ABSTRACT
Carbapenem antibiotics are among the mainstays for treating infections caused by Acinetobacter baumannii, especially in the Northwest United States, where carbapenem-resistant A. baumannii remains relatively rare. However, between June 2012 and October 2014, an outbreak of carbapenem-resistant A. baumannii occurred in 16 patients from five health care facilities in the state of Oregon. All isolates were defined as extensively drug resistant. Multilocus sequence typing revealed that the isolates belonged to sequence type 2 (international clone 2 [IC2]) and were >95% similar as determined by repetitive-sequence-based PCR analysis. Multiplex PCR revealed the presence of a blaOXA carbapenemase gene, later identified as blaOXA-237. Whole-genome sequencing of all isolates revealed a well-supported separate branch within a global A. baumannii phylogeny. Pacific Biosciences (PacBio) SMRT sequencing was also performed on one isolate to gain insight into the genetic location of the carbapenem resistance gene. We discovered that blaOXA-237, flanked on either side by ISAba1 elements in opposite orientations, was carried on a 15,198-bp plasmid designated pORAB01-3 and was present in all 16 isolates. The plasmid also contained genes encoding a TonB-dependent receptor, septicolysin, a type IV secretory pathway (VirD4 component, TraG/TraD family) ATPase, an integrase, a RepB family plasmid DNA replication initiator protein, an alpha/beta hydrolase, and a BrnT/BrnA type II toxin-antitoxin system. This is the first reported outbreak in the northwestern United States associated with this carbapenemase. Particularly worrisome is that blaOXA-237 was carried on a plasmid and found in the most prominent worldwide clonal group IC2, potentially giving pORAB01-3 great capacity for future widespread dissemination.
KEYWORDS: Acinetobacter, OXA-237, carbapenemase, plasmid, Acinetobacter baumannii
INTRODUCTION
Long-term acute care hospitals (LTACHs) and skilled nursing facilities (SNFs) are essential components of the health care delivery system for many patients. However, in recent years, numerous outbreaks of multidrug-resistant (MDR) Gram-negative organisms have been described in these facilities (1–4). A major challenge in infection control now lies in the detection, identification, and prevention of the spread of highly resistant organisms from LTACHs to other health care facilities (5). Acinetobacter baumannii, Pseudomonas aeruginosa, Escherichia coli, and Klebsiella pneumoniae are among the pathogens in most need of infection prevention and control (1–4, 6, 7). In some areas of the United States, A. baumannii is endemic in LTACHs, colonizing patients and causing subsequent infection (4).
Successful treatment of infection caused by A. baumannii requires early and effective antimicrobial therapy. Carbapenems were among the most effective antibiotics against A. baumannii. However, carbapenem resistance is ever on the rise and has created significant therapeutic challenges. In A. baumannii, carbapenem resistance is most often mediated by the presence of a carbapenemase. Although metallo-β-lactamases are still rare in A. baumannii in the United States, OXA (oxacillinase) carbapenemases are common. The OXA-carbapenemase genes can be both chromosomally and/or plasmid encoded, and are often associated with insertion elements, particularly ISAba1 (8). The acquired OXA carbapenem-hydrolyzing β-lactamase (bla) genes, associated with A. baumannii, that are most commonly found in the United States include blaOXA-23-like, blaOXA-24/40-like, and blaOXA-58-like. In addition, blaOXA-143-like and blaOXA-235-like are also detected; however, these latter two bla genes are found far less frequently.
Of note, the deduced amino acid sequence of the OXA-235-like carbapenemases share 54 to 57% identities with the acquired OXA-23, OXA-24/40, OXA-58, and OXA-143; 56% identity with the intrinsic OXA-51; and the highest shared identity of 85% with the OXA-134 class D β-lactamase, and thereby represents a novel subclass of OXAs (9). OXA-237, which is part of the OXA-235 oxacillinase family, contains important residues for carbapenem hydrolysis (Y112 and M223) that were previously identified in OXA-24 as contributing to a tunnel-like entrance for carbapenems into the active site (10). In addition, OXA-235 was shown to have an increased affinity for carbapenems but lower rates of hydrolysis relative to OXA-24 (9). Compared to OXA-235, OXA-237 has an amino acid change at position 208 (Asp208Gly). However, the exact structure/function role of this substitution has not been fully explored. The blaOXA-235-like carbapenemase genes to date have only been reported in two studies; one describes an extensive outbreak in Los Angeles County, California, reportedly involving hypervirulent strains, but not blaOXA-237 in particular (9, 11).
In this analysis, we characterized 16 highly carbapenem-resistant isolates that were part of an outbreak occurring in the state of Oregon from June 2012 to October 2014. In June 2012, an isolated case of extensively drug-resistant (XDR) A. baumannii from an Oregon patient (Oregon A. baumannii isolate 1 [ORAB01]) was reported to the Oregon Health Authority (OHA). XDR was defined as nonsusceptible to at least one agent in all but two or fewer antimicrobial categories (12). The isolate was resistant to penicillins, cephalosporins, extended-spectrum cephalosporins, carbapenems, fluoroquinolones, and aminoglycosides and was susceptible to tigecycline (using the Enterobacteriaceae breakpoint) and colistin. By November 2012, the OHA was notified of two other patients infected by XDR A. baumannii (ORAB02 and ORAB03). OHA reviewed all three cases and identified a common health care facility: SNF-A. In response, OHA launched a 2-year investigation, as fully described by Buser et al. (13). During the next 2 years, 13 other isolates, all XDR A. baumannii, were collected and available for molecular analysis (Fig. 1).
FIG 1.
Timeline of A. baumannii blaOXA-237-confirmed outbreak isolates from Oregon 2012 to 2014 (n = 16) with important events, specimen collection dates, and facilities highlighted. Isolate names are located within the boxes, e.g., “01” indicates ORAB01. “SC” represents ORABSC and is a surveillance culture (source: groin/axilla). Dark solid boxes, LTACH; diagonal line boxes, SNF-A; dots/no-fill boxes, other facilities; LTACH, long-term acute care hospital; SNF, skilled nursing facility; H, hospital.
We sought to define the molecular characteristics of the XDR A. baumannii isolates identified from the multifacility outbreak in Oregon. Our investigation revealed that these isolates harbored a plasmid that contained a blaOXA-235-like carbapenemase gene, blaOXA-237, as well as in the AF684 isolate from which blaOXA-237 was first reported in 2007 (9). This is the first outbreak report of this unique OXA carbapenemase and could represent a “sentinel event” that has implications for future surveillance studies and health care.
RESULTS AND DISCUSSION
The 16 blaOXA-237-positive A. baumannii isolates reported here were collected from June 2012 to October 2014, from 5 facilities in the state of Oregon: a LTACH, SNF-A, SNF-B H1, SNF-B H2, and SNF-C H2. Clinical specimens were obtained from blood (n = 2), wound (n = 2), urine (n = 5), respiratory (n = 5), axillary/groin (n = 1), and unknown (n = 1) sources. The surveillance source was axillary/groin. The A. baumannii isolates were initially selected due to their high-level carbapenem resistance and were a subset of 21 cases identified during this study (13). These 16 isolates were physically available for further molecular characterization.
Figures 1 and 2 track the timeline of isolate collection and the intra- and interfacility spread. The patient from whom isolate 1 (ORAB01) was collected transferred from the LTACH to SNF-A during early September 2012. Isolates 2 and 3 (ORAB02 and ORAB03) were obtained from patients at the SNF-A after patient 1 transferred and were collected in late September and November of 2012. Even though MDR and XDR A. baumannii strains are highly prevalent in LTACH facilities in other parts of the United States (6, 14, 15), Oregon is not recognized to have a high prevalence of these organisms, and therefore there was a chance to intervene and prevent them from establishing endemicity.
FIG 2.
Genetic characteristics of carbapenem-resistant A. baumannii carrying blaOXA-237 from Oregon, 2012 to 2014 (n = 16). The dendrogram depicts the genetic relatedness of outbreak organisms as determined by rep-PCR type, sequence type (MLST), collection date, facility, specimen source, the presence or absence of armA, and bla genes. LTACH, long-term acute care hospital; SNF, skilled nursing facility; H, hospital.
According to the antimicrobial susceptibility test results summarized in Table 1, all 16 isolates were resistant to all tested β-lactams, including carbapenems, piperacillin-tazobactam, and ceftazidime, and to the quinolones (levofloxacin and ciprofloxacin). Also, 93.8% (15/16) were intermediate (I) or resistant (R) to gentamicin, and 81.3% (13/16) were I or R to amikacin. Minocycline also showed poor activity against these isolates (12/16 were I or R). In addition, nine isolates were susceptible (MIC ≤ 0.5 μg/ml) and seven were resistant (MIC = 4 μg/ml or >8 μg/ml) to colistin using a 2-ml broth macrodilution method. The only antimicrobial to which the isolates were susceptible was tigecycline. However, if the current EUCAST breakpoints (S ≤ 1 μg/ml and R > 2 μg/ml) were adopted here in the United States, 62.5% (10/16) of these isolates would be considered resistant to this agent.
TABLE 1.
Antimicrobial susceptibility testing results of Oregon A. baumannii (ORAB) isolates carrying blaOXA-237
| Isolate | Date | MIC (μg/ml)a |
||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| TZP | CAZ | FEP | AMI | GEN | CIP | LEVO | MIN | DOR | IMI | MER | TGC | CST | ||
| ORAB01 | 6-14-12 | >64/4 | >16 | >16 | >32 | >8 | >2 | >8 | 8 | >2 | >8 | >8 | 2 | ≤0.5 |
| ORAB02 | 9-26-12 | >64/4 | >16 | 16 | >32 | >8 | >2 | >8 | 8 | >2 | 8 | >8 | 2 | >8 |
| ORAB03 | 11-22-12 | >64/4 | >16 | 8 | >32 | >8 | >2 | 8 | 16 | >2 | 8 | >8 | 2 | >8 |
| ORABSC | 12-21-12 | >64/4 | >16 | >16 | >32 | >8 | >2 | >8 | 16 | >2 | >8 | >8 | 2 | >8 |
| ORAB08 | 3-5-13 | >64/4 | >16 | 16 | >32 | >8 | >2 | >8 | 16 | >2 | 8 | >8 | 2 | >8 |
| ORAB09 | 3-11-13 | >64/4 | 16 | 8 | >32 | >8 | >2 | >8 | 8 | >2 | 4 | 8 | 2 | >8 |
| ORAB12 | 4-4-13 | >64/4 | >16 | 16 | >32 | >8 | >2 | >8 | 8 | >2 | >8 | >8 | 1 | >8 |
| ORAB13 | 5-6-13 | >64/4 | >16 | 16 | >32 | >8 | >2 | >8 | 8 | >2 | 8 | >8 | 2 | 4 |
| ORAB17 | 5-21-13 | >64/4 | >16 | >16 | >32 | >8 | >2 | >8 | 8 | >2 | 4 | 8 | 2 | ≤0.5 |
| ORAB18 | 5-31-13 | >64/4 | >16 | >16 | >32 | >8 | >2 | >8 | 4 | >2 | >8 | >8 | 1 | ≤0.5 |
| ORAB14 | 7-14-13 | >64/4 | >16 | 16 | >32 | >8 | >2 | >8 | 8 | >2 | >8 | >8 | 4 | ≤0.5 |
| ORAB15 | 7-24-13 | >64/4 | >16 | >16 | 32 | 8 | >2 | >8 | 8 | >2 | >8 | >8 | 1 | ≤0.5 |
| ORAB16 | 8-21-13 | >64/4 | >16 | 16 | >32 | >8 | >2 | >8 | 4 | >2 | 8 | >8 | 1 | ≤0.5 |
| ORAB21 | 6-3-14 | >64/4 | >16 | 16 | 8 | >8 | >2 | >8 | 4 | >2 | >8 | >8 | 1 | ≤0.5 |
| ORAB6b | 7-7-14 | >64/4 | >16 | >16 | ≤4 | ≤1 | >2 | >8 | 4 | >2 | >8 | >8 | 1 | ≤0.5 |
| ORAB23 | 10-29-14 | >64/4 | >16 | >16 | 16 | >8 | >2 | >8 | 16 | >2 | >8 | >8 | 2 | ≤0.5 |
Antimicrobial susceptibility tests were interpreted according to 2014 CLSI criteria for A. baumannii, except that FDA breakpoints for Enterobacteriaceae were used to interpret the tigecycline results. Antibiotics: TZP, piperacillin-tazobactam; CAZ, ceftazidime; FEP, cefepime; AMI, amikacin; GEN, gentamicin; CIP, ciprofloxacin; LEVO, levofloxacin; MIN, minocycline; DOR, doripenem; IMI, imipenem; MER, meropenem; TGC, tigecycline; CST, colistin.
The blaOXA carbapenemase multiplex PCR identified blaOXA-235-like and blaOXA-51-like genes in all 16 isolates. All isolates were negative for the metallo-β-lactamase genes blaNDM, blaIMP, and blaVIM and also for the carbapenemase genes blaKPC, blaGES, blaIMI, and blaNMC-A.
MLST analysis, based on the Pasteur scheme, identified all of the isolates as sequence type 2 (international clone 2 [IC2]), while repetitive-sequence-based PCR (rep-PCR) analysis revealed that they all belonged to one clonally related group (>95% similarity) (Fig. 2).
To better understand the genetic background of this outbreak, we performed whole-genome shotgun sequencing. Genome comparisons showed that the A. baumannii strains were nearly identical to one another. A global phylogeny constructed from whole-genome sequencing (WGS) assemblies indicated that the Oregon A. baumannii isolates cluster together in a clade also containing A. baumannii from the University of Washington, as well as from the southwestern United States and East Asia (Fig. 3) (16). In ORAB01, the Tn1548 transposon (17) was located in the chromosome, from ∼1.388-1.401 Mbp. Tn1548 carries several antibiotic resistance genes, including armA, which encodes a rRNA methyltransferase and confers resistance to amikacin and other aminoglycosides. Tn1548 was missing from strains ORAB15, ORAB21, ORAB23, and ORAB6b, and its absence was corroborated phenotypically by the susceptible/intermediate resistance they exhibit to amikacin (Table 1) and by the absence of an armA-specific PCR amplicon in those isolates (Fig. 2). However, the aphA6 gene was not detected in any of the isolates. Other than the intrinsic β-lactamases blaADC and blaOXA-51-like, additional β-lactamase genes were not found in these strains. The specific alleles identified for these two β-lactamases were blaADC-30 (an Acinetobacter AmpC β-lactamase) and blaOXA-66 and were present in all 16 isolates. The combination of blaADC-30 and blaOXA-66 occurring together has been reported before, as was the combination of blaOXA-237 and blaOXA-66 in strain AF684 isolated in 2007 (9, 18, 19).
FIG 3.
Global SNV-based phylogeny demonstrating the location of the ORAB isolates in an A. baumannii global context. The reference genome was A. baumannii ACICU (NC_010605.1), and all ∼1,800 A. baumannii genomes available in GenBank as of March 2017 were used to construct the tree using FastTreeMP.
We focused our examination of SNP differences on genes that could account for antibiotic resistance phenotypes, and in so doing found SNPs in genes (pmrA and pmrB) that have previously been associated with increased colistin resistance. All but one of the colistin resistant isolates (MIC = 4 μg/ml or >8 μg/ml; Table 1) had a single P170L amino acid substitution in PmrB that previously has been associated with polymyxin resistance (20). The lone colistin-resistant isolate (ORAB13) that did not contain the P170L mutation had a singular S17R substitution in PmrB instead. It is also interesting to note that two colistin-susceptible isolates (ORAB6b and ORAB21) had the P170L substitution in PmrB accompanied by a R111C mutation in PmrA. No other isolates had the R111C variation. Unfortunately, due to assembly issues for ORAB23, pmrA and pmrB genes could not be analyzed. All 16 isolates had identical gene sequences for lpxA, lpxC, and lpxD.
In addition, we mapped the locations of chromosomal and plasmid insertion sequence (IS) elements contained within the WGS data for all isolates (Table 2). This was done to help identify relatedness and transmission patterns of the isolates. Variable ISAba1 sites indicate that ORAB6b, ORAB21, and ORAB23 share a recent origin, as do ORAB09 and ORABSC (surveillance culture). ORAB14, ORAB17, and ORAB18 share a IS26-mediated deletion near 1.6 Mb in A. baumannii TYTH-1, whereas ORAB17 and ORAB18 have a 23-kb larger deletion than does ORAB14.
TABLE 2.
Location of variable ISAba1 sites and deletions within ORAB genomes relative to the position in the reference genome A. baumannii TYTH-1 (NC_018706.1)
| TYTH-1a coordinate | ORAB21 | ORAB6b | ORAB23 | ORAB09 | ORABSC | ORAB14 | ORAB17 | ORAB18 | ORAB15 |
|---|---|---|---|---|---|---|---|---|---|
| 958175 | X | X | X | ||||||
| 3032868 | X | X | |||||||
| 3230347 | X | X | |||||||
| 3634449 | X | X | |||||||
| Δ3.6 kb at 1.6 Mb | X | X | X | ||||||
| Δ23 kb at 1.6 Mb | X | X | |||||||
| pORAB01-3 | X |
Reference genome: A. baumannii TYTH-1 (NC_018706.1). Variable ISAba1 sites and deletion differences between isolates: ORAB21, ORAB6b, and ORAB23 share an ISAba1 site at bp 958175; ORAB09 and ORABSC share an ISAba1 site at bp 3032868; ORAB21 and ORAB6b share ISAba1 sites at bp 3230347 and 3634449. Isolates ORAB14, ORAB17, and ORAB18 have an ∼3.6-kb IS26-mediated deletion at 1.6 Mb, and additionally ORAB17 and ORAB18 have lost an ∼23-kb fragment at the same site. ORAB15 has an additional ISAba1 element inserted into pORAB01-3.
PacBio sequencing revealed the presence of three plasmids within the ORAB01 isolate: pORAB01-1 (110,965 bp), pORAB01-2 (24,022 bp), and pORAB01-3 (15,198 bp) (Table 3). Illumina assemblies were consistent with the presence of all three plasmids in all isolates, with the exception of ORAB21 and ORAB6b, which have lost pORAB01-1.
TABLE 3.
Detailed information regarding the pORAB01-3 plasmid
| pORAB01-3 ORF (accession no.) | Position (bp)a | Length (bp) | Functionb |
|---|---|---|---|
| WP_000932953.1 | 60–2471 | 2,412 | TonB-dependent receptor (Iron transport) |
| WP_000761346.1 | 2776–3237 | 462 | Septicolysin-like; cholesterol-dependent cytolysin family |
| WP_000965055.1 | 3558–4091C | 534 | hypothetical protein |
| WP_000903026.1 | 4159–5958C | 1,800 | Type IV secretory pathway, VirD4 component, TraG/TraD family ATPase |
| WP_000510443.1 | 5977–6180C | 204 | Hypothetical protein |
| WP_000171721.1 | 6217–7110C | 894 | Integrase, DNA breaking and rejoining enzymes |
| WP_001205341.1 | 8318–9268 | 951 | RepB family plasmid DNA replication initiator protein |
| WP_001096611.1 | 9261–9836 | 576 | DNA binding protein |
| WP_001022900.1 | 10184–10957C | 774 | Alpha/beta hydrolase |
| WP_000438826.1 | 11267–11554 | 288 | BrnT RNase toxin, of type II toxin-antitoxin system |
| WP_001983304.1 | 11547–11855 | 309 | BrnA antitoxin of type II toxin-antitoxin system |
| WP_000780881.1 | 11950–12384C | 435 | ISAba1 ORF 2 |
| WP_000149353.1 | 12471–13040C | 570 | ISAba1 ORF 1 |
| WP_000854010.1 | 13126–13956 | 831 | OXA-237 |
| WP_000149353.1 | 14090–14659 | 570 | ISAba1 ORF 1 |
| WP_000780881.1 | 14746–15180 | 435 | ISAba1 ORF 2 |
A superscript “C” indicates “encoded in the complementary orientation.”
ORF, open reading frame.
We provide here only a detailed analysis of the 15,198-bp plasmid within the ORAB01 isolate, pORAB01-3, which contained the genetic location of the blaOXA-237 gene (Fig. 4). A 3,548-bp segment of pORAB01-3 that contains the TonB-dependent receptor and septicolysin genes and flanking sequence was identical to a 3,548-bp segment of the A. baumannii plasmid pMMCU3 (GenBank accession number GQ904227) and nearly identical to a segment of A. baumannii plasmid pMMA2 (GenBank accession number GQ377752), which also harbored a blaOXA-24/40 carbapenemase gene (21). In fact, this sequence is found in >30 deposited A. baumannii plasmid sequences with ≥99% homology. In A. baumannii and other bacteria, TonB-dependent receptors are associated with iron uptake, host infection, and bacterial survival in bloodstream infections (22–24). Septicolysin is a pore-forming toxin and part of the cholesterol-dependent cytolysin family, which has been described in Clostridium septicum, Bacillus anthracis, and Streptococcus pneumoniae (25).
FIG 4.
Schematic of the linearized pORAB01-3 plasmid. List of genes and what they encode: repB, RepB family plasmid DNA replication initiator protein; DNA bp, DNA binding protein; α/β hydro, alpha/beta hydrolase; brnT, BrnT RNase toxin of the type II toxin-antitoxin system; brnA, BrnA antitoxin of type II toxin-antitoxin system; ISAba1 ORF 2 and ORF1 flanking OXA-237 on either side in opposite orientations; tonB, TonB-dependent receptor; SPL, septicolysin; type IV SS, VirD4, a type IV secretory pathway, VirD4 component, TraG/TraD family ATPase flanked on either side by hypothetical proteins (hp); int, an integrase.
Also of note in pORAB01-3 is a type IV secretory pathway, VirD4 component, TraG/TraD family ATPase. Type IV secretory systems (T4SS) mediate intracellular DNA and protein transfer via a homologous mechanism ancestrally related to the conjugation machinery of bacteria (26, 27). T4SS also secretes virulence factors into host cells and aides the uptake of DNA directly from the media during natural transformation (28). The DNA segment encoding the type IV secretory pathway, VirD4 component, TraG/TraD family ATPase is not commonly reported in A. baumannii plasmids.
Following in the plasmid are genes encoding a RepB family plasmid DNA replication initiator protein, an alpha/beta hydrolase, and the BrnT/BrnA type II toxin-antitoxin system. BrnT/BrnA are a set of linked genes that together encode a toxin and its antitoxin. When these systems are on plasmids, only daughter cells that inherit the complete plasmid survive; if the plasmid is absent, the unstable antitoxin is quickly broken down, and the stable toxin remains to kill the new cell and ensures the plasmid's survival (29–31). The sequence encoding BrnT/BrnA has been reported in >40 Acinetobacter plasmids.
Lastly, and of most interest to this outbreak, is the blaOXA-237 β-lactamase gene, which is flanked on either side by ISAba1 elements in opposite orientations. OXA-237 is an OXA-235-like carbapenemase that differs from OXA-235 by one amino acid, Asp208Gly. OXA-235 hydrolyzes penicillins and carbapenems but not extended-spectrum cephalosporins, and it demonstrates a high affinity for carbapenems but lower rates of hydrolysis relative to OXA-24/40 (9). OXA-237 most likely contributes to high-level carbapenem resistance particularly because it is flanked upstream by ISAba1, which has been shown to drive overexpression of OXA β-lactamases (32). Furthermore, together with the downstream copy of ISAba1, OXA-237 is in a composite transposon, which probably plays a role in its dissemination.
All other isolates were positive for the blaOXA-237 gene via the OXA carbapenemase multiplex PCR and were checked for the presence of the plasmid found in the ORAB01 isolate (pORAB01-3). By conducting four separate PCRs for each of the 16 blaOXA-237 positive isolates, we confirmed that ISAba1 flanked the blaOXA-237 cassette for every outbreak isolate, as was previously shown in the original AF684 isolate. In addition, the Illumina assemblies were consistent with the presence of the pORAB01-3 plasmid in all strains. Plasmids pORAB01-1 and pORAB01-2 sequences were run through the ResFinder −2.1 server. Resistance genes for the resistance mechanism categories listed were not found.
In terms of refining transmission patterns based upon genetic analysis, it appears that ORAB21, ORAB23, and ORAB6b were likely linked as far as transmission is concerned, based on the following evidence: (i) shared unique sites for ISAba1 elements, (ii) lack of the Tn1548 transposon that includes the armA gene, and (iii) loss of the pORAB01-1 plasmid (in ORAB21 and ORAB6b). These may also trace back to ORAB15 that was collected at an earlier time point and which also lacks the Tn1548 transposon. In addition, the IS26-mediated deletions suggest that ORAB14, ORAB17, and ORAB18 are linked genetically.
We note that the pORAB01-3 blaOXA-237-containing plasmid also had regions identical to portions of the p2ABAYE plasmid described by Vallenet et al. (33). The TonB-dependent receptor and septicolysin gene cassettes have been previously reported in other blaOXA carbapenemase-containing plasmids, e.g., plasmid pMMA2; this plasmid, however, contained blaOXA-24/40 and not blaOXA-237, as did pORAB01-3 (21). Also of note, ORAB15 has an additional ISAba1 element inserted into the plasmid, between the integrase and RepB genes. However, due to the site of insertion and its position relative to transcriptional orientation of the septicolysin gene, we do not think it drives the overexpression of the septicolysin gene as in plasmid pMMA2 (21). This outbreak of infections by A. baumannii carrying blaOXA-237 illustrates the interconnectedness of health care facilities and the fact that both epidemiological and molecular/genomic data are vital to defining an outbreak, identifying the source, gathering information on how best to treat patients, and truncating transmission. PacBio SMRT sequencing allowed for resolution of the 15,198-kb plasmid and definitive location identification of the blaOXA-237 gene.
Conclusion.
Our detailed molecular analysis focused on answering several key questions. (i) Was this a clonal outbreak? (ii) What mechanisms were responsible for the carbapenem-resistant phenotype? (iii) What is the significance of finding blaOXA-237? (iv) What is the genetic environment of blaOXA-237? Our initial thrust was to determine the molecular genetics of the carbapenem resistance by PCR amplification and, using subsequent genome sequencing, we discovered that a plasmid-carried blaOXA-237 gene was responsible for the carbapenem-resistant phenotype in a clonal outbreak.
In the United States, the frequency of MDR and XDR A. baumannii strain isolation has been increasing since 2005. However, some areas, such as Oregon and Washington, have rarely reported such strains. Thus, it was unexpected that an outbreak of XDR A. baumannii, mediated by blaOXA-237, would be identified in Oregon, given the uncommon presence of this bla gene in A. baumannii and the fact that such isolates are infrequently found in these areas. It should be noted that the A. baumannii in this study cluster with isolates from East Asia (Fig. 3), perhaps suggesting East Asia as the origin of XDR A. baumannii containing blaOXA-237. However, no reports of blaOXA-237-mediated carbapenem resistance have come out of that region.
Not only is the finding of blaOXA-237 a very rare event, since it has only been reported in one other isolate to date from California (9), but this is the first time it has been reported in an outbreak setting. What makes this finding particularly worrisome is that blaOXA-237 was carried on a plasmid and found in the most prominent worldwide clonal group IC2 (ST2), as recorded both in this study and in the original description. This gives pORAB01-3 great capacity for future widespread dissemination; indeed, such spread may already be occurring. Greater use of the carbapenemase multiplex PCR would likely uncover more isolates containing the blaOXA-235-like subclass. We should be vigilant in looking for this carbapenemase subclass as a cause for carbapenem resistance in A. baumannii, especially when it is not explained by the presence of the more common blaOXA-23 or blaOXA-58 genes.
MATERIALS AND METHODS
Setting and selection of isolates.
Sixteen A. baumannii isolates carrying blaOXA-237 reported in this study were initially selected due to their high-level carbapenem resistance and were a subset of 21 cases identified during this study (13). The blaOXA-237-positive A. baumannii AF684 strain was included as a control for comparison purposes (9).
Antimicrobial susceptibility testing.
We assessed the susceptibility of all isolates against a full panel of antibiotics—including piperacillin-tazobactam, ceftazidime, cefepime, amikacin, gentamicin, ciprofloxacin, levofloxacin, minocycline, doripenem, imipenem, meropenem, tigecycline, and colistin—using broth microdilution Sensititre GNX2F trays (Trek Diagnostic Systems, Oakwood Village, OH). American Type Culture Collection strains P. aeruginosa 27853 and E. coli 25922 were used as quality controls. Results were interpreted according to the 2014 Clinical and Laboratory Standards Institute (CLSI) guidelines (34). Breakpoints established by the FDA for Enterobacteriaceae were used to interpret MIC results for tigecycline (“susceptible” was defined as an MIC ≤ 2 µg/ml; and “resistant” was defined as an MIC ≥ 8 µg/ml). Colistin (sulfate salt; Sigma-Aldrich) MIC determinations were performed in duplicate using a broth macrodilution method in glass sterile tubes using Escherichia coli ATCC 25922 as a quality control according to CLSI guidelines (34).
blaOXA carbapenemase multiplex PCR.
A blaOXA carbapenemase multiplex PCR was performed using crude lysates from overnight cultures. This multiplex PCR assay is able to detect multiple blaOXA carbapenemase genes on the basis of differential PCR product sizes: blaOXA-143 (150 bp), blaOXA-24/40 (264 bp), blaOXA-51 (353 bp), blaOXA-23 (500 bp), blaOXA-58 (600 bp), and blaOXA-235 (700 bp) (9, 35, 36).
Molecular typing/rep-PCR.
Clonality among isolates was determined by repetitive-sequence-based PCR (rep-PCR) using the DiversiLab strain typing system (bioMérieux, Durham, NC), as previously described (37). Briefly, a MoBio UltraClean microbial DNA isolation kit (MoBio Laboratories, Inc., Carlsbad, CA) was used to extract DNA. Isolated DNA was amplified using the DiversiLab Acinetobacter kit, and amplicons were run on an Agilent 2100 Bioanalyzer (Agilent Technologies, Inc., Santa Clara, CA). Dendrograms were generated with DiversiLab Software (bioMérieux), and isolates with >95% similarity were considered clonally related.
MLST.
Multilocus sequence typing (MLST) was performed on all A. baumannii isolates according to the Pasteur scheme as previously described (38). Sequences of 7 housekeeping genes (cpn-60, fusA, gltA, pyrG, recA, rplB, and rpoD) were compared to those in the MLST database (http://pubmlst.org/abaumannii/) to identify alleles and assign sequence types. The primers and PCR conditions used are as listed on the pubmlst.org website.
PCR amplification of resistance genes.
To further investigate the molecular basis of carbapenem resistance, PCR amplification was performed for the carbapenemase genes blaNDM, blaIMP, blaVIM, blaKPC, blaGES, blaIMI, and blaNMC-A. We also tested for the presence of aphA6, a gene encoding an aminoglycoside modifying enzyme, and the ribosomal methyl transferase gene, armA. For all PCR amplifications, we used conditions and validated primers as previously described (39). Presence or absence of the genes was validated and identity elucidated by WGS.
WGS and assembly-based analysis.
Draft genome sequences were obtained from each isolate, including AF684. Illumina libraries were prepared using NexteraXT and sequenced on the Illumina NextSeq 500 with paired 150-base reads to a targeted 150× genome coverage. Paired reads were assembled using SPAdes, and the resulting contigs were submitted to GenBank for annotation using NCBI's prokaryotic gene annotation pipeline PGAP (https://www.ncbi.nlm.nih.gov/books/NBK174280/). Isolate ORAB01 was also sequenced to completion using Pacific Biosciences (PacBio) SMRT sequencing according to the manufacturer's protocols as previously described and assembled using HGAP (40). A global SNV-based phylogeny was constructed using the ∼575,000 SNVs identified in NASP (43) with A. baumannii ACICU (NC_010605.1) as the reference genome and all ∼1,800 A. baumannii genomes available in GenBank as of March 2017. The tree was constructed using FastTreeMP (41). Insertion sequences within the ORAB genomes were mapped using ISseeker relative to the position in the reference genome A. baumannii TYTH-1 (NC_018706.1) to further resolve strain relatedness (42).
PCR to confirm plasmid structure.
Separate PCRs were performed to amplify regions of the blaOXA-237-carrying plasmid in order to confirm the presence of the same plasmid in all other isolates. The primers listed in Table 4 were used for that purpose and lie outside the ISAba1 elements that flank blaOXA-237 or within the blaOXA-237 gene.
TABLE 4.
Primers used to confirm the presence of plasmid carrying blaOXA-237 in all isolates
| Primer | Sequence (5′–3′) |
|---|---|
| pORAB01-3R1 | AACAGGCCCTTCAGCTGCCA |
| pORAB01-3R2 | AATTCCGTACCCAAGGCATCC |
| pORAB01-3F1 | GACTGGAGCAATGCTGTACG |
| pORAB01-3F2 | CCGCCCAGTAAAGCAACAAA |
| mpOXA237F | CAAGCCATGCAAGCTTCT |
| mpOXA237R | GCTGGACTTGAGGATCAAAG |
Accession number(s).
The PacBio nucleotide sequences of the ORAB01 genome and plasmids were deposited in GenBank under accession numbers CP015483.1 for the ORAB01 chromosome, CP015484.1 for plasmid pORAB01-1, CP015485.1 for plasmid pORAB01-2, and CP015486.1 for plasmid pORAB01-3. Illumina genome sequences are available through BioProject PRJNA271775.
ACKNOWLEDGMENTS
This study was supported in part by funds and facilities provided by the Cleveland Department of Veterans Affairs (Veterans Affairs Merit Review Program award 1I01BX001974) from the Biomedical Laboratory Research and Development Service of the VA Office of Research and Development and the Geriatric Research Education and Clinical Center VISN 10 to R.A.B. This study was also supported by funds from the National Institute of Allergy and Infectious Diseases of the National Institutes of Health under award numbers R01AI063517, R01AI072219, and R01AI100560 to R.A.B. and U19AI110819 to the J. Craig Venter Institute (JCVI). In addition, this work was also funded by a cooperative agreement with the Centers for Disease Control and Prevention Epidemiology and Laboratory Capacity Program under award NU50CK000484-01-01 to G.L.B., P.M.C., M.C.C., R.V., J.P.F., C.D.P., and Z.G.B.
We thank the JCVI Sequencing Group and Bioinformatics Group for computational assistance.
Funding organizations were not involved in the design and conduct of the study; collection, management, analysis, and interpretation of the data; and preparation, review, or approval of the manuscript. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health, Department of Veterans Affairs, or the Centers for Disease Control and Prevention.
REFERENCES
- 1.Bonomo RA. 2000. Multiple antibiotic-resistant bacteria in long-term-care facilities: an emerging problem in the practice of infectious diseases. Clin Infect Dis 31:1414–1422. doi: 10.1086/317489. [DOI] [PubMed] [Google Scholar]
- 2.Lautenbach E, Marsicano R, Tolomeo P, Heard M, Serrano S, Stieritz DD. 2009. Epidemiology of antimicrobial resistance among gram-negative organisms recovered from patients in a multistate network of long-term care facilities. Infect Control Hosp Epidemiol 30:790–793. doi: 10.1086/599070. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.O'Fallon E, Pop-Vicas A, D'Agata E. 2009. The emerging threat of multidrug-resistant gram-negative organisms in long-term care facilities. J Gerontol A Biol Sci Med Sci 64:138–141. doi: 10.1093/gerona/gln020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Furuno JP, Hebden JN, Standiford HC, Perencevich EN, Miller RR, Moore AC, Strauss SM, Harris AD. 2008. Prevalence of methicillin-resistant Staphylococcus aureus and Acinetobacter baumannii in a long-term acute care facility. Am J Infect Control 36:468–471. doi: 10.1016/j.ajic.2008.01.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Perez F, Endimiani A, Ray AJ, Decker BK, Wallace CJ, Hujer KM, Ecker DJ, Adams MD, Toltzis P, Dul MJ, Windau A, Bajaksouzian S, Jacobs MR, Salata RA, Bonomo RA. 2010. Carbapenem-resistant Acinetobacter baumannii and Klebsiella pneumoniae across a hospital system: impact of post-acute care facilities on dissemination. J Antimicrob Chemother 65:1807–1818. doi: 10.1093/jac/dkq191. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Gonzalez-Villoria AM, Valverde-Garduno V. 2016. Antibiotic-resistant Acinetobacter baumannii increasing success remains a challenge as a nosocomial pathogen. J Pathog 2016:7318075. doi: 10.1155/2016/7318075. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Perez F, Hujer AM, Hujer KM, Decker BK, Rather PN, Bonomo RA. 2007. Global challenge of multidrug-resistant Acinetobacter baumannii. Antimicrob Agents Chemother 51:3471–3484. doi: 10.1128/AAC.01464-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Poirel L, Naas T, Nordmann P. 2010. Diversity, epidemiology, and genetics of class D beta-lactamases. Antimicrob Agents Chemother 54:24–38. doi: 10.1128/AAC.01512-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Higgins PG, Perez-Llarena FJ, Zander E, Fernandez A, Bou G, Seifert H. 2013. OXA-235, a novel class D beta-lactamase involved in resistance to carbapenems in Acinetobacter baumannii. Antimicrob Agents Chemother 57:2121–2126. doi: 10.1128/AAC.02413-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Schneider KD, Ortega CJ, Renck NA, Bonomo RA, Powers RA, Leonard DA. 2011. Structures of the class D carbapenemase OXA-24 from Acinetobacter baumannii in complex with doripenem. J Mol Biol 406:583–594. doi: 10.1016/j.jmb.2010.12.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Ou HY, Kuang SN, He X, Molgora BM, Ewing PJ, Deng Z, Osby M, Chen W, Xu HH. 2015. Complete genome sequence of hypervirulent and outbreak-associated Acinetobacter baumannii strain LAC-4: epidemiology, resistance genetic determinants, and potential virulence factors. Sci Rep 5:8643. doi: 10.1038/srep08643. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, Harbarth S, Hindler JF, Kahlmeter G, Olsson-Liljequist B, Paterson DL, Rice LB, Stelling J, Struelens MJ, Vatopoulos A, Weber JT, Monnet DL. 2012. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect 18:268–281. doi: 10.1111/j.1469-0691.2011.03570.x. [DOI] [PubMed] [Google Scholar]
- 13.Buser GL, Cassidy PM, Cunningham MC, Rudin S, Hujer AM, Vega R, Furuno JP, Marshall SH, Higgins PG, Jacobs MR, Wright MS, Adams MD, Bonomo RA, Pfeiffer CD, Beldavs ZG. 2017. Failure to communicate: transmission of extensively drug resistant blaOXA-237-containing Acinetobacter baumannii—multiple facilities in Oregon, 2012–2014. Infect Control Hosp Epidemiol. doi: 10.1017/ice.2017.189. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Marchaim D, Chopra T, Bogan C, Bheemreddy S, Sengstock D, Jagarlamudi R, Malani A, Lemanek L, Moshos J, Lephart PR, Ku K, Hasan A, Lee J, Khandker N, Blunden C, Geffert SF, Moody M, Hiro R, Wang Y, Ahmad F, Mohammadi T, Faruque O, Patel D, Pogue JM, Hayakawa K, Dhar S, Kaye KS. 2012. The burden of multidrug-resistant organisms on tertiary hospitals posed by patients with recent stays in long-term acute care facilities. Am J Infect Control 40:760–765. doi: 10.1016/j.ajic.2011.09.011. [DOI] [PubMed] [Google Scholar]
- 15.Townsend J, Park AN, Gander R, Orr K, Arocha D, Zhang S, Greenberg DE. 2015. Acinetobacter infections and outcomes at an academic medical center: a disease of long-term care. Open Forum Infect Dis 2:ofv023. doi: 10.1093/ofid/ofv023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Roach DJ, Burton JN, Lee C, Stackhouse B, Butler-Wu SM, Cookson BT, Shendure J, Salipante SJ. 2015. A year of infection in the intensive care unit: prospective whole-genome sequencing of bacterial clinical isolates reveals cryptic transmissions and novel microbiota. PLoS Genet 11:e1005413. doi: 10.1371/journal.pgen.1005413. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Galimand M, Sabtcheva S, Courvalin P, Lambert T. 2005. Worldwide disseminated armA aminoglycoside resistance methylase gene is borne by composite transposon Tn1548. Antimicrob Agents Chemother 49:2949–2953. doi: 10.1128/AAC.49.7.2949-2953.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Lee Y, D'Souza R, Yong D, Lee K. 2016. Prediction of putative resistance islands in a carbapenem-resistant Acinetobacter baumannii global clone 2 clinical isolate. Ann Lab Med 36:320–324. doi: 10.3343/alm.2016.36.4.320. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Tian GB, Adams-Haduch JM, Taracila M, Bonomo RA, Wang HN, Doi Y. 2011. Extended-spectrum AmpC cephalosporinase in Acinetobacter baumannii: ADC-56 confers resistance to cefepime. Antimicrob Agents Chemother 55:4922–4925. doi: 10.1128/AAC.00704-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Arroyo LA, Herrera CM, Fernandez L, Hankins JV, Trent MS, Hancock RE. 2011. The pmrCAB operon mediates polymyxin resistance in Acinetobacter baumannii ATCC 17978 and clinical isolates through phosphoethanolamine modification of lipid A. Antimicrob Agents Chemother 55:3743–3751. doi: 10.1128/AAC.00256-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Acosta J, Merino M, Viedma E, Poza M, Sanz F, Otero JR, Chaves F, Bou G. 2011. Multidrug-resistant Acinetobacter baumannii harboring OXA-24 carbapenemase, Spain. Emerg Infect Dis 17:1064–1067. doi: 10.3201/eid1706.091866. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Dorsey CW, Tolmasky ME, Crosa JH, Actis LA. 2003. Genetic organization of an Acinetobacter baumannii chromosomal region harbouring genes related to siderophore biosynthesis and transport. Microbiology 149:1227–1238. doi: 10.1099/mic.0.26204-0. [DOI] [PubMed] [Google Scholar]
- 23.Reeves SA, Torres AG, Payne SM. 2000. TonB is required for intracellular growth and virulence of Shigella dysenteriae. Infect Immun 68:6329–6336. doi: 10.1128/IAI.68.11.6329-6336.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Torres AG, Redford P, Welch RA, Payne SM. 2001. TonB-dependent systems of uropathogenic Escherichia coli: aerobactin and heme transport and TonB are required for virulence in the mouse. Infect Immun 69:6179–6185. doi: 10.1128/IAI.69.10.6179-6185.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Rosado CJ, Kondos S, Bull TE, Kuiper MJ, Law RH, Buckle AM, Voskoboinik I, Bird PI, Trapani JA, Whisstock JC, Dunstone MA. 2008. The MACPF/CDC family of pore-forming toxins. Cell Microbiol 10:1765–1774. doi: 10.1111/j.1462-5822.2008.01191.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Christie PJ. 2004. Type IV secretion: the Agrobacterium VirB/D4 and related conjugation systems. Biochim Biophys Acta 1694:219–234. doi: 10.1016/j.bbamcr.2004.02.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Yeo HJ, Yuan Q, Beck MR, Baron C, Waksman G. 2003. Structural and functional characterization of the VirB5 protein from the type IV secretion system encoded by the conjugative plasmid pKM101. Proc Natl Acad Sci U S A 100:15947–15952. doi: 10.1073/pnas.2535211100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Lawley TD, Klimke WA, Gubbins MJ, Frost LS. 2003. F factor conjugation is a true type IV secretion system. FEMS Microbiol Lett 224:1–15. doi: 10.1016/S0378-1097(03)00430-0. [DOI] [PubMed] [Google Scholar]
- 29.Gerdes K. 2000. Toxin-antitoxin modules may regulate synthesis of macromolecules during nutritional stress. J Bacteriol 182:561–572. doi: 10.1128/JB.182.3.561-572.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Heaton BE, Herrou J, Blackwell AE, Wysocki VH, Crosson S. 2012. Molecular structure and function of the novel BrnT/BrnA toxin-antitoxin system of Brucella abortus. J Biol Chem 287:12098–12110. doi: 10.1074/jbc.M111.332163. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Van Melderen L, Saavedra De Bast M. 2009. Bacterial toxin-antitoxin systems: more than selfish entities? PLoS Genet 5:e1000437. doi: 10.1371/journal.pgen.1000437. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Turton JF, Ward ME, Woodford N, Kaufmann ME, Pike R, Livermore DM, Pitt TL. 2006. The role of ISAba1 in expression of OXA carbapenemase genes in Acinetobacter baumannii. FEMS Microbiol Lett 258:72–77. doi: 10.1111/j.1574-6968.2006.00195.x. [DOI] [PubMed] [Google Scholar]
- 33.Vallenet D, Nordmann P, Barbe V, Poirel L, Mangenot S, Bataille E, Dossat C, Gas S, Kreimeyer A, Lenoble P, Oztas S, Poulain J, Segurens B, Robert C, Abergel C, Claverie JM, Raoult D, Medigue C, Weissenbach J, Cruveiller S. 2008. Comparative analysis of acinetobacters: three genomes for three lifestyles. PLoS One 3:e1805. doi: 10.1371/journal.pone.0001805. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.CLSI. 2014. Performance standards for antimicrobial susceptibility testing; 24th informational supplement. CLSI document M100-S24. Clinical and Laboratory Standards Institute, Wayne, PA. [Google Scholar]
- 35.Higgins PG, Lehmann M, Seifert H. 2010. Inclusion of OXA-143 primers in a multiplex polymerase chain reaction (PCR) for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents 35:305. doi: 10.1016/j.ijantimicag.2009.10.018. [DOI] [PubMed] [Google Scholar]
- 36.Woodford N, Ellington MJ, Coelho JM, Turton JF, Ward ME, Brown S, Amyes SG, Livermore DM. 2006. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents 27:351–353. doi: 10.1016/j.ijantimicag.2006.01.004. [DOI] [PubMed] [Google Scholar]
- 37.Higgins PG, Hujer AM, Hujer KM, Bonomo RA, Seifert H. 2012. Interlaboratory reproducibility of DiversiLab rep-PCR typing and clustering of Acinetobacter baumannii isolates. J Med Microbiol 61:137–141. doi: 10.1099/jmm.0.036046-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Diancourt L, Passet V, Nemec A, Dijkshoorn L, Brisse S. 2010. The population structure of Acinetobacter baumannii: expanding multiresistant clones from an ancestral susceptible genetic pool. PLoS One 5:e10034. doi: 10.1371/journal.pone.0010034. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Hujer KM, Hujer AM, Hulten EA, Bajaksouzian S, Adams JM, Donskey CJ, Ecker DJ, Massire C, Eshoo MW, Sampath R, Thomson JM, Rather PN, Craft DW, Fishbain JT, Ewell AJ, Jacobs MR, Paterson DL, Bonomo RA. 2006. Analysis of antibiotic resistance genes in multidrug-resistant Acinetobacter sp. isolates from military and civilian patients treated at the Walter Reed Army Medical Center. Antimicrob Agents Chemother 50:4114–4123. doi: 10.1128/AAC.00778-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Wright MS, Perez F, Brinkac L, Jacobs MR, Kaye K, Cober E, van Duin D, Marshall SH, Hujer AM, Rudin SD, Hujer KM, Bonomo RA, Adams MD. 2014. Population structure of KPC-producing Klebsiella pneumoniae isolates from midwestern U.S. hospitals. Antimicrob Agents Chemother 58:4961–4965. doi: 10.1128/AAC.00125-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Price MN, Dehal PS, Arkin AP. 2010. FastTree 2: approximately maximum-likelihood trees for large alignments. PLoS One 5:e9490. doi: 10.1371/journal.pone.0009490. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Adams MD, Bishop B, Wright MS. 2016. Quantitative assessment of insertion sequence impact on bacterial genome architecture. Microb Genom 2:e000062. doi: 10.1099/mgen.0.000062. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Sahl JW, Lemmer D, Travis J, Schupp J, Gillece J, Aziz M, Driebe E, Drees K, Hicks N, Williamson C, Hepp C, Smith D, Roe C, Engelthaler D, Wagner D, Keim P. 2016. The Northern Arizona SNP Pipeline (NASP): accurate, flexible, and rapid identification of SNPs in WGS datasets. bioRxiv doi: 10.1101/037267. [DOI] [PMC free article] [PubMed] [Google Scholar]