Oxidative stress-induced miR-27a targets the redox gene Nrf2 in diabetic embryopathy

Abstract

Background

Maternal diabetes induces neural tube defects (NTDs), and oxidative stress is a causal factor for maternal diabetes-induces NTDs. The redox gene Nrf2 (nuclear factor-erythroid 2-related factor 2) is the master regulator of the cellular antioxidant system.

Objective

In the present study, we aimed to determine whether maternal diabetes inhibits Nrf2 expression and Nrf2-controlled antioxidant genes through the redox-sensitive miR-27a.

Study design

We used a well-established type 1 diabetic embryopathy mouse model induced by streptozotocin for our in vivo studies. Embryos at E8.5 were harvested for analysis of Nrf2, Nrf2-controlled antioxidant genes and miR-27a expression. To determine if mitigating oxidative stress inhibits the increase of miR-27a and the decrease of Nrf2 expression, we induced diabetic embryopathy in SOD2 (mitochondrial-associated antioxidant gene)-overexpressing mice. This model exhibits reduced mitochondria reactive oxygen species even in the presence of hyperglycemia. To investigate the causal relationship between miR-27a and Nrf2 in vitro, we examined C17.2 neural stem cells under normal and high glucose conditions.

Results

We observed that the mRNA and protein levels of Nrf2 were significantly decreased in E8.5 embryos from diabetic dams compared to those from nondiabetic dams. High glucose also significantly decreased Nrf2 expression in a dose- and time-dependent manner in cultured neural stem cells. Our data revealed that miR-27a was up-regulated in E8.5 embryos exposed to diabetes, and that high glucose increased miR-27a levels in a dose- and time-dependent manner in cultured neural stem cells. In addition, we found that a miR-27a inhibitor abrogated the inhibitory effect of high glucose on Nrf2 expression, and a miR-27a mimic suppressed Nrf2 expression in cultured neural stem cells. Furthermore, our data indicated that the Nrf2-controlled antioxidant enzymes glutamate-cysteine ligase catalytic subunit (GCLC), glutamate-cyteine ligase modifier subunit (GLCM), and glutathione S-transferase A1 (GSTA1) were downregulated by maternal diabetes in E8.5 embryos and high glucose in cultured neural stem cells. Inhibiting miR-27a restored expression of GCLC, GLCM and GSTA1. Overexpressing SOD2 reversed the maternal diabetes-induced increase of miR-27a and suppression of Nrf2 and Nrf2-controlled antioxidant enzymes.

Conclusions

Our study demonstrates that maternal diabetes-induced oxidative stress increases miR-27a, which, in turn, suppresses Nrf2 and its responsive antioxidant enzymes, resulting in diabetic embryopathy.

Introduction

It has been well established that maternal diabetes increases the risk of neural tube defects (NTDs) in offspring^1–11. The clinical data show that approximate 8,000 babies born each year in the United States have birth defects in type 1 or 2 diabetic pregnancies^11–13. Data from the National Birth Defects Prevention Study shows that the incidence for newborn NTDs are up to 10 times more frequent in women with pregestational diabetes compared to women who never had diabetes or who developed diabetes late in pregnancy (such as gestational diabetes mellitus)¹⁴. Maternal diabetes-induced hyperglycemia in the developing embryo has been identified as an adverse factor that impacts embryogenesis and leads to NTD formation^{1, 2, 5–7}. Although evidence from clinical and experimental studies supports the theory that hyperglycemia enhances the generation of reactive oxygen species (ROS) and oxidative stress in developing embryos^{7, 11}, the precise steps by which this occurs are still not fully understood.

Nuclear factor erythroid 2-related factor 2 (Nrf2) is a redox sensitive transcription factor and one of the most important cellular defense mechanisms for combating oxidative stress through its ability to regulate phase II detoxifying enzymes and antioxidant proteins^{15, 16}. Many endogenous enzymes that catalyze antioxidant reactions are under the control of Nrf2, including heme oxygenase-1 (HO-1), NAD(P)H dehydrogenase (quinone) 1 (NQO-1), glutathione peroxidase-1 (GPx-1), glutamate-cysteine ligase modifier subunit (GLCM), glutamate-cysteine ligase catalytic subunit (GCLC), and glutathione S-transferase A1 (GSTA1)¹⁷. Inhibiting Nrf2 is associated with a reduction of the antioxidant ability of the cell¹⁵. Dysregulation of Nrf2 has been involved in many diseases, including alcoholic liver disease, cancer, chronic obstructive pulmonary disease, and neurodegenerative diseases¹⁵. It has been shown that suppression of Nrf2 activity leads to oxidative stress-induced insulin resistance in adult cardiomyocytes in the diabetic heart¹⁸. Therefore, we wanted to investigate whether inhibition of Nrf2 by maternal diabetes leads to an abundance of ROS and oxidative stress in the developing embryo.

Regulation of Nrf2 can be divided into Kelch-like ECH-associated protein 1 (Keap1)-dependent and Keap1-independent mechanisms¹⁹. In normal conditions, the Nrf2 protein level in the cell is maintained at a low level to prevent constitutive activation of the oxidative stress response by its inhibitor Keap1, which sequesters Nrf2 in the cytosol and facilitates its degradation through the proteasome¹⁹. Under stressed conditions, the cysteine residues in Keap1 are modified. These modifications lead to a conformational change of Keap1 and result in the release of Nrf2 and disturbed transfer of ubiquitin to Nrf2, ultimately preventing Nrf2 degradation¹⁹. Despite the above-mentioned regulation of Nrf2 via Keap1, emerging evidence demonstrates that Nrf2 can be regulated independently of Keap1^{19, 20}. The emerging evidence shows that some miRNAs have been shown to be involved in the regulation of Nrf2, including miR-28, -34, -200, and -144²⁰.

In the present study, we observed that miR-27a can regulate Nrf2 expression at the post-transcriptional level and plays a critical role in diabetic embryopathy. Hyperglycemia-increased miR-27a directly affects Nrf2 mRNA stability and results in decreased Nrf2 protein levels, as well as decreased levels of Nrf2-regulated antioxidant genes, including GLCM, GCLC, and GSTA1. Our data reveal a new mechanism by which maternal diabetes induces oxidative stress via the miR-27a-Nrf2 pathway in the developing embryo.

Because oxidative stress is the causal factor for maternal diabetes-induced NTDs^{7, 11}, revealing the role of Nrf2 in diabetic embryopathy will possibly lead to the discovery of new and novel therapeutics for the treatment of this disease. Clinical trials have shown disappointing results in the use of general antioxidants in treating diabetic complications²¹. Nrf2 is the master regulator of redox homeostasis, and several Nrf2 activators have displayed their potential to activate the Nrf2 pathway and reduce oxidative stress in diabetic complications^{21, 22}. Our study will provide the mechanistic basis for the use of Nrf2 activators as an alternative for the treatment of maternal diabetes-induced NTDs.

Methods and materials

Study design

We used the well-established type 1 diabetic embryopathy mouse model induced by streptozotocin for in vivo studies. Embryos at E8.5 were harvested for analysis of Nrf2, Nrf2-controlled antioxidant genes and miR-27a expression. To determine if mitigating oxidative stress inhibits the increase of miR-27a and the decrease of Nrf2 expression by maternal diabetes, we induced diabetic embryopathy in SOD2 (mitochondrial-associated antioxidant gene)-overexpressing mice. This model exhibits reduced mitochondrial reactive oxygen species (ROS) in the presence of hyperglycemia²³. To investigate the relationship between miR-27a and Nrf2 in vitro, we examined C17.2 neural stem cells under normal and high glucose conditions.

Animals

All procedures for animal use were approved by the Institutional Animal Care and Use Committee of University of Maryland School of Medicine. Wild-type (WT) C57BL/6J mice were purchased from the Jackson Laboratory (Bar Harbor, ME). SOD2 transgenic (SOD2-Tg) mice, which overexpress human mitochondrial SOD2 under the β-actin promoter, were obtained from Dr. Robia Pautler at Baylor College of Medicine²⁴.

Model of diabetic embryopathy and morphological assessment of NTDs

We^{8, 10, 25–29} and others^30–32 have used a rodent model of streptozotocin (STZ)-induced diabetes to study diabetic embryopathy. Briefly, ten-week-old WT female mice were intravenously injected daily with 75 mg/kg streptozotocin for two days to induce diabetes. Streptozotocin from Sigma (St. Louis, MO) was dissolved in 0.1 M citrate buffer (pH 4.5). We used a U-100 insulin syringe (Becton Dickinson, Franklin Lakes, NJ) with 281/2-G needles for injections. Approximately 140 μl of STZ solution was injected per mouse. Diabetes was defined as a 12-hour fasting blood glucose level of ≥ 16.7 mM. Male and female mice were paired at 3:00 P.M., and day 0.5 (E0.5) of pregnancy was established at noon on the day that a vaginal plug was present. Embryos were harvested at embryonic day (E) E8.5 (2:00 PM at E8.5) for biochemical and molecular analyses.

Cell culture and treatment

C17.2 mouse neural stem cells (European Collection of Cell Culture, UK) were maintained in DMEM (5 mM glucose) supplemented with 10% fetal bovine serum, 100 U/ml penicillin and 100 μg/ml streptomycin at 37°C in a humidified atmosphere of 5% CO₂. C17.2 cells are newborn mouse cerebellar progenitor cells transformed with retroviral v-myc³³. Lipofectamine 2000 (Invitrogen, Carlsbad, CA) was used according to the manufacturer’s protocol for the transfection of miR-27a mimic or inhibitor (Thermo Scientific, Waltham, MA). To investigate the possible effect of miR-27a on Nrf2 and its target gene expression, miR-27a inhibitor or mimic was transfected for 48 hours with or without high glucose (25 mM), and then, cells were harvested for subsequent analysis.

Immunoblotting

Equal amounts of protein (30 or 50 μg) from cultured cells and embryos were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto Immunobilon-P membranes (Millipore, Billerica, MA). Membranes were incubated in 5% nonfat milk for 1 hour, and then incubated for 18 hours at 4°C with Nrf2 primary antibodies (Cell Signaling Technology, Danvers, MA) at dilutions of 1:1000 in 5% nonfat milk. Membranes were then exposed to goat anti-rabbit secondary antibodies. To ensure that equivalent amounts of protein were loaded, membranes were stripped and probed with a mouse antibody against β-actin (1:5000; Abcam, Cambridge, UK). Signals were detected using the SuperSignal West Femto Maximum Sensitivity Substrate kit (Thermo Scientific, Waltham, MA). Quantification of blots was performed using VisionWorksLS software (UVP Company, Upland, CA). All experiments were repeated in triplicate.

RNA extraction and real-time quantitative PCR (RT-qPCR)

Total RNA was isolated from cells using Trizol reagent (Thermo Scientific, Waltham, MA) and reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany) for mRNA. Reverse transcription of miRNA was performed using a qScript microRNA cDNA Synthesis Kit (Quanta Biosciences, Gaithersburg, MD). RT-qPCR for Nrf2, GCLC, GLCM, GSTA1, β-actin, miR-27a and small nuclear RNA U6 was performed using the Maxima SYBR Green/ROX qPCR Master Mix assay (Thermo Scientific, Waltham, MA). The primers for RT-qPCR are listed in Table 1. RT-qPCR and subsequent calculations were performed by a StepOnePlus™ Real-Time PCR System (Applied Biosystems, Foster City, CA).

Table 1.

Primer sequences used in RT-qPCR.

Primer name	Primer source	Primer sequence
Nrf2 F	PrimerBank	5′TAGATGACCATGAGTCGCTTGC3′
Nrf2 R	PrimerBank	5′GCCAAACTTGCTCCATGTCC3′
GSTA1 F	PrimerBank	5′AAGCCCGTGCTTCACTACTTC3′
GSTA1 R	PrimerBank	5′GGGCACTTGGTCAAACATCAAA3′
GCLC F	PrimerBank	5′GGGGTGACGAGGTGGAGTA3′
GCLC R	PrimerBank	5′GTTGGGGTTTGTCCTCTCCC3′
GLCM F	PrimerBank	5′AGGAGCTTCGGGACTGTATCC3′
GLCM R	PrimerBank	5′GGGACATGGTGCATTCCAAAA3′
mmu - miR - 27a - 3p	Designed by ourselves	5′TTCACAGTGGCTAAGTTCCGC3′
U6 F	Designed by ourselves	5′CTCGCTTCGGCAGCACA3′
U6 R	Designed by ourselves	5′AACGCTTCACGAATTTGCGT3′
β-actin F	Designed by ourselves	5′GTGACGTTGACATCCGTAAAGA3′
β-actin R	Designed by ourselves	5′ GCCGGACTCATCGTACTCC3′
Universal primer for miRNA	From Kit	Request from Life technologies

F: forward; R: reverse; mmu: murine.

Statistical analyses

All experiments were repeated in triplicate. Data are presented as the means ± standard errors (SE). Student’s t-test was used for comparisons between two groups. One-way or two-way ANOVA was performed for more than two group comparisons using the SigmaPlot 12.5 software (SigmaStat). In ANOVA analysis, Tukey’s test was used to estimate significance. Statistical significance was indicated when P < 0.05.

Results

Maternal diabetes in vivo or high glucose in vitro decreases Nrf2 expression

To investigate the possible role of Nrf2 in diabetic embryopathy, we measured Nrf2 expression in the developing embryo. Maternal diabetes significantly decreased Nrf2 mRNA and protein levels in the developing embryo (E8.5) (Fig. 1A and B). To identify the role of fetal hyperglycemia in the suppression of Nrf2, C17.2 neural stem cells were treated with normal (5 mM) or high (16.7, 25, 33.3 mM) glucose, and then, Nrf2 expression was determined. Our experiments confirmed that inhibition of Nrf2 expression resulted from fetal hyperglycemia because high glucose inhibited Nrf2 mRNA and protein levels in a dose- and time-dependent manner (Fig. 1 C–F). Mannitol was used for the osmotic control of glucose. High mannitol concentrations did not affect Nrf2 expression (Fig. 1G and H).

Figure 1. Maternal diabetes in vivo or high glucose in vitro decreases Nrf2 expression.

A. Nrf2 mRNA levels in E8.5 embryos assessed by RT-qPCR. B. Nrf2 protein levels in E8.5 embryos assessed by Western blot. C. Nrf2 mRNA levels in C17.2 cells treated with normal (5 mM) or high (16.7, 25, 33.3 mM) glucose for 48 h, assessed by RT-qPCR. D. Nrf2 protein levels in C17.2 cells treated with normal (5 mM) or high (16.7, 25, 33.3 mM) glucose for 48 h, assessed by Western blot. E. Nrf2 mRNA levels in C17.2 cells treated with normal (5 mM) or high (25 mM) glucose for 24 h, 48 h, and 72 h, assessed by RT-qPCR. F. Nrf2 protein levels in C17.2 cells treated with normal (5 mM) or high (25 mM) glucose for 24 h, 48 h, and 72 h, assessed by Western blot. G. Nrf2 mRNA levels in C17.2 cells treated with normal glucose (5 mM) or high mannitol (11.7, 20, 28.3 mM) for 48 h, assessed by RT-qPCR. H. Nrf2 protein levels in C17.2 cells treated with normal glucose (5 mM) or high mannitol (11.7, 20, 28.3 mM), assessed by Western blot. Experiments were repeated using 3 embryos (N =3) from different dams. Experiments were repeated three times. Bar graphs for protein levels show quantitative data from three independent experiments. ND: nondiabetic dams; DM: diabetic dams; G: glucose. * indicates significant difference (P < 0.05) compared with other groups.

Maternal diabetes in vivo or high glucose in vitro increases miR-27a expression

To search for possible miRNAs that may regulate Nrf2 expression, the miRNA target gene prediction tool miRanda (http://www.microrna.org) was used. The prediction showed that miR-27a is a potential regulator of Nrf2 through imperfect complementation with Nrf2 mRNA in the 3′UTR region (Fig. 2A). Next, we examined whether maternal diabetes in vivo or high glucose in vitro affected expression of miR-27a. Maternal diabetes significantly upregulated expression of miR-27a in the developing embryo (E8.5) (Fig. 2B). At the same time, high glucose also significantly increased miR-27a expression in a dose- and time-dependent manner in cultured C17.2 neural stem cells (Fig. 2C and D). High mannitol concentrations did not affect miR-27a expression (Fig. 2E).

Figure 2. Maternal diabetes in vivo or high glucose in vitro decreases miR-27a expression.

A. Schematic representation of the Nrf2 mRNA depicting the binding site for miR-27a in its 3′-UTR. CR: coding region; BS: binding site; UTR: untranslated region. B. miR-27a levels in E8.5 embryos assessed by RT-qPCR. C. miR-27a levels in C17.2 cells treated with normal (5 mM) or high (16.7, 25, 33.3 mM) glucose for 48 h, assessed by RT-qPCR. D. miR-27a levels in C17.2 cells treated with normal (5 mM) or high (25 mM) glucose for 24 h, 48 h, and 72 h, assessed by RT-qPCR. E. miR-27a levels in C17.2 cells treated with normal glucose (5 mM) or high mannitol (11.7, 20, 28.3 mM) for 48 h, assessed by RT-qPCR. Experiments were repeated using 3 embryos (N =3) from different dams. Experiments were repeated three times. ND: nondiabetic dams; DM: diabetic dams. * indicates significant difference (P < 0.05) compared with other groups.

Nrf2 is the target gene of miR-27a

To determine if miR-27a plays a role in the suppression of Nrf2 by maternal diabetes or high glucose, we used a miR-27a inhibitor or mimic to manipulate the levels of miR-27a in neural stem cells. High glucose (25 mM) increased miR-27a expression and decreased Nrf2 mRNA levels, whereas transfection of miR-27a inhibitor blocked high glucose-increased miR-27a expression and restored high glucose-suppressed Nrf2 mRNA levels in C17.2 neural stem cells (Fig. 3A and B). Moreover, miR-27a inhibitor reversed high glucose-blocked Nrf2 protein levels in C17.2 neural stem cells (Fig. 3C). In addition, transfection of miR-27a mimic increased miR-27a expression and decreased Nrf2 mRNA and protein levels in C17.2 neural stem cells (Fig. 3D–F). Thus, in vitro experiments support the conclusion that high glucose suppressed Nrf2 expression through miR-27a in neural stem cells.

Figure 3. High glucose-increased miR-27a suppresses Nrf2 expression.

A. miR-27a levels in C17.2 cells treated with normal (5 mM) or high (25 mM) glucose combined with miR-27a inhibitor for 48 h. B. Nrf2 mRNA levels in C17.2 cells treated with normal (5 mM) or high (25 mM) glucose, combined with miR-27a inhibitor for 48 h. C. Nrf2 protein levels in C17.2 cells treated with normal (5 mM) or high (25 mM) glucose, combined with miR-27a inhibitor for 48 h. D. miR-27a levels in C17.2 cells transfected with miR-27a mimic for 48 h. E. Nrf2 mRNA levels in C17.2 cells transfected with miR-27a mimic for 48 h. F. Nrf2 protein levels in C17.2 cells transfected with miR-27a mimic for 48 h. Experiments were repeated three times. Bar graphs for protein levels show quantitative data from three independent experiments. * indicates a significant difference (P < 0.05) compared with other groups. # indicates significant difference (P < 0.05) compared to control group.

The miR-27a-Nrf2 circuit suppresses the expression of Nrf2 responsive genes

Many genes are controlled by Nrf2¹⁷. In this study, we surveyed these genes and found that three genes (GSTA1, GCLC and GLCM) were inhibited by maternal diabetes in the developing embryo (E8.5) (Fig. 4A). At the same time, high glucose inhibited GSTA1, GCLC and GLCM in a dose-dependent manner in C17.2 neural stem cells (Fig. 4B). Because we demonstrated that miR-27a mediates high glucose-suppressed Nrf2 expression, we tested whether miR-27a mediates high glucose-inhibited Nrf2-controlled gene expression. Indeed, transfection of miR-27a inhibitor significantly restored high glucose-suppressed GSTA1, GCLC and GLCM expression in C17.2 neural stem cells (Fig. 4C). Therefore, our data indicate that miR-27a mediates high glucose-inhibited Nrf2-controlled gene expression in neural stem cells.

Figure 4. High glucose inhibits Nrf2-controlled gene expression through miR-27a.

A. mRNA levels of GSTA1, GCLC, and GLCM in E8.5 embryos, assessed by RT-qPCR. B. mRNA levels of GSTA1, GCLC, and GLCM in C17.2 cells treated with normal (5 mM) or high (16.7, 25, 33.3 mM) glucose for 48 h, assessed by RT-qPCR. C. mRNA levels of GSTA1, GCLC, and GLCM in C17.2 cells treated with normal (5 mM) or high (25 mM) glucose, combined with miR-27a inhibitor, for 48 h, assessed by RT-qPCR. Experiments were repeated three times. ND: nondiabetic dams; DM: diabetic dams. * indicates a significant difference (P < 0.05) compared with other groups.

Oxidative stress contributes to the increase of miR-27a and inhibition of Nrf2 expression in diabetic pregnancy

It has been demonstrated that maternal diabetes impairs mitochondrial function by triggering electron leakage and causing ROS production^{8, 23, 34, 35}. Theoretically, Nrf2, as a sensor of ROS, should be increased and promote the expression of antioxidant genes under diabetic conditions. However, Nrf2 does not respond to oxidative stress under hyperglycemic conditions. Therefore, we hypothesized that maternal diabetes causes long-term oxidative stress that may inhibit Nrf2 expression according to an epigenetic mechanism. In the present study, we identified miR-27a as an epigenetic factor that affects Nrf2 expression, as well as its downstream genes. Our previous data demonstrated that overexpression of superoxide dismutase 2 (SOD2), a mitochondrial-located antioxidant gene, blocks maternal diabetes-induced oxidative stress and significantly reduces the incidence of maternal diabetes-induced NTD formation from 25% to 4%²³. It is possible that elimination of mitochondrial-generated ROS may reactivate Nrf2 and its downstream genes through the epigenetic factor miR-27a. Our data demonstrates that overexpression of SOD2 blocks the increase of miR-27a by maternal diabetes (Fig. 5A), as well as restores Nrf2 mRNA expression (Fig. 5B) and protein levels (Fig. 5C) in the developing embryo (E8.5), indicating that mitochondrial-generated ROS results in an increase of miR-27a and inhibition of Nrf2. Furthermore, overexpression of SOD2 also restores expression of GSTA1, GCLC and GLCM in the developing embryo (Fig. 5D). Thus, our data indicate that mitochondrial-generated ROS worsens oxidative stress in diabetic embryos through miR-27a-mediated inhibition of Nrf2 expression.

Figure 5. Mitochondrial dysfunction contributes to the increase of miR-27a and the inhibition of Nrf2 expression.

A. miR-27a levels in E8.5 embryos assessed by RT-qPCR. B. Nrf2 mRNA levels in E8.5 embryos assessed by RT-qPCR. C. Nrf2 and SOD2 protein levels in E8.5 embryos assessed by Western blot. D. mRNA levels of GSTA1, GCLC, and GLCM in E8.5 embryos assessed by RT-qPCR. Experiments were repeated using 3 embryos (N =3) from different dams. Experiments were repeated three times. Bar graphs for protein levels show quantitative data from three independent experiments. ND: nondiabetic dams; DM: diabetic dams; WT: wild type; TG: SOD2 transgenic mice. * indicates significant difference (P < 0.05) compared with other groups.

Comment

In the present study, we elucidate a mechanism by which maternal diabetes induces oxidative stress in the developing embryo, thereby causing NTDs. We observed that hyperglycemia in vivo and high glucose in vivo increases expression of the epigenetic factor miR-27a. MiR27a inhibits expression of Nrf2, a major cellular defense transcription factor, and suppresses the overall antioxidant capability of cells. Our results reveal a novel pathway that regulates the cellular redox balance in maternal diabetes-induced embryopathy. We also demonstrated that maternal diabetes inhibits expression of three antioxidant enzymes, GSTA1, GCLC and GLCM, via the miR-27a-Nrf2 pathway to trigger excessive ROS production in the developing embryo.

Nrf2 is subject to complex regulatory mechanisms at both the transcriptional and posttranscriptional levels^{15–17, 19, 20}. The Nrf2 promoter contains two ARE-like sequences that regulate its expression at the transcriptional level³⁶, and Nrf2 protein stability is controlled by Keap1, β-TrCP, and GSK3 at the posttranscriptional level¹⁷. In addition, new evidence has demonstrated that Nrf2 mRNA is regulated by various miRNAs²⁰. Eighty-five miRNAs have been predicted to bind to Nrf2 mRNA to downregulate its translation³⁷. Several miRNAs have been shown to directly bind to the 3′UTR of mRNA, including miR-153, -27a, miR-142, and miR-144 in neuronal SH-SY5Y cells³⁸; miR-144 in lymphoblast K562 cells, primary human erythroid progenitor cells, and reticulocytes³⁹; miR-28 in human mammary epithelial cells and breast cancer MCF-7 cells⁴⁰; and miR-34a in human embryonic kidney HEK293 cells⁴¹, have been shown to directly bind to the 3′UTR of mRNA. In addition to the direct downregulation of Nrf2 by miRNAs, miR-200a can target Nrf2 inhibitor Keap1 to affect Nrf2 levels⁴². Here, we reveal that miR-27a in neuroepithelial cells is increased by maternal diabetes, where it then suppresses Nrf2 expression and contributes to the overproduction of ROS and oxidative stress in the developing embryo.

Mitochondrial damage is thought to be the main source of ROS production observed in various diseases⁴³. Previous studies have demonstrated that developing embryos exposed to hyperglycemia caused by maternal diabetes exhibit morphological damage to mitochondria and long-term excessive ROS production^{8, 34, 35}. We have also shown that repairing mitochondria damaged by high glucose, through overexpression of SOD2, alleviates oxidative stress, indicating that mitochondria are the source of ROS production in diabetic embryopathy²³. In this study, we found that maternal diabetes inhibits Nrf2, which should be activated in response to oxidative stress induced by hyperglycemia, by increasing the expression of miR27a. We also found that overexpressing SOD2 in diabetic embryos reduces miR-27a expression and restores Nrf2 expression, compared to the diabetic WT groups. This means that oxidative stress itself results in inhibition of Nrf2 expression through oxidative stress-sensitive miR-27a. We hypothesize that acute oxidative stress may increase Nrf2 expression, thereby eliminating ROS production, but that the long-term oxidative stress caused by maternal diabetes cannot stimulate Nrf2 expression and enhances ROS production in embryos.

Dysregulation of Nrf2 has been shown to be involved in the etiology of diabetes, such as pancreatic islet beta cell dysfunction⁴⁴ and insulin resistance^{18, 44}, and its complications, including cardiomyopathy^44–46, nephropathy^{44, 45, 47}, retinopathy⁴⁸ and atherosclerosis⁴⁹. Emerging evidence suggests that the dysregulation of Nrf2 caused by maternal diabetes impairs embryogenesis and placenta development. It has been demonstrated that gestational diabetes impairs Nrf2-mediated adaptive antioxidant defenses and redox signaling in fetal endothelial cells in utero⁵⁰. Insufficient activation of Nrf2 contributes to maternal diabetes-induced renal dysmorphogenesis by increasing renal ROS production in the offspring⁵¹. In addition, Nrf2 signaling is involved in maternal diabetes-induced defects in the development of the mouse placenta⁵². Prepregnancy maternal diabetes combined with obesity impairs placental mitochondrial function, increases oxidative stress of the placenta induced by the Nrf2 pathway and detrimentally alters the metabolism of offspring⁵³. Our data further demonstrate that maternal diabetes-induced oxidative stress results from inhibition of Nrf2 by the epigenetic factor miR-27a in the developing embryo.

Nrf2 regulates the cellular redox balance by controlling expression of antioxidant enzymes¹⁷. In the present study, we observed that maternal diabetes suppresses three Nrf2-controlled genes, GSTA1, GCLC and GLCM. GCLC and GLCM are used to synthesize cellular antioxidant glutathione¹⁷. Glutathione is a tripeptide antioxidant that directly scavenges ROS within the cell by donating an electron from two molecules of reduced glutathione (GSH), followed by GSH oxidation to oxidized glutathione (GSSG)¹⁷. It has been reported that hyperglycemia in vivo or high glucose in vitro lead to decreased concentrations of GSH as well as decreased activity of the rate-limiting GSH-synthesizing enzyme γ-glutamylcysteine synthetase (γ-GCS) in the embryonic tissues of diabetic pregnancy or cultured embryos^{54, 55}. Our data demonstrate that suppression of GCLC and GLCM by maternal diabetes also contributes to the depletion of glutathione in diabetic embryos. GSTA1 is major phase II detoxification enzyme¹⁷. In addition to this function, GSTA1 has glutathione peroxidase activity, which uses GSH to reduce H₂O₂¹⁷. Previous studies showed that excessive H₂O₂ accumulation in diabetic embryos may result from the inhibition of GSTA1⁵⁶.

Clinical significance and study limitations

Experiments in animal models have clearly shown that oxidative stress is responsible for maternal diabetes-induced NTDs^{1, 7, 11, 56–61} and congenital heart defects^{62, 63}, and clinical research has demonstrated that oxidative stress is involved in various adverse pregnancy outcomes^{64, 65}. For example, oxidative stress induced by tobacco smoke is associated with preterm delivery, intrauterine growth restriction, stillbirth, low birth weight, aberrant placental metabolism, syncytial knot formation, and multiple markers of oxidative damage^{66, 67}. A case-control study showed that maternal oxidative stress may be an important contributor to preterm birth, regardless of subtype and timing of exposure during pregnancy⁶⁸. Another study has shown that oxidative stress markers are found repeatedly in preeclamptic pregnancies, compared with normotensive pregnancies^{69, 70}. Although two studies have reported that Nrf2 dysregulation in deciduas or placentas from preeclamptic patients^{71, 72}, it is still unclear whether impaired Nrf2 function contributes to adverse pregnancy outcomes in various maternal conditions^73–77, Therefore, further work is needed to determine the potential involvement of the Nrf2 signaling pathway in the induction of adverse pregnancy outcomes.

Based on the importance of Nrf2 in the antioxidant system of the cell, as well as its association with the etiology of diabetic complications, many Nrf2 activators are being developed as therapeutic agents^{44–46, 78}. For example, the Nrf2 activators sulforaphane and cinnamic aldehyde have been shown to significantly attenuate diabetes-associated metabolic disorders and relieve renal damage in mice⁷⁹. Another study has revealed that the Nrf2 inducer MG132 can reduce diabetic kidney disease in mice⁸⁰. A previous study from our laboratory revealed that the Nrf2 activator vinylsulfone reduces high glucose-induced neural tube defects by suppressing cellular stress and apoptosis in cultured mouse embryo⁸¹. Taken together, these data indicate that Nrf2 could be a therapeutic target for treating maternal diabetes-associated birth defects.

The limitation of this study is that all data were obtained from animal models. Due to the ethics of research, human fetal samples are difficult to obtain for experiments. Translational studies using nonhuman primates may be carried out in the near future. Future studies may assess the therapeutic effect of Nrf2 activators on maternal diabetes-induced NTDs in rodent and nonhuman primates model. Vinylsulfone, one of the Nrf2 activators that possess the beneficial effect on preventing hyperglycemia-induced NTDs in cultured mouse embryos⁸¹, could be a good candidate in our future studies.

Conclusions

Our study reveals that maternal diabetes induces oxidative stress in the developing embryo through increasing miR-27a expression and suppressing Nrf2. miR27a inhibits Nrf2 expression, leading to the repression of Nrf2-controlled antioxidant genes GSTA1, GCLC, and GLCM. These data suggest that Nrf2 activators could be therapeutically effective in treating maternal diabetes-induced structural birth defects.

Glossary of Terms

Diabetic embryopathy

Embryonic developmental deficiency in prenatal or postnatal fetus caused by maternal diabetes during pregnancy

Neural tube defects (NTDs)

Congenital abnormalities in the structure where brain and spinal cord form during embryonic development

Redox

A chemical reaction in which the oxidation states of atoms are changed. Within cell, molecules which the electron is added are defined to be reduced, while molecules which the electron is stripped are defined to be oxidized. Redox is used to describe the status or homeostasis between oxidation and reduction among molecules

Nuclear factor erythroid 2-related factor 2 (Nrf2)

A redox sensitive transcription factor and one of the most important cellular defense mechanisms for combatting oxidative stress through its ability to regulate phase II detoxifying enzymes and antioxidant proteins

MiRNA

A small noncoding RNA which can target specific mRNA by complementary binding and lead to the degradation of such mRNA or inhibition of translation

Glutathione S-transferase A1 (GSTA1)

A major phase II detoxification enzyme and also displays glutathione peroxidase activity

Glutamate-cysteine ligase catalytic subunit (GCLC)

Catalytic subunit of the enzyme responsible for the rate-limiting step in synthesis of the cellular antioxidant glutathione

Glutamate-cysteine ligase modifier subunit (GLCM)

Modifier subunit of the enzyme responsible for the rate-limiting step in synthesis of the cellular antioxidant glutathione