Abstract
Premise of the study:
Microsatellite primers were developed for Primula ovalifolia, a member of Primula section Petiolares (Primulaceae), to study the population genetics and species delimitation in this section.
Methods and Results:
A total of 4753 markers were successfully designated from 5139 putative simple sequence repeat loci. We isolated 38 expressed sequence tag–simple sequence repeat markers from 220 selected marker sites and tested polymorphism in three populations of P. ovalifolia, one of P. tardiflora, and one of P. epilosa. The number of alleles per locus ranged from one to 19, and the observed and expected levels of heterozygosity varied from 0 to 0.938 and 0 to 0.915, respectively. Most of the loci could be successfully cross-amplified in the two congeneric species.
Conclusions:
These markers will be useful for further population genetic analysis and gene flow estimation of P. ovalifolia and its relatives.
Keywords: EST-SSR marker, interspecific transferability, Primula ovalifolia, Primulaceae, transcriptome
Primula L. section Petiolares Pax (Primulaceae) is mainly distributed in the Hengduanshan–Himalaya Mountains with only a few members occurring in Kashmir, central China, and other regions (Hu and Kelso, 1996). Primula ovalifolia Franch. and P. tardiflora (C. M. Hu) C. M. Hu are two closely related species in the section. Primula ovalifolia is widely distributed in southwestern and adjacent central China, around the Sichuan Basin, mainly growing in shaded habitats in broad-leaved forests and ravines, with altitudes ranging from 600 to 2500 m. Primula tardiflora is morphologically similar to P. ovalifolia but with a more limited distribution, known only from a single locality in E’mei Mountain. It was first considered as a subspecies of P. ovalifolia, and later was regarded as distinct from P. ovalifolia by its higher altitude habitat, later floral phenology, and some neglected vegetative traits (Hu and Kelso, 1996). A phylogeographic study based on chloroplast DNA data suggested that P. tardiflora is genetically close to the E’mei Mountain population of P. ovalifolia (Xie et al., 2012). Development of highly polymorphic nuclear markers (e.g., simple sequence repeats [SSRs]) will help to delineate between the two species. In Primula, only a few genomic SSR markers have been developed for several species thus far, such as P. vulgaris Huds. (Van et al., 2006), P. obconica Hance (Yan et al., 2010), P. sieboldii E. Morren (Ueno et al., 2011), P. veris L. (Bickler et al., 2013), P. poissonii Franch., and P. wilsonii Dunn (Zhang et al., 2013). Considering that these markers demonstrate low polymorphism and limited transferability, and that species of section Petiolares are phylogenetically distant from the above-named species, expressed sequence tag (EST)-SSRs specific to section Petiolares could provide useful tools for evolutionary and ecological studies in this section. In this study, we first obtained transcriptome data for P. ovalifolia using the Illumina platform and then designed marker pairs based on SSR loci. A subset of the markers was selected to investigate their polymorphism and transferability in congeneric species of Primula.
METHODS AND RESULTS
Transcriptome sequencing
Plants of P. ovalifolia were collected from Mount E’mei, Sichuan Province, China. Leaves from one individual were sampled, frozen immediately in liquid nitrogen, and stored at −80°C for RNA extraction and transcriptome sequencing. RNA was extracted using TRIzol Reagent (QIAGEN, Dusseldorf, Germany) and delivered to Genepioneer Technologies Corporation (Nanjing, China) for construction of cDNA libraries and sequencing. The cDNA libraries were sequenced on the Illumina HiSeq 2500 platform (Illumina, San Diego, California, USA) according to the manufacturer’s recommendations. A total of 49,094,910 raw reads were obtained and deposited in the National Center for Biotechnology Information (NCBI) Short Read Archive under BioProject ID PRJNA379052 (accession no. SRP102475). Raw reads were first cleaned by trimming adapters and removing ambiguous reads (‘N’ > 10%) and low-quality reads (Phred score < 30). Clean reads were assembled into 142,468 transcripts using Trinity tools with default parameters (Haas et al., 2013) and were then clustered into 67,577 unigenes with TGICL version 2.1 (Pertea et al., 2003).
Development of EST-SSR markers
The EST-SSR loci were identified from unigenes longer than 1 kb using MIcroSAtellite identification tool (MISA) based on the Perl language (Thiel et al., 2003). We searched for SSRs with motifs ranging from mono- to hexanucleotides in size, and 4753 primer pairs were designated from 5139 putative loci using Primer3 web version 0.4.0 (Rozen and Skaletsky, 1999). A total of 220 markers comprising two nucleotides with at least eight contiguous repeat units were chosen for screening, among which 102 primers produced clear bands with suitable fragment lengths (<500 bp) during the preliminary test with four individuals of P. ovalifolia.
These 102 loci were further tested with eight individuals of P. ovalifolia. PCR reactions were performed with three primers: a sequence-specific forward primer with an M13(−21) tail at its 5′ end, a sequence-specific reverse primer, and the universal fluorescent-labeled M13(–21) primer (FAM, ROX, HEX, or TAMRA; Invitrogen, Guangzhou, Guangdong, China) (Schuelke, 2000). Genomic DNA was extracted using a modified cetyltrimethylammonium bromide (CTAB) protocol (Doyle, 1991). The amplified 10-μL mixture for SSRs included 5 μL of Master Mix (Generay Biotech, Guangzhou, China), 0.4 mM of each primer pair, 3.2 μL of deionized water, and 30–50 ng of genomic DNA. PCRs were run following a touchdown procedure with initial denaturation for 4 min at 94°C; followed by 10 cycles of 94°C for 35 s, 35 s at 60°C with an increment of −1°C per cycle, 45 s at 72°C; followed by 28 cycles of 94°C for 35 s, 35 s at 50°C, 45 s at 72°C; ending with an extra extension of 10 min at 72°C. PCR products were scanned by an ABI PRISM 3100 Genetic Analyzer using GeneScan 500 LIZ internal size standard (Invitrogen). Allele binning and calling were done using GeneMarker version 2.4.0 (SoftGenetics, State College, Pennsylvania, USA), and 38 primer pairs were selected for further polymorphism and transferability detection (Table 1). All of these SSR sequences have been deposited in GenBank (Table 1).
Table 1.
Characteristics of 38 microsatellite loci identified in Primula ovalifolia.
| Locusa | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp) | Fluorescent dye | GenBank accession no. |
| C11339 | F: CGACTTCACTCCCACTGTTG | (CT)8 | 278–310 | HEX | MF716482 |
| R: GGTCAAAATCACCGGAAAGA | |||||
| C13959 | F: TGGACGCCAATCTTTCTCAT | (AG)8 | 266–282 | FAM | MF716483 |
| R: TTGCATATCCCCTCCCAATA | |||||
| C14309 | F: ATTGCAAGTGTTCTTTCGGC | (TC)10 | 116–132 | ROX | MF716484 |
| R: TCCCTTTGCTAAAAAGAAGGC | |||||
| C14710 | F: TACACCGGTCGGAAGAAGTC | (AG)8 | 258–276 | TAMRA | MF716485 |
| R: GGTGTTCCTCCTAAATCCCC | |||||
| C15228 | F: TTTCCAATCCATGTCGTTCA | (AG)8 | 268–276 | HEX | MF716486 |
| R: CAATTTGCACCCAACAAACA | |||||
| C21614 | F: GCGCCGTGACATAAATCATA | (CT)9 | 180–184 | HEX | MF716487 |
| R: GGTGGAGGTGTTCGTAAGGA | |||||
| C23409 | F: CAGTCAAATCACCAAGGGCT | (CT)8 | 171–203 | FAM | MF716488 |
| R: CAGCTTGTTCGATTGTTGGA | |||||
| C23644 | F: GCGTAAGTAGTAGCGGTGGC | (CT)8 | 238–268 | TAMRA | MF716489 |
| R: CGCCCAATAACAAAACCAG | |||||
| C23746 | F: CCACTGCCTCCATTACCATT | (AG)9 | 112–114 | TAMRA | MF716490 |
| R: AACGTTCCATTTTCAGGTGC | |||||
| C24233 | F: CTGCAAAAACATGCTCTGGA | (CT)10 | 284–298 | HEX | MF716491 |
| R: GGGCAGTTTTGTGTCCATTT | |||||
| C24268 | F: ATGGCAAATTCGGATTCAAG | (AT)8 | 221–249 | ROX | MF716492 |
| R: ACACGCACGTCTCCTCTTCT | |||||
| C24676 | F: CCTGCAAACAGTTAGGCACA | (GA)10 | 206–224 | FAM | MF716493 |
| R: TTTCGCTATTTATCACCGCC | |||||
| C40984 | F: AGGAGTGAGAGGGGTTTGGT | (CT)8 | 145–153 | TAMRA | MF716494 |
| R: CACAACAATTAAGCAGACAAAAA | |||||
| C45417 | F: GGGGGAGCAGGAGTAATAGG | (AT)10 | 166–252 | ROX | MF716495 |
| R: CTTGAAAGTGGCAAGGCAAT | |||||
| C46430 | F: CCAAGCCACACCACACAT | (CT)8 | 285–305 | ROX | MF716496 |
| R: GAGGACGGAGAGTACGCAAG | |||||
| C47095 | F: GTCTGATCATGGCAGTGGTG | (GA)8 | 212 | HEX | MF716497 |
| R: GATCGGACGGTGGAGAATAA | |||||
| C48258 | F: GGTGAATCATCACCCAATCC | (GA)9 | 176–212 | TAMRA | MF716498 |
| R: TGCCCAAACATATGCCTTCT | |||||
| C48475 | F: GGCCCAAAGGAAAAGGATAA | (AG)8 | 139–173 | FAM | MF716499 |
| R: TGTGAGTGGAATTGGGAACA | |||||
| C50127 | F: CCAGCGAGATTTGTGATTGA | (TC)8 | 172–184 | TAMRA | MF716500 |
| R: CAGATGAACATGTACACACCTGC | |||||
| C51170 | F: GTACTCATCCGGCACCACTT | (CT)10 | 294–322 | ROX | MF716501 |
| R: AAAGCCGCAAGACCAGTAAA | |||||
| C53509 | F: ACCATCCCAATTCCCTTCTC | (TC)8 | 204–236 | TAMRA | MF716502 |
| R: GCAGCAGTGACGACTGGTAA | |||||
| C53824 | F: CTCGATCTCCAAGGGCTAAA | (GT)8 | 248–254 | TAMRA | MF716503 |
| R: CCCCTCTCTCTGTCATGGAA | |||||
| C53825 | F: CAACAACAGGTTTTGGAGCA | (AG)9 | 282–320 | HEX | MF716504 |
| R: CCCTTGGGATCTCATCTTCA | |||||
| C53843 | F: GGCAATAGTAGCCCCAAACA | (GA)8 | 444–470 | ROX | MF716505 |
| R: ATAACGCAACACCATCCCAG | |||||
| C53920 | F: AACATGAGATGCCTGCACAA | (CT)9 | 184–192 | TAMRA | MF716506 |
| R: TGGGTCTGCATGTGAAAGAA | |||||
| C53962 | F: GGTACAAAAGAAAAACGAGCTGA | (CA)8 | 128–160 | FAM | MF716507 |
| R: GGTAGGCGCAGCACTATGTT | |||||
| C55683 | F: TGATGAAAAGTTGGGCATGA | (AT)9 | 156–182 | HEX | MF716508 |
| R: CACCGTATCGTGTGGAGATG | |||||
| C55722 | F: CCATCGGCCTCATAAGAAAA | (TA)8 | 206–220 | TAMRA | MF716509 |
| R: GTATGCTCTCCCAGCTCCAC | |||||
| C57707 | F: AGCAGCAAGAGCATTGGAGT | (TC)8 | 225–239 | ROX | MF716510 |
| R: TCATTGTTTCCAACTCTCACAAA | |||||
| C58437 | F: ACCGGTCTACACCATGACCT | (GA)8 | 252–256 | ROX | MF716511 |
| R: CACACAAGGCTTCTTTGCAG | |||||
| C58140 | F: AACACAATCTCGTATACTATCCATCA | (AG)6…(GA)9 | 280–304 | HEX | MF716512 |
| R: GTAAATCTCGGCGTCGGTAA | |||||
| C59012 | F: ATCGTCAACATCGTCGTCAG | (AG)8 | 213–243 | FAM | MF716513 |
| R: AGAGCGAGAAACCTCTTCCC | |||||
| C59078 | F: CCGGCATTAAACACACTCAC | (TA)9 | 166–180 | FAM | MF716514 |
| R: CTACTGCTGCCGTGCATCTA | |||||
| C59155 | F: TGCTTGCTTATTACCCTGCC | (AG)8 | 145–151 | HEX | MF716515 |
| R: AATTGTTGGCGTTGGAAGAC | |||||
| C59702 | F: TTAATCGTGACAGCCAGCAG | (CT)8 | 182–200 | TAMRA | MF716516 |
| R: GAGTCATCAATGCGAGGTGA | |||||
| C63472 | F: ACGTGAAGCATGGTGCAATA | (AT)9 | 206–234 | FAM | MF716517 |
| R: CGGAAGCTTCTACTCGCCTA | |||||
| C65324 | F: GCTCACCCTACCAACGATGT | (GA)9 | 278–286 | ROX | MF716518 |
| R: TCTCCACCGTCAAACCTACC | |||||
| C66329 | F: CAAGGACCCGAATACTCCAA | (AT)9 | 152–170 | HEX | MF716519 |
| R: GATGGAATGGAAAAGGCAGA |
A touchdown PCR program with annealing temperature of 60–50°C was used for all loci.
Polymorphism and transferability assessment
To assess the polymorphism level of these 38 loci, we genotyped 20–24 individuals in each of five populations from three species (Appendix 1). DNA extraction, PCR amplification, and length assessment of PCR products were performed following the procedures described above. Linkage disequilibrium among loci per population and deviation from Hardy–Weinberg equilibrium were tested using FSTAT version 2.9.3 (Goudet, 2001). We used GenAlEx 6.5 (Peakall and Smouse, 2012) to calculate the number of observed alleles per locus (A), expected heterozygosity (He), and observed heterozygosity (Ho).
No significant linkage disequilibrium was detected among loci after Bonferroni correction at α = 0.05 confidence level, and some loci showed significant deviations from Hardy–Weinberg equilibrium (Table 2). The 38 EST-SSRs displayed varied genetic diversity in three populations of P. ovalifolia (Table 2). A, Ho, and He for each locus ranged from one to 19, 0 to 0.938, and 0 to 0.915, respectively (Table 2). Excluding monomorphic loci, the polymorphic EST-SSR markers showed an average A of 5.2, 6.1, and 4.0; He of 0.587, 0.582, and 0.51; and Ho of 0.389, 0.421, and 0.40, in each population, respectively (Table 2). Out of the 38 SSR markers, 36 loci were successfully amplified in P. tardiflora and 31 loci showed polymorphism, with A ranging from two to six (Table 2). Similarly, 34 loci were successfully amplified in P. epilosa Craib, among which 23 loci showed polymorphism, with A ranging from two to six (Table 2). Overall, most of the EST-SSR markers developed for P. ovalifolia could be successfully cross-amplified, leading to a high transferability in the two congeneric species.
Table 2.
Results of initial primer screening in populations of Primula species.a
| P. ovalifolia | P. tardiflora | P. epilosa | |||||||||||||
| OVA_EMS (n = 24) | OVA_HZG (n = 24) | OVA_BSH (n = 20) | TAR_EMS (n = 24) | EPI_PZ (n = 24) | |||||||||||
| Locus | A | Ho | He | A | Ho | He | A | Ho | He | A | Ho | He | A | Ho | He |
| C11339 | 6 | 0.632 | 0.757 | 12 | 0.667 | 0.893 | 7 | 0.900 | 0.813* | 3 | 0.136 | 0.210 | 1 | 0.000 | 0.000 |
| C13959 | 4 | 0.313 | 0.619 | 3 | 0.250 | 0.507 | 3 | 0.056 | 0.517* | 2 | 0.708 | 0.510 | 3 | 0.375 | 0.423 |
| C14309 | 5 | 0.333 | 0.660 | 6 | 0.375 | 0.532 | 2 | 0.529 | 0.389 | 2 | 0.053 | 0.149 | 4 | 0.125 | 0.363* |
| C14710 | 6 | 0.833 | 0.779 | 7 | 0.708 | 0.764 | 8 | 0.857 | 0.847 | 3 | 0.813 | 0.679 | 3 | 0.565 | 0.569 |
| C15228 | 5 | 0.579 | 0.731 | 5 | 0.300 | 0.278 | 3 | 0.300 | 0.296 | — | — | — | 1 | 0.000 | 0.000 |
| C21614 | 3 | 0.231 | 0.495* | 3 | 0.261 | 0.241 | 7 | 0.455 | 0.802 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 |
| C23409 | 1 | 0.000 | 0.000 | 2 | 0.050 | 0.050 | 4 | 0.500 | 0.668 | 2 | 0.200 | 0.287 | 1 | 0.000 | 0.000 |
| C23644 | 5 | 0.286 | 0.741* | 12 | 0.739 | 0.887 | 4 | 0.842 | 0.698 | 3 | 0.667 | 0.519 | 2 | 0.083 | 0.082 |
| C23746 | 1 | 0.000 | 0.000 | 2 | 0.125 | 0.120 | 2 | 0.000 | 0.278* | 2 | 0.125 | 0.120 | 1 | 0.000 | 0.000 |
| C24233 | 2 | 0.000 | 0.359 | 9 | 0.500 | 0.825* | 3 | 0.049 | 0.050 | 2 | 0.375 | 0.311 | 2 | 0.261 | 0.232 |
| C24268 | 10 | 0.500 | 0.870* | 6 | 0.522 | 0.739 | 5 | 0.368 | 0.639* | 6 | 0.429 | 0.606 | 1 | 0.000 | 0.000 |
| C24676 | 3 | 0.087 | 0.405* | 4 | 0.177 | 0.668* | 4 | 0.938 | 0.666* | 2 | 0.208 | 0.191 | 1 | 0.000 | 0.000 |
| C40984 | 5 | 0.217 | 0.648* | 2 | 0.895 | 0.508* | 7 | 0.579 | 0.812* | 6 | 0.333 | 0.559* | 4 | 0.458 | 0.415 |
| C45417 | 11 | 0.435 | 0.825 | 19 | 0.417 | 0.915 | 4 | 0.400 | 0.415* | 6 | 0.250 | 0.509* | 5 | 0.417 | 0.395 |
| C46430 | 6 | 0.600 | 0.717 | 5 | 0.579 | 0.576 | 8 | 0.850 | 0.825 | 3 | 0.059 | 0.269 | 4 | 0.563 | 0.538 |
| C47095 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | — | — | — | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 |
| C48258 | 2 | 0.050 | 0.142 | 4 | 0.750 | 0.645 | 4 | 0.632 | 0.683* | 1 | 0.000 | 0.000 | 4 | 0.652 | 0.654 |
| C48475 | 5 | 0.278 | 0.819* | 6 | 0.565 | 0.503 | — | — | — | 2 | 0.042 | 0.042 | 4 | 0.542 | 0.657 |
| C50127 | 7 | 0.381 | 0.630 | — | — | — | 3 | 0.000 | 0.460* | 3 | 0.750 | 0.573 | 4 | 0.318 | 0.698 |
| C51170 | 6 | 0.750 | 0.761 | 11 | 0.542 | 0.872* | 2 | 0.000 | 0.142* | 3 | 0.476 | 0.441 | — | — | — |
| C53509 | 11 | 0.632 | 0.871 | 6 | 0.263 | 0.713* | 5 | 0.600 | 0.654 | 4 | 0.188 | 0.688* | — | — | — |
| C53824 | 7 | 0.778 | 0.764 | 13 | 0.667 | 0.884 | — | — | — | 5 | 0.304 | 0.442* | 2 | 0.000 | 0.089* |
| C53825 | 1 | 0.000 | 0.000 | 2 | 0.526 | 0.398 | 3 | 0.368 | 0.547 | — | — | — | 2 | 0.375 | 0.311 |
| C53843 | 8 | 0.765 | 0.743 | 10 | 0.870 | 0.876 | 5 | 0.800 | 0.643 | 3 | 0.435 | 0.445 | 5 | 0.539 | 0.634 |
| C53920 | 3 | 0.044 | 0.086* | 2 | 0.117 | 0.156 | 1 | 0.000 | 0.000 | 3 | 0.435 | 0.530 | 2 | 0.042 | 0.042 |
| C53962 | 5 | 0.273 | 0.459 | 4 | 0.368 | 0.647 | 1 | 0.000 | 0.000 | 3 | 0.167 | 0.519* | 2 | 0.046 | 0.206* |
| C55683 | 2 | 0.000 | 0.502 | 9 | 0.478 | 0.857* | 3 | 0.063 | 0.576* | 6 | 0.350 | 0.782* | 4 | 0.154 | 0.665* |
| C55722 | 2 | 0.235 | 0.371 | 4 | 0.364 | 0.444 | 4 | 0.200 | 0.595* | 1 | 0.000 | 0.000 | 6 | 0.667 | 0.660 |
| C57707 | 8 | 0.810 | 0.829 | 8 | 0.609 | 0.837 | 3 | 0.083 | 0.344* | 2 | 0.143 | 0.143 | 3 | 0.208 | 0.196 |
| C58140 | 10 | 0.500 | 0.808* | 9 | 0.500 | 0.825* | 2 | 0.050 | 0.049 | 3 | 0.792 | 0.543* | — | — | — |
| C58437 | 3 | 0.684 | 0.522 | 2 | 0.067 | 0.067 | 2 | 0.600 | 0.495 | 2 | 0.478 | 0.476 | — | — | — |
| C59012 | 2 | 0.053 | 0.053 | 3 | 0.191 | 0.180 | 3 | 0.200 | 0.184 | 3 | 0.762 | 0.638 | 1 | 0.000 | 0.000 |
| C59078 | 2 | 0.263 | 0.309 | — | — | — | 1 | 0.000 | 0.000 | 3 | 0.385 | 0.631 | 2 | 0.048 | 0.048 |
| C59155 | 3 | 0.046 | 0.09* | 4 | 0.235 | 0.713 | 4 | 0.200 | 0.499* | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 |
| C59702 | 6 | 0.563 | 0.794 | 6 | 0.409 | 0.538 | 3 | 0.111 | 0.106 | 4 | 0.200 | 0.407 | 2 | 0.208 | 0.311 |
| C63472 | 4 | 0.154 | 0.542* | 4 | 0.188 | 0.667* | 5 | 0.375 | 0.734* | 2 | 0.300 | 0.262 | 2 | 0.208 | 0.191 |
| C65324 | 4 | 0.250 | 0.673* | — | — | — | 3 | 0.789 | 0.517 | 4 | 0.292 | 0.645* | 5 | 0.478 | 0.728* |
| C66329 | 1 | 0.000 | 0.000 | 3 | 0.042 | 0.451 | 1 | 0.000 | 0.000 | 6 | 0.524 | 0.436 | 1 | 0.000 | 0.000 |
| Meanb | 5.2 | 0.389 | 0.587 | 6.1 | 0.421 | 0.582 | 4.0 | 0.400 | 0.510 | 3.3 | 0.367 | 0.437 | 3.2 | 0.306 | 0.379 |
Note: — = unsuccessful amplification; A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; n = number of individuals sampled.
Locality and voucher information are provided in Appendix 1.
Monomorphic loci are excluded.
Significant deviation from Hardy–Weinberg equilibrium (P < 0.05).
CONCLUSIONS
We developed and characterized 38 EST-SSR markers based on transcriptome sequencing of P. ovalifolia, a widely distributed species of Primula section Petiolares. These markers demonstrated high polymorphism in P. ovalifolia, with A ranging from one to 19, Ho from 0.000 to 0.938, and He from 0.000 to 0.915. Most of the markers could be successfully cross-amplified in congeneric species. These SSR makers are found to be useful tools for investigation of genetic structure and interspecific gene flow in this section.
Appendix 1.
Locality and voucher information for populations of Primula ovalifolia, P. tardiflora, and P. epilosa used in this study. Voucher specimens are deposited at the herbarium of South China Botanical Garden (IBSC), Guangzhou, Guangdong, China.
| Species | Population code | Voucher no. | Location | Geographic coordinates | Altitude (m) | n |
| Primula ovalifolia Franch. | OVA_EMS | YS214 | E’mei, China | 29°32′55″N, 103°21′31″E | 1702 | 24 |
| OVA_HZG | YS524 | E’bian, China | 29°02′42″N, 103°00′29″E | 1793 | 24 | |
| OVA_BSH | YS436 | Pengzhou, China | 31°14′09″N, 103°50′20″E | 1900 | 20 | |
| Primula tardiflora (C. M. Hu) C. M. Hu | TAR_EMS | YS440 | E’mei, China | 29°32′49″N, 103°20′24″E | 2448 | 24 |
| Primula epilosa Craib | EPI_PZ | YS504 | Pengzhou, China | 31°11′32″N, 103°54′45″E | 1300 | 24 |
Note: n = number of individuals sampled.
LITERATURE CITED
- Bickler C., A’Hara S., Cottrell J., Rogers L., Bridle J. 2013. Characterisation of thirteen polymorphic microsatellite markers for cowslip (Primula veris L.) developed using a 454 sequencing approach. Conservation Genetics Resources 5: 1185–1187. [Google Scholar]
- Doyle J. 1991. DNA protocols for plants: CTAB total DNA isolation. In G. M. Hewitt and A. Johnston [eds.], Molecular techniques in taxonomy, 283–293. Springer-Verlag, Berlin, Germany. [Google Scholar]
- Goudet J. 2001. FSTAT (version 2.9.3): A program to estimate and test gene diversities and fixation indices. Institute of Ecology, Lausanne, Switzerland. Website http://www2.unil.ch/popgen/softwares/fstat.htm [accessed 27 November 2017].
- Haas B. J., Papanicolaou A., Yassour M., Grabherr M., Blood P. D., Bowden J., Couger M. B., et al. 2013. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nature Protocols 8: 1494–1512. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hu C. M., Kelso S. 1996. Primulaceae. In Z. Y. Wu and P. H. Raven [eds.], Flora of China, vol. 15. Science Press, Beijing, China, and Missouri Botanical Garden Press, St. Louis, Missouri, USA. [Google Scholar]
- Peakall R., Smouse P. 2012. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research–an update. Bioinformatics (Oxford, England) 28: 2537–2539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pertea G., Huang X., Liang F., Antonescu V., Sultana R., Karamycheva S., Lee Y., et al. 2003. TIGR Gene Indices clustering tools (TGICL): A software system for fast clustering of large EST datasets. Bioinformatics (Oxford, England) 19: 651–652. [DOI] [PubMed] [Google Scholar]
- Rozen S., Skaletsky H. 1999. Primer3 on the WWW for general users and for biologist programmers. In S. Misener and S. A. Krawetz [eds.], Methods in molecular biology, vol. 132: Bioinformatics: Methods and protocols, 365–386. Humana Press, Totowa, New Jersey, USA. [DOI] [PubMed] [Google Scholar]
- Schuelke M. 2000. An economic method for the fluorescent labeling of PCR fragments. Nature Biotechnology 18: 233–234. [DOI] [PubMed] [Google Scholar]
- Thiel T., Michalek W., Varshney R., Graner A. 2003. Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theoretical and Applied Genetics 106: 411–422. [DOI] [PubMed] [Google Scholar]
- Ueno S., Yoshida Y., Taguchi Y., Ujino-Ihara T., Kitamoto N., Honjo M., Ohsawa R., et al. 2011. Generation of expressed sequence tags, development of microsatellite and single nucleotide polymorphism markers in Primula sieboldii E. Morren (Primulaceae) for analysis of genetic diversity in natural and horticultural populations. Breeding Science 61: 234–243. [Google Scholar]
- Van G. A., Van R. F., Stiers I., Sierens T., Barker J., Triest L. 2006. Isolation and characterization of microsatellite loci in primrose (Primula vulgaris). Belgian Journal of Botany 139: 261–264. [Google Scholar]
- Xie X. F., Yan H. F., Wang F. Y., Ge X. J., Hu C. M., Hao G. 2012. Chloroplast DNA phylogeography of Primula ovalifolia in central and adjacent southwestern China: Past gradual expansion and geographical isolation. Journal of Systematics and Evolution 50: 284–294. [Google Scholar]
- Yan H., Ge X., Hu C. M., Hao G. 2010. Isolation and characterization of microsatellite loci for the ornamental plant Primula obconica Hance (Primulaceae). HortScience 45: 314–315. [Google Scholar]
- Zhang L., Yan H. F., Wu W., Yu H., Ge X. J. 2013. Comparative transcriptome analysis and marker development of two closely related Primrose species (Primula poissonii and Primula wilsonii). BMC Genomics 14: 329. [DOI] [PMC free article] [PubMed] [Google Scholar]