Abstract
Leishmaniases are parasitic diseases transmitted to mammalian hosts by sand fly vectors (Diptera: Psychodidae). Despite the increasing occurrence of visceral and cutaneous leishmaniasis cases in urban centers, their transmission still occur primarily in wild environments and may be associated with professional activities and recreation, such as ecotourism. The Reserva Particular do Patrimônio Natural Santuário do Caraça (RPPNSC) is one of the largest ecotourism attractions in the State of Minas Gerais, Brazil, and comprises an area of environmental preservation with 11,233 hectares presenting a transitional vegetation between Cerrado and Atlantic Forest. The present study describes the abundance of small mammals in RPPNSC, the isolation and identification of Leishmania in five wild animals. Small mammals were bimonthly trapped along 6 trails within the RPPNSC with 10 Tomahawk traps each. Two trails were located in peridomiciliary areas near tourist lodging facilities, and four trails were located at sites visited by tourists in forest areas. The most prevalent species were Akodon cursor, Cerradomys subflavus and Oligoryzomys nigripes. Six isolates of Leishmania were obtained from these animals and identified as Leishmania braziliensis through HSP70-PCR RFLP method. Leishmania spp. DNA was detected by kDNA-PCR method and isolated by biphasic culture. Studies point to some of the captured species as potential wild reservoirs of Leishmania, suggesting they may be involved in the transmission cycle in these wild environments.
Introduction
Leishmaniasis is a complex of diseases caused by an intracellular protozoon, on vertebrate hosts, of the genus Leishmania. There are four generally accepted classifications of clinical leishmaniasis: cutaneous, diffuse cutaneous, mucocutaneous and visceral leishmaniasis. Leishmania infection is acquired through the bite of female sand flies of the genera Phlebotomus (Old World) and Lutzomyia (New World) [1]. In Brazil, the main species responsible for cutaneous leishmaniasis is Leishmania (Viannia) braziliensis, with approximately 26,000 new human cases reported every year [2], although it is difficult to obtain accurate numbers on the incidence of this disease.
The major reservoirs of this disease are small mammals, and many studies have been undertaken to determine the prevalence of infection by Leishmania species among small mammals of endemic and non-endemic areas [3, 4, 5, 6, 7]. Although the identification and incrimination of primary hosts of this species is complex, there are reports of infection in some wild and synanthropic mammals of different rodent genera in some States of Brazil including Minas Gerais, such as Akodon [8], Rattus [9], Rhipidomys [5, 10], Nectomys [11], Necromys (former Bolomys) [11, 12] and some marsupials [5, 13].
There is an increasing number of ecotourism areas nearby urban areas in the State of Minas Gerais, such as Ibitipoca State Park [14] and Rio Doce State Park [15], where important vectors of Leishmania were reported. In this context, the RPPNSC is inserted, one of the most visited parks in the state, surrounded by urban areas with autochthonous cases and lacking previous studies on possible wild hosts of Leishmania. In this study, we propose to investigate the Leishmania infection in small mammals caught in a natural protected area in southeastern Brazil which is surrounded by urban centers and constantly visited by tourists.
Material and methods
The study was approved by the Ethics Committee for Research with Animals of the Oswaldo Cruz Foundation (CEUA/Fiocruz) under protocol number n° 14/16-3, and by the Brazilian Institute of Environment and Renewable Natural Resources (IBAMA) License n° 40191–2. All procedures involving experimental animals were conducted according to the guidelines of the Brazilian College for Experiments with Animals (Colégio Brasileiro de Experimentacão Animal/COBEA).
Study area
The present study was carried out in the “Reserva Particular do Patrimônio Natural (RPPN) Santuário do Caraça” (20°06’ S, 43° 27’ W), located between the cities of Santa Bárbara and Catas Altas in the Espinhaço mountain range in state of Minas Gerais, southeastern Brazil. This RPPN encompasses 11,233 hectares, of which 10,180 hectares are a protected area and 1,053 hectares of which are for sustainable management (Fig 1). Ecologically, the park comprises a transition zone between Atlantic Forest and Cerrado (Brazilian Savanna) with grasslands on mountain peaks. There are trails from the sanctuary (location of tourist lodging, dining, etc.) that lead to rivers, lakes, waterfalls, caves and peaks. This area remains one of the most popular tourist attractions in Brazil.
Fig 1. Sample sites and location site where isolation on biphasic medium culture and DNA detection by kDNA PCR of Le. braziliensis was performed from captured small mammals on the RPPN Santuário do Caraça.
A—The red dot represents the location of the Sanctuary, yellow dots are the sample points and the red border in the yellow dot represents the location of isolation and detection of Le. braziliensis. B–Location of the RPPNSC in Brazil and Minas Gerais.
Trapping of wild small mammals and sample collection
Small mammals were captured bimonthly, from July 2013 to July 2014, during four consecutive days per campaign. Ten Tomahawk® traps (30 x 17.5 x 15.5 cm) were placed at 10 m intervals along each of six transects (Fig 1). Traps were baited with a mixture of pineapple and emulsion of cod liver oil, which has been considered an effective attractant for wild small mammals [16, 5]. To perform parasitological and molecular tests for Leishmania detection by PCR-kDNA, all caught animals were anesthetized by a xylazine (10 mg / kg) and ketamine (200 mg / kg) followed by euthanasia by overdose of thiopental (1.25%) in concentration three times higher than that of the anesthetic plane and samples of spleen, liver, and skin (tail and ear) were collected. Identification of small mammal species followed specific literature [17, 18, 19]. In addition, they were compared to museum specimens. Collected specimens were deposited in the Mammal Collection of Universidade Federal de Minas Gerais (UFMG). Small-mammal nomenclature followed Paglia et al., [16].
DNA extraction and PCR amplification
DNA extraction was performed using a Gentra Puregene QIAGEN (Germantown, MD, EUD) extraction kit following the manufacturer’s specifications.
PCR was conducted according to Degrave et al., [20] using the generic primers A: 5’ (C/G)(C/G)(G/C) CC(C/A) CTA T(T/A)T TAC ACC AAC CCC 3’ and B: 5’ GGG GAG GGG CGT TCT GCG AA 3’ in order to amplify a 120bp fragment of the conserved region within the minicircles of Leishmania kDNA [20]. Reaction mixtures were prepared in a final volume of 25uL containing 2uL of DNA template and 1× buffer solution (1.0mM Tris–HCl; 5.0mM KCl; 1.5mM MgCl2; pH 8.0), 200_M dNTPs, 10 pmol of each primer and 1.25U of Taq DNA polymerase (Invitrogen). The amplification conditions were as follows: 94°C for 4 min, followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 30 s and extension at 72°C for 30 s, with a final extension step at 72°C for 10min. Amplification were analysed on 2% polyacrylamide gels. All samples were tested for irbp-PCR as internal control for mammal DNA [21, 22] (S1 Appendix).
Amplified products were visualized in a 2% agarose gel stained with ethidium bromide, with a 100 bp DNA Step Ladder provided as a molecular-weight size-standard, and analyzed using the L-PIX EX (Loccus, Biotechnology, Cotia, SP) photo-documentation system. A panel of reference strains was used as a positive control, in all PCR procedures, which included Leishmania amazonensis (IFLA/BR/67/PH8), Le. braziliensis (MHOM/BR/75/M2903), Le. infantum (MHOM/BR/74/PP75) and Le. guyanensis (MHOM/BR/75/M4147).
Culture and molecular characterization
Samples from spleen, liver, skin (tail and ear) were macerated in 1% phosphate-buffered saline (1 ml) with 50μL of Nistatin/100.000U/mL and penicillin/streptomycin antibiotic mix 100-200ųg/ml. After 24 hours macerated tissues were inoculated in NNN (Novy–MacNeal-Nicolle)/LIT (liver infusion tryptose) medium supplemented with 20% fetal bovine serum (FBS) and associated antibiotics (penicillin and streptomycin 100-200ųg/ml). All cultures were incubated at 25°C±1 about 50 days with periodic inoculation in new culture at 7-day intervals (a total of seven passages). The positive cultures were expanded to be cryopreserved (10% glycerol) and prepared for use in the different molecular techniques. The samples are deposited in the cryobank of the Laboratory of Leishmaniasis of the Centro de Pesquisas René Rachou. Negative cultures until the seventh week or contaminated by bacteria or fungi were discarded. DNA samples of positive cultures were subjected to PCR, targeting a fragment of the gene coding for heat shock proteins of 70 kilodaltons (hsp70) of Leishmania spp. using the primers HSP70 for 5’ GACGGTGCCTGCCTACTTCAA 3’ and HSP70rev for 5’ CCGCCCATGCTCTGGTACATC 3’, generating a 1300 bp fragment. Samples that had this specific band were subjected to digestion using the enzyme HaeIII for analysis of restriction fragment length polymorphisms [23]. The restriction profiles were analyzed in 4% agarose and compared with standards of reference strains previously cited.
Results
A total of 55 small mammals of six species of Cricetidae [Akodon cursor (Winge, 1887), Cerradomys subflavus (Wagner, 1842), Necromys lasiurus (Lund, 1841), Nectomys squamipes (Brants, 1827), Oligoryzomys nigripes (Olfers, 1818) and Oxymycterus dasytrichus (Schinz, 1821)], one species of Sciuridae [Guerlinguetus ingrami (Thomas, 1901)] and two species of Didelphidae [Gracilinanus agilis (Burmeister, 1854) and Marmosops incanus (Lund, 1841)] were captured during the study period (Fig 2). The most successful sampling points were the trail 1 (21,82%), trail 4 (20%) and trail 5 (20%) (Table 1). Akodon cursor (56.4%) was the most abundant species followed by Cerradomys subflavus (10.9%) and Oligoryzomys nigripes (10.9%) (Table 1).
Fig 2. Frequency of trapped mammals in RPPN Santuário do Caraça between July 2013 and July 2014.
Table 1. Captured small mammals by collection trails and the positivity on culture analysis.
Species | Trail 1 | Trail 2 | Trail 3 | Trail 4 | Trail 5 | Trail 6 | TOTAL (%) |
---|---|---|---|---|---|---|---|
Captured animals (n of positive animals) | |||||||
Cricetidae | |||||||
A. cursor | 9 (1a) | 2 | 4 | 9 | 2 (1b) | 5 (1ab) | 31 (56,36) |
C. subflavus | 0 | 2 | 2 | 1 | 1 (1a) | 0 | 6 (10,91) |
N. lasiurus | 0 | 0 | 1 | 0 | 0 | 0 | 1 (1,82) |
N. squamipes | 0 | 0 | 0 | 1 | 0 | 0 | 1 (1,82) |
O. nigripes | 1 | 3 | 0 | 0 | 2 | 0 | 6 (10,91) |
O. dasytrichus | 0 | 0 | 0 | 0 | 3 (1b) | 0 | 3 (5,45) |
Sciuridae | |||||||
G. ingrami | 0 | 0 | 0 | 0 | 3 | 0 | 3 (5,45) |
Didelphidae | |||||||
G. agilis | 1 | 1 | 0 | 0 | 0 | 0 | 2 (3,64) |
M. incanus | 1 | 0 | 0 | 0 | 0 | 1 | 2 (3,64) |
TOTAL (%) |
12 (21,82) |
8
(14,55) |
7
(12,73) |
11 (20) | 11 (20) | 6 (10,90) |
55 (100) |
a—isolated parasite from tail skin
b—isolated parasite from liver
Results found in culture recorded a total of 5 (9.1%) infected animals and six isolates. Isolates were obtained from liver and tail skin from three captured species (Akodon cursor, Cerradomys subflavus, Oxymycterus dasytrichus) and characterized by hsp70 PCR-RFLP as Leishmania (Viannia) braziliensis (Fig 3). One culture was positive after 34 days and the others after 41 days. All positive culture samples were also positive by kDNA PCR (Table 2). The sample points where small mammals captured were positive on the culture and kDNA-PCR are marked on Fig 1.
Fig 3. Electrophoresis 4% agarose gel of the RFLP HSP70 of positive DNA samples of small mammals collected in RPPNSC.
MW = Molecular Weight, 8L, 11TS, 12L, 12TS, 13L and 14L = samples of liver (L) and tail skin (TS), NC = Negative Control, La, Lb, Lcand Lg = Positive Controls strains of Leishmania amazonensis, Le. braziliensis, Le. infantum and Le. guyanensis respectively.
Table 2. Species of small mammals captured in the RPPN Santuário do Caraça positive in kDNA PCR and culture by tissue analyzed.
Species | Liver | Spleen | Tail Skin | |||
---|---|---|---|---|---|---|
kDNA | Culture | kDNA | Culture | kDNA | Culture | |
Cerradomys subflavus | + | + | ||||
Akodon cursor | + | + | + | |||
Akodon cursor | + | + | + | + | + | |
Akodon cursor | + | + | + | |||
Oxymycterus dasytrichus | + | + | ||||
TOTAL | 5 | 4 | 3 | 0 | 1 | 2 |
Discussion
Isolation of L. braziliensis from rodents has been described in different regions, for review see Roque & Jansen [24], but to the best of our knowledge, there are no prior reports of L. braziliensis isolated from Akodon cursor, Cerradomys subflavus and Oxymycterus dasytrichus in the southeastern region of Brazil. Here we report six isolations of L. braziliensis from these wild rodent species. Our results agree with the previous isolation of L. braziliensis from Akodon arviculoides [25] and Nectomys squamipes [26] in Brazil; and the cotton rat (Sigmodon hispidus) in Venezuela [27]. L. braziliensis has been also isolated from naturally infected Necromys lasiurus and Rattus rattus captured between 1996 and 2000 in the endemic cutaneous leishmaniasis region of Amaraji, Pernambuco State, northeast Brazil [3]. Additionally, in the same region an isolate was obtained from a spleen sample collected from a water rat (Nectomys squamipes). The spleen sample was initially inoculated in a hamster and then seeded on modified NNN medium. The isolate was characterized by monoclonal antibodies and multilocus enzyme electrophoresis as L. braziliensis, belonging to the zymodeme Z-74 the same one found in the isolates from ACL human cases [6].
In our study the animals showed L. braziliensis infection not only in the skin but also in the spleen and liver. It is important to note that this species of Leishmania has been previously reported to infect visceral organs [3, 6]. Our results also show that Leishmania infection in wild rodents follows a pattern different from that observed in human, infecting other tissues than the skin. This may change the point of view of the discussions about the dermotropic behavior of L. braziliensis as previously reported by Roque et al. [28].
Our results showed the same sensitivity for detection of Leishmania sp. in culture medium and molecular methods, contrary to literature data [3, 5]. Analysis of infection by Leishmania sp. in wild hosts can be made by tissue imprints on microscopy slides with results given in short time; however, sensitivity is highly variable (20%–70%) and requires experience for a praiseworthy diagnosis [29]. Culture in biphasic medium is another method to detect infection by parasites in hosts but it’s a laborious method and quite susceptible to contamination by fungi and bacteria, besides being a difficult methodology due to the parasite burden. The sensitivity of these methods, however, decreases as the number of parasites decreases, so PCR has become one of the most used method for detect infection by Leishmania spp. in small mammals, thus may be very useful in understanding the epidemiology of leishmaniasis [30]. The demonstrated capacity of hsp70 PCR-RFLP analysis to distinguish among closely related Leishmania species, along with the ability to detect parasites in clinical samples, indicates that this technique could replace multilocus enzyme electrophoresis (MLEE) as the gold standard for Leishmania species identification [31].
None of the animals captured in the present study had a clinical sign of tegumentary leishmaniasis. Previous study found none of the small mammals examined to present clinical signs suggestive of leishmaniasis (e.g., skin lesions). This fact strengthen the hypothesis that these small mammals are suitable reservoirs for L. braziliensis and also suggests that these parasites have adapted to several small mammal species, probably due to their long co-existence [6], but new laboratory infection experiments must be taken to confirm this hypothesis.
Studies investigating the natural hosts of Leishmania parasites are often complicated due to the inherent difficulties in working with species of wildlife and the costs associated with long-term fieldwork [31]. However, the involvement of rodents in the maintenance of transmission cycle of L. braziliensis has been overlooked by public health and researchers, and is a component of the epizootiology of this disease that needs critical examination to update prevention and control programs in areas both endemic and non-endemic for tegumentary leishmaniasis.
Isolations were obtained from mammals captured on trails 1, 5 and 6, two peridomiciliary areas and one wild environment as showed on Fig 1. In one of the places where L. braziliensis was isolated from Akodon cursor, this same parasite was also detected by molecular methods in phlebotomine sand flies species Psychodopygus lloydi [32]. The isolations from vertebrate reservoirs were obtained on the month of September 2013, while the detection of Leishmania DNA in sand flies was made in December 2013, a month with greater density of sand flies [32].
Ours results in southeastern Brazil reinforce the hypothesis that rodents are major reservoir of L. braziliensis, and that Cerradomys subflavus, Oxymycterus dasytrichus and Akodon cursor, the most abundant species of rodent captured in the RPPN Santuário do Caraça and also with the high prevalence, are inserted in enzootic cycles of L. braziliensis in the study area.
Some preventive care as use of repellents and appropriate clothing when practicing ecotourism may be adopted by visitors to reduce contact with mosquitoes that may act as vectors through the Santuário do Caraça. A very useful preventive measure already employed by the Sanctuary is the use of traps for small mammals in the peridomestic regions, preventing the circulation of these animals in the lodging areas. Continued studies in RPPN Santuário do Caraça are important for monitoring the situation of infections in local small mammals since it is an area of global tourist attraction, and thus can serve as a migration route for infectious diseases to non-endemic areas.
Supporting information
MW = Molecular Weight, 1–13 = samples tested, NC = Negative Control.
(TIF)
Acknowledgments
We would like to thank the staff of the RPPN Sanctuary of the Caraça for the support during the realization of the collections of the small mammals.
Data Availability
All relevant data are within the paper and its Supporting Information files.
Funding Statement
The authors thank the Fundação de Amparo a Pesquisa do Estado de Minas Gerais/FAPEMIG (RDP-00149-10 and PPM-00438-14), the Conselho Nacional de Desenvolvimento Científico e Tecnológico/CNPq (302701/2016-8 and 306451/2014-0), the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior/CAPES and the Postgraduate Programmme in Ciências da Saúde/IRR. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.WHO Library Cataloguing-in-Publication Data: Control of the leishmaniasis: report of a meeting of the WHO Expert Committee on the Control of Leishmaniases, Geneva, 22–26 March 2010. (WHO technical report series; no. 949).
- 2.Alvar J, Velez ID, Bern C, Herrero M, Desjeux P, Cano J, et al. , 2012. Leishmaniasis Worldwide and Global Estimates of Its Incidence. PLoS One 7: e35671 doi: 10.1371/journal.pone.0035671 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Brandão-Filho SP, Brito ME, Carvalho FG, Ishikawa EA, Cupolillo E, Floeter-Winter L, et al. , 2003. Wild and synanthropic hosts of Leishmania (Viannia) braziliensis in the endemic cutaneous leishmaniasis locality of Amaraji, Pernambuco State, Brazil. Trans. R. Soc. Trop. Med. Hyg. 97, 291–296. [DOI] [PubMed] [Google Scholar]
- 4.Oliveira FS, Pirmez C, Pires MQ, Brazil RP, Pacheco RS. 2005. PCR-based diagnosis for detection of Leishmania in skin and blood of rodents from an endemic area of cutaneous and visceral leishmaniasis in Brazil. Vet. Parasitol. 129,219–227. doi: 10.1016/j.vetpar.2005.01.005 [DOI] [PubMed] [Google Scholar]
- 5.Quaresma PF, Rêgo FD, Botelho HA, da Silva SR, Moura AJ, Neto RGT, et al. , 2011. Wild, synanthropic and domestic hosts of Leishmania in an endemic area of cutaneous leishmaniasis in Minas Gerais State, Brazil. Trans. R. Soc. Trop. Med. Hyg. 105: 579–585. doi: 10.1016/j.trstmh.2011.07.005 [DOI] [PubMed] [Google Scholar]
- 6.Lima BS, Dantas-Torres F, de Carvalho MR, Marinho-Junior JF, de Almeida EL, Brito ME, et al. , 2013. Small mammals as hosts of Leishmania spp. in a highly endemic area for zoonotic leishmaniasis in North-Eastern Brazil. Trans R Soc Trop Med Hyg. 2013 September;107(9):592–7. doi: 10.1093/trstmh/trt062 [DOI] [PubMed] [Google Scholar]
- 7.Cássia-Pires R, Boité MC, D’Andrea PS, Herrera HM, Cupolillo E, Jansen AM, et al. ,. 2014. Distinct Leishmania Species Infecting Wild Caviomorph Rodents (Rodentia: Hystricognathi) from Brazil. PLoS Negl Trop Dis 8(12): e3389 doi: 10.1371/journal.pntd.0003389 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Forattini OP, Pattoli DBG, Rabello EX, Ferreira OA. Infecções naturais de mamíferos silvestres em área endêmica de leishmaniose tegumentar no Estado de São Paulo, Ver Saúde Pública. 1972. September; 6 (3);255–61. [PubMed] [Google Scholar]
- 9.Lainson R, Shaw JJ. The role of animals in the epidemiology of South American leishmaniasis In Lumsden WHR, Evans D, editors. Biology of the Kinetoplastida. London; Academic Press; 1979, p. 1–116. [Google Scholar]
- 10.Lainson R, Shaw JJ, Ready PD, Miles MA, Póvoa M. Leishmaniasis in Brazil: XVI, Isolation and identification of Leishmania species from sandflies, wild mammals and man in north Pará State, with particular reference to Leishmania braziliensis guyanensis, causative agent of “pian-bois”. Trans R Soc Trop Med Hyg, 1981; 75(4):530–6. [DOI] [PubMed] [Google Scholar]
- 11.Brandão-Filho SP, Carvalho FG, Brito MEF, Almeida FA, Nascimento LA. American cutaneous leishmaniasis in Pernambuco, Brazil: Ecoepidemiological aspects in “Zona da Mata” region. Mem Inst Oswaldo Cruz. 1994. Jul-Sep; 89(3); 445–9. [DOI] [PubMed] [Google Scholar]
- 12.Ferreira de CF, Cruz I, Cañavate C, de Melo LA, Pereira AAS, Madeira FAM, et al. , 2015. Mixed infection of Leishmania infantum and Leishmania braziliensis in rodents from endemic urban área of the New World. BMC Veterinary Research. 11:71 doi: 10.1186/s12917-015-0392-y [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Brandão-Filho SP, Dantas-Torres F, Tolezano JE, Shaw JJ, 2011. "Hospedeiros reservatórios de Leishmania spp. associados à leishmaniose tegumentar americana, com especial ênfase no Brasil." Leishmanias e a leishmaniose tegumentar Americana 1: 1–236. [Google Scholar]
- 14.Carvalho GM, De Vasconcelos FB, Da Silva DG, Botelho HA, Andrade Filho JD. Diversity of phlebotomine sand flies (Diptera: Psychodidae) in Ibitipoca State Park, Minas Gerais, Brazil. J Med Entomol. 2011;48: 764–769. [DOI] [PubMed] [Google Scholar]
- 15.Mayrink W, Williams P, Coelho MV, Dias M, Martins AV, Magalhães PA, et al. , 1979. Epidemiology of dermal leishmaniasis in the Rio Doce Valley, State of Minas Gerais, Brazil. Ann. Trop. Med. Parasitol. 73: 123Ð 137. [DOI] [PubMed] [Google Scholar]
- 16.Paglia AP, Fonseca GAB, Rylands AB, Herrmann G, Aguiar LMS, Chiarello AG, et al. , 2012. Lista Anotada dos Mamíferos do Brasil. 2a Edição Occasional Papers in Conservation Biology, n.6. Conservation International, Arlington. [Google Scholar]
- 17.Gardner AL. 2007. Mammals of South America Volume 1: Marsupials, xenarthrans, shews and bats. Chicago and London: University Of Chicago Press. 690p. [Google Scholar]
- 18.Bonvicino CR., Oliveira J.A. & D’Andrea P.S. 2008. Guia de Roedores do Brasil. Rio de Janeiro: Centro Pan-Americano de Febre Aftosa–OPAS/OMS. 120p. [Google Scholar]
- 19.Patton JL, Pardiñas UFJ, D’Elía G. 2015. Mammals of South America Volume 2: Rodents. Chicago and London: University Of Chicago Press. 1356p. [Google Scholar]
- 20.Degrave W, Fernandes O, Campbell D, Bozza M, Lopes U. Use of molecular probes and PCR for detection and typing of Leishmania—a mini review. Mem Inst Oswaldo Cruz. 1994. 89:463–469. [DOI] [PubMed] [Google Scholar]
- 21.Pepperberg DR, Okajima L, Wigger B, Ripps H, Crouch RK, Chade GJ. Interphotoreceptor Retinoid-Binding Protein (IRBP) Molecular Biology and Physiological Role in the Visual Cycle of Rhodopsin. 7: 61–84. [DOI] [PubMed] [Google Scholar]
- 22.Ferreira EC, Gontijo CM, Cruz I, Melo MN, Silva AM. Alternative PCR protocol using a single primer set for assessing DNA quality in several tissues from a large variety of mammalian species living in areas endemic for leishmaniasis. 2010;105: 895–898. [DOI] [PubMed] [Google Scholar]
- 23.Garcia L, Kindt A, Bermudez H, Llanos-Cuentas A, De Doncker S, Arevalo J, et al. ,. Culture-independent species typing of neotropical Leishmania for clinical validation of a PCR-based assay targeting heat shock protein 70 genes. J Clin Microbiol. 2004. May;42(5):2294–7. doi: 10.1128/JCM.42.5.2294-2297.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Roque ALR, Jansen AM. Wild and synantropic reservoirs of Leishmania species in the Americas. International Jornal for Parasitology: Parasites and Wildlife 3: 251–262, 2014. doi: 10.1016/j.ijppaw.2014.08.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Rocha NMM, Melo MN, Babfi EH, Dias MSM, Michalick MSM, Da Costa CA, et al. ,. Leishmania braziliensis braziliensis isolated from Akodon arviculoides captured in Caratinga, Minas Gerais, Brazil. Transactions of the Royal Society of Tropical Medicine and Hygiene, 1988; 82, 68 [PubMed] [Google Scholar]
- 26.Peterson NE, Vexemat JA, Rosa ACOC, Lago PRL. 1988. Isolation of Leishmania (Viannia) braziliensis from the rodent Nectomys squamipes captured in Bahia, Brazil. Mem. Inst. Oswaldo Cruz. 83 (S1) p. 28. [Google Scholar]
- 27.De Lima H, De Guglielmo Z, Rodriguez A, Convit J, Rodriguez N. 2002. Cotton rats (Sigmodon hispidus) and black rats (Rattus rattus) as possible reservoirs of Leishmania spp. in Lara State, Venezuela. Mem6rias do Instituto Oswaldo Cruz, 97, 169–174. [DOI] [PubMed] [Google Scholar]
- 28.Roque ALR, Cupolillo E, Marchevsky RS, Jansen AM. Thrichomys laurentius (Rodentia; Echimyidae) as a Putative Reservoir of Leishmania infantum and L. braziliensis: Patterns of Experimental Infection. PLoS Negl Trop Dis, 2010; 4(2): e589 doi: 10.1371/journal.pntd.0000589 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Romero GA, Boelaert M. Control of visceral leishmaniasis in latinAmerica—a systematic review. PLoS Negl Trop Dis 2010; 4:e584 doi: 10.1371/journal.pntd.0000584 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Silva ES, Gontijo MF, Melo MN. Contribution of molecular techniques to the epidemiology of neotropical Leishmania species. Trends in Parasitology. 2005; 21: 550–552. doi: 10.1016/j.pt.2005.09.008 [DOI] [PubMed] [Google Scholar]
- 31.Silva LA, de Sousa CS, da Graça GC, Porrozzi R, Cupolillo E. Sequence analysis and PCR-RFLP profiling of the hsp70 gene as a valuable tool for identifying Leishmania species associated with human leishmaniasis in Brazil. Infect Genet Evol. 2010. January;10(1):77–83. doi: 10.1016/j.meegid.2009.11.001 [DOI] [PubMed] [Google Scholar]
- 32.Tonelli GB, Tanure A, Rêgo FD, Carvalho GML, Simões TC, Andrade Filho JD. Aspects of the ecology of phlebotomine sand flies (Diptera: Psychodidae) in the Private Natural Heritage Reserve Sanctuary Caraça. PLosONE 2017, 12 (6): e0178628. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
MW = Molecular Weight, 1–13 = samples tested, NC = Negative Control.
(TIF)
Data Availability Statement
All relevant data are within the paper and its Supporting Information files.