Abstract
Helicobacter pylori, which is involved in the pathogenesis of gastroduodenal disease, produces CagA and VacA as major virulence factors. CagA is classified into East Asian and Western types based on the number and sequences of its Glu-Pro-Ile-Tyr-Ala motifs. The vacA gene has three polymorphic regions: the signal (s), intermediate (i), and middle (m) regions. The lowest gastric cancer mortality rate is seen in Okinawa. On the Japanese mainland (Honshu), most H. pylori produce s1/m1-VacA, which exhibits strong toxicity, and East Asian-type CagA. However, the H. pylori detected in Okinawa produces s1/m2-VacA, which exhibits weak toxicity, or s2/m2-VacA, which is non-toxic, and Western-type CagA. Studies about the i-region of vacA have been performed around the world, but there have been few such studies in Japan. Therefore, the aim of this study was to assess the relationships between the clinical outcomes of H. pylori infections in Okinawa, vacA (especially the i-region genotype), and cagA. H. pylori strains that were collected from patients with gastric cancer or gastric ulcers in Okinawa only produced the i1-type VacA virulence factor. The vacuolating cytotoxin activity of i1-type VacA was stronger than that of i2-type VacA, suggesting that the i-region genotype of vacA is closely associated with vacuolating cytotoxin activity. These results indicate that the i-region genotype of vacA is a useful marker of both H. pylori virulence and the clinical outcomes of H. pylori infections in Okinawa, Japan.
Keywords: Helicobacter pylori, CagA, VacA, Okinawa
INTRODUCTION
Helicobacter pylori, which was discovered in 1983, is involved in the pathogenesis of various digestive diseases, such as gastritis, peptic ulcers, mucosa-associated lymphoid tissue lymphoma, and gastric cancer (GC). H. pylori produces multiple virulence factors, with the major ones being CagA and VacA. The cagA gene is one of the genes found in the cag pathogenesis island (cagPAI), and CagA is directly injected into epithelial cells via the bacterial type IV secretion system and then undergoes tyrosine phosphorylation. CagA contains Glu-Pro-Ile-Tyr-Ala (EPIYA) motifs, which repeat several times in the C-terminal region (1,2), and the tyrosine phosphorylation of CagA occurs at the EPIYA motifs (3–5). CagA is classified into the East Asian (EA) and Western (W) types based on the number and sequence of its EPIYA motifs; EA-type CagA includes EPIYA-A, EPIYA-B, and EPIYA-D, while W-type CagA includes EPIYA-A, EPIYA-B, and one or more EPIYA-C motifs (1).
In 1988, it was reported that a vacuolating cytotoxin that was found in H. pylori culture solution denatured some cancer cell lines (6). Cover et al. identified the vacuolating cytotoxin as the VacA protein in 1992 (7), and other research groups reported the base sequence of the vacA gene (8–11). The vacA gene of H. pylori strain ATCC49503 encodes a 1,287-amino acid protoxin, which undergoes cleavage of its 33-amino-acid amino-terminal signal sequence and carboxy-terminal proteolytic processing to yield a mature secreted toxin of about 87-kDa, which consists of 821 amino acids (12). Mature VacA undergoes cleavage into a 37-kDa N-terminal fragment (p37) and a 58-kDa C-terminal (p58) fragment (12). p37 causes vacuole formation after entering cells (13, 14), and p58 is involved in the binding of the toxin to target cells and its subsequent invasion of the target cells (15). The vacA gene has three polymorphic regions: the signal (s), intermediate (i), and middle (m) regions (16, 17). The s-region, which is included in p37, encodes part of the VacA signal peptide. On the contrary, the m-region encodes part of p58 (16). The s-region of vacA is divided into s1 (s1a, s1b, and s1c) and s2 genotypes (16). s1-type VacA is secreted immediately and in greater quantities than s2-type VacA, and s1-type VacA has been suggested to be associated with peptic ulcers (16). In addition, the m-region, which is composed of about 300 amino acids, is classified into m1 (m1a and m1b) and m2 genotypes (16). m1-type VacA, but not m2-type VacA, induces vacuolation in HeLa cells. Therefore, the differences between the amino acid sequences of the m1 and m2 genotypes are related to the cell specificity of the toxin (17).
In Europe and America, it has been reported that H. pylori possessing s1/m1-type vacA were found in patients who had a history of peptic ulcers (16), but in Japan no relationship between s1/m1-type vacA and peptic ulcers has been detected (18). In 2007, the i-region was reported as a new polymorphic site in the vacA gene (19). The i-region is located between the s- and m-regions of vacA and is composed of different combinations of 3 clusters (A, B, and C) (19). The i-region is classified into the i1 and i2 genotypes according to the combination of clusters present. Strains with the i1 genotype are strongly associated with GC and vacuolating cytotoxin activity (19). Chung et al. detected the i3 genotype, in which cluster B or C is i1-like, and the other cluster in this pair is i2-like (20).
Most of the H. pylori strains collected in Japan produced s1/m1-type VacA, which exhibits strong toxicity, and EA-type CagA. However, most of the H. pylori strains collected in Okinawa, Japan, produce s1/m2-type VacA, which displays weak toxicity, or s2/m2-type VacA, which is non-toxic, and W-type CagA (18, 21, 22). Studies about the i-region of vacA have been performed worldwide, but few such studies have been conducted in Japan. Previously, it was reported that Okinawa has the lowest GC mortality rate in Japan (23, 24). In 2014, the GC mortality rate in Okinawa was 16.4 deaths/100,000 people, whereas the mean GC mortality rate in Japan was 37.7 deaths/100,000 people (25). Therefore, the aim of this study is to assess the relationships between the clinical outcomes of H. pylori infections, vacA (especially the i-region genotype), and cagA in Okinawa, Japan.
MATERIALS AND METHODS
H. pylori strains
One hundred and thirty-nine clinical H. pylori strains from Okinawa (Okinawa Chubu Hospital), Japan, were included in this study. The strains were isolated from patients with GC (N=34, 24.4%), gastric ulcers (GU; N=19, 13.7%), duodenal ulcers (DU; N=26, 18.7%), or chronic gastritis (CG; N=60, 43.2%). All patients gave written informed consent for use of their samples for the present study.
H. pylori culture conditions
The gastric biopsy specimens obtained from each patient were inoculated onto a Trypticase soy agar (TSA)-II/5% sheep blood plate and cultured for 3 days at 37°C under microaerobic conditions (5% O2, 5% CO2, and 90% N2). A single colony was collected from each primary culture plate, inoculated onto a fresh TSA-II plate, and then was cultured under the same conditions. H. pylori was harvested from each plate, transferred into Brucella broth liquid culture medium (BBL Microbiology Systems, Cockeysville, MD, USA) containing 10% fetal calf serum (FCS), and cultured for 24 hr with agitation under the same conditions. Some of the bacterial suspension was stored at −80°C in phosphate-buffered saline (PBS) containing 20% glycerol. The DNA of each H. pylori strain was extracted from a pellet derived from the bacterial suspension using TE buffer consisting of 10 mM Tris-HCl (pH 8.0) and 1 mM ethylenediaminetetraacetic acid and was then stored at 4°C, before being amplified via the polymerase chain reaction (PCR).
PCR amplification and typing of vacA
The primers used for the PCR amplification and typing of the s-, i-, and m-regions of vacA are shown in Table I. The amplification conditions were as follows: 94°C for 1 min; 25 cycles of 94°C for 30 sec, 55°C for 30 sec, and 72°C for 5 min; followed by 72°C for 10 min. The PCR products were separated by 1.2% agarose gel electrophoresis and examined under ultraviolet (UV) illumination. The PCR products were purified using the QIAquick PCR purification kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. The typing of the s and m regions of vacA were performed according to the method of Ito et al. (18), and the i-region was typed according to the method of Rhead et al. (19). Twelve Okinawa strains (OK107, OK139, OK144, OK158, OK160, OK180, OK181, OK185, OK187, OK204, OK205, and OK210), whose vacA sequences were reported previously, were also used in this study (GenBank accession numbers: AB190968, AB190974, AB190975, AB190977, AB190979, AB190981, AB190982, AB190983, AB190984, AB190986, AB190987, and AB190988, respectively).
Table I.
Oligonucleotide primers used for the PCR analysis and DNA typing of H. pylori cagA and vacA.
| Gene | Region | Primer | Sequence (5′ to 3′) | Reference |
|---|---|---|---|---|
| cagA | ||||
| C2(+) | GAATTGTCTGATAAACTTGAAA | 26 | ||
| C3(−) | GCGTATGTGGCTGTTAGTAGCG | |||
| vacA | ||||
| VAS-1F | AGCCGATAGCATCAGAGAAGAAC | 18 | ||
| VAS-11R | TGTGGTGTATGCGTTGTAGGGGTT | |||
| s1a | vacA s1a-F | CTCTCGCTTTAGTAGGAGC | 18 | |
| VA1-R | CTGCTTGAATGCGCCAAAC | |||
| s1b | SS3-F | AGCGCCATACCGCAAGAG | 18 | |
| VA1-R | CTGCTTGAATGCGCCAAAC | |||
| s1c | vacA s1c-F | CTCTCGCTTTAGTGGGGYT | 27 | |
| VA1-R | CTGCTTGAATGCGCCAAAC | |||
| s2 | SS2-F | GCTAACACGCCAAATGATCC | 18 | |
| VA1-R | CTGCTTGAATGCGCCAAAC | |||
| i1 | VacF1 | GTTGGGATTGGGGGAATGCCG | 19 | |
| VacA-C1R | TTAATTTAACGCTGTTTGAAG | |||
| i2 | VacF1 | GTTGGGATTGGGGGAATGCCG | 19 | |
| vacC2R | GATCAACGCTCTGATTTGA | |||
| m1a | VA3-F | GGTCAAAATGCGGTCATGG | 18 | |
| VA3-R | CCATTGGTACCTGTAGAAAC | |||
| m1b | VAm-F3 | GGCCCCAATGCAGTCATGGAT | 18 | |
| VAm-R3 | GCTGTTAGTGCCTAAAGAAGCAT | |||
| m2 | VA4-F | GGAGCCCCAGGAAACATTG | 18 | |
| VA4-R | CATAACTAGCGCCTTGCAC |
Nucleotide sequence of the 3′ region of cagA
The primers used for the PCR amplification and direct sequencing of the 3′ region of cagA are shown in Table I. The amplification conditions were as follows: 94°C for 2 min; 30 cycles of 94°C for 30 sec, 55°C for 30 sec, and 72°C for 1 min; followed by 72°C for 10 min. The PCR products were separated by 1.5% agarose gel electrophoresis and examined under UV illumination. The PCR products were purified as described above. The direct DNA sequencing was performed using a BigDye terminator v.3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA, USA) and an Applied Biosystems 3130 genetic analyzer (Applied Biosystems) according to the manufacturer’s recommendations. The amino acid sequences of each gene were constructed and translocated from the nucleotide sequence, and then were aligned and analyzed using GENETYX version 7.0 (Software Development Co., Ltd., Tokyo, Japan).
Preparation of VacA
H. pylori strains were cultured at 37°C in Brucella broth liquid culture medium containing 10% FCS. The broth cultures were incubated in an atmosphere of 5% O2, 5% CO2, and 90% N2 on a gyratory shaker at 120 rpm for 72 hr. In order to count the number of H. pylori, the absorbance of the culture supernatants was measured at a wavelength of 560 nm (OD560) using a NanoDrop ND-1000 spectrophotometer V3.2. (NanoDrop Technologies, Wilmington, DE, USA), and OD560 values ranging from 0.3 to 0.45 were recorded. The cultures were centrifuged at 6,000 × g for 15 min, and the supernatants were sterilized by passing them through a filter (pore size: 0.45 μm) (Minisart; Sartorius Hannover, Germany). The filtered culture supernatants were stored at −20°C. VacA from H. pylori ATCC49503 (GenBank accession number: HPU05676) was also prepared and used as a positive control for the Western blotting and neutral red dye uptake (NRU) measurements, which are described below.
Western blotting
Western blotting was used to confirm the presence of VacA in the samples used by NRU measurements. For electrophoresis, 20 μL of the VacA solution were loaded onto 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis gel and then run at 80 mA. After gel electrophoresis, the proteins were transferred to polyvinylidene difluoride membranes (Immobilon-P membranes; Millipore Bedford, MA, USA) at 100 V for 1 hr. The polyclonal anti-VacA antibody was kindly provided by Dr. T. Hirayama (Nagasaki University, Nagasaki, Japan). The Western blotting was performed as described previously (28), and enhanced chemiluminescent reagents were used to visualize the secondary antibody.
NRU
The human gastric adenocarcinoma cell line AZ-521 (Culture Collection of Human Science Research Resources Bank, Japan Health Science Foundation) was grown in Eagle’s minimal essential medium (EMEM) containing 10% FCS and 1% antibiotic/antimycotic solution under a 5% CO2 atmosphere at 37°C. The AZ-521 cells were seeded into 96-well culture plates (2 × 104 cells in 100 μL/well; Corning Glass Works, Corning, NY, USA) and then were cultured as monolayers for 24 hr under a 5% CO2 atmosphere at 37°C. After transferring the culture supernatant to 80 μL of FCS-free EMEM, the cells were treated with 20 μL of VacA solution and incubated for 6 hr at 37°C. To quantify vacuolating activity, the uptake of neutral red into the vacuoles of the VacA-treated cells was determined as described by Cover et al. (29). The cells were incubated with 50 μL of freshly prepared 0.05% neutral red solution in PBS containing 0.3% BSA for 10 min at room temperature and then were washed twice with 0.1 mL of PBS containing 0.3% BSA. After the addition of 0.2 mL of 70% ethanol in water containing 0.4% HCl, the absorbance of the cells at a wavelength of 540 nm (OD540) was measured (30).
Statistical analysis
Excel 2013 (Statcell ver.4) was used to perform the statistical analyses. The chi-squared (χ2) test or Fisher’s exact probability test was used to analyze the associations between virulence factors and clinical outcomes. The differences in the OD540 values produced by NRU among the various H. pylori genotypes were analyzed using the Tukey-Kramer test. In all cases, p-values of <0.05 were considered to indicate a significant difference.
RESULTS
Genotypes of vacA and their associations with clinical outcomes
First, the genotypes of vacA were evaluated on the basis of three polymorphic regions: the s, i, and m regions. Among the 139 H. pylori strains that were collected in this study, 111 (79.9%), 6 (4.3%), 10 (7.2%), 2 (1.4%), 7 (5.0%), and 1 (0.7%) possessed the s1/i1/m1-type, s1/i1/m2-type, s1/i2/m2-type, s1/i3/m2-type, s2/i2/m2-type, and s2/i2/m2-m1b hybrid-type vacA gene, respectively. Two strains were vacA-negative (1.4%). Two strains possessed the i3-type vacA gene, and both of these strains had an i1-like cluster B and an i2-like cluster C (Table II).
Table II.
Relationships between the s/i/m regions of vacA and the clinical outcomes of H. pylori infections in Okinawa.
| Disease | N | s1/i1/m1 | s1/i1/m2 | s1/i2/m2 | s1/i3/m2 | s2/i2/m2 | s2/i2/m2-m1b | Negative |
|---|---|---|---|---|---|---|---|---|
| GC | 34 | 31 | 2 | 0 | 0 | 0 | 0 | 1 |
| GU | 19 | 19 | 0 | 0 | 0 | 0 | 0 | 0 |
| DU | 26 | 15 | 2 | 7 | 1 | 1 | 0 | 0 |
| CG | 60 | 46 | 2 | 3 | 1 | 6 | 1 | 1 |
| Total | 139 | 111 | 6 | 10 | 2 | 7 | 1 | 2 |
The numbers of H. pylori strains of each vacA genotype detected in various diseases are shown. GC: gastric cancer; GU: gastric ulcers; DU: duodenal ulcers; CG: chronic gastritis
All of the strains with s1/m1-type vacA genes carried i1-type vacA genes, and all of the strains with s2/m2-type vacA genes had i2-type vacA genes. Every type of i-region was detected among the strains that carried s1/m2-type vacA genes; however, none of the examined strains exhibited the s2/m1-type vacA genotype (Table II, Table III). Regarding the associations between the various vacA genotypes and clinical outcomes, all of the H. pylori strains that were collected from the patients with GC or GU had i1-type vacA genes. Among the H. pylori strains that were collected from the patients with DU, 17 (65.4%), 8 (30.8%), and 1 (3.8%) possessed i1-type, i2-type, and i3-type vacA genes, respectively. Regarding the H. pylori strains collected from the CG patients, 48 (81.4%), 10 (16.9%), and 1 (1.7%) had i1-type, i2-type, and i3-type vacA genes, respectively (Table IV). The s-region of vacA was not found to be related to the clinical outcomes of H. pylori infections (p=0.063), but the m- and i-regions were shown to be significantly related to clinical outcomes (p<0.05).
Table III.
Genotypes of the i-region of vacA and cagA in H. pylori strains isolated in Okinawa.
| Gene | vacA i-region genotype (no. of strains) | Total | |||
|---|---|---|---|---|---|
|
| |||||
| i1 | i2 | i3 | |||
| vacA | s1/m1 | 111 | 0 | 0 | 111 |
| s1/m2 | 6 | 10 | 2 | 18 | |
| s2/m2 | 0 | 8 | 0 | 8 | |
| Total | 117 | 18 | 2 | 137 | |
| Gene | vacA i-region genotype (no. of strains) | vacA-negative | Total | |||
|---|---|---|---|---|---|---|
|
| ||||||
| i1 | i2 | i3 | ||||
| cagA | East Asian | 102 | 1 | 0 | 2 | 105 |
| Western | 7 | 11 | 2 | 0 | 20 | |
| Negative | 2 | 6 | 0 | 0 | 8 | |
| Total | 111 | 18 | 2 | 2 | 133 | |
Among the 139 H. pylori strains, 137 were vacA-positive, and the i-region genotypes of the vacA genes detected in the 137 vacA-positive H. pylori strains are shown in the upper table. In the lower table, the results for 133 H. pylori strains in which it was possible to type cagA are shown. s2/i2/m2-m1b vacA is included in s2/i2/m2 vacA.
Table IV.
Relationships between the vacA s-, m-, i-region genotypes of H. pylori strains isolated in Okinawa and the clinical outcomes of H. pylori infections.
| Clinical outcome | vacA s-region genotype (no. of strains) | Total | |
|---|---|---|---|
|
| |||
| s1 | s2 | ||
| GC | 33 | 0 | 33 |
| GU | 19 | 0 | 19 |
| DU | 25 | 1 | 26 |
| CG | 52 | 7 | 59 |
| Total | 129 | 8 | 137 |
| Clinical outcome | vacA m-region genotype (no. of strains) | Total | |
|---|---|---|---|
|
| |||
| m1 | m2 | ||
| GC | 31 | 2 | 33 |
| GU | 19 | 0 | 19 |
| DU | 15 | 11 | 26 |
| CG | 46 | 13 | 59 |
| Total | 111 | 26 | 137 |
| Clinical outcome | vacA i-region genotype (no. of strains) | Total | ||
|---|---|---|---|---|
|
| ||||
| i1 | i2 | i3 | ||
| GC | 33 | 0 | 0 | 33 |
| GU | 19 | 0 | 0 | 19 |
| DU | 17 | 8 | 1 | 26 |
| CG | 48 | 10 | 1 | 59 |
| Total | 117 | 18 | 2 | 137 |
For the 137 vacA-positive H. pylori strains, the numbers of H. pylori strains that exhibited each vacA genotype in various diseases are shown. GC: gastric cancer; GU: gastric ulcers; DU: duodenal ulcers; CG: chronic gastritis
Genotypes of cagA and their associations with the i-region of vacA
Of the 139 H. pylori strains examined in this study, it was possible to type 133 for cagA, and the clinical outcomes of these 133 strains were as follows: GC: 34 (25.6%), GU: 16 (12.0%), DU: 26 (19.5%), and CG: 57 (42.9%) (Table V). In total, 105 (79.0%) H. pylori strains possessed EA-type cagA genes, and 20 (15.0%) had W-type cagA genes. There were 8 (6.0%) cagA-negative strains (Table III). Two vacA-negative H. pylori strains possessed EA-type cagA genes. Among the 133 H. pylori strains in which it was possible to type cagA, the i-region of the vacA gene was classified as i1, i2, i3, and vacA-negative in 102 (97.1%), 1 (1.0%), 0 (0.0%), and 2 (1.9%) of the H. pylori strains with EA-type cagA genes, respectively; 7 (35.0%), 11 (55.0%), 2 (10.0%), and 0 (0.0%) of the H. pylori strains with W-type cagA genes, respectively; and 2 (25.0%), 6 (75.0%), 0 (0.0%), and 0 (0.0%) of the cagA-negative H. pylori strains, respectively (Table III).
Table V.
Associations among clinical outcomes, cagA, and the i-region genotype of vacA.
| (A) GC | |||||||||
|---|---|---|---|---|---|---|---|---|---|
|
| |||||||||
| vacA | Total | ||||||||
|
| |||||||||
| s1/i1/m1 | s1/i1/m2 | s1/i2/m2 | s1/i3/m2 | s2/i2/m2 | s2/i2/m2-m1b | Negative | |||
| cagA | East Asian | 29 | 2 | 0 | 0 | 0 | 0 | 1 | 32 |
| Western | 2 | 0 | 0 | 0 | 0 | 0 | 0 | 2 | |
| Negative | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
| Total | 31 | 2 | 0 | 0 | 0 | 0 | 1 | 34 | |
| (B) GU | |||||||||
|---|---|---|---|---|---|---|---|---|---|
|
| |||||||||
| vacA | Total | ||||||||
|
| |||||||||
| s1/i1/m1 | s1/i1/m2 | s1/i2/m2 | s1/i3/m2 | s2/i2/m2 | s2/i2/m2-m1b | Negative | |||
| cagA | East Asian | 16 | 0 | 0 | 0 | 0 | 0 | 0 | 16 |
| Western | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
| Negative | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
| Total | 16 | 0 | 0 | 0 | 0 | 0 | 0 | 16 | |
| (C) DU | |||||||||
|---|---|---|---|---|---|---|---|---|---|
|
| |||||||||
| vacA | Total | ||||||||
|
| |||||||||
| s1/i1/m1 | s1/i1/m2 | s1/i2/m2 | s1/i3/m2 | s2/i2/m2 | s2/i2/m2-m1b | Negative | |||
| cagA | East Asian | 13 | 1 | 1 | 0 | 0 | 0 | 0 | 15 |
| Western | 2 | 1 | 6 | 1 | 0 | 0 | 0 | 10 | |
| Negative | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | |
| Total | 15 | 2 | 7 | 1 | 1 | 0 | 0 | 26 | |
| (D) CG | |||||||||
|---|---|---|---|---|---|---|---|---|---|
|
| |||||||||
| vacA | Total | ||||||||
|
| |||||||||
| s1/i1/m1 | s1/i1/m2 | s1/i2/m2 | s1/i3/m2 | s2/i2/m2 | s2/i2/m2-m1b | Negative | |||
| cagA | East Asian | 39 | 2 | 0 | 0 | 0 | 0 | 1 | 42 |
| Western | 2 | 0 | 3 | 1 | 2 | 0 | 0 | 8 | |
| Negative | 2 | 0 | 0 | 0 | 4 | 1 | 0 | 7 | |
| Total | 43 | 2 | 3 | 1 | 6 | 1 | 1 | 57 | |
For the 133 H. pylori strains in which it was possible to type cagA, the numbers of H. pylori strains that exhibited each vacA genotype in various diseases are shown. GC: gastric cancer; GU: gastric ulcers; DU: duodenal ulcers; CG: chronic gastritis
Associations between clinical outcomes, cagA, and the i-region of vacA
All of the H. pylori strains that were collected from the patients with GC exhibited i1-type vacA genes, and 31 (91.2%), 2 (6.1%), and 1 (2.9%) were EA-type cagA, W-type cagA, and cagA-negative strains, respectively. Regarding the H. pylori strains collected from the patients with GU, only i1-type vacA and EA-type cagA genes were detected in these strains. Of the H. pylori strains that were collected from the patients with DU, 15 (57.7%) possessed EA-type cagA genes, 10 (38.5%) had W-type cagA genes, and 1 (3.8%) was cagA-negative. The i-region of vacA was classified as i1, i2, and i3 in 14 (93.3%), 1 (6.7%), and 0 (0%) of the H. pylori that possessed EA-type cagA genes, respectively; 3 (30.0%), 6 (60.0%), and 1 (10.0%) of the H. pylori strains with W-type cagA genes, respectively; and 0 (0%), 1 (100.0%), and 0 (0%) of the cagA-negative H. pylori strains. Of the H. pylori strains collected from the patients with CG, 42 (73.7%) possessed EA-type cagA genes, 8 (14.0%) had W-type cagA genes, and 7 (12.3%) were cagA-negative. In addition, the i-region of vacA was classified as i1, i2, i3, and vacA-negative in 41 (97.6%), 0 (0.0%), 0 (0.0%), and 1 (2.4%) of the H. pylori strains that possessed EA-type cagA genes, respectively; 2 (25.0%), 5 (62.5%), 1 (12.5%), and 0 (0.0%) of the H. pylori strains with W-type cagA genes, respectively; and 2 (28.6%), 5 (71.4%), 0 (0%), and 0 (0.0%) of the cagA-negative H. pylori strains, respectively (Table V). Taken together, the Okinawa H. pylori strains collected from GC and GU were only i1-type vacA genes, although statistical analyses could not be performed due to the biased sample data. In the H. pylori strains collected from DU and CG, the significant relation between the genotypes of cagA and vacA (p<0.05) were observed, so it means that the rate of Okinawa H. pylori strains with W-type cagA genes and m2-type or i2-type vacA genes tended to be high in DU and CG.
Evaluation of NRU
Vacuoles induced by VacA form both late endosomes and lysosomes (24), and neutral red is taken up by and accumulates in lysosomes in viable cells. Therefore, NRU is widely used to measure vacuolating cytotoxin activity (20, 24). To compare the vacuolating cytotoxin activity associated with the various types of vacA i-regions, we examined NRU in 19 H. pylori strains, which consisted of 6 strains with s1/i1/m2-type vacA genes; 8 strains with s1/i2/m2-type vacA genes; 2 strains with s1/i3/m2-type vacA genes; 2 strains with s1/i1/m1-type vacA genes; and H. pylori ATCC49503, which possesses s1/i1/m1-type vacA genes, as a positive control (Figure 1). The presence of VacA in the samples used by this analysis was confirmed by Western blotting. As a result, OD540 values of 0.427 ± 0.179, 0.159 ± 0.032, 0.313 ± 0.258, and 0.49 ± 0.164 were obtained for s1/i1/m2-type VacA, s1/i2/m2-type VacA, s1/i3/m2-type VacA, and s1/i1/m1-type VacA, respectively (mean ± SE). The OD540 value obtained for H. pylori ATCC49503 was 0.67, and s1/i1/m1-type VacA exhibited the highest OD540 value, as we expected. There were significant differences between the vacuolating cytotoxin activity of s1/i1/m2-type VacA and s1/i2/m2-type VacA and between that of s1/i1/m1-type VacA and s1/i2/m2-type VacA, but we not detect any such differences between s1/i2/m2-type VacA and s1/i3/m2-type VacA, between s1/i1/m1-type VacA and s1/i1/m2-type VacA, or between s1/i1/m2-type VacA and s1/i3/m2-type VacA.
Figure 1. NRU induced by VacA.
OD540 values of 0.427 ± 0.179, 0.159 ± 0.032, 0.313 ± 0.258, and 0.49 ± 0.164 were obtained for s1/i1/m2-VacA, s1/i2/m2-type VacA, s1/i3/m2-type VacA, and s1/i1/m1-type VacA, respectively (mean ± SE). The OD540 value of H. pylori ATCC49503 (the positive control) was 0.67. The asterisks indicate significant differences (p<0.05) according to the Tukey-Kramer test. n.s.: not significant
DISCUSSION
Previously, Yamaoka et al. reported that the s- and m-genotypes of vacA are not useful as disease markers in East or Southeast Asia (27, 31–34). Similarly, it was also shown that the i-region of vacA is not useful as a disease determinant in these areas (35). In this study, we investigated the relationship between the clinical outcomes of H. pylori infections, vacA (especially the i-region genotype), and cagA in Okinawa, Japan, because Okinawa has the lowest GC mortality rate in Japan (23, 24). In Okinawa, the m- and i-regions, but not the s-region, of vacA, were found to be related to the clinical outcomes of H. pylori infections. In our previous study (22), it was demonstrated that all of the H. pylori strains collected from patients in Fukui, which is a typical prefecture located on the Japanese mainland (Honshu), possessed s1/i1/m1-type vacA genes. The H. pylori strains collected from Fukui also had EA-type cagA genes (22). In this study, the H. pylori strains of s1/i1/m1-vacA genes and EA-type cagA genes in Okinawa were related to GC and GU, and this tendency was also observed in the H. pylori strains collected from Fukui. On the other hand, the results from the H. pylori strains except GC and GU in Okinawa were different from those of Fukui. The reasons for this might include differences in the geographic characteristics and culture of Okinawa, which is an island located in the southwest of Japan and has a different culinary culture and history from the other areas of Japan. Taking these findings together, the typing of vacA and cagA might only be useful in Okinawa.
In a study carried out in Iran by Rhead et al., it was reported that most of the H. pylori strains with s1/m1-type vacA genes had i1-type vacA genes, whereas all of the strains with s2/m2-type vacA genes had i2-type vacA genes, and infection with an i1-type H. pylori strain was found to be associated with GC (19). Similarly, in Okinawa all of the H. pylori strains that possessed s1/m1-type vacA genes had i1-type vacA genes, and i1-type H. pylori strains were associated with GC. In addition, the i1-type H. pylori strains were associated with GU in Okinawa, and infection with an i2-type H. pylori strain was very rare among the patients with GC or GU. Therefore, the i1-type of vacA might be a risk factor for GC and GU. Most of the H. pylori strains with EA-type cagA genes had the i1-type of vacA, whereas the i1-, i2-, and i3-types of vacA were detected in the H. pylori strains with W-type cagA genes. These results suggest that the EA-type cagA genotype is a risk factor for GC. On the contrary, patients that are infected with H. pylori strains possessing i2-type vacA genes might be at low risk of developing of GC or GU. Regarding vacuolating cytotoxin activity, which was measured via NRU in this study, i1-type VacA exhibited stronger vacuolating cytotoxin activity than i2-type VacA, while there was no significant difference between the vacuolating cytotoxin activity levels of the m1- and m2- types of VacA. These results indicate that the i-region genotype of vacA might be closely associated with the degree of vacuolating cytotoxin activity.
In conclusion, the i-region genotype of vacA is a useful marker of both H. pylori virulence and the clinical outcomes of H. pylori infections in Okinawa, Japan, and the typing of the i-region of vacA might be helpful for evaluating the toxicity of H. pylori and predicting H. pylori-related diseases.
ACKNOWLEDGEMENTS
We are very grateful to Yoshihide Keida (Division of Internal Medicine, Okinawa Chubu Hospital, Uruma, Japan) and Toshiya Hirayama (Department of Bacteriology, Institute of Tropical Medicine, Nagasaki University, Nagasaki, Japan) for the research assistance they provided. None of the authors has any conflicts of interest or any financial ties to disclose.
REFERENCES
- 1.Higashi H, Tsutsumi R, Fujita A, Yamazaki S, Asaka M, Azuma T, Hatakeyama M. Biological activity of the Helicobacter pylori virulence factor CagA is determined by variation in the tyrosine phosphorylation sites. Proc Natl Acad Sci USA. 2002;99:14428–14433. doi: 10.1073/pnas.222375399. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Azuma T, Yamazaki S, Yamakawa A, Ohtani M, Muramatsu A, Suto H, Ito Y, Dojo M, Yamazaki Y, Kuriyama M, Keida Y, Higashi H, Hatakeyama M. Association between diversity in the Src homology 2 domain--containing tyrosine phosphatase binding site of Helicobacter pylori CagA protein and gastric atrophy and cancer. J Infect Dis. 2004;189:820–827. doi: 10.1086/381782. [DOI] [PubMed] [Google Scholar]
- 3.Higashi H, Tsutsumi R, Muto S, Sugiyama T, Azuma T, Asaka M, Hatakeyama M. SHP-2 tyrosine phosphatase as an intracellular target of Helicobacter pylori CagA protein. Science. 2002;295:683–686. doi: 10.1126/science.1067147. [DOI] [PubMed] [Google Scholar]
- 4.Backert S, Moese S, Selbach M, Brinkmann V, Meyer TF. Phosphorylation of tyrosine 972 of the Helicobacter pylori CagA protein is essential for induction of a scattering phenotype in gastric epithelial cells. Mol Microbiol. 2001;42:631–644. doi: 10.1046/j.1365-2958.2001.02649.x. [DOI] [PubMed] [Google Scholar]
- 5.Stein M, Bagnoli F, Halenbeck R, Rappuoli R, Fantl WJ, Covacci A. c-Src/Lyn kinases activate Helicobacter pylori CagA through tyrosine phosphorylation of the EPIYA motifs. Mol Microbiol. 2002;43:971–980. doi: 10.1046/j.1365-2958.2002.02781.x. [DOI] [PubMed] [Google Scholar]
- 6.Leunk RD, Johnson PT, David BC, Kraft WG, Morgan DR. Cytotoxic activity in brouth-culture filtrates of Campylobacter pylori. J Med Microbiol. 1988;26:93–99. doi: 10.1099/00222615-26-2-93. [DOI] [PubMed] [Google Scholar]
- 7.Cover TL, Blaser MJ. Purification and characterization of the vacuolating toxin from Helicobacter pylori. J Biol Chem. 1992;267:10570–10575. [PubMed] [Google Scholar]
- 8.Cover TL, Tummuru MKR, Cao P, Thompson S, Blaser MJ. Divergence of genetic sequences for the vacuolating cytotoxin among Helicobacter pylori strains. J Biol Chem. 1994;269:10566–10573. [PubMed] [Google Scholar]
- 9.Phadnis SH, Ilver D, Janzon L, Normark S, Westblom TU. Pathological significance and molecular characterization of the vacuolating cytotoxin gene of Helicobacter pylori. Infect Immun. 1994;62:1557–1565. doi: 10.1128/iai.62.5.1557-1565.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Schmitt W, Haas R. Genetic analysis of the Helicobacter pylori vacuolating cytotoxin: structural similarities with the IgA protease type of exported protein. Mol Microb. 1994;12:307–319. doi: 10.1111/j.1365-2958.1994.tb01019.x. [DOI] [PubMed] [Google Scholar]
- 11.Telford JL, Ghiara P, Dell’Orco M, Commanducci M, Burroni D, Bugnoli M, Tecce MF, Censini S, Covvacci A, Xiang Z, Papini E, Montecucco C, Parente L, Rappuoli R. Gene structure of the Helicobacter pylori cytotoxin and evidence of its key role in gastric disease. J Exp Med. 1994;179:1653–1658. doi: 10.1084/jem.179.5.1653. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Nguyen VQ, Captioli RM, Cover TL. Carboxy-terminal proteolytic processing of Helicobacter pylori vacuolating toxin. Infect Immun. 2001;69:543–546. doi: 10.1128/IAI.69.1.543-546.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.de Bernard M, Arico B, Papini E, Rizzuto R, Grandi G, Rappuoli R, Montecucco C. Helicobacter pylori toxin VacA induces vacuole formation by acting in the cell cytosol. Mol Microb. 1997;26:665–674. doi: 10.1046/j.1365-2958.1997.5881952.x. [DOI] [PubMed] [Google Scholar]
- 14.de Bernard M, Burroni D, Papini E, Rappouli R, Telford J, Montecucco C. Identification of the Helicobacter pylori VacA toxin domain active in the cell cytosol. Infect Immun. 1998;66:6014–6016. doi: 10.1128/iai.66.12.6014-6016.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Garner JA, Cover TL. Binding and internalization of the Helicobacter pylori vacuolating cytotoxin by epithelial cells. Infect Immun. 1996;64:4197–4203. doi: 10.1128/iai.64.10.4197-4203.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Atherton JC, Cao P, Peek RM, Jr, Tummuru MK, Blaser MJ, Cover TL. Mosaicism vacuolating cytotoxin alleles of Helicobacter pylori association of specific vacA types with cytotoxin production and peptic ulceration. J Biol Chem. 1995;270:147771–147777. doi: 10.1074/jbc.270.30.17771. [DOI] [PubMed] [Google Scholar]
- 17.Pagliaccia C, de Bernard M, Lupetti P, Ji X, Burruni D, Cover TL, Papini E, Rappuoli R, Telford JL, Reyrat JM. The m2 form of the Helicobacter pylori cytotoxin has cell type specific vacuolating activity. Proc Natl Acad Sci USA. 1998;95:10212–10217. doi: 10.1073/pnas.95.17.10212. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Ito Y, Azuma T, Ito S, Miyaji H, Hirai M, Yamazaki Y, Sato F, Kato T, Kohli Y, Kuriyama M. Analysis and typing of the vacA gene from cagA-positive strains of Helicobacter pylori isolated in Japan. J Clin Microbiol. 1997;35:1710–1714. doi: 10.1128/jcm.35.7.1710-1714.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Rhead JL, Letley DP, Mohammad M, Hussein N, Mohagheghi MA, Hossein ME, Atherton JC. A New Helicobacter pylori Vacuolating Cytotoxin Determinant, the Intermediate Region, Is Associated With Gastric Cancer. Gastroenterology. 2007;133:926–936. doi: 10.1053/j.gastro.2007.06.056. [DOI] [PubMed] [Google Scholar]
- 20.Chung C, Olivares A, Torres E, Yilmaz O, Cohen H, Perez-Perez GI. Diversity of VacA intermediate region among Helicobacter pylori strains from several regions of the world. J Clin Microbiol. 2010;48:690–696. doi: 10.1128/JCM.01815-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Shirakawa D, Aoyama N, Satonaka K, Shirakawa K, Yoshida H, Sakai T, Ikemura T, Shinoda Y, Sakashita M, Miyamoto M, Yahiro K, Wada A, Kurazono H, Hirayama T, Kasuga M. Analysis of Helicobacter pylori vacA Gene and Serum Antibodies to VacA in Japan. Dig Dis Sci. 2000;45:789–795. doi: 10.1023/a:1005412214375. [DOI] [PubMed] [Google Scholar]
- 22.Zhou W, Yamazaki S, Yamakawa A, Ohtani M, Ito Y, Keida Y, Higashi H, Hatakeyama M, Si J, Azuma T. The diversity of vacA and cagA genes of Helicobacter pylori in East Asia. FEMS Immunol Med Microbiol. 2004;40:81–87. doi: 10.1016/S0928-8244(03)00299-2. [DOI] [PubMed] [Google Scholar]
- 23.Azuma T. Helicobacter pylori CagA protein variation associated with gastric cancer in Asia. J Gastroenterol. 2004;39:97–103. doi: 10.1007/s00535-003-1279-4. [DOI] [PubMed] [Google Scholar]
- 24.Satomi S, Yamakawa A, Matsunaga S, Masaki R, Inagaki T, Okuda T, Suto H, Ito Y, Yamazaki Y, Kuriyama M, Keida Y, Kutsumi H, Azuma T. Relationship between the diversity of the cagA gene of Helicobacter pylori and gastric cancer in Okinawa, Japan. J Gastroenterol. 2006;41:668–673. doi: 10.1007/s00535-006-1838-6. [DOI] [PubMed] [Google Scholar]
- 25.Cancer Registry and Statistics. Cancer Information service, National Cancer Center; Japan: [Google Scholar]
- 26.Azuma T, Yamakawa A, Yamazaki S, Fukuta K, Ohtani M, Ito Y, Dojo M. Correlation between variation of the 3′ region of the cagA gene in Helicobacter pylori and disease outcome in Japan. J Infect Dis. 2002;186:1621–30. doi: 10.1086/345374. [DOI] [PubMed] [Google Scholar]
- 27.Yamaoka Y, Kodama T, Gutierrez O, Kim JG, Kashima K, Graham DY. Relationship between Helicobacter pylori iceA, cagA, and vacA status and clinical outcome: studies in four different countries. J Clin Microbiol. 1999;37:2274–2279. doi: 10.1128/jcm.37.7.2274-2279.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Hirohide O, Samuelson LC, Yule DJ, Ernst SA, Williams JA. Overexpression of Rab3D Enhances Regulated Amylase Secretion from Pancreatic Acini of Transgenic Mice. J Clin Invest. 1997;100:3044–3052. doi: 10.1172/JCI119859. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Cover TL, Puryear W, Perez-Perez GI, Blaser MJ. Effect of urease on HeLa cell vacuolation induced by Helicobacter pylori cytotoxin. Infect Immun. 1991;59:1264–1270. doi: 10.1128/iai.59.4.1264-1270.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Yahiro K, Niidome T, Kimura M, Hatakeyama T, Aoyagi H, Kurazono H, Imagawa K, Wada A, Moss J, Hirayama T. Activation of Helicobacter pylori VacA toxin by alkaline or acid conditions increases its binding to a 250-kDa receptor protein-tyrosine phosphatase beta. J Biol Chem. 1999;274:36693–36699. doi: 10.1074/jbc.274.51.36693. [DOI] [PubMed] [Google Scholar]
- 31.Vilaichone RK, Mahachai V, Tumwasorn S, Wu JY, Graham DY, Yamaoka Y. Molecular Epidemiology and Outcome of Helicobacter pylori Infection in Thailand: a Cultural Cross Roads. Helicobacter. 2004;9:453–459. doi: 10.1111/j.1083-4389.2004.00260.x. [DOI] [PubMed] [Google Scholar]
- 32.Yamaoka Y, Kodama T, Kita M, Imanishi J, Kashima K, Graham DY. Relationship of vacA Genotypes of Helicobacter pylori to cagA Status, Cytotoxin Production, and Clinical Outcome. Helicobacter. 1998;3:241–253. doi: 10.1046/j.1523-5378.1998.08056.x. [DOI] [PubMed] [Google Scholar]
- 33.Yamaoka Y, Souchek J, Odenbreit S, Haas R, Arnqvist A, Borén T, Kodama T, Osato MS, Gutierrez O, Kim JG, Graham DY. Discrimination between cases of duodenal ulcer and gastritis on the basis of putative virulence factors of Helicobacter pylori. J Clin Microbiol. 2002;40:2244–2246. doi: 10.1128/JCM.40.6.2244-2246.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Ogiwara H, Graham DY, Yamaoka Y. vacA i-Region Subtyping. Gastroenterology. 2008;134:1267. doi: 10.1053/j.gastro.2007.11.062. [DOI] [PubMed] [Google Scholar]