Skip to main content
Ecology and Evolution logoLink to Ecology and Evolution
. 2017 Nov 4;7(24):10604–10615. doi: 10.1002/ece3.3462

Numerous mitochondrial DNA haplotypes reveal multiple independent polyploidy origins of hexaploids in Carassius species complex

Xiao‐Li Liu 1, Xi‐Yin Li 1, Fang‐Fang Jiang 1, Zhong‐Wei Wang 1, Zhi Li 1, Xiao‐Juan Zhang 1, Li Zhou 1, Jian‐Fang Gui 1,
PMCID: PMC5743492  PMID: 29299242

Abstract

Evolutionary trajectory and occurrence history of polyploidy have been extensively studied in plants, but they remain quite elusive in vertebrates. Here, we sampled and gathered 4,159 specimens of polyploid Carassius species complex including 1,336 tetraploids and 2,823 hexaploids from a large geographic scale (49 localities) across East Asia, and identified a huge number of 427 diverse haplotypes of mitochondrial control region, in which 74 haplotypes with total occurrence frequency up to 75.498% were shared by hexaploids and tetraploids. Significantly, these diverse haplotypes were clustered into four major lineages, and many haplotypes of hexaploids and tetraploids were intermixed in every lineage. Moreover, the evolutionary trajectory and occurrence history of four different lineages were revealed by a simplified time‐calibrated phylogenetic tree, and their geographic distribution frequencies and haplotype diversity were also analyzed. Furthermore, lineage C and D were revealed to undergo population expansion throughout mainland China. Therefore, our current data indicate that hexaploids should undergo multiple independent polyploidy origins from sympatric tetraploids in the polyploid Carassius species complex across East Asia.

Keywords: diploidization, ecological adaption, evolution, hexaploid, polyploidy, tetraploid

1. INTRODUCTION

Polyploidy, as a significant driving force on speciation and evolutionary success, has been extensively elucidated in many respects of polyploid plants including morphology, physiology, genomics, and ecology (Jiao et al., 2011; Leitch & Leitch, 2008; Soltis, Marchant, Van de Peer, & Soltis, 2015). Polyploids usually have wider ecological amplitude and stronger environmental adaptability than their ancestors (Brochmann & Elven, 1992), as polyploidy commonly introduces higher genomic complexity and more innovation (Doyle et al., 2008; Soltis, Liu, Marchant, Visger, & Soltis, 2014). Moreover, polyploidy consequences are frequently associated with reproduction mode transition (Gui & Zhou, 2010; Mei & Gui, 2015), and dramatic genome shifts after polyploidization have been recognized as an important mechanism in speciation and trait evolution (Van de Peer, Maere, & Meyer, 2009). In comparison with the commonness of polyploids in plants, polyploid species are rare in vertebrates (Choleva et al., 2012; Furlong & Pwh, 2004), but some taxonomic groups of reptiles, amphibians, and teleost fishes have passed through the bottleneck of polyploidy and formed stable polyploid species (Ficetola & Stöck, 2016; Gui & Zhou, 2010; Otto & Whitton, 2000; Schmid, Evans, & Bogart, 2015). Especially in some groups of fishes, different ploidy forms such as triploids, tetraploids, hexaploids, and even octoploids have been found (Arai & Fujimoto, 2013; Collares‐Pereira, Matos, Morgadosantos, & Coelho, 2013; Mei & Gui, 2015; Takada et al., 2010). However, evolutionary trajectory and ecological adaption of these polyploids remain elusive in vertebrates.

Carassius species complex with wide distribution across the Eurasian continent and neighboring islands (Abramenko, Nadtoka, Makhotkin, Kravchenko, & Poltavtseva, 2004; Hanfling, Bolton, Harley, & Carvalho, 2005; Jakovlic & Gui, 2011; Jiang et al., 2013; Li, Li, Zhang, Zhou, & Gui, 2014; Liousia, Liasko, Koutrakis, & Leonardos, 2008; Sakai, Iguchi, Yamazaki, Sideleva, & Goto, 2009; Toth, Varkonyi, Hidas, Meleg, & Varadi, 2005; Zhou & Gui, 2017) has been found to possess different ploidy forms including tetraploids, hexaploids, and even octaploids (Gao et al., 2012; Gui & Zhou, 2010; Jiang et al., 2013; Takada et al., 2010). Tetraploids with 100 chromosomes are diploidizated allotetraploids that reproduce by sexual reproduction (Luo, Stadler, He, & Meyer, 2007; Ohno, Muramoto, Christian, & Atkin, 1967), while hexaploids with about 150 chromosomes are able to reproduce by dual modes including unisexual gynogenesis and bisexual reproduction (Gui & Zhou, 2010; Gui & Zhu, 2012; Zhou, Wang, & Gui, 2000), and octaploids reproduce only via unisexual gynogenesis (Xiao et al., 2011; Zhu & Gui, 2007). Recently, an early allopolyploidy event leading to ancestral allotetraploids has been revealed, and a recurrent autopolyploidy from allotetraploids that results in allohexaploids has been elucidated in the Carassius species complex (Li, et al., 2014; Luo et al., 2014). Therefore, the wide geographic distribution, coexistence of different ploidy forms, and occurrence of repeated polyploidy events make the Carassius species complex an ideal system to investigate evolutionary trajectory and ecological adaption of polyploidy in vertebrates (Gao et al., 2017; Liu et al., 2017).

Mitochondrial DNA (mtDNA), as a cytoplasmic marker, had been extensively utilized to study origin and evolutionary history of unisexual or polyploid vertebrates including gynogenetic Amazon molly Poecilia Formosa (Dang, Xia, Xu, & Zhang, 2016), gynogenetic Phoxinus eos‐neogaeus (Angers & Schlosser, 2007), hybridogenetic Poeciliopsis (Quattro, Avise, & Vrijenhoek, 1992), hybridogenetic Australian carp gudgeon (Schmidt, Bond, Adams, & Hughes, 2011), kleptogenetic salamanders (Bi & Bogart, 2010; Robertson, Ramsden, Niedzwiecki, Fu, & Bogart, 2006), and parthenogenetic lizards (Hedges, Bezy, & Maxson, 1991). And, they were efficiently used to analyze genetic diversity and evolutionary implications of the polyploidy Carassius species complex in several different geographic populations (Apalikova, Eliseikina, Kovalev, & Brykov, 2008; Brykov et al., 2002; Gao et al., 2012; Jakovlic & Gui, 2011; Li & Gui, 2008; Takada et al., 2010; Wang et al., 2011). To further reveal evolutionary trajectory and ecological adaption of tetraploids and hexaploids in the Carassius species complex, a huge number of specimens were sampled throughout mainland China, and numerous mtDNA sequences including the newly obtained and previously reported sequences were used to perform a comprehensive investigation from a large geographic scale across East Asia.

2. METHODS

2.1. Sampling and specimen collection

A total of 3,105 individuals of the Carassius species complex were currently sampled from 34 locations through mainland China. And the other 1,054 sample data of Carassius species complex from 15 localities in East Asia were collected from previous reports (Luo et al., 2014; Takada et al., 2010). Details about all the samples, sampling sites, and references are given in Table 1. For currently sampled specimens, caudal fin was preserved in 100% ethanol for subsequent DNA extraction and sequencing, and the blood cells were fixed in 70% ethanol for ploidy determination as described (Jiang et al., 2013). For the previously reported samples, the ploidy forms were collected from previous reports (Luo et al., 2014; Takada et al., 2010), and the mitochondrial control region (CR) sequences were obtained from GenBank. All experiments in this research were performed according to the permit guidelines established by the Institute of Hydrobiology, Chinese Academy of Sciences, and the experimental protocols were approved by the animal care and use committee of Institute of Hydrobiology, Chinese Academy of Sciences.

Table 1.

Specimen information of Carassius species complex used in this study

Code Sampled locality Abbreviation Geographic coordinate Sampled number Tetraploid percentage (%) Hexaploid percentage (%) Geographic area
1 Hongze Lake, Sihong county HZ 118.719°E, 33.291°N 126 93.65 6.35 Jing‐Hang Grand Canal of China
2 Gaoyou Lake, Gaoyou county GY 119.348°E, 32.864°N 100 90 10
3 Luoma Lake, Suyu district of Suqian LM 118.182°E, 34.103°N 100 89 11
4 Weishan Lake, Weishan county WS 116.752°E, 35.113°N 80 76.25 23.75
5 Dianchi, Chenggong district of Kunming DC 102.736°E, 24.853°N 74 0 100 Upper Yangtze River of China
6 Puan, Puan county PA 105.070°E, 25.538°N 96 0 100
7 Fujiang, Hechuan district FJ 106.227°E, 29.993°N 60 1.67 98.33
8 Jialingjiang, Beibei district JLJ 106.449°E, 29.826°N 60 1.67 98.33
9 Yunan (Luo et al., 2014) YN 102.852°E, 24.876°N 203 28.08 71.92
10 Puan county, Guizhou (Luo et al., 2014) GZ 104.960°E, 25.782°N 27 0 100
11 Beimin Lake, Jinshi county BM 111.886°E, 29.712°N 60 1.67 98.33 Middle Yangtze River of China
12 Shanbo Lake, Anxiang county SB 112.041°E, 29.428°N 60 5 95
13 Xihu Lake, Jinshi county XH 111.934°E, 29.365°N 60 43.33 56.67
14 Xiaoshui, Shuangpai county XS 111.721°E, 25.899°N 172 1.16 98.84
15 Dongting Lake, Xiangyin county DT 112.693°E, 28.811°N 100 34 66
16 Taibai Lake, Huangmei county TB 115.828°E, 29.965°N 96 18.75 81.25
17 Honghu Lake, Honghu county HH 113.373°E, 29.821°N 80 86.25 13.75
18 Dongting Lake, Hunan (Luo et al., 2014) HN 112.584°E, 28.888°N 11 45.45 54.55
19 Longgan Lake, Huangmei county LG 116.041°E, 29.944°N 86 80.23 19.77 Lower Yangtze River of China
20 Poyang Lake, Duchang county PY 116.301°E, 29.214°N 105 89.52 10.48
21 Taihu Lake, Wuxi city TH 120.183°E, 31.257°N 118 72.88 27.12
22 Zhejiang (Luo et al., 2014) ZJ 120.127°E, 30.126°N 44 52.27 47.73
23 Chagan Lake, Qianguo county CG 124.284°E, 45.270°N 100 9 91 Northeast of China
24 Jingbo Lake, Ningan county JB 128.911°E, 43.854°N 100 6 94
25 Xingkai Lake, Mishan city XK 132.264°E, 45.228°N 100 0 100
26 Suifen River, Suifenhe city SF 131.115°E, 44.409°N 103 0 100
27 Songhua Lake, Jiaohe city SH 126.932°E, 43.603°N 100 2 98
28 Songhuajiang, Haerbin city (Luo et al., 2014) SHJ 128.457°E, 45.922°N 47 61.7 38.3
29 Fangzheng county, Haerbin city (Luo et al., 2014) FZ 128.829°E, 45.851°N 18 0 100
30 Dawusong Lake, Heshuo county DWS 87.222°E, 41.966°N 88 62.5 37.5 Northwest of China
31 Bositeng Lake, Heshuo county BST 86.876°E, 41.942°N 100 47 53
32 Tian'e Lake, Hejing county TE 84.116°E, 42.919°N 100 13 87
33 500 reservoir, Fukang city R500 87.830°E, 44.180°N 90 0 100
34 IrtySh River, Aletai district IS 87.747°E, 47.393°N 77 0 100
35 Wulungu Lake, Aletai district WLG 87.123°E, 47.234°N 56 0 100
36 Yili River, Gongliu county YL 82.452°E, 43.597°N 46 0 100
37 Lijiang, Xing'an county LJ 110.344°E, 25.530°N 105 0 100 Upper Pearl River of China
38 Guangzhou city (Luo et al., 2014) GD 113.264°E, 23.129°N 14 0 100
39 Yellow River, Xingqing district of Yinchuan YC 106.448°E, 38.387°N 105 0 100 Yellow River of China
40 Yellow River, Hubin district of Sanmenxia SMX 111.154°E, 34.782°N 102 0 100
41 Yellow River, Jiyuan city JY 112.384°E, 34.923°N 100 0 100
42 Honshu, Japan (Takada et al., 2010) HO 139.669°E, 37.217°N 131 38.93 61.07 Main islands of Japan
43 Kyusyu, Japan (Takada et al., 2010) KY 130.858°E, 32.491°N 22 27.27 72.73
44 Shikoku, Japan (Takada et al., 2010) SHK 133.385°E, 33.523°N 21 19.05 80.95
45 Shibuta River, Tokyo (Takada et al., 2010) SHB 139.703°E, 35.658°N 70 54.29 45.71
46 LakeBiwa, Shiga Prefecture (Takada et al., 2010) BI 136.167°E, 35.333°N 36 13.89 86.11
47 Imba,River, Tokyo, Japan (Takada et al., 2010) IM 140.123°E, 35.605°N 16 0 100
48 Lake Kasumigaura, Tokyo (Takada et al., 2010) KA 140.230°E, 36.080°N 5 0 100
49 Ryukyus, Japan (Takada et al., 2010) RY 128.946°E, 27.186°N 389 57.58 42.42 Ryukyus

2.2. Ploidy determination

High speed sorting flow cytometer FACSAriaTMIII (BD) was used to estimate ploidy levels of currently sampled specimens by measuring the relative DNA content of their fixed blood cells as described previously (Wei, Zhang, Zhang, Zhou, & Gui, 2003). Chicken blood cells with known DNA content of 2.5 pg/nucleus were used as an internally quantitative standard for each sample flow cytometry profile. The sampled blood cells of each sample were mixed with chicken blood cells and fixed in 70% precooled ethanol overnight at 4°C. The mixed cells were washed 2–3 times in 1× phosphate‐buffered saline and then resuspended in the solution including 0.5% pepsin and 0.1 M HCl. DNA was stained with propidium iodide solution (40 g/ml) for 1–3 hr at room temperature in the dark. Each sample contained three repeats, and each repeat was measured at least 10,000 cells. DNA contents for each sample were measured by a formula in which the PI fluorescence intensity ratio of the mean of blood cells from each individual to the mean of blood cells from chicken was multiplied by the known mean DNA content (2.5 pg) of chicken blood cells as described (Wei et al., 2003) and was generated automatically by the flow cytometer. As reported previously (Jiang et al., 2013), the individuals with average DNA contents of about 3.64 pg/N ± 0.12 were generally detected as tetraploids, whereas the individuals with near 5.42 pg/N ± 0.198 were identified as hexaploids.

2.3. Mitochondrial DNA sequencing and common sequence selection

Whole DNA was extracted from fin clips by DNeasy Blood & Tissue Kit (QIAGEN) following the manufacturer's protocol. We used the following primers L15923c (5′‐TTAAAGCATCGGTCTTGTAA‐3′) and H16500d (5′‐GCCCTGAAATAGGAACCAGA‐3′) (Jiang et al., 2013) to amplify mitochondrial CR sequences. Purified PCR products were directly used for bidirectional Sanger sequencing on PRISM 3700 (ABI) via primers L15923c and H16500d.

The corresponding common sequences with the newly generated mitochondrial CR s were selected from previously reported data (Luo et al., 2014; Takada et al., 2010) and were aligned with all of them via multiple alignments using MEGA7.0 (Kumar, Stecher, & Tamura, 2016). At last, the common sequences ranging from 298 to 353 bp were used for subsequent analyses.

2.4. Sequence and data analyses

Sequence alignments and information of haplotypes were identified using MEGA7.0 (Kumar et al., 2016). Haplotypes were generated by DnaSP 5.10 (Librado & Rozas, 2009) software and then arranged according to their frequency for easy reading. Haplotype diversity was evaluated using Arlequin version 3.5 (Excoffier & Lischer, 2010). Phylogenetic analysis of haplotypes was conducted using Bayesian inference (BI) in MRBAYES 3.1.2 (Ronquist & Huelsenbeck, 2003) and maximum‐likelihood (ML) in RAXML (Stamatakis, Hoover, & Rougemont, 2008). HKY + I + G was selected as the best‐fit model of evolution by MODELTEST version 3.7 (Posada & Crandall, 1998). For BI tree, four independent Markov chain Monte Carlo (MCMC) chains were simultaneously run for 20,000,000 generations with sample frequency of 1,000 generations. The first 25% of the trees were discarded as burn‐in, and the remaining tree samples were used to generate a consensus tree. For ML tree, nodal support value was assessed from 100 nonparametric bootstrap replicates. In addition, to investigate the relationship between haplotypes, a network was built by TCS 1.21 (Clement, Posada, & Crandall, 2000).

To estimate divergence times in Carassius species complex, an uncorrelated relaxed molecular clock approach was implemented in Beast 1.7.5 (Drummond & Rambaut, 2007). HKY + I + G was selected as the best‐fit model of evolution by MODELTEST software of version 3.7 (Posada & Crandall, 1998). The divergence time (11.11–9.14 million years ago [Mya]) (Gao et al., 2012) between Cyprinus carpio and Carassius species complex was used as the calibration. The Markov chain Monte Carlo (MCMC) analyses were run for 100,000,000 generations with sample frequency of 1,000 generations. Tracer v1.5 (http://tracer-1-5.software.informer.com/1.5/) was used to ensure adequate mixing of the MCMC with effective sample sizes (ESS) above 100. The plausible trees were summarized in the maximum clade credibility (MCC) tree after discarding first 40% of sampled generations by Tree Annotator v1.7.5, and then the results were visualized and edited in FigTree 1.4 (http://beast.bio.ed.ac.uk/FigTree).

Historical demographic/spatial expansions of Carassius species complex were investigated by two approaches. First, Tajima's D (Tajima, 1989) and Fu's Fs (Fu, 1997) statistics were calculated. Second, pairwise mismatch distributions (Schneider & Excoffier, 1999) were used to detect the demographic history of Carassius species complex. When the neutrality test values were negative and significant (p < .05), and the mismatch distribution curve was unimodal, the lineage was thought to fit the sudden expansion model. Both the two approaches were performed by Arlequin 3.5 (Excoffier & Lischer, 2010). Moreover, the expansion time was estimated by the equation τ = 2ut (Nei & Tajima, 1981; Rogers & Harpending, 1992), in which u is the mutation rate per sequence and per generation. The value of u was calculated from u = 2μk, where μ is the mutation rate per nucleotide, and k is the number of nucleotides in the analyzed fragment. The approximate time of expansion was calculated by multiplying t by the generation time (1 year; Luo et al., 2014). The average substitution rate of 2% site−1 Myr−1 (Meyer, 1993) was used for mitochondrial CR haplotypes of the Carassius species complex.

3. RESULTS

3.1. Ploidy distribution of Carassius species complex across East Asia

A total of 4,159 specimens of Carassius species complex were gathered from 49 localities across East Asia. As shown in Table 1 and Figure 1, 3,105 specimens comprising 894 tetraploids and 2,211 hexaploids are currently sampled from 34 localities throughout mainland China reported recently (Liu et al., 2017), 364 specimens including 114 tetraploids and 250 hexaploids are from seven localities of mainland China reported previously (Luo et al., 2014), and 690 individuals containing 328 tetraploids and 362 hexaploids come from eight localities of Japan main islands and Ryukyus as described (Takada et al., 2010). In the 49 populations, there are 17 all‐hexaploid populations and 32 sympatric populations of both hexaploids and tetraploids, whereas there is no one all‐tetraploid population (Figure 1). And even in the 32 sympatric populations of both hexaploids and tetraploids, most of them (19 of 32) consist of high frequency of hexaploids, while only a few populations (13 of 32) are tetraploid‐biased. In terms of different drainage systems or geographic areas, all‐hexaploids and highly biased‐hexaploid populations are predominant in northeast of China (except SHJ), northwest of China (except DWS), Yellow River basin, upper Yangtze River, upper Pearl River, and two localities of Japan main islands, whereas tetraploid‐biased populations are mainly distributed in Middle/Lower Yangtze River basin, Jing‐Hang Grand Canal and Ryukyus. As reported recently (Liu et al., 2017), hexaploids have wider geographic distribution than tetraploids in Carassius species complex throughout East Asia.

Figure 1.

Figure 1

Specimen and ploidy distribution of Carassius species complex across East Asia. Detail information of the sampled and gathered populations is in Table 1. The proportions of hexaploids and tetraploids are indicated by the sizes of black and gray pie charts, respectively. The hexaploid percentages and the specimen numbers are given nearby and in the brackets

3.2. Identification of diverse mtDNA CR haplotypes

Subsequently, a total of 316 various mtDNA CR haplotypes were identified from the newly sequenced 3,105 specimens, and 57 and 72 haplotypes were, respectively, retrieved from two previous reports by Luo et al. (2014) and Takada et al. (2010). As 18 haplotypes in the newly identified 316 haplotypes were same to that reported by Luo et al. (2014), a total of 427 various mtDNA CR haplotypes (Table S1) were gathered at last. The length variations of 427 mtDNA CR haplotypes ranged from 298 to 353 bp, and contained 154 variable positions, of which 109 were potentially parsimony informative (Fig. S1). Among the 427 haplotypes, there were 74 haplotypes to share by hexaploids and tetraploids, in which each haplotype frequency ranged from 14.378% to 0.048%, and their total occurrence frequency was high up to 75.498%. There were 217 haplotypes and 136 haplotypes to be detected only in hexaploids or in tetraploids, but their total occurrence frequency was 18.755% and 5.747%, respectively, in which each haplotype frequency ranged from 1.467% to 0.024% in hexaploids and from 0.457% to 0.024% in tetraploids. Moreover, 130 haplotypes and 98 haplotypes were respectively detected from only one hexaploid or one tetraploid individual (Table S2).

3.3. Matrilineal genealogy of mtDNA CR haplotypes

Based on the 427 diverse mtDNA CR haplotypes, a network was constructed by TCS 1.21 (Clement et al., 2000) to investigate their matrilineal genealogy. As shown in Figure 2, four major lineages are clustered, and haplotypes of hexaploids and tetraploids are intermixed in all of the four lineages. Lineage A includes 39 haplotypes, in which four haplotypes are shared by hexaploids and tetraploids, and eight and 27 haplotypes exist only in hexaploids or tetraploids respectively. The highest frequency haplotype in lineage A is CR42 (4.4%; Figure 2 and Table S2) that distributes only in Ryukyus (Table S1), and h41 is the most widely distributed haplotype in lineage A, which occurs in seven local populations of China including GY, YN, XK, LJ, GD, SMX, JY (Table S1). Lineage B includes 54 haplotypes that distribute in Japan main islands and Ryukyus, in which 19 haplotypes are shared by hexaploids and tetraploids, and 21 and 14 haplotypes exist only in hexaploids or tetraploids, respectively. CR2 is the highest frequency haplotype with only 0.745% in lineage B (Figure 2 and Table S2). A total of 45 haplotypes are grouped into lineage C, where four are shared by hexaploids and tetraploids, and 34 and seven haplotypes exist only in hexaploids or tetraploids, respectively. In lineage C, the highest frequency haplotype is GH12 (9.930%; Figure 2) that distributes in most newly sampled populations of China (22/34; Table S1), and other haplotypes in this lineage are derived from GH12 due to the star‐like phylogenetic relationship (Figure 2). Lineage D is the largest and includes 289 haplotypes, in which 47 haplotypes are shared by hexaploids and tetraploids, and 154 and 88 haplotypes exist only in hexaploids and tetraploids, respectively. Haplotype CRH1 with the highest frequency occurrence (14.378%; Figure 2) extensively coexists in both hexaploids and tetraploids of all newly sampled populations throughout mainland China except PA and JLJ (Table S1), implicating that CRH1 might be one of the ancestor haplotypes of Carassius species complex. Significantly, the first 10 major haplotypes among 427 haplotypes are shared by both hexaploids and tetraploids (Table S2), and they also represent a star‐like phylogenetic relationship around them except CR42 in lineage A.

Figure 2.

Figure 2

Network of 427 mitochondrial DNA control region haplotypes identified from the polyploid Carassius species complex. Circles represent different haplotypes and their corresponding occurrence frequency in all sampled populations. Border colors stand for different lineages A, B, C, and D. Black and yellow inside the circle indicate the percentage of tetraploid and hexaploid, respectively. Haplotype codes are denoted inside or beside the circles. Solid red dots represent unsampled or predicted haplotypes

3.4. Phylogenetic relationship and evolutionary history of mtDNA CR haplotypes

To pursue the phylogenetic relationship of polyploidy occurrence and divergence evolution in Carassius species complex, phylogenetic BI tree and ML tree were also constructed according to these diverse CR haplotypes. And only BI tree was given in Figure 3, as both ML and BI tree were well supported each other and showed the same topology. Similar to haplotype network, the diverse 427 mtDNA CR haplotypes were also clustered into four major lineages with obvious geographical distribution differences, and haplotypes of hexaploids and tetraploids were intermixed in each lineage as well.

Figure 3.

Figure 3

Bayesian tree of 427 mitochondrial DNA (mtDNA) control region (CR) haplotypes identified from the polyploid Carassius species complex. Bayesian posterior probabilities (BPP) of >50% are shown around nodes. Major lineages are shown by different colors. Lineage A, B, C, and D are exhibited in blue, brown, green, and pink, respectively. Solid squares indicate shared haplotypes between tetraploids and hexaploids. Solid triangles and circles represent haplotypes only detected from hexaploids and tetraploids, respectively. 4N and 6N are the abbreviation of tetraploids and hexaploids, respectively. Seven mtDNA CR haplotypes from Cyprinus carpio are used as outgroup

Moreover, a simplified time‐calibrated phylogenetic tree of the diverse mtDNA CR haplotypes was constructed (Figure 4a), and the relative frequencies of four different lineages in all 49 local populations were presented (Figure 4b). As shown in Figure 4, within Carassius species complex, A and B lineages split from C and D lineages early at about 7.60 Mya, then lineage A and lineage B diverge around 5.71 Mya, and lineage C and lineage D divide at about 5.79 Mya (Figure 4a, Table S3). The haplotypes clustered in lineage A were mainly detected in some locations of central/southern China including Yangtze River basin, Yellow River basin, Pearl River basin, Jing‐Hang Grand Canal, and Ryukyus island, and several haplotypes were also observed at one point (XK) in northeast of China. Haplotypes of lineage B were completely distributed in Japan and Ryukyus islands. Haplotypes of lineage C were distributed throughout mainland China, in which the occurrence frequencies were relatively higher in northern China than in central/southern China. Haplotypes of lineage D were scattered in all populations throughout mainland China, and most of them occupied relatively dominant frequencies of more than 90% in central/south populations (22/27), in which there were seven local populations with 100% haplotypes of lineage D. Significantly, the dominant distribution was also detected in BST and DWS of northwest China, and a few of haplotypes (five) were also found in KA of Japan and Ryukyus.

Figure 4.

Figure 4

Simplified time‐calibrated phylogeny tree of four major haplotype lineages (a) and their geographical distribution (b). Color in each lineage is corresponding to the Bayesian tree in Figure 3. Values above branches indicate Bayesian posterior probabilities, and divergence times are shown near each node. The numbers in black circles indicate estimated divergence time listed in Table S3. Haplotypes of Cyprinus carpio are used as outgroup

3.5. Population expansion possibility of different mtDNA haplotype lineages

Based on mtDNA CR haplotype sequences for each lineage, we calculated the statistical data about neutrality test and mismatch analysis by the reported approaches (Excoffier & Lischer, 2010; Fu, 1997; Schneider & Excoffier, 1999; Tajima, 1989), and thereby evaluated the historical demography and population expansion possibility in Carassius species complex across East Asia. As shown in Table 2 and Figure 5, for lineage A, Tajima's D and Fu's Fs tests are positive and not significant (Table 2), and mismatch distribution analysis shows bimodal distribution of pairwise differences (Figure 5a), indicating that lineage A rejects the hypothesis of sudden expansion (Table 2). For lineage B, although mismatch analysis reveals approximately unimodal distribution of pairwise differences (Figure 5b), Tajima's D and Fu's Fs tests are positive and not significant (Table 2), implying that lineage B also rejects the sudden expansion model. For lineage C and lineage D, Tajima's D and Fu's Fs tests are negative and significant (Table 2), and mismatch distribution analysis exhibits a unimodal distribution of pairwise differences (Figure 5c,d), showing that lineage C and lineage D do not reject the sudden expansion model. Therefore, these data suggest that lineage C and lineage D distributed throughout mainland China might have undergone population expansion, and the expansion time might occur at about 890–940 and 91,000–108,000 years ago, respectively (Table 2), whereas other two lineages might not encounter population expansion.

Table 2.

Statistical data of neutrality tests and mismatch analyses based on mtDNA control region haplotype sequences for each lineage

Lineage Neutrality test Mismatch analysis
Tajima's D (p‐value) Fu's Fs (p‐value) SSD (p‐value) Raggedness index (p‐value) Tau Expansion time (Mya)
Lineage A 0.1304 (.6350) 8.5978 (.9040) 0.1140 (.1200) 0.1522 (.0100) 40.6172
Lineage B −0.2701 (.442) −1.2232 (.4870) 0.0083 (.2000) 0.0077 (.0800) 8.1270
Lineage C −2.2204 (.0000) −24.4773 (.0000) 0.4288 (.0000) 0.0657 (1.0000) 0.025 0.00089–0.00094
Lineage D −1.9321 (.0010) −24.2047 (.0060) 0.0015 (.7500) 0.0103 (.8700) 2.5684 0.091–0.108

Figure 5.

Figure 5

Mismatch distributions for each lineage of Carassius species complex. The X‐axis indicates the number of pairwise differences between compared haplotypes. The Y‐axis is the frequency for each value. Histograms indicate the observed frequencies of pairwise divergences among haplotypes, and the lines denote the expectation under the model of population expansion. Color of each histogram is corresponding to color of lineage in Figure 3. (a–d) Mismatch distributions for the lineage A, B, C, and D, respectively

4. DISCUSSION

Our current studies had identified and gathered numerously diverse mtDNA CR haplotypes (427 haplotypes) of polyploid Carassius species complex from a huge number of specimens (4,159 specimens) and a large geographic scale (49 localities) across East Asia (Figure 1 and Table 1), and analyzed each haplotype variation and occurrence frequency in hexaploids or in tetraploids, respectively (Fig. S1, Table S2). Subsequently, these diverse haplotypes were clustered into four major lineages, and many haplotypes of hexaploids and tetraploids were intermixed in every lineage (Figures 2 and 3). Significantly, the first 10 haplotypes with high occurrence frequency were found to share by both hexaploids and tetraploids, and their occurrence frequency was high up to 53.017% (Table S2). Moreover, a simplified time‐calibrated phylogenetic tree revealed evolutionary history of four different lineages (Figure 4a), and their geographic distribution frequencies (Figure 4b). And the lineage C and D that distribute throughout mainland China were revealed to undergo population expansion by neutrality test, mismatch analysis (Figure 5 and Table 2). Therefore, these data suggest that multiple independent polyploidy origins should have occurred in hexaploids of the polyploid Carassius species complex across East Asia, as numerous CR haplotypes of hexaploids and tetraploids are intermixed in each lineage, and many CR haplotypes especially high occurrence frequency haplotypes are shared by both hexaploids and tetraploids (Figures 2 and 3).

Previous studies have proposed that an early allopolyploidy event might lead to tetraploids, and an autopolyploidy event might result in hexaploids in the polyploid Carassius species complex (Li, Zhang, Li, et al., 2014; Luo et al., 2014). The current studies further help us understand their evolutionary history and trajectory. As shown in Figures 2 and 3, in the four lineages revealed by diverse 427 mtDNA CR haplotypes, most of the haplotypes in hexaploids and tetraploids are intermixed in the same lineages, and numerous haplotypes are shared by both hexaploids and tetraploids. Thus, hexaploids might at least have four independent origins across Central and East Asia, and might originate from sympatric tetraploids via autopolyploidy. Lineage A and lineage B were split with lineage C and lineage D at about 7.60 Mya, in which lineage A was further separated with lineage B at about 5.71 Mya, and lineage C was divided with lineage D at approximate 5.79 Mya. These data suggest that lineage A should be the oldest lineage in the polyploid Carassius species complex, and Yangtze River basin might be the potential origin center, because lineage A mainly distributed in Yangtze River basin (Figure 4), and mtDNA CR haplotype diversity was higher in Yangtze River basin than in other areas examined (Fig. S2). Moreover, lineage C and lineage D might derive from Yangtze River basin, in which lineage C might thereby diffuse to northwest China and northeast China, and lineage D might extend throughout mainland China via population expansion (Figure 5 and Table 2). Actually, these deduced evolutionary history and trajectory are basically consistent with the time record of Carassius species fossil in Pliocene epoch (5.3–2.6 Mya) discovered in north of China (Yushe, Shanxi province) (Liu & Su, 1962).

Significantly, several unusual area existences of mtDNA CR haplotypes further revealed certain extent effects of human activities on geographic distribution of the polyploid Carassius species complex, as they have been important commercial and aquaculture fishes (Zhou, Wang, Wang, & Gui, 2017). Obviously, the exceptional dominant distribution of lineage D haplotypes in BST and DWS of northwest China might be resulted from artificial introduction, as other locations of northwest China were revealed to mainly contain haplotypes of lineage C, and multiple introductions in BST and DWS were recorded from middle and lower basins of the Yangtze River (Peng, Xue, Guo, & Xue, 2008). In Ryukyus island, the examined population was mainly consisted of lineage A haplotypes, and a few of lineage B and lineage D haplotypes were also detected, indicating that the Ryukyus population of Carassius species complex might be artificially introduced from China and Japan, respectively, as suggested previously (Takada & Tachihara, 2009; Takada et al., 2010). In addition, a few haplotypes of lineage A observed in XK of northeast China and only two haplotypes of lineage D detected in KA of Japan might be resulted from human activities (Gao et al., 2012).

Diploidization process after polyploidy has been suggested to be the driving force of recurrent polyploidy (Soltis et al., 2015; Wendel, 2015). After autopolyploidy from sympatric tetraploids, the extant hexaploids in Carassius species complex may be entering an evolutionary trajectory of diploidization or have been on the diploidization process, as many phenomena similar to normal sexual diploid species have been revealed in some strains of hexaploid Carassius gibelio, such as normal meiosis completion, multiple modes of unisexual gynogenesis and sexual reproduction, and extra microchromosomes for male determination (Li et al., 2016; Zhang et al., 2015). However, recurrent polyploidy is not ceased, as octaploids have been also detected in some natural habitats occasionally (Table 1) (Liasko et al., 2010; Xiao et al., 2011). Therefore, the wide geographic distribution, coexistence of different ploidy forms and occurrence of repeated polyploidy events make the polyploid Carassius species complex an intriguing system to investigate evolutionary genetics and ecological genetics of vertebrates.

CONFLICT OF INTEREST

None declared.

AUTHORS CONTRIBUTION

JFG, LZ, ZWW, FFJ, and XLL collected samples, XJZ, ZL, and XLL performed the experiments, XLL and XYL analyzed the data, JFG and XLL prepared the data and wrote the manuscript. All authors read and approved the final manuscript.

Supporting information

 

 

 

 

ACKNOWLEDGMENTS

This work was supported by the Frontier Science Research Program of the Chinese Academy of Sciences (QYZDY‐SSW‐SMC025), the Strategic Priority Research Program of the Chinese Academy of Sciences (XDA08030201), the earmarked fund for Modern Agro‐industry Technology Research System (NYCYTX‐49), the National Natural Science Foundation of China (31123001), the Special Fund for Agro‐scientific Research in the Public Interest (Grant No. 200903046), and the Autonomous Project of the State Key Laboratory of Freshwater Ecology and Biotechnology (2016FBZ01), and the Autonomous Project of the Institute of Hydrobiology, Chinese Academy of Sciences (Y25A171).

Liu X‐L, Li X‐Y, Jiang F‐F, et al. Numerous mitochondrial DNA haplotypes reveal multiple independent polyploidy origins of hexaploids in Carassius species complex. Ecol Evol. 2017;7:10604–10615. https://doi.org/10.1002/ece3.3462

REFERENCES

  1. Abramenko, M. I. , Nadtoka, E. V. , Makhotkin, M. A. , Kravchenko, O. V. , & Poltavtseva, T. G. (2004). Distribution and cytogenetic features of triploid male goldfish in Azov basin. Ontogenez, 35, 375–386. [PubMed] [Google Scholar]
  2. Angers, B. , & Schlosser, I. J. (2007). The origin of Phoxinus eos‐neogaeus unisexual hybrids. Molecular Ecology, 16, 4562–4571. [DOI] [PubMed] [Google Scholar]
  3. Apalikova, O. V. , Eliseikina, M. G. , Kovalev, M. Y. , & Brykov, V. A. (2008). Collation of data on the ploidy levels and mitochondrial DNA phylogenetic lineages in the silver crucian carp Carassius auratus gibelio from Far Eastern and Central Asian populations. Russian Journal of Genetics, 44, 873–880. [PubMed] [Google Scholar]
  4. Arai, K. , & Fujimoto, T. (2013). Genomic constitution and atypical reproduction in polyploid and unisexual lineages of the Misgurnus loach, a teleost fish. Cytogenetic and Genome Research, 140, 226–240. [DOI] [PubMed] [Google Scholar]
  5. Bi, K. , & Bogart, J. P. (2010). Time and time again: Unisexual salamanders (genus Ambystoma) are the oldest unisexual vertebrates. BMC Evolutionary Biology, 10, 1–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Brochmann, C. , & Elven, R. (1992). Ecological and genetic consequences of polyploidy in arctic Draba (Brassicaceae). Evolutionary Trends in Plants, 6, 111–124. [Google Scholar]
  7. Brykov, V. A. , Poliakova, N. E. , Skurikhina, L. A. , Dolganov, S. M. , Eliseĭkina, M. G. , & Miu, K. (2002). Mitochondrial DNA variation in goldfish Carassius auratus gibelio from water reservoirs in the Far East. Genetika, 38, 1387–1392. [PubMed] [Google Scholar]
  8. Choleva, L. , Janko, K. , Gelas, K. D. , Bohlen, J. , Šlechtová, V. , Rábová, M. , & Ráb, P. (2012). Synthesis of clonality and polyploidy in vertebrate animals by hybridization between two sexual species. Evolution, 66, 2191–2203. [DOI] [PubMed] [Google Scholar]
  9. Clement, M. , Posada, D. , & Crandall, K. A. (2000). TCS: A computer program to estimate gene genealogies. Molecular Ecology, 9, 1657–1659. [DOI] [PubMed] [Google Scholar]
  10. Collares‐Pereira, M. J. , Matos, I. , Morgadosantos, M. , & Coelho, M. M. (2013). Natural pathways towards polyploidy in animals: The Squalius alburnoides fish complex as a model system to study genome size and genome reorganization in polyploids. Cytogenetic and Genome Research, 140, 97–116. [DOI] [PubMed] [Google Scholar]
  11. Dang, X. , Xia, Y. , Xu, Q. , & Zhang, J. (2016). The complete mitochondrial genome of the Poecilia formosa (Amazon molly). Mitochondrial DNA. Part A, DNA Mapping, Sequencing, and Analysis, 27, 3523–3524. [DOI] [PubMed] [Google Scholar]
  12. Doyle, J. J. , Flagel, L. E. , Paterson, A. H. , Rapp, R. A. , Soltis, D. E. , Soltis, P. S. , & Wendel, J. F. (2008). Evolutionary genetics of genome merger and doubling in plants. Annual Review of Genetics, 42, 443–461. [DOI] [PubMed] [Google Scholar]
  13. Drummond, A. J. , & Rambaut, A. (2007). BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology, 7, 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Excoffier, L. , & Lischer, H. E. L. (2010). Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Molecular Ecology Resources, 10, 564–567. [DOI] [PubMed] [Google Scholar]
  15. Ficetola, G. F. , & Stöck, M. (2016). Do hybrid‐origin polyploid amphibians occupy transgressive or intermediate ecological niches compared to their diploid ancestors? Journal of Biogeography, 43, 703–715. [Google Scholar]
  16. Fu, Y. X. (1997). Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics, 147, 915–925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Furlong, R. F. , & Pwh, H. (2004). Polyploidy in vertebrate ancestry: Ohno and beyond. Biological Journal of the Linnean Society, 82, 425–430. [Google Scholar]
  18. Gao, Y. , Wang, S. Y. , Luo, J. , Murphy, R. W. , Du, R. , Wu, S. F. , … Zhang, Y. P. (2012). Quaternary palaeoenvironmental oscillations drove the evolution of the Eurasian Carassius auratus complex (Cypriniformes, Cyprinidae). Journal of Biogeography, 39, 2264–2278. [Google Scholar]
  19. Gao, F. X. , Wang, Y. , Zhang, Q. Y. , Mou, C. Y. , Li, Z. , Deng, Y. S. , … Gui, J. F. (2017). Distinct herpesvirus resistances and immune responses of three gynogenetic clones of gibel carp revealed by comprehensive transcriptomes. BMC Genomics, 18, 561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Gui, J. F. , & Zhou, L. (2010). Genetic basis and breeding application of clonal diversity and dual reproduction modes in polyploid Carassius auratus gibelio . Science China Life sciences, 53, 409–415. [DOI] [PubMed] [Google Scholar]
  21. Gui, J. F. , & Zhu, Z. Y. (2012). Molecular basis and genetic improvement of economically important traits in aquaculture animals. Science Bulletin, 57, 1751–1760. [Google Scholar]
  22. Hanfling, B. , Bolton, P. , Harley, M. , & Carvalho, G. R. (2005). A molecular approach to detect hybridisation between crucian carp (Carassius carassius) and non‐indigenous carp species (Carassius spp. and Cyprinus carpio). Freshwater Biology, 50, 403–417. [Google Scholar]
  23. Hedges, S. B. , Bezy, R. L. , & Maxson, L. R. (1991). Phylogenetic relationships and biogeography of xantusiid lizards, inferred from mitochondrial DNA sequences. Molecular Biology and Evolution, 8, 767–780. [DOI] [PubMed] [Google Scholar]
  24. Jakovlic, I. , & Gui, J. F. (2011). Recent invasion and low level of divergence between diploid and triploid forms of Carassius auratus complex in Croatia. Genetica, 139, 789–804. [DOI] [PubMed] [Google Scholar]
  25. Jiang, F. F. , Wang, Z. W. , Zhou, L. , Jiang, L. , Zhang, X. J. , Apalikova, O. V. , … Gui, J. F. (2013). High male incidence and evolutionary implications of triploid form in northeast Asia Carassius auratus complex. Molecular Phylogenetics and Evolution, 66, 350–359. [DOI] [PubMed] [Google Scholar]
  26. Jiao, Y. , Wickett, N. J. , Ayyampalayam, S. , Chanderbali, A. S. , Landherr, L. , Ralph, P. E. , … dePamphilis, C. W. (2011). Ancestral polyploidy in seed plants and angiosperms. Nature, 473, 97–100. [DOI] [PubMed] [Google Scholar]
  27. Kumar, S. , Stecher, G. , & Tamura, K. (2016). MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution, 33, 1870–1874. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Leitch, A. R. , & Leitch, I. J. (2008). Genomic plasticity and the diversity of polyploid plants. Science, 320, 481–483. [DOI] [PubMed] [Google Scholar]
  29. Li, F. B. , & Gui, J. F. (2008). Clonal diversity and genealogical relationships of gibel carp in four hatcheries. Animal Genetics, 39, 28–33. [DOI] [PubMed] [Google Scholar]
  30. Li, X. Y. , Li, Z. , Zhang, X. J. , Zhou, L. , & Gui, J. F. (2014). Expression characterization of testicular DMRT1 in both Sertoli cells and spermatogenic cells of polyploid gibel carp. Gene, 548, 119–125. [DOI] [PubMed] [Google Scholar]
  31. Li, X. Y. , Zhang, X. J. , Li, Z. , Hong, W. , Liu, W. , Zhang, J. , & Gui, J. F. (2014). Evolutionary history of two divergent Dmrt1 genes reveals two rounds of polyploidy origins in gibel carp. Molecular Phylogenetics and Evolution, 78, 96–104. [DOI] [PubMed] [Google Scholar]
  32. Li, X. Y. , Zhang, Q. Y. , Zhang, J. , Zhou, L. , Li, Z. , Zhang, X. J. , … Gui, J. F. (2016). Extra microchromosomes play male determination role in polyploid gibel carp. Genetics, 203, 1415–1424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Liasko, R. , Liousia, V. , Vrazeli, P. , Papiggioti, O. , Chortatou, R. , Abatzopoulos, T. J. , & Leonardos, I. D. (2010). Biological traits of rare males in the population of Carassius gibelio (Actinopterygii: Cyprinidae) from Lake Pamvotis (north‐west Greece). Journal of Fish Biology, 77, 570–584. [DOI] [PubMed] [Google Scholar]
  34. Librado, P. , & Rozas, J. (2009). DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics, 25, 1451–1452. [DOI] [PubMed] [Google Scholar]
  35. Liousia, V. , Liasko, R. , Koutrakis, E. , & Leonardos, I. D. (2008). Variation in clones of the sperm‐dependent parthenogenetic Carassius gibelio (Bloch) in Lake Pamvotis (north‐west Greece). Journal of Fish Biology, 72, 310–314. [Google Scholar]
  36. Liu, X. L. , Jiang, F. F. , Wang, Z. W. , Li, X. Y. , Li, Z. , Zhang, X. J. , … Gui, J. F. (2017). Wider geographic distribution and higher diversity of hexaploids than tetraploids in Carassius species complex reveal recurrent polyploidy effects on adaptive evolution. Scientific Reports, 7, 5395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Liu, H. T. , & Su, T. T. (1962). Pliocene fishes from Yushe basin, Shansi. Vertebrata Palasiatica, 6, 1–125. (in Chinese with English abstract). [Google Scholar]
  38. Luo, J. , Gao, Y. , Ma, W. , Bi, X. Y. , Wang, S. Y. , Wang, J. , Wang, Y. Q. , … Zhang, Y. P. (2014). Tempo and mode of recurrent polyploidization in the Carassius auratus species complex (Cypriniformes, Cyprinidae). Heredity, 112, 415–427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Luo, J. , Stadler, P. F. , He, S. , & Meyer, A. (2007). PCR survey of hox genes in the goldfish Carassius auratus auratus . Journal of Experimental Zoology. Part B, Molecular and Developmental Evolution, 308, 250–258. [DOI] [PubMed] [Google Scholar]
  40. Mei, J. , & Gui, J. F. (2015). Genetic basis and biotechnological manipulation of sexual dimorphism and sex determination in fish. Science China Life sciences, 58, 124–136. [DOI] [PubMed] [Google Scholar]
  41. Meyer, A. (1993). Evolution of mitochondrial DNA in fishes Zh Evol Biokhim Fiziol (Ed.), Molecular biology frontiers, biochemistry and molecular biology of fishes (pp. 1–38). 27(2), 249–254. [Google Scholar]
  42. Nei, M. , & Tajima, F. (1981). DNA polymorphism detectable by restriction endonucleases. Genetics, 97, 145–163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Ohno, S. , Muramoto, J. , Christian, L. , & Atkin, N. B. (1967). Diploid tetraploid relationship among Old World members of fish family Cyprinidae. Chromosoma, 23, 1–9. [Google Scholar]
  44. Otto, S. P. , & Whitton, J. (2000). Polyploid incidence and evolution. Genetics, 34, 401–437. [DOI] [PubMed] [Google Scholar]
  45. Peng, Y. , Xue, D. Y. , Guo, L. , & Xue, K. (2008). Fish species introduction and its ecological effects in Bositeng Lake in Xinjiang. China Biodiversity Conservation and Research Progress, VIII, 275–282. (in Chinese with English abstract). [Google Scholar]
  46. Posada, D. , & Crandall, K. A. (1998). MODELTEST: Testing the model of DNA substitution. Bioinformatics, 14, 817–818. [DOI] [PubMed] [Google Scholar]
  47. Quattro, J. M. , Avise, J. C. , & Vrijenhoek, R. C. (1992). An ancient clonal lineage in the fish genus Poeciliopsis (Atheriniformes: Poeciliidae). Proceedings of the National Academy of Sciences of the United States of America, 89, 348–352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Robertson, A. V. , Ramsden, C. , Niedzwiecki, J. , Fu, J. , & Bogart, J. P. (2006). An unexpected recent ancestor of unisexual Ambystoma . Molecular Ecology, 15, 3339–3351. [DOI] [PubMed] [Google Scholar]
  49. Rogers, A. R. , & Harpending, H. (1992). Population growth makes waves in the distribution of pairwise genetic differences. Molecular Biology and Evolution, 9, 552–569. [DOI] [PubMed] [Google Scholar]
  50. Ronquist, F. , & Huelsenbeck, J. (2003). MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19, 1572–1574. [DOI] [PubMed] [Google Scholar]
  51. Sakai, H. , Iguchi, K. , Yamazaki, Y. , Sideleva, V. G. , & Goto, A. (2009). Morphological and mtDNA sequence studies on three crucian carps (Carassius: Cyprinidae) including a new stock from the Ob River system, Kazakhstan. Journal of Fish Biology, 74, 1756–1773. [DOI] [PubMed] [Google Scholar]
  52. Schmid, M. , Evans, B. J. , & Bogart, J. P. (2015). Polyploidy in Amphibia. Cytogenetic and Genome Research, 145, 315–330. [DOI] [PubMed] [Google Scholar]
  53. Schmidt, D. J. , Bond, N. R. , Adams, M. , & Hughes, J. M. (2011). Cytonuclear evidence for hybridogenetic reproduction in natural populations of the Australian carp gudgeon (Hypseleotris: Eleotridae). Molecular Ecology, 20, 3367–3380. [DOI] [PubMed] [Google Scholar]
  54. Schneider, S. , & Excoffier, L. (1999). Estimation of past demographic parameters from the distribution of pairwise differences when the mutation rates vary among sites: Application to human mitochondrial DNA. Genetics, 152, 1079–1089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Soltis, P. S. , Liu, X. , Marchant, D. B. , Visger, C. J. , & Soltis, D. E. (2014). Polyploidy and novelty: Gottlieb's legacy. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences, 369, 20130351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Soltis, P. S. , Marchant, D. B. , Van de Peer, Y. , & Soltis, D. E. (2015). Polyploidy and genome evolution in plants. Current Opinion in Genetics and Development, 35, 119–125. [DOI] [PubMed] [Google Scholar]
  57. Stamatakis, A. , Hoover, P. , & Rougemont, J. (2008). A rapid bootstrap algorithm for the RAxML Web Servers. Systematic Biology, 57, 758–771. [DOI] [PubMed] [Google Scholar]
  58. Tajima, F. (1989). Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics, 123, 585–595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Takada, M. , & Tachihara, K. (2009). Comparisons of age, growth, and maturity between male and female, and diploid and triploid individuals in Carassius auratus from Okinawa‐jima Island, Japan. Aquatic Conservation: Marine and Freshwater Ecosystems, 19, 806–814. [Google Scholar]
  60. Takada, M. , Tachihara, K. , Kon, T. , Yamamoto, G. , Iguchi, K. , Miya, M. , & Nishida, M. (2010). Biogeography and evolution of the Carassius auratus‐complex in East Asia. BMC Evolutionary Biology, 10, 18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Toth, B. , Varkonyi, E. , Hidas, A. , Meleg, E. E. , & Varadi, L. (2005). Genetic analysis of offspring from intra‐ and interspecific crosses of Carassius auratus gibelio by chromosome and RAPD analysis. Journal of Fish Biology, 66, 784–797. [Google Scholar]
  62. Van de Peer, Y. , Maere, S. , & Meyer, A. (2009). The evolutionary significance of ancient genome duplications. Nature Reviews Genetics, 10, 725–732. [DOI] [PubMed] [Google Scholar]
  63. Wang, Z. W. , Zhu, H. P. , Wang, D. , Jiang, F. F. , Guo, W. , Zhou, L. , & Gui, J. F. (2011). A novel nucleo‐cytoplasmic hybrid clone formed via androgenesis in polyploid gibel carp. BMC Research Notes, 4, 82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Wei, W. H. , Zhang, J. , Zhang, Y. B. , Zhou, L. , & Gui, J. F. (2003). Genetic heterogeneity and ploidy level analysis among different gynogenetic clones of the polyploid gibel carp. Cytometry. Part A, 56, 46–52. [DOI] [PubMed] [Google Scholar]
  65. Wendel, J. F. (2015). The wondrous cycles of polyploidy in plants. American Journal of Botany, 102, 1–4. [DOI] [PubMed] [Google Scholar]
  66. Xiao, J. , Zou, T. M. , Chen, Y. B. , Chen, L. , Liu, S. J. , Tao, M. , … Liu, Y. (2011). Coexistence of diploid, triploid and tetraploid crucian carp (Carassius auratus) in natural waters. BMC Genetics, 12, 1–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Zhang, J. , Sun, M. , Zhou, L. , Li, Z. , Liu, Z. , Li, X. Y. , … Gui, J. F. (2015). Meiosis completion and various sperm responses lead to unisexual and sexual reproduction modes in one clone of polyploid Carassius gibelio . Scientific Reports, 5, 10898. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Zhou, L. , & Gui, J. F. (2017). Natural and artificial polyploids in aquaculture. Aquaculture and Fisheries, 2, 103–111. [Google Scholar]
  69. Zhou, L. , Wang, Y. , & Gui, J. F. (2000). Genetic evidence for gonochoristic reproduction in gynogenetic silver crucian carp (Carassius auratus gibelio bloch) as revealed by RAPD assays. Journal of Molecular Evolution, 51, 498–506. [DOI] [PubMed] [Google Scholar]
  70. Zhou, L. , Wang, Z. W. , Wang, Y. , & Gui, J. F. (2017). Crucian carp and gibel carp culture. Wiley‐ Blackwells, Oxford, UK: Success stories in Chinese aquacuture (In press). [Google Scholar]
  71. Zhu, H. P. , & Gui, J. F. (2007). Identification of genome organization in the unusual allotetraploid form of Carassius auratus gibelio . Aquaculture, 265, 109–117. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

 

 

 

 


Articles from Ecology and Evolution are provided here courtesy of Wiley

RESOURCES