Skip to main content
PLOS One logoLink to PLOS One
. 2018 Mar 21;13(3):e0194042. doi: 10.1371/journal.pone.0194042

Life in a rock pool: Radiation and population genetics of myxozoan parasites in hosts inhabiting restricted spaces

Pavla Bartošová-Sojková 1,*,#, Alena Lövy 1,#, Cecile C Reed 2, Martina Lisnerová 1,3, Tereza Tomková 3, Astrid S Holzer 1,3, Ivan Fiala 1,3
Editor: Tzen-Yuh Chiang4
PMCID: PMC5862482  PMID: 29561884

Abstract

Introduction

Intertidal rock pools where fish and invertebrates are in constant close contact due to limited space and water level fluctuations represent ideal conditions to promote life cycles in parasites using these two alternate hosts and to study speciation processes that could contribute to understanding the roles of parasitic species in such ecosystems.

Material and methods

Gall bladder and liver samples from five clinid fish species (Blenniiformes: Clinidae) were morphologically and molecularly examined to determine the diversity, prevalence, distribution and host specificity of Ceratomyxa parasites (Cnidaria: Myxozoa) in intertidal habitats along the coast of South Africa. Phylogenetic relationships of clinid ceratomyxids based on the SSU rDNA, LSU rDNA and ITS regions were assessed additionally to the investigation of population genetic structure of Ceratomyxa cottoidii and subsequent comparison with the data known from type fish host Clinus cottoides.

Results and discussion

Seven Ceratomyxa species including previously described Ceratomyxa dehoopi and C. cottoidii were recognized in clinids. They represent a diverse group of rapidly evolving, closely related species with a remarkably high prevalence in their hosts, little host specificity and frequent concurrent infections, most probably as a result of parasite radiation after multiple speciation events triggered by limited host dispersal within restricted spaces. C. cottoidii represents the most common clinid parasite with a population structure characterized by young expanding populations in the south west and south east coast and by older populations in equilibrium on the west coast of its distribution. Parasite and fish host population structures show overlapping patterns and are very likely affected by similar oceanographic barriers possibly due to reduced host dispersal enhancing parasite community differentiation. While fish host specificity had little impact on parasite population structure, the habitat preference of the alternate invertebrate host as well as tidal water exchange may be additional crucial variables affecting the dispersal and associated population structure of C. cottoidii.

Introduction

Rock pools are unique and complex habitats in intertidal areas. They harbor large numbers of fishes and invertebrates that are well adapted to life in harsh conditions of strong fluctuations in water temperature, oxygen levels and salinity [1]. Fishes of the family Clinidae (Blenniiformes: Blennioidei), locally known as klipfish, are well adapted to such turbulent and unstable conditions [2, 3]. They are prominent inhabitants of these intertidal and shallow subtidal habitats and represent up to 98% of the total number of fish species in rock pool communities of South Africa [2, 3]. Distribution and genetic structure of South African clinids are strongly affected by oceanic circulation, paleoclimate changes, contemporary environmental variables, specific biological features and habitat preferences [46]. Significant biogeographic boundaries that affect South African marine fauna are created by two very distinct ocean currents that flank the west and south coasts. The Benguela Current, on the west coast, brings cold nutrient-rich water to the surface as it moves northwards along the west coast of the country. The Agulhas Current carries warm, nutrient-poor surface waters southwards along the east and south coasts of the country. A biogeographical barrier is created over the Agulhas Bank where these two currents meet (Fig 1) [4]. The latest glaciation events also affected the distribution of intertidal marine organisms in South Africa as a result of changes in sea levels and associated availability of rocky shore habitats [47].

Fig 1. Map showing the sampling area of clinid fish in this study.

Fig 1

The twelve sampling localities, grouped into three geographical regions, are labeled by round colored circles. The number of samples obtained at each locality is shown in parentheses. Moreover, the major oceanographic features around the South African coastline, the Benguela and Agulhas Currents, that influence population structuring of Clinus cottoides are shown along with the barriers to gene flow (blue vertical lines) as HB1: Jacobs Bay–Sea Point (at Cape Town), HB2: Gaansbai–Cape Agulhas, HB3: Knysna–Port Alfred [11, 12]. Agulhas ring eddies and the Agulhas counter-current are also highlighted.

The South African clinid genera Clinus, Muraenoclinus, Blennophis, and Pavoclinus as well as their sister-related Australian genera Heteroclinus and Cristiceps [8] are viviparous species giving birth to well-developed postflexion larvae [9]. This is in contrast to North and South American clinids which are oviparous [9]. Thus, the potential for free dispersal in South African live-bearing clinid fishes is highly reduced [10], creating more pronounced population genetic structures [6, 11, 12]. Clinus cottoides Valenciennes, 1836 (bluntnose klipfish) is a viviparous fish species with restricted dispersal capacity [10], which is endemic to South Africa and has a clear population structure with discontinuities along the oceanographic barriers that influence gene flow patterns. The first main genetic break lies on the southern South African coast (Gaansbai–Cape Agulhas; HB2 in Fig 1) while the second break is located between the east coast and other locations on the south (Knysna–Port Alfred; HB3 in Fig 1) [11]. Studies have also revealed additional pronounced genetic differentiation of C. cottoides populations between Jacobs Bay and Sea Point (HB1 in Fig 1) [12]. Similar isolation of populations on the east coast has been documented for the super klipfish Clinus superciliosus (L.) whereas a recent colonization event of the eastern range distribution has been suggested for the nosestripe klipfish Muraenoclinus dorsalis (Bleeker, 1860) [6, 12]. Both of these fish species represent species complexes showing evidence of cryptic speciation [6, 13].

Rock pools are important habitats in intertidal environments as they support a diverse assemblage of organisms [14, 15]. Moreover, these habitats represent ideal conditions for parasite life cycles as, due to the limited space, different host groups are in constant close contact [16]. The Myxozoa, a group of microscopic cnidarian parasites alternating mainly between the fish intermediate and annelid definitive hosts, are very common in marine habitats [17]. Representatives of five myxozoan genera Henneguya, Ceratomyxa, Myxidium, Ortholinea and Sphaeromyxa have so far been described from South African clinids [1823]. Ceratomyxa is a species-rich genus characterized by crescent shaped spores with two polar capsules. Individual species mostly infect gall bladders and bile ducts of marine fishes and generally differ by spore measurements, host preference and SSU rRNA gene sequences [17, 24]. Ceratomyxids are highly host specific [2530] and very few taxa infect more than one host species [25, 30]. Therefore, host as an informative diagnostic character has become particularly valuable for morphologically and genetically closely related species of Ceratomyxa [2530]. Even though ceratomyxids in general cause little harm to their hosts, some species have been documented to induce severe histopathological damage [3133] and obstruction and distension of bile ducts due to the presence of masses of spores and plasmodial stages [20]. The ceratomyxid life cycle has so far been elucidated only for Ceratomyxa auerbachii Kabata, 1962 which alternates between a clupeid fish and a marine polychaete [34]. Though globally distributed, the knowledge of Ceratomyxa species diversity in South African clinids is very limited. Ceratomyxa obovalis (Fantham, 1930) was found to parasitize blennioids C. cottoides, C. superciliosus, bull klipfish Clinus taurus Gilchrist & Thompson, 1908 and horned blenny Parablennius cornutus (L.) from False Bay and Kalk Bay [18, 19]. Ceratomyxa cottoidii Reed, Basson, Van As et Dyková, 2007 and Ceratomyxa dehoopi Reed, Basson, Van As et Dyková, 2007 were described from C. cottoides and C. superciliosus, respectively, from De Hoop [20], one of South Africa’s largest marine reserves. This area is located just east of Cape Agulhas, a dominant genetic break for marine intertidal organisms [6, 11, 35, 36]. A further undescribed Ceratomyxa species, morphologically similar to C. cottoidii, was reported from M. dorsalis from Kommetjie, Granger Bay and Jacobs Bay [37]. Interestingly, this species [37] and other ceratomyxids [26, 31, 38] display a high degree of morphological spore plasticity. This raises questions whether the observed variation is determined by deformations of their presumably thin-walled shell valves, a feature previously documented for some ceratomyxids [39], or alternatively is due to the concurrent infections of several Ceratomyxa species of different morphology, as mixed myxozoan infections [17], including those of Ceratomyxa spp. [40], are a common phenomenon.

Myxozoans are generally recognized as parasites with an accelerated rate of molecular evolution [41, 42] explained by an extraordinary level of radiation [43, 44]. Such rapid molecular evolution and associated long-branch attraction (LBA) can greatly obscure the results of phylogenetic studies of the Myxozoa [41]. Substitution rates significantly differ among myxozoan lineages. For example, the Ceratomyxa clade, placed within the marine myxosporean lineage [45, 46] includes several long-branching taxa sometimes clustering together, most probably due to LBA [46]. Ceratomyxa spp. from the same fish host family (and sometimes from the same geographic location) tend to cluster together, however, this is not always the rule [27, 29].

Though population structure of both, host and parasite, is most relevant to co-evolutionary processes [4749] and myxozoan evolutionary history has been significantly linked to host-parasite co-evolution [50, 51], unfortunately, to date, investigations determining the population structure of myxozoan parasites in relation to that of their hosts are still missing. For this purpose, we selected the host-parasite model system of Clinus cottoides, rendering the detailed knowledge of its biology, distributional range, and population structure [1012], and Ceratomyxa cottoidii for which information on its fish host species and distribution was collected during the previous [20] and this studies. Moreover, an ecological system with geographically limited host dispersion as seen in C. cottoides is ideal for study.

Our aims were to i) examine diversity, prevalence, distribution and host species spectra of ceratomyxids from South African clinids, ii) reconstruct the phylogenetic relationships among clinid ceratomyxids and to other members of the Ceratomyxa clade, and iii) reveal the patterns of population structuring of C. cottoidii and to investigate if they are linked to geographical or host-driven isolation of parasite populations. Based on previous knowledge, we hypothesized that ceratomyxids species in South African clinids are strictly host-specific, closely related and occur in mixed infections. Finally, we hypothesized that C. cottoidii as a specialist parasite follows the population structure of its fish host C. cottoides.

Material and methods

Sample collection, study area and time schedule

In total, 143 fish specimens of the family Clinidae (Perciformes) belonging to Clinus acuminatus (Bloch & Schneider), Clinus brevicristatus Gilchrist et Thompson, C. cottoides, C. superciliosus and M. dorsalis were collected from intertidal rock pools using small hand nets, at several localities in South Africa in March–April 2008, November 2009 and October–November 2012 (Fig 1, S1 Table). Fish were captured and treated under the terms and conditions of the MCM permit number RES2008/15, 2008/V8/LT and 2009/V1/LT of the Science Faculty Animal Ethics Committee (SFAEC) of University of Cape town (UCT) that approved this study. Captured fish were identified using Branch et al. [52].

Processing of samples

Fish livers and gall bladders (in total 152 samples; S1 Table) were examined directly in the field or fixed in 70% ethanol and examined subsequently in the laboratory for the presence of myxosporean infections by light microscopy (LM) on Leica DM750 and Olympus BX51 microscopes. Plasmodia and myxospore morphology were documented with an Olympus DP70 digital camera using differential interference contrast. Samples were stored in 400 μL of TNES urea buffer (10 mM Tris-HCl with pH 8, 125 mM NaCl, 10 mM EDTA, 0.5% SDS and 4 M urea) or in 90% ethanol for subsequent DNA extraction.

DNA extraction, PCR amplification, cloning and sequencing

Total DNA was extracted from all collected samples using a standard phenol-chloroform protocol, after an overnight digestion with proteinase K (50 μg mL-1; Serva, Germany), at 55°C. DNA was re-suspended in 50–100 μL−1 of DNAse-free water and left to dissolve overnight at 4°C.

Different regions of molecular markers within the nuclear ribosomal operon (SSU rDNA, LSU rDNA, ITS region) were amplified in this study with primer combinations as listed in Table 1. At the beginning we aimed at obtaining the sequence data of all three markers for Ceratomyxa parasites using the general Ceratomyxa (SSU rDNA) or general clinid Ceratomyxa (LSU rDNA, longer ITS region) primers from a random selection of several samples to compare the phylogenetic clustering patterns. Later on, we selected the longer ITS region as the most suitable marker for species detection based on the highest amount of data informativeness and best tree resolution and continued in PCRs of additional samples only for this region. Using these approaches, seven Ceratomyxa spp. were uncovered (C. cottoidii, C. dehoopi, further undescribed species Ceratomyxa sp. 1, Ceratomyxa sp. 2, Ceratomyxa sp. 3, Ceratomyxa sp. 4 and Ceratomyxa sp. 5). However, amplification of all three loci from samples chosen for amplification of all markers was not successful in all cases. This situation was further complicated by identification of concurrent infections of multiple Ceratomyxa spp. from clones placed in different clinid Ceratomyxa subclades (representing species) originating from single PCR products. To overcome these obstacles, which would bias the exact assessment of diversity and prevalence of Ceratomyxa spp., we designed seven sets of species- (lineage) specific primers targeting the shorter ITS region of each Ceratomyxa species (Table 1). This region was nested within the previously amplified longer ITS region and provides enough interspecific sequence variation and sufficient number of sequences for primer design. We subsequently PCR-screened all 152 samples.

Table 1. Primers used to amplify target regions of the nuclear ribosomal operon of clinid Ceratomyxa spp.

Primer name Primer sequence Target group/species PCR type/ Amplicon length (bp) Reference
SSU rDNA
ERIB1 ACCTGGTTGATCCTGCCAG Universal eukaryotic Primary PCR ≈ 1900–2050 [53]
ERIB10 CTTCCGCAGGTTCACCTACGG Universal eukaryotic [53]
18S-cerF CTWGTTGGTADGGTAGTG All Ceratomyxa Nested PCR ≈ 1300–1450 [46]
18S-cerR GTACAAGAGGCAGAGACGTAT All Ceratomyxa [46]
LSU rDNA
NLF-CerCot-out ACCGTGATTGTCCCAGTAACTGCG Clinid Ceratomyxa Primary PCR ≈ 1050–1150 This study
NLR-CerCot-out AAAGTGGCCCACTTGGAGCGC Clinid Ceratomyxa This study
NLF-CerCot-in ACAAGAGCCCGTAGTCGAATCGC Clinid Ceratomyxa Nested PCR ≈ 950–1050 This study
NLR-CerCot-in TTAGGAGCCTGCTCGCCGGTTGGG Clinid Ceratomyxa This study
Longer ITS region (last 50 bp of SSU rDNA, full ITS1, full 5.8S rDNA, full ITS2, first 85 bp of LSU rDNA)
CerCot_ITS_for CACGGCGACGGTGTGAAAACG Clinid Ceratomyxa Primary PCR ≈ 700–1050 This study
C_cot-ITS-R-out GCGATTCGACTACGGGCTCTTGT Clinid Ceratomyxa This study
C_Cot-ITS-F-in GAAGTAAAAGTCGTAACAAGG Clinid Ceratomyxa Nested PCR ≈ 500–850 This study
C_Cot-ITS-R-in CGCAGTTACTGGGACAATCACGGT Clinid Ceratomyxa This study
Shorter ITS region (cca 60–300 bp of ITS1 + 5.8S rDNA + cca 60–100 bp of ITS2)
C_Cot-ITS-F-in GAAGTAAAAGTCGTAACAAGG Clinid Ceratomyxa Primary PCR ≈ 500–850 This study
C_Cot-ITS-R-in CGCAGTTACTGGGACAATCACGGT Clinid Ceratomyxa This study
CCotITS162-for TACGRKWRVARGTACTKTGAGGATG C. cottoidii Nested PCR ≈ 300 This study
CCotITS730-rev TTTTMCGGCAGAGTAACC C. cottoidii This study
CDehITS154-for AGAGTRCGTWTGGTGCGTTGAAG C. dehoopi Nested PCR ≈ 300 This study
CDehITS789-rev TCGAGTCGGGTCAGTTGTTGTTC C. dehoopi This study
Csp1ITS223-for AGTGTAAATATATGSCTACMTG Ceratomyxa sp. 1 Nested PCR ≈ 300 This study
Csp1ITS801-rev TTCATCAAGGGCAAATGTCGTC Ceratomyxa sp. 1 This study
Csp2ITS315-for AAGAGTAAAGATGAATGCCTAC Ceratomyxa sp. 2 Nested PCR ≈ 350 This study
Csp2ITS824-rev TTGTAATTTACAGGGGTCTAGG Ceratomyxa sp. 2 This study
Csp3ITS198-for TGAACGAAAGATGAAWTWAAGC Ceratomyxa sp. 3 Nested PCR ≈ 350–550 This study
Csp3ITS785-rev TGTTACTTGGTTGCCAGTCAG Ceratomyxa sp. 3 This study
Csp4ITS199-for AKGTRGACTGTGCTGCTTGCAG Ceratomyxa sp. 4 Nested PCR ≈ 350 This study
Csp4ITS798-rev TTCTAGTTGTCGGGYTTGTACCG Ceratomyxa sp. 4 This study
Csp5ITS151-for AGGTGAAATGGTGCAGTCTATC Ceratomyxa sp. 5 Nested PCR ≈ 350 This study
Csp5ITS782-rev TTCACCGTAACCATCATTCAC Ceratomyxa sp. 5 This study

PCRs of the first three regions were carried out in a total volume of 25 μl consisting of 1x Taq Buffer, 250 μM of each dNTP, 10 pmol of each primer, 1 U of Taq-Purple polymerase (Top-Bio, Czech Republic), 1 μl of DNA (50 to 150 ng) and sterile distilled H2O. For the PCR screening based on the shorter ITS region, an AmpOne HS-Taq premix (GeneAll Biotechnology, South Korea) was used to prepare PCR reactions containing 10 μl of HS-Taq premix, 0.5 μl of each primer (25 pmol), 8 μl of sterile distilled H2O and 1 μl of DNA (50 to 150 ng). The following cycling parameters were used for these primary/nested PCRs i) SSU rDNA: 95°C 3 min, 30x (95°C 1 min, 52°C/55°C 1 min, 72°C 1 min 40s/1 min 15s), 72°C 7 min, ii) LSU rDNA: 95°C 3 min, 30x (95°C 30 s, 50°C/55°C 30s, 72°C 1 min), 72°C 7 min, iii) longer ITS region: 95°C 3 min, 30x (95°C 30 s, 50°C/56°C 30s, 72°C 1 min/40 s), 72°C 7 min, and iv) shorter ITS region: 95°C 3 min, 30x (95°C 30 s, 56°C/55°C 30s, 72°C 40 s/30s), 72°C 7 min.

PCR products were purified using a Gel/PCR DNA Fragments Extraction Kit (Geneaid Biotech Ltd, USA) and sequenced directly. In most cases, the amplified fragments were cloned into the pDrive Vector with a PCR Cloning Kit (Qiagen, Germany) and transformed into TOP10 chemically competent Escherichia coli cells (Life Technologies, Czech Republic). Plasmid DNA was extracted using a High Pure Plasmid Isolation Kit (Roche Applied Science, Germany) and up to 1–8 (mostly three) colonies (clones) were sequenced (SeqMe, Czech Republic).

A table with detailed information on sample localities and fish species, DNA extracted, numbers of PCR products and clones sequenced for each locus of a particular Ceratomyxa species is supplemented (S1 Table).

Sequence alignments

Five datasets were created for the phylogenetic analyses and the haplotype network: i) Ceratomyxa-SSU rDNA dataset (1176 bp) composed of 70 sequences representing seven newly sequenced Ceratomyxa spp. from clinids (2 sequences for each species, in total 14 sequences), other selected members of the Ceratomyxa clade retrieved from the GenBank (54 sequences) and two outgroup sequences (basal ceratomyxids Ceratomyxa leatherjacketi and Myxodavisia bulani) ii) clinid-Ceratomyxa-SSU rDNA dataset (1465 bp) including 106 SSU rDNA sequences of seven newly sequenced Ceratomyxa spp. from clinids (104 sequences) and two outgroup sequences (Ceratomyxa longipes and Ceratomyxa barnesi), iii) clinid-Ceratomyxa-LSU rDNA dataset (1068 bp) including 122 LSU rDNA sequences of five newly sequenced Ceratomyxa spp. from clinids (118 sequences) and four outgroup sequences (Ceratomyxa appendiculata, Ceratomyxa cardinalis, Ceratomyxa vikrami, Ceratomyxa verudaensis), iv) clinid-Ceratomyxa-ITS dataset (908 bp) including 173 ITS sequences of seven newly sequenced Ceratomyxa spp. from clinids (170 sequences) and three outgroup sequences (Ceratonova shasta, Cystodiscus australis, Parvicapsula sp.), and v) Ceratomyxa cottoidii-ITS haplotype dataset (264 bp) including 76 new ITS sequences of C. cottoidii. This dataset, prepared for the haplotype networks and population genetics analyses, contained sequences from both the longer and the shorter ITS region that were trimmed to the length of the shortest ones (see Table 1). Nucleotide sequences in each dataset were aligned in MAFFT v7.017 algorithm [54] implemented in Geneious v8.0.5 [55] using the E-INS-i multiple alignment method, with a gap opening penalty (–op) of 1.53 and gap extension penalty (–ep) of 0.123. The alignments were manually edited and highly variable sections were removed manually in Geneious.

Phylogenetic analyses

Maximum parsimony (MP) analysis was performed in PAUP* v4.b10 [56], using a heuristic search with random taxa addition, the ACCTRAN option, TBR swapping algorithm, all characters treated as unordered and gaps treated as missing data. Maximum likelihood (ML) analysis was performed in RAxML v7·0·3 [57] using the GTR + Γ model of nucleotide substitution. Bootstraps were based on 1000 replicates for both analyses. Bayesian inference (BI) analysis was performed in MrBayes v3.0 [58], using the GTR + Γ + I model of evolution. Analyses were initiated with random starting trees, four simultaneous MCMC chains sampled at intervals of 100 trees and posterior probabilities estimated from 1 million generations for the Ceratomyxa-SSU rDNA dataset (burn-in 100,000), 3 million generations for the clinid-Ceratomyxa-SSU rDNA dataset (burn-in 600,000), 3.5 million generations for the clinid-Ceratomyxa-LSU rDNA dataset (burn-in 350,000) and the clinid-Ceratomyxa-ITS dataset (burn-in 710,000). Suitable burn-in levels were chosen in Tracer v1.4.1 [59].

Distances

The intraspecific and interspecific divergences were determined from proportional distances (in %) which were calculated in Geneious from the datasets previously used for the phylogenetic analyses. These datasets were additionally adjusted by excluding the very short sequences and by trimming the 5’ and 3’ ends of the remaining sequences to achieve their same length. The intraspecific cut-offs for the studied markers in the group of long branching ceratomyxids from clinid hosts were as follows: SSU rDNA–7.5%, LSU rDNA–10%, ITS region–20%.

Haplotype networks, AMOVA and population genetic statistics

The ITS region (Ceratomyxa cottoidii-ITS haplotype dataset, 76 sequences) was selected for haplotype networks, analysis of molecular variance (AMOVA) and population genetic statistics, as it provides enough sequence variability to distinguish the population structure patterns in myxozoans [60].

To examine the evolutionary relationships among haplotypes in populations of C. cottoidii from different localities and clinid fish species statistical parsimony networks (TCS) based on pairwise differences were constructed using PopART v1.7 [61]. Sampling localities were set as traits for the haplotype network which grouped the sequences (number of sequences = n) with regard to geography (Cape Columbine n = 6, Jacobs Bay n = 2, Granger Bay n = 1, Mouille Point n = 4, Kommetjie n = 1, Kalk Bay n = 24, False Bay n = 1, De Hoop n = 14, Jongensfontein n = 2, Herolds Bay n = 19, Jeffreys Bay n = 2). Fish host species were set as traits for the haplotype network which grouped the sequences with regard to host specificity (C. cottoides n = 61, C. superciliosus n = 9, C. acuminatus n = 1, C. brevicristatus n = 1, M. dorsalis n = 4).

Population structure was estimated by AMOVA in PopART. Individuals represented by ITS region sequences were grouped by sampling locality to populations and then nested within groups delimited by putative oceanographic barriers and host-driven isolation. We performed AMOVAs at three different levels to quantify how much variation is partitioned: (i) among individuals within populations, (ii) among populations within groups, and (iii) among groups of populations. A priori groupings were as follows: i) “Geographic groups” formed according to the geographic separation of the South African coastline [11]: “West coast group” (n = 14): localities Cape Columbine, Jacobs Bay, Granger Bay, Mouille Point, Kommetjie; “South west coast group” (n = 25): Kalk Bay, False Bay; “South east coast group” (n = 37): De Hoop, Jongensfontein, Herolds Bay, Jeffreys Bay, ii) “Barrier groups” formed in accordance with the main barriers to gene flow recognized for the populations of the type fish host Clinus cottoides (HB1, HB2 and HB3 in Fig 1) [11, 12] with an exception that the most eastern locality, Jeffreys Bay, was not analyzed as a separate group due to low sample size (n = 2), so it was merged into a single group with the south coast localities De Hoop, Jongensfontein and Herolds Bay: “B1 group” (n = 8): Cape Columbine, Jacobs Bay; “B2 group” (n = 31): Kalk Bay, False Bay, Granger Bay, Mouille Point, Kommetjie; “B3 group” (n = 37): De Hoop, Jongensfontein, Herolds Bay, Jeffreys Bay, and iii) “Host groups” formed according to fish host species: “Clinus cottoides” (n = 61): C. cottoides from Kalk Bay, De Hoop, Jongensfontein, Herolds Bay, Jeffreys Bay; “Clinus superciliosus” (n = 9): C. superciliosus from Cape Columbine, Mouille Point, Kommetjie; and “Muraenoclinus dorsalis” (n = 4): M. dorsalis from Jacobs Bay, Granger Bay and Mouille Point. The variation was not quantified for C. acuminatus and C. brevicristatus due to small sample size (1 sequence for each host species).

To characterize the diversity of populations and their demographic history we performed several population genetic statistics for C. cottoidii groups that showed significant variation among the groups tested in the previous AMOVA (i.e. above defined geographic and barrier groups). DNA polymorphism statistics (number of haplotypes, number of segregating sites, nucleotide genetic diversity, haplotype diversity) and statistical tests aiming at detection of population size changes (Tajima's D, Fu & Li's F and D and Ramos-Onsins and Rozas R2) were calculated using DNAsp v6.10.04 [62]. The significance of all tests was determined by 10,000 coalescent simulations implemented in DNAsp. Highly significant negative values of Fs and small positive values of R2 indicate population growth whereas positive Fs values can result from balancing selection, population bottlenecks or the presence of population structure [63, 64]. Significantly negative values of Tajima’s D indicate recent range expansion (excess of low frequency polymorphisms), whereas significantly positive values are a signature of bottleneck or selection. A non-significant D is consistent with a population at drift-mutation equilibrium [64, 65].

Results

Ceratomyxa diversity as observed by light microscopy

Myxospores (Fig 2A–2E) and/or plasmodia (Fig 2F) of the genus Ceratomyxa were found in 40% of examined samples with the majority represented by infected gall bladders (58/152), and with few of them (3/152) found in bile ducts (liver). High morphological plasticity of Ceratomyxa spores was commonly observed in our samples with spore morphotypes similar to previously described C. cottoidii (Fig 2A) and C. dehoopi (Fig 2B) typical for their slender spores, however, oval round spores suggestive of novel species were also frequently seen (Fig 2C and 2D). Spore shape and size (length and thickness) varied even within single fresh samples. Aberrant Ceratomyxa spores with three polar capsules and three valves were occasionally observed (Fig 2E). Concurrent infections of Ceratomyxa with other myxozoan genera, Sphaeromyxa and Kudoa were also detected.

Fig 2. Light microscopy pictures of Ceratomyxa spp. spores of different morphotypes and plasmodia from clinid fish as seen in nomarski differential interference contrast.

Fig 2

(A) Ceratomyxa cottoidii from Clinus cottoides from Herolds Bay. (B) Ceratomyxa dehoopi from Clinus superciliosus from Jacobs Bay. (C) Ceratomyxa sp. from Clinus cottoides from Jongensfontein. (D) Ceratomyxa sp. from Muraenoclinus dorsalis from Mouille Point. (E) Aberrant spore of Ceratomyxa sp. from Clinus cottoides from De Hoop. (F) Plasmodia of Ceratomyxa sp. from Clinus cottoides from Jongensfontein. Scale bar 5 μm (A–E), 20 μm (F).

Phylogenetic positioning of clinid ceratomyxids within the Ceratomyxa clade

The Ceratomyxa clade is an assemblage of diverse groups that evolved initially at different substitution rates and some of them have undergone subsequent radiation events [46]. This pattern is evident in ceratomyxids from South African clinids that clustered into a single well-supported long-branched lineage (“Ceratomyxa group from clinid fish“) which further split into several short-branched species (Fig 3). The whole lineage grouped with other extremely long-branching taxa with various scenarios in tree topology, most probably due to LBA artifacts. In ML and BI analyses (Fig 3), clinid ceratomyxids grouped with Ceratomyxa aegyptiaca from soleid fish from a Mediterranean coastal lagoon in northern Africa and Ceratomyxa longipes from a gadid fish sampled in the North Sea. The whole group then clustered either with a group including Ceratomyxa ayami and Ceratomyxa sp. M0304 (ML analysis, Fig 3) or formed a polytomy with two groups (Ceratomyxa ayami and Ceratomyxa sp. M0304; C. anko, C. appendiculata, C. pantherini, C. vikrami and Pseudalataspora kovalevae, BI analysis, BI posterior probability = 0.81). Another alternative in tree topology was observed in MP analysis, where clinid ceratomyxids grouped with C. longipes and then with the group formed by C. anko, C. appendiculata, C. pantherini, C. vikrami and Pseudalataspora kovalevae (MP bootstrap support <50%).

Fig 3. SSU rDNA-based maximum likelihood phylogenetic tree showing the position of clinid ceratomyxids within the Ceratomyxa clade.

Fig 3

Nodal supports are shown for maximum likelihood and maximum parsimony bootstraps and Bayesian inference posterior probabilities. Branches of Ceratomyxa ayami and Ceratomyxa sp. M0304 were shortened to 50% of their original length. Ceratomyxa leatherjacketi and Myxodavisia bulani were used as outgroups.

Phylogenetic relationships within the clinid Ceratomyxa group

In this study, we amplified almost 400 clinid Ceratomyxa sequences belonging to different molecular markers of the nuclear ribosomal operon (SSU rDNA: n = 104; LSU rDNA: n = 118; Longer and shorter ITS region: n = 170, S1 Table) that were all used for subsequent phylogenetic analyses. After performing the analyses, unique sequence data representing each Ceratomyxa species from different fish hosts and localities were selected for GenBank submission (74 sequences, S2 Table). All other sequences are available in the S1 Dataset containing the untrimmed and trimmed fasta datasets of all molecular markers analyzed in this study. Blasting of newly obtained sequences against GenBank entries has shown that our data represent the first publicly available sequences of Ceratomyxa spp. from clinids. Phylogenetic analyses of SSU rDNA (S1 Fig) and ITS data (Fig 4) recognized seven well-supported novel lineages of Ceratomyxa, likely species, from South African clinids, whereas only five lineages were recovered in the LSU rDNA-based tree (S2 Fig) due to missing data from the two remaining lineages (Ceratomyxa sp. 2 and Ceratomyxa sp. 3). Based on the consensus of biological data (type host species and type locality) and, wherever possible, morphological data two of the lineages are considered to represent the previously described species C. cottoidii and C. dehoopi. The remainder of the sequences likely represents novel species (see paragraph “PCR screening, prevalence, distribution, co-infections and morphological remarks”). In the ITS-based tree, C. cottoidii clustered with a well-supported clade of Ceratomyxa sp. 1, Ceratomyxa sp. 2 and Ceratomyxa sp. 3 to create a common sister group to C. dehoopi (Fig 4). However, positioning of C. cottoidii and C. dehoopi varied depending on the marker used (S1 and S2 Figs). Another stable clade in all single gene analyses was formed by Ceratomyxa sp. 4 and Ceratomyxa sp. 5. Some members, i.e. Ceratomyxa dehoopi and Ceratomyxa sp. 3, created long branches to their sister taxa within the clinid Ceratomyxa group (Figs 3 and 4, S1 and S2 Figs).

Fig 4. Maximum likelihood phylogenetic tree of the ITS region showing the relationships of Ceratomyxa spp. from South African clinids.

Fig 4

Nodal supports are shown for maximum likelihood and maximum parsimony bootstraps and Bayesian inference posterior probability. Cystodiscus australis, Ceratonova shasta and Parvicapsula sp. were used as outgroups; branches of the first two outgroup taxa were shortened to 50% of their original length. Host species and localities are shown with colored symbols.

Species distances

SSU rDNA sequence variability among clinid ceratomyxids ranged from 7.8 to 15.7% whereas intraspecific divergence ranged from 0.4% in Ceratomyxa sp. 5 to the significantly higher level (7%) in C. cottoidii (Fig 5A). A similar trend was observed for the LSU rRNA gene with interspecific variation of 18.2–28.3% and intraspecific variation ranging from 4.7 to 9% (Fig 5B). The highest variation was calculated for the ITS region showing 20.9–33.6% interspecific divergence and 1.7–18.4% intraspecific distance (Fig 5C).

Fig 5.

Fig 5

Graphic interpretation of maximum intraspecific distances plotted against minimum interspecific distances (dissimilarities) among the sequences of (A) SSU rDNA, (B) LSU rDNA and (C) ITS region of clinid Ceratomyxa spp. Intraspecific cut-off values (thresholds) are shown with thick grey-colored line.

PCR screening, prevalence, distribution, co-infections and morphological remarks

Species-specific PCR screening revealed 100% of samples positive at least for one Ceratomyxa species compared to only 40% parasite prevalence determined based on morphological observations (see paragraph “Ceratomyxa diversity as observed by light microscopy”). By species-specific PCR, C. cottoidii was recognized to be a true generalist with a high prevalence in all fish host species including its type host C. cottoides, while general clinid Ceratomyxa PCR revealed its presence in four out of five fish host species (Table 2). It is widely distributed from the west (Cape Columbine) to the east coast (Sea View) of South Africa with almost 100% prevalence at all studied localities. The only exception is its lower prevalence in Jacobs Bay (west coast) (Fig 6) where it was missing in all C. superciliosus and present in 80% of M. dorsalis samples. However, C. superciliosus was a common host of C. cottoidii at other localities (Table 2). On the other side, C. dehoopi is a parasite with a narrower host range (three out of five clinid species) and with the highest prevalence in C. superciliosus (Table 2). Its distributional range spans from Cape Columbine (west coast) to Herolds Bay (south coast). It was not detected at any of the two east coast localities (Fig 6). The remainder of Ceratomyxa spp. is represented by generalists, present in 4–5 examined fish species and distributed from the west to the east coast of South Africa with variable prevalence at each locality (Table 2, Fig 6). Importantly, the application of species-specific PCR was especially crucial for the assessment of the fish host species spectra of C. dehoopi, Ceratomyxa sp. 1 and Ceratomyxa sp. 5 for which general clinid Ceratomyxa PCR amplification was suggestive of their strict host specificity only in one fish species (Table 2).

Table 2. Prevalence of studied Ceratomyxa spp. in the fish host samples identified by PCR with general Ceratomyxa SSU rDNA, LSU rDNA and longer ITS region primers and species-specific shorter ITS-based PCR screening.

Myxozoan species Marker Clinus cottoides Clinus superciliosus Clinus acuminatus Clinus brevicristatus Muraenoclinus dorsalis
Ceratomyxa cottoidii SSU rDNA 80% (31/39) 22% (2/9) 100% (4/4) 0% (0/1) 67% (2/3)
LSU rDNA 86% (18/21) 14% (1/7) 100% (2/2) 0% (0/1) 100% (1/1)
ITS region 71% (20/28) 14% (1/7) N/A 0% (0/1) 100% (1/1)
Screening 98% (110/112) 67% (12/18) 100% (6/6) 100% (1/1) 93% (14/15)
Ceratomyxa dehoopi SSU rDNA 0% (0/39) 33% (3/9) 0% (0/4) 0% (0/1) 0% (0/3)
LSU rDNA 0% (0/21) 29% (2/7) 0% (0/2) 0% (0/1) 0% (0/1)
ITS region 0% (0/28) 43% (3/7) N/A 0% (0/1) 0% (0/1)
Screening 6% (7/112) 56% (10/18) 17% (1/6) 0% (0/1) 0% (0/15)
Ceratomyxa sp. 1 SSU rDNA 21% (8/39) 0% (0/9) 0% (0/4) 0% (0/1) 0% (0/3)
LSU rDNA 38% (8/21) 0% (0/7) 0% (0/2) 0% (0/1) 0% (0/1)
ITS region 32% (9/28) 0% (0/7) N/A 0% (0/1) 0% (0/1)
Screening 55% (61/112) 39% (7/18) 17% (1/6) 100% (1/1) 13% (2/15)
Ceratomyxa sp. 2 SSU rDNA 3% (1/39) 33% (3/9) 0% (0/4) 0% (0/1) 0% (0/3)
LSU rDNA 0% (0/21) 0% (0/7) 0% (0/2) 0% (0/1) 0% (0/1)
ITS region 0% (0/28) 14% (1/7) N/A 0% (0/1) 0% (0/1)
Screening 12% (13/112) 83% (15/18) 17% (1/6) 100% (1/1) 13% (2/15)
Ceratomyxa sp. 3 SSU rDNA 10% (4/39) 0% (0/9) 0% (0/4) 0% (0/1) 33% (1/3)
LSU rDNA 0% (0/21) 0% (0/7) 0% (0/2) 0% (0/1) 0% (0/1)
ITS region 7% (2/28) 14% (1/7) N/A 0% (0/1) 100% (1/1)
Screening 29% (32/112) 22% (4/18) 0% (0/6) 100% (1/1) 47% (7/15)
Ceratomyxa sp. 4 SSU rDNA 3% (1/39) 11% (1/9) 0% (0/4) 100% (1/1) 0% (0/3)
LSU rDNA 10% (2/21) 29% (2/7) 0% (0/2) 100% (1/1) 0% (0/1)
ITS region 7% (2/28) 43% (3/7) N/A 100% (1/1) 0% (0/1)
Screening 14% (16/112) 67% (12/18) 17% (1/6) 100% (1/1) 7% (1/15)
Ceratomyxa sp. 5 SSU rDNA 0% (0/39) 22% (2/9) 0% (0/4) 0% (0/1) 0% (0/3)
LSU rDNA 0% (0/21) 43% (3/7) 0% (0/2) 0% (0/1) 0% (0/1)
ITS region 0% (0/28) 43% (3/7) N/A 0% (0/1) 0% (0/1)
Screening 9% (10/112) 61% (11/18) 33% (2/6) 0% (0/1) 20% (3/15)

N/A: PCR not done.

Fig 6. Prevalence of clinid Ceratomyxa spp. at each locality based on the PCR-screening of the shorter ITS region of all samples.

Fig 6

Co-infections of single fish host samples by several Ceratomyxa species were extremely common and occurred in 71% of all samples. One sample from C. superciliosus from Cape Columbine even contained all Ceratomyxa spp. which was confirmed by variable shapes and dimensions of myxospores observed in this sample. On the other hand, many samples with single spore morphotype observed by LM showed multiple species infections. Single infections (29% of all samples) were mainly represented by C. cottoidii (42 samples) and only two samples exclusively contained C. dehoopi or Ceratomyxa sp. 5.

We were not able to draw any conclusions regarding the measurements of C. cottoidii spores from the original species description (Reed et al. 2007) and from our samples with single infections, for which LM measurements were taken, as the comparison would be biased by potential spore shrinkage of our ethanol-fixed material (details on spore measurements in S3 Table). Unfortunately, the lack of any samples with single infections of C. dehoopi and Ceratomyxa sp. 1–5 accompanied by spore measurements prevented analysis of spore morphometry for species comparison/descriptions. Therefore, Ceratomyxa sp. 1–5 currently represent phylogenetic lineages and remain undescribed species.

Haplotype networks of Ceratomyxa cottoidii populations

The haplotype network of C. cottoidii ITS region sequences with traits defined as geographic localities was represented by 39 haplotypes and showed a considerable complexity of haplotype grouping (Fig 7A). Isolates of C. cottoidii fell into six main haplotype groups. Haplotype group A, separated from the rest of the network by 11 mutations (nucleotide changes), was represented by samples from Cape Columbine, the most western locality of our sampling range. Haplotype groups B and C were mainly created by samples from Kalk Bay (south west coast) mixed with samples from the western localities. Haplotype group D was mainly represented by samples from De Hoop and Herolds Bay (south east coast) mixed with samples from the south-western locality Kalk Bay. Haplotype group E contained exclusively samples from the south-eastern coast. Two haplotypes from the south-eastern coast locality Jeffreys Bay formed haplotype group F separated from haplotype group E by two mutations. Haplotype groups B–E showed a radial branching pattern with the main haplotype surrounded by satellite low frequency haplotypes which is typical for young expanding populations. Due to small sample size (4 and 2 sequences, respectively), existence of a similar burst pattern cannot be excluded for haplotype groups A and F (Fig 7A).

Fig 7. Haplotype network of Ceratomyxa cottoidii ITS dataset calculated using statistical parsimony networks (TCS) in PopArt v1.7.

Fig 7

Haplotype network with (A) sampling localities and (B) host species used as traits. The sizes of haplotypic nodes are relative to the sample size. Each line represents one mutational step and dots represent alternative one-step mutations.

The separation of haplotypes according to the fish host species was not evident in our analyses. Haplotypes from different fish species mixed with each other and the only two unmixed groups of parasite haplotypes were biased by their exclusive origin from a single host species (C. cottoides) sampled in Kalk Bay, De Hoop, Jongensfontein, Herolds Bay, and Jeffreys Bay, localities from which data from other host species were not available (Fig 7B).

Population genetic structure of Ceratomyxa cottoidii

Approximately half (55.4%) of the variation in C. cottoidii was attributable to highly significant differences within populations whereas about 42.6% was associated with significant differences among geographic groups. On the other hand, very low variation was observed among populations (2.6%). The second AMOVA showed slightly higher variation among the barrier groups (50.0%) with highly significant covariance components. The within population variation was comparable with the one from the previous analysis. The lowest level of among group variation was found for AMOVA of host groups (26.0%), the analysis reaching highly significant levels only within and among populations (Table 3). In summary, our a priori AMOVA settings dividing C. cottoidii populations into groups delimited by major oceanographic barriers, especially if followed by the separation according to host gene flow barriers, explained significant amount of variation, however, additional factors except of fish host species, seem to impact population structuring of C. cottoidii. As revealed by AMOVA and haplotype networks, calculations of population genetics statistics for C. cottoidii using the dataset of parasite sequences from different fish species and their subsequent comparison with the population data from the type host C. cottoides is not a problem due to the lack of significant structuring of C. cottoidii populations according to fish host species.

Table 3. AMOVA partitioning of genetic variance for shorter ITS region within populations and groups of Ceratomyxa cottoidii.

A priori groupings followed the separation of C. cottoidii sequences according to the i) geography of South African coastline (geographic groups), ii) main barriers to gene flow recognized for the populations of the fish host Clinus cottoides (barrier groups) and iii) fish host species (host groups).

% variation Geographic groups Barrier groups Host groups
Among groups 42.58* 50.04** 26.02
Among populations 2.55 -3.06 25.35**
Within populations 55.36** 53.02** 48.63**

The covariance components are indicated as

** for highly significant (P < 0.01) and

* for significant (P < 0.05).

Sequence diversity indices and demographic history of Ceratomyxa cottoidii populations

The differences between C. cottoidii populations based on geographic separation observed in haplotype networks and AMOVA were also evident in their population genetics statistics (Table 4). Results of DNA polymorphism statistical analysis showed generally high values of haplotype diversity with small differences between the analyzed groups. From the total of 39 haplotypes, the highest number of haplotypes was found in the south west (n = 20) and south east coast (n = 20) for the geography-related groups and in B2 (n = 22) for barrier groups. The nucleotide diversity was the lowest for the south east coast (resp. B3 group). Tajima's test showed significant negative values only for south east and B3 populations whereas Fu and Li's tests revealed significant negative values for the south west, south east coast, B2 and B3 populations. The R2 test was significant only for the south east coast and B3 group populations (Table 4). The results indicate that the south west, south east coast, B2 and B3 populations are expanding with the evidence of recent expansion in south east coast and B3 populations. In contrast, equilibrium and no population growth are suggested for the west and B1 populations at the edge of the distributional range of C. cottoidii.

Table 4. Results of population genetics statistics of ITS region for Ceratomyxa cottoidii.

Statistic tests Geographic groups Barrier groups
West coast South west coast South east coast B1 B2 B3
Number of sequences (n) 14 25 37 8 31 37
Number of haplotypes (h) 7 20 20 5 22 20
Number of segregating sites (S) 27 38 20 23 38 20
Haplotype diversity (Hd) 0.901 0.983 0.908 0.857 0.972 0.908
Nucleotide diversity (π) 0.043 0.042 0.015 0.045 0.038 0.015
Tajima's D (D) 1.233 0.259 -0.688* 1.470 0.040 -0.688*
Fu and Li's D* (D*) 0.968 -1.030** -1.512** 0.260 -1.743** -1.512**
Fu and Li's F* (F*) 0.893 -0.785* -1.453** 0.363 -1.408** -1.453**
Ramos-Onsins & Rozas’ (R2) 0.197 0.125 0.086* 0.227 0.112 0.086*

The total number of unique haplotypes for all groups is 39; some haplotypes are shared by the groups. The statistical significance of covariance components is indicated as

** highly significant (P < 0.05) and

* significant (P < 0.1)

Discussion

This is the first study to determine myxozoan diversity, distribution, prevalence and host specificity in a variety of clinid fish species, typical inhabitants of intertidal environments in South Africa. Moreover, the evolutionary history of the rapidly evolving clinid ceratomyxids has been assessed within this group as well as within the Ceratomyxa clade. Lastly, the most common clinid parasite in South Africa, Ceratomyxa cottoidii, has been subjected to population genetics analyses and its population structure has been compared with the data known for its type fish host, Clinus cottoides. This is a novel approach in myxozoan research as none of the previous studies compared the host-parasite genetic structure as they were solely focused on parasite population structuring [60, 6669] and phylogeography [7072].

We have revealed a high degree of species diversity represented by seven closely related Ceratomyxa spp. from the intertidal fishes Clinidae along the coast of South Africa. Such parasite radiation is probably the result of multiple speciation events triggered by limited host dispersal within this endemic area. Future application of a holistic approach in species descriptions based on detailed LM examination, proper photographic documentation and in-depth molecular identification is a good direction in accounting myxozoan species diversity, which currently seems to be underestimated [30, 7376].

PCR screening with species-specific primers was crucial for the discovery of the remarkably high prevalence of ceratomyxids in clinid fish, with all examined samples infected with at least one parasite species and with some ceratomyxids even reaching 100% prevalence in certain hosts and at certain sites. Our findings underpin the rock pools as ideal habitats for promoting myxozoan life cycles and for the establishment of a diverse assemblage of organisms as reported previously for other animal groups [1416]. Specific PCR assays were also essential for the exact assessment of Ceratomyxa spp. diversity in clinids, as frequent mixed infections, indeed common in myxozoans [17, 40], complicated such evaluation. Present evidence of multiple Ceratomyxa spp. infections indicates that the extreme spore variability observed in our samples, most likely resulted from concurrent infections of closely related species of different morphology. This may also be a case for Ceratomyxa sp. from M. dorsalis [37]. Moreover, high rates of mixed Ceratomyxa spp. infections encountered in such a restricted organ space are suggestive of a low or even lacking within-host competition in this niche. Nevertheless, a temporal and spatial separation of the infections during the host’s development may still occur similarly as reported for two competing marine myxozoan species [77].

In this study, we have unexpectedly revealed that Ceratomyxa spp. from South African clinids are not strictly host-specific parasites as a general rule for other ceratomyxids [2530]. This may be caused by the close evolutionary relationships of South African clinids [8] and associated likely similar immune system traits of these fish as well as by generally low host immune response to coelozoic myxozoan parasites [78, 79]. We assume that several clinid fish species are true hosts for individual Ceratomyxa spp. as spores have been observed in the site of sporogony (gall bladder) at least in several samples in which the parasite has been molecularly detected.

The phylogenetic relationships of clinid Ceratomyxa spp. with other ceratomyxids were provided in this study. However, their accurate assessment was difficult due to their unstable clustering and weak nodal supports within the Ceratomyxa clade most probably due to LBA artifact. Nevertheless, increased taxon sampling with some closely related species, possibly from other blenniiform fishes, would facilitate to break the long-branch [46, 80] and thus improve inferring the exact positioning of this fast-evolving parasite group.

There is no universal criterion regarding what constitutes a sufficient level of sequence variation to represent distinct species in the genus Ceratomyxa. The intraspecific threshold values used for clinid ceratomyxids in present study are higher than commonly reported in other myxozoan clades [17] but they have been carefully evaluated with regard to the fast evolution of the studied molecular markers in this long-branched parasite group and we recommend using these cut-offs for this specific group of ceratomyxids in future studies. For example, relatively low values of maximum SSU rDNA intraspecific divergences were reported for ceratomyxids from Indian (up to 0.8%) [81], Australian (up to 1.3%) [26, 27, 30] and North Atlantic fishes (up to 1.6%) [46], whereas wide ranges up to 7% in C. cottoidii were encountered for South African clinid ceratomyxids (present study). Such large intraspecific variability of C. cottoidii may be a result of fast evolution of its genes concordant with increased substitution rates and associated tree branch lengths [82]. Therefore, settings of the intraspecific cut-offs and the following assessment of intraspecific and interspecific variation of a molecular marker have to be taken into account in relation to the substitution rate in a particular Ceratomyxa group. As evolutionary rates also vary for other myxozoan lineages, investigations into the sequence variation for a particular phylogenetic group are crucial for the assessment of the species concept in the Myxozoa. Moreover, it would be desirable to assess the intragenomic variation of ribosomal sequences for each myxozoan species from one individual (spore), however, low DNA yields associated with single spore extractions are limiting factors for such approach. Information about the intragenomic variation would be of interest also in the present population genetics analysis of C. cottoidii, however, distinguishing of multiple haplotype infections from the real intragenomic variability was not possible due to the fact that DNA was extracted from hundreds of spores from each infected fish individual. Moreover, spores in each host specimen may have been a genetic mixture that developed after an infection from a mixed pool of invertebrate alternate hosts harboring different C. cottoidii haplotypes. It is highly probable that intragenomic variation exists in C. cottoidii but this would only have a significant effect on “within individual level of variation” that was not assessed in our analyses. An alternative how to get around the intragenomic variability issue would be the use of mitochondrial (maternally inherited) genes, for example cytochrome c oxidase I or cytochrome b, but this approach was unfortunately not feasible in our case as such genes are difficult to amplify in myxosporeans in general and lead to several misinterpretations due to occurrence of pseudogenes (numts) [73].

C. cottoidii was shown to represent the most common parasite of clinids with a widespread distribution along the South African coastline. Investigation of a potential host-driven isolation of C. cottoidii populations, impelled by the newly discovered generalist life history of this parasite, showed no evidence for separation of parasite haplotypes by fish hosts. However, a certain bias may exist as the largest haplotype groups were characterized by a single host species. On the other hand, population structuring based on geography-related groupings (geographic and barrier groups) showed important overlapping patterns with fish host population structure [11, 12] consistent with the hypothesis that reduced host dispersal, as typical for C. cottoides [10], enhances parasite community differentiation. C. cottoidii population structure is formed by young expanding populations as well as by older populations in equilibrium. The older populations are represented by haplotypes from B1 group, which includes the most western localities, most probably at the edge of the distributional range of C. cottoidii. In these peripheral populations, no haplotype mixture is evident in the associated haplotype group A, likely representing the populations under recent speciation, which further supports the clustering of Cape Columbine sample (nr. 1462) as a separate lineage within (Fig 4) or at the base of the Ceratomyxa clade (S1 and S2 Figs). The young expanding populations of C. cottoidii are mainly represented by haplotypes from groups B2 and B3 covering western, south-western and south-eastern South African localities. Though some of the western localities are present in geographically mixed haplotype groups B and C (west + south west coast) and D (south west + south east coast), the west coast haplotypes never mixed with south east coast haplotypes. This pattern of population mixing does imply existence of some gene flow barriers on one side along with still ongoing migration between south west coast and south east coast locations on the other side, which is most probably facilitated by Agulhas ring eddies between Cape of Good Hope and Cape Agulhas in the zone of contact of Agulhas and Benguela current (Fig 1). Haplotype network suggests that some additional barrier to gene flow may exist within the south east coast populations (separation of haplotype group F), however, analysis of this hypothesis by splitting the south east group into south coast (De Hoop, Jongensfontein, Herolds Bay) and east coast (Jeffreys Bay) groups was not feasible due to low sample size from the eastern locality. Therefore, a more efficient fish taxon sampling, especially from the peripheral eastern and western localities, and following haplotype sequencing are necessary to support our conclusions which would additionally provide more data for detailed gene flow and migration analyses.

Our data suggest that oceanographic barriers around Cape Point, Cape Agulhas and east of Jeffreys Bay (east of Algoa Bay) region play important roles in the distribution and population structuring of the parasite as they do for the fish host Clinus cottoides [6, 11, 83]. This may be caused by closely linked host-parasite co-evolution in these space-limited habitats as genetic structure and co-divergence of host-parasite populations is higher in parasites infecting hosts with limited dispersal abilities [84]. However, only 43–50% of molecular variation in C. cottoidii sequences was ascribed to differences among groups associated with geography (Table 3) while a higher percentage of variation among groups (localities) was encountered for C. cottoides populations exhibiting significant oceanographic separation [11]. Such difference in variation may be linked to the complex myxozoan life cycle involving a vertebrate (intermediate) and an invertebrate (definitive) host, which adds another variable to the dispersal and associated population structure of C. cottoidii, a myxozoan with a presumably two-host life cycle [34]. C. cottoides is most commonly associated with mid-shore areas [2, 12], and while this fish host shows strong site fidelity, its ceratomyxid parasites may have a high dispersal capacity by distributing spores to other rock pools via tidal water exchange or wave splashes. An invertebrate host can be present in these rock pools or alternatively, it can inhabit other terrestrial or planktonic habitats and thus contributing further to the gene flow in C. cottoidii populations. The high infection prevalence in fish, however, suggests that the invertebrate host habitat overlaps with that of C. cottoides. Excellent candidates that are common in the intertidal rocky shore habitats are sedentary polychaetes (Annelida: Polychaeta) from the families Cirratulidae, Spionidae, Orbiniidae, Arenicolidae, Flabelligeridae, Sabellariidae, Terebellidae, Sabellidae, Serpulidae and Spirorbidae [52, 85]. A systematic approach specifically targeting the species present in rock pools in order to find myxozoan parasites within these is needed.

Conclusions

We show that ceratomyxid species from South African clinids are a diverse group of fast evolving closely related parasites with high prevalence in their fish hosts, little host specificity and frequent concurrent infections, most probably as a result of radiation and no competition within the space limited host niche. Ceratomyxa cottoidii shows overlapping population structure with its type fish host, C. cottoides, however, data on the definitive host is required to unravel the complex network.

Several genetic studies of marine organisms, including C. cottoides, have shown that the sections of South African coastline coined as marine protected areas, representing hotspots of species richness and endemism and including a high diversity of habitats [86], require more protection [11, 83]. As both parasite diversity and distribution are closely linked to that of the host, any change in the conservation status and distribution of the host directly impacts that of the parasite and vice versa [87]. As Ceratomyxa parasites of clinid fishes are well represented in the South African marine fauna (present study), they may significantly impact their fish host populations. Investigations into the aquatic parasite biodiversity and distribution are of highest priority, as global climate change can shift the balance in healthy parasite-rich ecosystems where parasites represent one of the most susceptible groups to environmental change [87]. Besides the implications of global climate change for fish populations, a more detailed research of myxozoan life cycles as well as the roles of these parasites in food webs and trophic transfers and their impact on the health of fish hosts are desirable not only from a South African [23] but also from a global perspective.

Supporting information

S1 Table. List of clinid fish samples molecularly examined on the presence of Ceratomyxa spp.

A detailed information on the host species and organ, locality, result of species-specific ITS-based PCR screening (+/-) and number of SSU rDNA, LSU rDNA and ITS PCR amplicons and/or clone sequences are available for each Ceratomyxa species along with the GenBank accession numbers (corresponding to those present in the phylogenetic trees). gb = gall bladder.

(XLSX)

S2 Table. GenBank accession numbers of newly amplified Ceratomyxa sequences.

(DOCX)

S3 Table. List of spore measurements of Ceratomyxa cottoidii from the present study and from the original species description.

(DOCX)

S1 Dataset. The fasta datasets of untrimmed and trimmed molecular markers used for the phylogenetic analyses.

(TXT)

S1 Fig. Maximum likelihood phylogenetic tree of the SSU rDNA sequences showing the relationships of Ceratomyxa spp. from South African clinids.

Nodal supports are mapped for maximum likelihood and maximum parsimony bootstraps and Bayesian inference posterior probabilities. Ceratomyxa barnesi and Ceratomyxa longipes, for which the branches were shortened to 50% of their original length, were used as outgroups. Host species and localities are shown with colored symbols.

(EPS)

S2 Fig. Maximum likelihood phylogenetic tree of the LSU rDNA sequences showing the relationships of Ceratomyxa spp. from South African clinids.

Nodal supports are mapped for maximum likelihood and maximum parsimony bootstraps and Bayesian inference posterior probabilities. Ceratomyxa appendiculata, Ceratomyxa vikrami, Ceratomyxa cardinalis and Ceratomyxa verudaensis, for which the branches were shortened to 50% of their original length, were used as outgroups. Host species and localities are shown with colored symbols.

(EPS)

Acknowledgments

Thank you to staff at CapeNature's De Hoop Nature Reserve for accommodating the field work and to Götz Froeschke (at that time Stellenbosch University) for the help in sampling fish. We would like to express special gratitude to Jan Štefka (Institute of Parasitology, BC AVČR) and Dagmar Jirsová (Institute of Parasitology, BC AVČR; Faculty of Science, Masaryk University, Brno; Faculty of Forestry and Wood Technology, Mendel University in Brno) for their advice in population genetics analyses. We also thank to two reviewers for their helpful suggestions.

Data Availability

All relevant data are within the paper and its Supporting Information files and newly obtained sequences are available from the NCBI database (accession numbers MG238427-MG238500).

Funding Statement

The authors acknowledge the Czech Science Foundation (16-20744S to Ivan Fiala, 505/12/G112), the National Research Foundation (Thuthuka) of South Africa (TTK200705020002008 to Cecile C. Reed) and the University of Cape Town Research Committee. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Huggett J, Griffiths CL. Some relationships between elevation, physicochemical variables and biota of intertidal rock pools. Mar Ecol Prog Ser. 1986;29(2): 189–197. [Google Scholar]
  • 2.Bennett BA, Griffiths CL. Factors affecting the distribution, abundance and diversity of rock-pool fishes on the Cape Peninsula, South Africa. S Afr J Zool. 1984;19(2): 97–104. [Google Scholar]
  • 3.Prochazka K, Griffiths CL. The intertidal fish fauna of the west coast of South Africa—Species, community and biogeographic patterns. S Afr J Zool. 1992;27(3): 115–120. [Google Scholar]
  • 4.Teske PR, von der Heyden S, McQuaid CD, Barker NP. A review of marine phylogeography in southern Africa. S Afr J Sci. 2011;107(5–6): 43–53. [Google Scholar]
  • 5.von der Heyden S, Lipinski MR, Matthee CA. Remarkably low mtDNA control region diversity in an abundant demersal fish. Mol Phylogenet Evol. 2010;55(3): 1183–1188. doi: 10.1016/j.ympev.2009.09.018 [DOI] [PubMed] [Google Scholar]
  • 6.von der Heyden S, Bowie RCK, Prochazka K, Bloomer P, Crane NL, Bernardi G. Phylogeographic patterns and cryptic speciation across oceanographic barriers in South African intertidal fishes. J Evol Biol. 2011;24(11): 2505–2519. doi: 10.1111/j.1420-9101.2011.02382.x [DOI] [PubMed] [Google Scholar]
  • 7.Muller CM, von der Heyden S, Bowie RCK, Matthee CA. Oceanic circulation, local upwelling and palaeoclimatic changes linked to the phylogeography of the Cape sea urchin Parechinus angulosus. Mar Ecol Prog Ser. 2012;468: 203–215. [Google Scholar]
  • 8.Lin HC, Hastings PA. Phylogeny and biogeography of a shallow water fish clade (Teleostei: Blenniiformes). BMC Evol Biol. 2013;13: 18 doi: 10.1186/1471-2148-13-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Stepien CA. Evolution and biogeography of the Clinidae (Teleostei, Blennioidei). Copeia. 1992(2): 375–392. [Google Scholar]
  • 10.Wright D, Bishop JM, Matthee CA, von der Heyden S. Genetic isolation by distance reveals restricted dispersal across a range of life histories: Implications for biodiversity conservation planning across highly variable marine environments. Diversity and Distributions. 2015;21(6): 698–710. [Google Scholar]
  • 11.von der Heyden S, Prochazka K, Bowie RCK. Significant population structure and asymmetric gene flow patterns amidst expanding populations of Clinus cottoides (Perciformes, Clinidae): Application of molecular data to marine conservation planning in South Africa. Mol Ecol. 2008;17(22): 4812–4826. doi: 10.1111/j.1365-294X.2008.03959.x [DOI] [PubMed] [Google Scholar]
  • 12.von der Heyden S, Gildenhuys E, Bernardi G, Bowie R. Fine-scale biogeography: Tidal elevation strongly affects population genetic structure and demographic history in intertidal fishes. Front Biogeogr. 2013;5(1): 29–38. [Google Scholar]
  • 13.Holleman W, Von Der Heyden S, Zsilavecz G. Delineating the fishes of the Clinus superciliosus species complex in southern African waters (Blennioidei: Clinidae: Clinini), with the validation of Clinus arborescens Gilchrist & Thompson, 1908 and Clinus ornatus Gilchrist & Thompson, 1908, and with descriptions of two new species. Zool J Linnean Soc. 2012;166(4): 827–853. [Google Scholar]
  • 14.Firth LB, Schofield M, White FJ, Skov MW, Hawkins SJ. Biodiversity in intertidal rock pools: Informing engineering criteria for artificial habitat enhancement in the built environment. Mar Environ Res. 2014;102: 122–130. doi: 10.1016/j.marenvres.2014.03.016 [DOI] [PubMed] [Google Scholar]
  • 15.Astles KL. Patterns of abundance and distribution of species in intertidal rock pools. J Mar Biol Assoc UK. 1993;73(3): 555–569. [Google Scholar]
  • 16.Mouritsen KN, Poulin R. Parasitism, community structure and biodiversity in intertidal ecosystems. Parasitology. 2002;124: S101–S117. [DOI] [PubMed] [Google Scholar]
  • 17.Okamura B, Gruhl A, Bartholomew JL. Myxozoan Evolution, Ecology and Development. Cham Heidelberg New York Dordrecht London: Springer; 2015. [Google Scholar]
  • 18.Fantham H. Some parasitic Protozoa found in South Africa II. S Afr J Sci. 1919;16: 185–191. [Google Scholar]
  • 19.Fantham H. Some parasitic Protozoa found in South Africa XIII. S Afr J Sci. 1930;27: 376–390. [Google Scholar]
  • 20.Reed CC, Basson L, Van As LL, Dyková I. Four new myxozoans (Myxosporea: Bivalvulida) from intertidal fishes along the south coast of Africa. Folia Parasitol. 2007;54(4): 283–292. [DOI] [PubMed] [Google Scholar]
  • 21.Bartošová-Sojková P, Kodádková A, Pecková H, Kuchta R, Reed CC. Morphology and phylogeny of two new species of Sphaeromyxa Thélohan, 1892 (Cnidaria: Myxozoa) from marine fish (Clinidae and Trachichthyidae). Parasitology. 2015;142(5): 660–674. doi: 10.1017/S0031182014001723 [DOI] [PubMed] [Google Scholar]
  • 22.Ali MA. Ortholinea basma n. sp (Myxozoa: Myxosporea) from Agile klipfish Clinus agilis (Teleostei: Clinidae), light and scanning electron microscopy. Eur J Protistol. 2000;36(1): 100–102. [Google Scholar]
  • 23.Smit NJ, Hadfield KA. Marine fish parasitology in South Africa: History of discovery and future direction. Af Zool. 2015;50(2): 79–92. [Google Scholar]
  • 24.Eiras J. Synopsis of the species of Ceratomyxa Thélohan, 1892 (Myxozoa: Myxosporea: Ceratomyxidae). Syst Parasitol. 2006:49–71. [DOI] [PubMed] [Google Scholar]
  • 25.Gunter N, Adlard R. Bivalvulidan (Myxozoa: Myxosporea) parasites of damselfishes with description of twelve novel species from Australia's Great Barrier Reef. Parasitology. 2008;135(10): 1165–1178. doi: 10.1017/S0031182008004733 [DOI] [PubMed] [Google Scholar]
  • 26.Gunter N, Whipps C, Adlard R. Ceratomyxa (Myxozoa: Bivalvulida): Robust taxon or genus of convenience? Int J Parasitol. 2009;39(12): 1395–1405. doi: 10.1016/j.ijpara.2009.04.008 [DOI] [PubMed] [Google Scholar]
  • 27.Gunter N, Adlard R. Seven new species of Ceratomyxa Thélohan, 1892 (Myxozoa) from the gall-bladders of serranid fishes from the Great Barrier Reef, Australia. Syst Parasitol. 2009;73(1): 1–11. doi: 10.1007/s11230-008-9162-6 [DOI] [PubMed] [Google Scholar]
  • 28.Gunter N, Burger M, Adlard R. Morphometric and molecular characterisation of four new Ceratomyxa species (Myxosporea: Bivalvulida: Ceratomyxidae) from fishes off Lizard Island, Australia. Folia Parasitol. 2010: 1–10. [DOI] [PubMed] [Google Scholar]
  • 29.Alama-Bermejo G, Raga JA, Holzer AS. Host-parasite relationship of Ceratomyxa puntazzi n. sp (Myxozoa: Myxosporea) and sharpsnout seabream Diplodus puntazzo (Walbaum, 1792) from the Mediterranean with first data on ceratomyxid host specificity in sparids. Vet Parasitol. 2011;182(2–4): 181–192. doi: 10.1016/j.vetpar.2011.05.012 [DOI] [PubMed] [Google Scholar]
  • 30.Heiniger H, Adlard RD. Molecular identification of cryptic species of Ceratomyxa Thélohan, 1892 (Myxosporea: Bivalvulida) including the description of eight novel species from apogonid fishes (Perciformes: Apogonidae) from Australian waters. Acta Parasitol. 2013;58(3): 342–360. doi: 10.2478/s11686-013-0149-3 [DOI] [PubMed] [Google Scholar]
  • 31.Sitjà-Bobadilla A, Alvarez-Pellitero P. Light and electron microscopic description of Ceratomyxa labracis n.sp. and redescription of C. diplodae (Myxosporea Bivalvulida) from wild and cultured Mediterranean sea bass (Dicentrarchus labrax L.). Syst Parasitol. 1993;26(3): 215–223. [Google Scholar]
  • 32.Alvarez-Pellitero P, Sitjà-Bobadilla A. Pathology of Myxosporea in marine fish culture. Dis Aquat Organ. 1993;17: 229–238. [Google Scholar]
  • 33.Palenzuela O, Sitjà-Bobadilla A, Alvarez-Pellitero P. Ceratomyxa sparusaurati (Protozoa: Myxosporea) infections in cultured gilthead sea bream Sparus aurata (Pisces: Teleostei) from Spain: Aspects of the host parasite relationship. Parasitol Res. 1997;83(6): 539–548. [DOI] [PubMed] [Google Scholar]
  • 34.Køie M, Karlsbakk E, Nylund A. The marine herring myxozoan Ceratomyxa auerbachi (Myxozoa: Ceratomyxidae) uses Chone infundibuliformis (Annelida: Polychaeta: Sabellidae) as invertebrate host. Folia Parasitol. 2008;55(2): 100–104. [DOI] [PubMed] [Google Scholar]
  • 35.Evans BS, Sweijd NA, Bowie RCK, Cook PA, Elliott NG. Population genetic structure of the perlemoen Haliotis midae in South Africa: Evidence of range expansion and founder events. Mar Ecol Prog Ser. 2004;270: 163–172. [Google Scholar]
  • 36.Teske PR, McQuaid CD, Froneman PW, Barker NP. Impacts of marine biogeographic boundaries on phylogeographic patterns of three South African estuarine crustaceans. Mar Ecol Prog Ser. 2006;314: 283–293. [Google Scholar]
  • 37.Tang L. Observations on myxozoans (Myzozoa: Myxosporea) and the spatial and temporal variation in parasite assemblages of the nosestripe klipfish, Muraenoclinus dorsalis Bleeke, 1860 (Perciformes: Clinidae). M.Sc. Thesis, University of Cape Town, Faculty of Science; 2010. Available from: https://open.uct.ac.za/bitstream/handle/11427/6210/thesis_sci_2010_tang_laura.pdf?sequence=1.
  • 38.Heiniger H, Gunter N, Adlard R. Relationships between four novel ceratomyxid parasites from the gall bladders of labrid fishes from Heron Island, Queensland, Australia. Parasitol Int. 2008;57(2): 158–165. doi: 10.1016/j.parint.2007.11.006 [DOI] [PubMed] [Google Scholar]
  • 39.Morrison CM, Martell DJ, Leggiadro C, Oneil D. Ceratomyxa drepanopsettae in the gallbladder of Atlantic halibut, Hippoglossus hippoglossus, from the northwest Atlantic Ocean. Folia Parasitol. 1996;43(1): 20–36. [PubMed] [Google Scholar]
  • 40.Rocha S, Rangel LF, Castro R, Severino R, Azevedo C, Santos MJ, et al. Ultrastructure and phylogeny of Ceratomyxa diplodae (Myxosporea: Ceratomyxidae), from gall bladder of European seabass Dicentrarchus labrax. Dis Aquat Organ. 2016;121(2): 117–128. doi: 10.3354/dao03049 [DOI] [PubMed] [Google Scholar]
  • 41.Evans NM, Holder MT, Barbeitos MS, Okamura B, Cartwright P. The phylogenetic position of Myxozoa: Exploring conflicting signals in phylogenomic and ribosomal data sets. Mol Biol Evol. 2010;27(12): 2733–2746. doi: 10.1093/molbev/msq159 [DOI] [PubMed] [Google Scholar]
  • 42.Hartigan A, Estensoro I, Vancová M, Bílý T, Patra S, Eszterbauer E, et al. New cell motility model observed in parasitic cnidarian Sphaerospora molnari (Myxozoa: Myxosporea) blood stages in fish. Sci Rep. 2016;6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Castro LR, Austin AD, Dowton M. Contrasting rates of mitochondrial molecular evolution in parasitic diptera and hymenoptera. Mol Biol Evol. 2002;19(7): 1100–1113. doi: 10.1093/oxfordjournals.molbev.a004168 [DOI] [PubMed] [Google Scholar]
  • 44.Eo SH, DeWoody JA. Evolutionary rates of mitochondrial genomes correspond to diversification rates and to contemporary species richness in birds and reptiles. Proc R Soc Lond B Biol Sci. 2010;277(1700): 3587–3592. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Fiala I. The phylogeny of Myxosporea (Myxozoa) based on small subunit ribosomal RNA gene analysis. Int J Parasitol. 2006;36(14): 1521–1534. doi: 10.1016/j.ijpara.2006.06.016 [DOI] [PubMed] [Google Scholar]
  • 46.Fiala I, Hlavničková M, Kodádková A, Freeman MA, Bartošová-Sojková P, Atkinson SD. Evolutionary origin of Ceratonova shasta and phylogeny of the marine myxosporean lineage. Mol Phylogenet Evol. 2015;86: 75–89. doi: 10.1016/j.ympev.2015.03.004 [DOI] [PubMed] [Google Scholar]
  • 47.Brandt M, Fischer-Blass B, Heinze J, Foitzik S. Population structure and the co-evolution between social parasites and their hosts. Mol Ecol. 2007;16(10): 2063–2078. doi: 10.1111/j.1365-294X.2007.03300.x [DOI] [PubMed] [Google Scholar]
  • 48.Pal C, Macia MD, Oliver A, Schachar I, Buckling A. Coevolution with viruses drives the evolution of bacterial mutation rates. Nature. 2007;450(7172): 1079–1081. doi: 10.1038/nature06350 [DOI] [PubMed] [Google Scholar]
  • 49.Papkou A, Gokhale CS, Traulsen A, Schulenburg H. Host-parasite coevolution: Why changing population size matters. Zoology. 2016;119(4): 330–338. doi: 10.1016/j.zool.2016.02.001 [DOI] [PubMed] [Google Scholar]
  • 50.Patra S, Bartošová-Sojková P, Pecková H, Fiala I, Eszterbauer E. Holzer AS. Biodiversity and host-parasite cophylogeny of Sphaerospora sensu stricto (Cnidaria: Myxozoa). Under revision in Parasit Vectors. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Holzer AS, Bartošová-Sojková P, Born-Torrijos A, Lövy A, Hartigan A, Fiala I. Joint evolution of myxozoa and their alternate hosts: a recipe for success and vast biodiversity? Under revision in Mol Ecol. [DOI] [PubMed] [Google Scholar]
  • 52.Branch GM, Griffiths CL, Branch ML, Beckley LE. Two Oceans: A Guide to the marine life of southern Africa. 1st ed. Claremont, South Africa: David Philip Publishers; 1994. [Google Scholar]
  • 53.Barta J, Martin D, Liberator P, Dashkevicz M, Anderson J, Feighner S, et al. Phylogenetic relationships among eight Eimeria species infecting domestic fowl inferred using complete small subunit ribosomal DNA sequences. J Parasitol. 1997;83(2): 262–271. [PubMed] [Google Scholar]
  • 54.Katoh K, Misawa K, Kuma K, Miyata T. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 2002;30(14): 3059–3066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, et al. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 2012;28(12): 1647–1649. doi: 10.1093/bioinformatics/bts199 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Swofford DL. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Sinauer Associates, Sunderland, Massachusetts: 2003. [Google Scholar]
  • 57.Stamatakis A. RAxML-VI-HPC: Maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics. 2006;22(21): 2688–2690. doi: 10.1093/bioinformatics/btl446 [DOI] [PubMed] [Google Scholar]
  • 58.Ronquist F, Huelsenbeck JP. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 2003;19(12): 1572–1574. [DOI] [PubMed] [Google Scholar]
  • 59.Rambaut A, Drummond AJ. Tracer v1.4; 2007. Available from: http://beast.bio.ed.ac.uk/Tracer.
  • 60.Lodh N, Kerans BL, Stevens L. The parasite that causes whirling disease, Myxobolus cerebralis, is genetically variable within and across spatial scales. J Euk Microbiol. 2012;59(1): 80–87. doi: 10.1111/j.1550-7408.2011.00596.x [DOI] [PubMed] [Google Scholar]
  • 61.Leigh JW, Bryant D. POPART: full-feature software for haplotype network construction. Method Ecol Evol. 2015;6(9): 1110–1116. [Google Scholar]
  • 62.Librado P, Rozas J. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics. 2009;25(11): 1451–1452. doi: 10.1093/bioinformatics/btp187 [DOI] [PubMed] [Google Scholar]
  • 63.Fu YX. Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics. 1997;147(2): 915–925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Ramos-Onsins SE, Rozas J. Statistical properties of new neutrality tests against population growth. Mol Biol Evol. 2002;19(12): 2092–2100. doi: 10.1093/oxfordjournals.molbev.a004034 [DOI] [PubMed] [Google Scholar]
  • 65.Tajima F. Statistical-method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics. 1989;123(3): 585–595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Atkinson S, Bartholomew J. Disparate infection patterns of Ceratomyxa shasta (Myxozoa) in rainbow trout (Oncorhynchus mykiss) and Chinook salmon (Oncorhynchus tshawytscha) correlate with internal transcribed spacer-1 sequence variation in the parasite. Int J Parasitol. 2010: 599–604. doi: 10.1016/j.ijpara.2009.10.010 [DOI] [PubMed] [Google Scholar]
  • 67.Atkinson SD, Bartholomew JL. Spatial, temporal and host factors structure the Ceratomyxa shasta (Myxozoa) population in the Klamath River basin. Infect Genet Evol. 2010;10(7): 1019–1026. doi: 10.1016/j.meegid.2010.06.013 [DOI] [PubMed] [Google Scholar]
  • 68.Atkinson SD, Jones SRM, Adlard RD, Bartholomew JL. Geographical and host distribution patterns of Parvicapsula minibicornis (Myxozoa) small subunit ribosomal RNA genetic types. Parasitology. 2011;138(8): 969–977. doi: 10.1017/S0031182011000734 [DOI] [PubMed] [Google Scholar]
  • 69.Wuennemann H, Holzer AS, Pecková H, Bartošová-Sojková P, Eskens U, Lierz M. Repatriation of an old fish host as an opportunity for myxozoan parasite diversity: The example of the allis shad, Alosa alosa (Clupeidae), in the Rhine. Parasit Vectors. 2016;9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Henderson M, Okamura B. The phylogeography of salmonid proliferative kidney disease in Europe and North America. Proc R Soc Lond B Biol Sci. 2004: 1729–1736. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Whipps C, El-Matbouli M, Hedrick R, Blazer V, Kent M. Myxobolus cerebralis internal transcribed spacer 1 (ITS-1) sequences support recent spread of the parasite to North America and within Europe. Dis Aquat Organ. 2004: 105–108. doi: 10.3354/dao060105 [DOI] [PubMed] [Google Scholar]
  • 72.Whipps C, Kent M. Phylogeography of the cosmopolitan marine parasite Kudoa thyrsites (Myxozoa: Myxosporea). J Euk Microbiol. 2006: 364–373. doi: 10.1111/j.1550-7408.2006.00114.x [DOI] [PubMed] [Google Scholar]
  • 73.Bartošová P, Fiala I. Molecular evidence for the existence of cryptic species assemblages of several myxosporeans (Myxozoa). Parasitol Res. 2011;108(3): 573–583. doi: 10.1007/s00436-010-2100-y [DOI] [PubMed] [Google Scholar]
  • 74.Bartošová P, Fiala I, Jirků M, Cinková M, Caffara M, Fioravanti ML, et al. Sphaerospora sensu stricto: Taxonomy, diversity and evolution of a unique lineage of myxosporeans (Myxozoa). Mol Phylogenet Evol. 2013;68(1): 93–105. doi: 10.1016/j.ympev.2013.02.026 [DOI] [PubMed] [Google Scholar]
  • 75.Bartošová-Sojková P, Hrabcová M, Pecková H, Patra S, Kodádková A, Jurajda P, et al. Hidden diversity and evolutionary trends in malacosporean parasites (Cnidaria: Myxozoa) identified using molecular phylogenetics. Int J Parasitol. 2014;44(8): 565–577. doi: 10.1016/j.ijpara.2014.04.005 [DOI] [PubMed] [Google Scholar]
  • 76.Kodádková A, Dyková I, Tyml T, Ditrich O, Fiala I. Myxozoa in high Arctic: Survey on the central part of Svalbard archipelago. Int J Parasitol Parasites Wildl. 2014;3: 41–56. doi: 10.1016/j.ijppaw.2014.02.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Holzer AS, Stewart S, Tildesley A, Wootten R, Sommerville C. Infection dynamics of two renal myxozoans in hatchery reared fry and juvenile Atlantic cod Gadus morhua L. Parasitology. 2010;137(10): 1501–1513. doi: 10.1017/S0031182010000247 [DOI] [PubMed] [Google Scholar]
  • 78.Sitjà-Bobadilla A. Fish immune response to Myxozoan parasites. Parasite. 2008;15(3): 420–425. doi: 10.1051/parasite/2008153420 [DOI] [PubMed] [Google Scholar]
  • 79.Gomez D, Bartholomew J, Sunyer JO. Biology and mucosal immunity to myxozoans. Dev Comp Immunol. 2014;43(2): 243–256. doi: 10.1016/j.dci.2013.08.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Poe S. Evaluation of the strategy of long-branch subdivision to improve the accuracy of phylogenetic methods. Syst Biol. 2003;52(3): 423–428. [DOI] [PubMed] [Google Scholar]
  • 81.Sanil NK, Chandran A, Shamal P, Binesh CP. Molecular and morphological descriptions of Ceratomyxa collarae n. sp and Ceratomyxa leucosternoni n. sp from marine ornamental fishes of Indian waters. Parasitol Res. 2017;116(2): 529–537. doi: 10.1007/s00436-016-5317-6 [DOI] [PubMed] [Google Scholar]
  • 82.Yang ZH. On the best evolutionary rate for phylogenetic analysis. Syst Biol. 1998;47(1): 125–133. [DOI] [PubMed] [Google Scholar]
  • 83.von der Heyden S. Why do we need to integrate population genetics into South African marine protected area planning? Afr J Mar Sci. 2009;31(2): 263–269. [Google Scholar]
  • 84.Blasco-Costa I, Poulin R. Host traits explain the genetic structure of parasites: a meta-analysis. Parasitology. 2013;140(10): 1316–1322. doi: 10.1017/S0031182013000784 [DOI] [PubMed] [Google Scholar]
  • 85.Day JH. A monograph on the Polychaeta of Southern Africa. Part 2: Sedentaria. London: Trustees of the British Museum (Natural History); 1967.
  • 86.Blamey LK, Branch GM. Habitat diversity relative to wave action on rocky shores: Implications for the selection of marine protected areas. Aquatic Conserv Mar Freshw Ecosyst. 2008. Available from: http://www.academia.edu/11425285/Habitat_diversity_relative_to_wave_action_on_rocky_shores_implications_for_the_selection_of_marine_protected_areas. [Google Scholar]
  • 87.Adlard RD, Miller TL, Smit NJ. The butterfly effect: Parasite diversity, environment, and emerging disease in aquatic wildlife. Trends Parasitol. 2015;31(4): 160–166. doi: 10.1016/j.pt.2014.11.001 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. List of clinid fish samples molecularly examined on the presence of Ceratomyxa spp.

A detailed information on the host species and organ, locality, result of species-specific ITS-based PCR screening (+/-) and number of SSU rDNA, LSU rDNA and ITS PCR amplicons and/or clone sequences are available for each Ceratomyxa species along with the GenBank accession numbers (corresponding to those present in the phylogenetic trees). gb = gall bladder.

(XLSX)

S2 Table. GenBank accession numbers of newly amplified Ceratomyxa sequences.

(DOCX)

S3 Table. List of spore measurements of Ceratomyxa cottoidii from the present study and from the original species description.

(DOCX)

S1 Dataset. The fasta datasets of untrimmed and trimmed molecular markers used for the phylogenetic analyses.

(TXT)

S1 Fig. Maximum likelihood phylogenetic tree of the SSU rDNA sequences showing the relationships of Ceratomyxa spp. from South African clinids.

Nodal supports are mapped for maximum likelihood and maximum parsimony bootstraps and Bayesian inference posterior probabilities. Ceratomyxa barnesi and Ceratomyxa longipes, for which the branches were shortened to 50% of their original length, were used as outgroups. Host species and localities are shown with colored symbols.

(EPS)

S2 Fig. Maximum likelihood phylogenetic tree of the LSU rDNA sequences showing the relationships of Ceratomyxa spp. from South African clinids.

Nodal supports are mapped for maximum likelihood and maximum parsimony bootstraps and Bayesian inference posterior probabilities. Ceratomyxa appendiculata, Ceratomyxa vikrami, Ceratomyxa cardinalis and Ceratomyxa verudaensis, for which the branches were shortened to 50% of their original length, were used as outgroups. Host species and localities are shown with colored symbols.

(EPS)

Data Availability Statement

All relevant data are within the paper and its Supporting Information files and newly obtained sequences are available from the NCBI database (accession numbers MG238427-MG238500).


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES