosynthetic reaction. Proc. Natl. Acad. Sci. U.S.A. 73, 476–480. 10.1073/pnas.73.2.476 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Richier S., Sabourault C., Courtiade J., Zucchini N., Allemand D., Furla P. (2006). Oxidative stress and apoptotic events during thermal stress in the symbiotic sea anemone, anemonia viridis. FEBS J. 273, 4186–4198. 10.1111/j.1742-4658.2006.05414.x [DOI] [PubMed] [Google Scholar]
  31. Ryter S. W., Kim H. P., Hoetzel A., Park J. W., Nakahira K., Wang X., et al. (2007). Mechanisms of cell death in oxidative stress. Antioxid. Redox Sign. 9, 49–89. 10.1089/ars.2007.9.49 [DOI] [PubMed] [Google Scholar]
  32. Steiner P., Sauer U. (2001). Proteins induced during adaptation of Acetobacter aceti to high acetate concentrations. Appl. Environ. Microb. 67, 5474–5481. 10.1128/AEM.67.12.5474-5481.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Stephanopoulos G. (1999). Metabolic fluxes and metabolic engineering. Metab. Eng. 1, 1–11. 10.1006/mben.1998.0101 [DOI] [PubMed] [Google Scholar]
  34. Toyama H., Mathews F. S., Adachi O., Matsushita K. (2004). Quinohemoprotein alcohol dehydrogenases: structure, function, and physiology. Arch. Bioch. Biophys. 428, 10–21. 10.1016/j.abb.2004.03.037 [DOI] [PubMed] [Google Scholar]
  35. Trček J., Matsushita K. (2013). A unique enzyme of acetic acid bacteria, PQQ-dependent alcohol dehydrogenase, is also present in frateuria aurantia. Appl. Microbiol. Biot. 97, 7369–7376. 10.1007/s00253-013-5007-6 [DOI] [PubMed] [Google Scholar]
  36. Trček J., Mira N. P., Jarboe L. R. (2015). Adaptation and tolerance of bacteria against acetic acid. Appl. Microbiol. Biot. 99, 6215–6129. 10.1007/s00253-015-6762-3 [DOI] [PubMed] [Google Scholar]
  37. Trček J., Toyama H., Czuba J., Misiewicz A., Matsushita K. (2006). Correlation between acetic acid resistance and characteristics of PQQ-dependent ADH in acetic acid bacteria. Appl. Microbio. Biot. 70, 366–373. 10.1007/s00253-005-0073-z [DOI] [PubMed] [Google Scholar]
  38. Wallenius J., Maaheimo H., Eerikäinen T. (2016). Carbon 13-metabolic flux analysis derived constraint-based metabolic modelling of Clostridium acetobutylicum in stressed chemostat conditions. Bioresour. Technol. 219, 378–386. 10.1016/j.biortech.2016.07.137 [DOI] [PubMed] [Google Scholar]
  39. Wang Z., Ning Z., Shi J., Feng W., Liu Y., Liang X. (2015). Comparative proteome of Acetobacter pasteurianus Ab3 during the high acidity rice vinegar fermentation. Appl. Biochem. Biotech. 177, 1573–1588. 10.1007/s12010-015-1838-1 [DOI] [PubMed] [Google Scholar]
  40. Welch N. J. (1993). Heat shock proteins functioning as molecular chaperones: their roles in normal and stressed cells, in Molecular Chaperones, eds Ellis R. J., Laskey R. A., Lorimer G. H. (Netherlands: Springer Netherlands; ), 71–77. [DOI] [PubMed] [Google Scholar]
  41. Yakushi T., Matsushita K. (2010). Alcohol dehydrogenase of acetic acid bacteria: structure, mode of action, and applications in biotechnology. Appl. Microbiol. Biot. 86, 1257–1265. 10.1007/s00253-010-2529-z [DOI] [PubMed] [Google Scholar]
  42. Yanisch-Perron C., Vieira J., Messing J. (1985). Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mpl8 and pUC19 vectors. Gene 33, 103–119. 10.1016/0378-1119(85)90120-9 [DOI] [PubMed] [Google Scholar]
  43. Zhang J. G., Zhang F., Thakur K., Hu F., Wei Z. J. (2017). Valorization of Spent Escherichia coli media using green microalgae Chlamydomonas reinhardtii and feedstock production. Front. Microbiol. 8:1026. 10.3389/fmicb.2017.01026 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Zheng Y., Wang M., Shen Y. B., Niu D. D., Luo J. M., Nie Z. Q., et al. (2014). Genetic Engineering Acetic Acid Bacteria of Overexpressing Coenzyme PQQ (Pyrroloquinoline Quinone) Synthetic Proteins and Application of Bacteria. CN, CN 103740629 A. Tianjin, CN. State Intellectual Property Office of the P.R.C.

Articles from Frontiers in Microbiology are provided here courtesy of Frontiers Media SA

RESOURCES