Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2018 Dec 10;93(1):e01188-18. doi: 10.1128/JVI.01188-18

A 1,000-Year-Old RNA Virus

Mahtab Peyambari a, Sylvia Warner b,*, Nicholas Stoler a,*, Drew Rainer b,*, Marilyn J Roossinck a,b,✉
Editor: Julie K Pfeifferc
PMCID: PMC6288340  PMID: 30305356

A virus related to plant chrysoviruses was found in numerous ancient samples of maize, with nearly complete genomes in three samples. The age of the ancient samples (i.e., about 1,000 years old) was confirmed by carbon dating. Chrysoviruses are persistent plant viruses. They infect their hosts from generation to generation by transmission through seeds and can remain in their hosts for very long time periods. When modern corn samples were analyzed, a closely related chrysovirus was found with only about 3% divergence from the ancient sequences. This virus represents the oldest known plant virus.

KEYWORDS: ancient tissue, maize, virus evolution

ABSTRACT

Only a few RNA viruses have been discovered from archaeological samples, the oldest dating from about 750 years ago. Using ancient maize cobs from Antelope house, Arizona, dating from ca. 1,000 CE, we discovered a novel plant virus with a double-stranded RNA genome. The virus is a member of the family Chrysoviridae that infect plants and fungi in a persistent manner. The extracted double-stranded RNA from 312 maize cobs was converted to cDNA, and sequences were determined using an Illumina HiSeq 2000. Assembled contigs from many samples showed similarity to Anthurium mosaic-associated virus and Persea americana chrysovirus, putative species in the Chrysovirus genus, and nearly complete genomes were found in three ancient maize samples. We named this new virus Zea mays chrysovirus 1. Using specific primers, we were able to recover sequences of a closely related virus from modern maize and obtained the nearly complete sequences of the three genomic RNAs. Comparing the nucleotide sequences of the three genomic RNAs of the modern and ancient viruses showed 98, 96.7, and 97.4% identities, respectively. Hence, in 1,000 years of maize cultivation, this virus has undergone about 3% divergence.

IMPORTANCE A virus related to plant chrysoviruses was found in numerous ancient samples of maize, with nearly complete genomes in three samples. The age of the ancient samples (i.e., about 1,000 years old) was confirmed by carbon dating. Chrysoviruses are persistent plant viruses. They infect their hosts from generation to generation by transmission through seeds and can remain in their hosts for very long time periods. When modern corn samples were analyzed, a closely related chrysovirus was found with only about 3% divergence from the ancient sequences. This virus represents the oldest known plant virus.

INTRODUCTION

Maize (Zea mays subsp. mays) is farmed on every continent except Antarctica. Civilization owes much to this plant and to the people who first cultivated it. The wild progenitor of maize remained a mystery for many decades but is now believed to be the wild Mexican grass, teosinte (Z. mays subsp. parviglumis), that has the same number of chromosomes and a remarkably similar arrangement of genes (1–4). More than 50 symptomatic acute viruses from different families with positive or negative sense single-stranded ssRNA (ssRNA), double-stranded RNA (dsRNA), and single-stranded DNA genomes, have been identified in maize crops (5), but no persistent viruses have been reported.

Plant persistent viruses are mostly asymptomatic; they transmit only vertically and do not move from cell-to-cell but are found in all plant cells, moving by cell division (6). Most plant persistent viruses have dsRNA genomes and are related to viruses that infect fungi (7). Based on virus biodiversity studies, persistent viruses are the most common viruses in wild plants (8). The Chrysoviridae family includes dsRNA viruses that persistently infect fungi or plants. Chrysoviruses are composed of three to five monocistronic dsRNA segments, ranging in size from 2.4 to 3.6 kbp, separately encapsidated by nonenveloped isometric particles 35 to 40 nm in diameter (9–12). Chrysoviruses encode an RNA-dependent RNA polymerase (RdRp), a coat protein (CP), and p98, a protein with unknown function. Raphanus sativus chrysovirus 1 (RasCV1) was the first chrysovirus reported to infect plants (9). Most RNA viruses, with short generation times and error-prone replication, have rapid rates of evolution (13). However, the evolutionary rate of persistent plant viruses may differ compared to acute viruses (14). RNA molecules are generally considered unstable and readily degraded, but there have been reports of RNA viruses in plant tissues that are 100 to 750 years old (15–17). In addition, dsRNA is much more stable than ssRNA since it is not readily subjected to enzymatic or chemical degradation.

The Antelope House excavation was conducted by Don P. Morris of the National Park Service from 1970 to 1974. The Antelope House is an Ancestral Puebloan (Anasazi) ruin, located in a cave in the bottom of Canyon del Muerto, the major tributary of Canyon de Chelly, in Apache County, Arizona (18), in the area known today as Four Corners, where the states of New Mexico, Arizona, Colorado, and Utah meet. The ruins are named after nearby pictographs of antelope and other animals made by the Navajo in the 1830s. Ancestral Puebloan artifacts have been divided into periods of occupation. The Basketmaker III and Pueblo I, II, and III occupations were involved in agricultural development. During Basketmaker III the Ancestral Puebloans become farmers living in small villages. The Ancestral Puebloans found the canyons an ideal place to plant crops like maize, beans, and squash. More than two tons of vegetal refuse, in highly recognizable form, were recovered at Antelope House. It is clear from the vegetal remains that maize was a major food (over 39% of the gross vegetal weight was contributed by maize). The remains of maize recovered at Antelope House consisted of cobs, ears with kernels, kernels alone, husks, leaves, shanks, stem portions, and tassels and archeologically dated from ∼700 to 1,300 CE (Basketmaker III, Pueblo I, Pueblo II, Early Pueblo III, Middle Pueblo III, and Late Pueblo III) (18).

In this study, by screening archeological and modern maize cobs, we discovered a persistent plant RNA virus with three dsRNAs of 3.3 to 4.2 kbp related to known chrysoviruses. Evidence of this virus was found in a total of 39 samples dating to about 1,000 years ago, making this the oldest plant virus described to date.

RESULTS

Ancient virus sequences.

For this study, we obtained 312 maize cobs from Antelope house through the Western Archeological and Conservation Center (National Parks Service). Cobs were selected based on provenance, and to obtain a variety of ages (Table S1). To search for viruses, total nucleic acids were extracted, enriched for dsRNA, and converted to cDNA in a clean lab, followed by multiplexing and sequence analysis using an Illumina HiSeq 2000. Sequence data were assembled and compared to the GenBank database. The most common virus-like sequence was related to Anthurium mosaic-associated virus, a virus from an ornamental plant in Hawaii. Partial sequences of this virus were found in a total of 39 samples, and nearly complete genomes were found in three samples (Table S1). We designated this putative novel virus Zea mays chrysovirus 1 (ZMCV1). The ZMCV1 genome has three RNA segments (Fig. 1A). Sequence analysis predicted one open reading frame (ORF) in each dsRNA encoding a putative CP, RdRp, and p98. The N-terminal ∼650-amino-acid (aa) residues of the CP shared significant sequence similarities among the ancient ZMCV1 and other related chrysoviruses. The RdRp, in addition to eight conserved motifs characteristic of RdRps (Fig. 1B), contains a consensus sequence known as phytoreovirus S7 domain at the N-terminal region. This domain is widely distributed in the Chrysoviridae, Totiviridae, Reoviridae, and Endornaviridae families (9, 19–21). RNA 3 codes p98 with an unknown function. This protein has the motif PGDGXCXXHX, which was previously described for the chrysovirus Amasya cherry disease-associated virus (22). This motif, along with three other motifs, constitute the conserved core of ovarian tumor gene-like superfamily of predicted proteases (23–25). The function of this putative protease is yet to be determined.

FIG 1.

FIG 1

(A) Genome organization of ancient ZMCV1. ZMCV1 genomic dsRNA 1 with a single ORF (nucleotides [nt] 165 to 4133) coding for a putative CP, ZMCV1 genomic dsRNA 2 with a single ORF (nt 159 to 3431) coding for a putative RdRp, and ZMCV1 genomic dsRNA 3 with a single ORF (nt 113 to 3313) coding for p98, a protein with unknown function, are depicted. (B) Multiple alignment of putative RdRp encoded by the ancient and modern ZMCV1 RNA 2 with the RdRps of additional chrysoviruses. Numbers I to VIII refer to the eight motifs conserved in the RdRps of dsRNA viruses of lower eukaryotes (41, 42). Accession numbers are provided in Materials and Methods.

The ages of the three cobs with nearly complete genomes, as well as two cobs with partial sequences of the virus, were confirmed by radiocarbon (14C) dating (Fig. 2). All conventional ages were calibrated to calendar years using OxCal 4.3 (26) and the IntCal13 calibration curve (27). These samples ranged in age from ∼1030 to 1290 CE.

FIG 2.

FIG 2

Morphological variability of ancient maize cobs collected from Antelope House. Samples 48, 74, and 154 have nearly complete genomes of ZMCV1. Samples 201 and 175 have partial sequences of ZMCV1. The estimated ages based on carbon dating are shown for each sample in the table below.

Contigs from ancient samples more than 500 bp in length were aligned and compared to a consensus sequence to provide a picture of the genetic diversity in each genomic RNA of ancient ZMCV1. Genetic diversity was calculated by counting differences between the individual contigs and the consensus sequence and was significantly lower in RNA 2 that encodes the RdRp than in RNAs 1 and 3 that encode the CP and p98, respectively; RNA 1 and RNA 3 showed similar genetic diversities (Table 1). This analysis does not take reverse transcription-PCR (RT-PCR) or sequencing errors into account and hence is artificially high, it but provides a general comparison of diversity among the three RNAs.

TABLE 1.

Comparative genetic diversity in CP, RdRp, and p98 of ancient ZMCV1

Virus segment Mutation frequency (10–2)a
RdRp 0.7A
CP 1.3B
p98 1.4B
a

Substitutions, insertions, and deletions were counted equally in determining mutation frequencies. Statistical differences in genetic variations were determined using ANOVA (P < 0.05). Mutation frequencies with the same superscript capital letter are not statistically different.

Three dsRNA segments in modern maize.

Uninfected plants do not contain detectable amounts of large dsRNAs, so the presence of dsRNAs is a sign of viral infection (28). We enriched for dsRNAs in modern maize cultivars and teosinte accessions and found a pattern of dsRNAs that was consistent with chrysoviruses with three segments ranging in size from 3.3 to 4.2 kb, in addition to other dsRNA segments that were not characterized (Fig. 3A; Table 2). Resistance to DNase I and RNase A in a high salt concentration confirmed the dsRNA nature of the nucleic acids.

FIG 3.

FIG 3

(A) Agarose gel electrophoresis of dsRNAs extracted from modern maize cultivars. Lanes: 1, Japonica Striped; 2, Calico; 3, Jade Blue Dwarf; M, DNA marker (lambda DNA digested with EcoRI and HindIII). (B) Agarose gel electrophoresis profile of RT-PCR products of modern ZMCV1 genomic dsRNA segments isolated from modern maize leaf tissue. Lanes: 1, CP; 2, RdRp; 3, p98; M, DNA marker (lambda DNA digested with PstI). (C) Northern blot analysis of modern maize and teosinte total RNA probed for ZMCV1 CP, RdRp, and p98.

TABLE 2.

Maize cultivars and teosinte accession numbers tested for ZMCV1-like dsRNAs

Cultivar/speciesa Accession no.b Presence of dsRNAc Positive by RT-PCRd
Maize
    Calico Popcorn NA + −
    Japonica Striped NA + +
    Jade Blue Dwarf NA + NT
    Yellow Field Dent NA + −
    Mini Indian NA + NT
    Tom Thumb NA + NT
    Goldan Bantum NA + NT
    Japanese Hulless NA + NT
    Country Gentleman NA + NT
    Blue Jade NA + NT
    Ashworth Sweet NA + −
Teosinte
    Z. mays subsp. parviglumis PI 384066 + −
    Z. mays subsp. parviglumis PI 566687 + −
    Z. mays subsp. mexicana Ames 8,083 + −
    Z. mays subsp. mexicana PI 566674 + −
a

Cultivar names for maize (Zea mays subsp. mays) and species names for Teosinte.

b

Maize seeds were purchased from commercial seed companies, and do not have accession numbers; Teosinte seeds were obtained from the USDA. NA, not applicable.

c

That is, the presence (+) or absence (–) of dsRNAs, as shown in Fig. 3A.

d

Not all maize cultivars were tested by RT-PCR using ZMCV1-specific primers. NT, not tested.

The modern maize and teosinte dsRNAs were recalcitrant to cDNA synthesis using standard random priming methods (29). Hence, we generated three sets of specific primers based on the ancient ZMCV1 sequences for the RdRp, CP, and p98. We were able to amplify the appropriate-sized fragments from dsRNA from modern maize (cultivar Japonica Striped) (Fig. 3B), but not teosinte. The Japonica Striped maize cultivar was selected for further investigation. Using primer walking, we obtained the nearly complete genome sequences from RNAs 1, 2, and 3 from ZMCV1 in modern maize, but we were never able to amplify anything from teosinte, even using degenerate primers. Sequence comparison of the genomes of modern and ancient ZMCV1 showed 96.7, 98, and 97.4% identities in RNAs 1, 2 and 3, respectively, suggesting that ZMCV1 has changed about 3% in the 1,000 years that it has been evolving through vertical passage in maize, although we cannot be certain that the ZMCV1 in the Japonica Strip cultivar is a direct descendant of the virus found in the Ancient Puebloan maize.

Using published methods for chrysovirus purification from plant tissues (9), we attempted to isolate virus particles from modern maize leaves. We obtained a pellet after centrifugation through a 10% sucrose cushion, which normally contains only virus particles. This pellet contained the viral dsRNAs, but we were unable to visualize any particles by transmission electron microscopy (TEM), most likely due to the very low concentration of this virus.

Northern blot analysis.

The dsRNAs from modern maize and teosinte were separated on an agarose gel, transferred to a nylon membrane, and probed with chemiluminescence-labeled cDNA clones of RdRp-1, CP-1, and p98-3 (Fig. 3C). The dsRNAs from maize annealed with the appropriate probes but not those from teosinte, confirming that ZMCV1 is not found in teosinte, so if the dsRNAs represent a chrysovirus it is a different virus.

DISCUSSION

We have determined the nearly complete genomic sequence and genome organization of ZMCV1, a tentative member of the Chrysoviridae family, obtained from ancient maize cobs and modern maize leaf tissue. ZMCV1 is the first dsRNA plant virus obtained from ancient samples dating from ca. 1030 to 1210 CE and is the oldest known plant virus. By resolving the dsRNA extracted from modern maize into three bands by agarose gel electrophoresis, followed by molecular cloning, cDNA sequencing, and Northern hybridization analysis of ZMCV1 dsRNAs, the presence of three distinct dsRNA segments was confirmed. We analyzed dsRNA sequences using specific primers for each segment, designed based on ancient ZMCV1 sequences. dsRNA 1 encodes the putative CP, and dsRNA 2 codes for the putative RdRp, while dsRNA 3 encodes a protein with unknown function that has some similarities to known proteases. RNA ligase-mediated RACE (30), poly(A) tailing 3′-RACE (3′-rapid amplification of cDNA ends), and poly(G/C) 5′-RACE were unsuccessful, and hence the complete sequences of the 5′ and 3′ untranslated regions (UTRs) are unknown. This may be due to modified nucleotides or cross-linking in portions of the dsRNA genome that make it recalcitrant to normal cDNA synthesis. This is not unique to ZMCV1 but has been found in a variety of dsRNA viral genomes from both plants and fungi (unpublished data). The partial sequences included most of the 5′ and 3′ UTRs of three dsRNAs, based on related chrysovirus sequences. Phylogenetic analysis of the putative RdRp indicated that this is a novel tentative member of Chrysoviridae family, most closely related to Anthurium mosaic-associated virus and Persea americana chrysovirus (Fig. 4). Because of the apparently low concentration of ZMCV1 in maize tissue, we were unable to examine virus particles by TEM, but the presence of viral genomic dsRNA in pellets from 10% sucrose cushions, which normally contain only virus particles, implies that the virus does package its genome into virions. In screening several accessions of teosinte, we found a profile of dsRNAs similar to those from maize cultivars, but we were unable to find any evidence of ZMCV1 in teosinte by using specific primers or Northern blot analysis. Either the dsRNAs of teosinte cultivars are not ZMCV1 and this virus was introduced to maize after divergence from teosinte, or the virus has diverged too much in teosinte to be identified even by Northern blot analysis that can detect more divergent nucleic acids.

FIG 4.

FIG 4

Phylogenetic analysis based on amino acid sequences of RdRps of ancient and modern ZMCV1 and selected members of Chrysoviridae. Bayesian analysis was done using the MrBayes plugin in Geneious software. Posterior probabilities are indicated by numbers at the nodes. The viral siglas and accession numbers of sequences used in the analyses are given in Materials and Methods. Species indicated in boldface are isolated from plants. Raphanus sativus chrysovirus 1 was used as an outgroup.

In the ancient ZMCV1 sequences, the mutation frequency of the RdRp-encoding segment is significantly lower than that of the CP (P = 0.005) and p98 (P = 0.03) encoding segments, but there is no significant difference between CP and p98 (P = 0.82). Thus, the RdRp gene shows different patterns of evolution compared to CP and p98. This is not surprising, since RdRp is an essential enzyme for all RNA viruses and is usually highly conserved. These data indicate that the RdRp, CP, and p98 probably have different evolutionary trajectories and are under different selection pressures.

In RNA viruses, mutation rates are determined by the presence or absence of proofreading mechanisms, the mode of replication, and host factors (31). The classical viewpoint that RNA viruses are replicated with low fidelity and evolve rapidly does not appear to hold true for ZMCV1 or other persistent plant viruses (6, 14). Previous estimates have been based on presumed ages of divergence of persistent viruses based on the divergence of their plant hosts. In this study, we provide direct evidence that the evolution of ZMCV1 in maize is indeed slower than that calculated for other viruses (32), although population studies on dsRNA viruses are rare, and there is some evidence that long-term evolution of RNA viruses is not a precise extrapolation of what has been found in experimental studies (33, 34).

There are a number of possible scenarios that could explain low variation in persistent plant viruses, as seen when we compare the ancient and modern ZMCV1. It is likely that there is no benefit for a persistent plant virus that is perfectly adapted to its host and transmitted only through vertical passage to offspring of the same host to change. So, in this constant environment, all mutations are probably deleterious and removed through purifying selection. Another possibility is a higher fidelity of the RdRps of dsRNA viruses, although this has not been studied. In addition, dsRNA viruses do not undergo exponential replication but rather use a stamping machine mode of replication, which would limit variation (14). Finally, RNA molecules are much less prone to deamination and depurination than DNA molecules, and all double-stranded molecules are protected from other posttranscriptional modifications such as hydrolysis and enzymatic degradation that affect single-stranded molecules (both RNA and DNA) (35). In a study of Barley stripe mosaic virus (BSMV) discovered in an ∼750-year-old archaeological sample of barley seeds, the levels of variation in comparison to modern BSMV were considerably lower than would be expected from experimental studies on RNA virus evolution (34). In that study the authors also used C-U changes as a signal of deamination to confirm the ancient nature of the RNA (34). In the present study, we could not verify the ancient nature of the RNA by this method since we do not have significant modern sequence data for comparison, and the dsRNA nature of the genome makes deamination much less likely than for an ssRNA genome such as BSMV. However, all of the ancient-sample work was done under strict clean-lab conditions, and no modern corn was worked on in the lab until after the work on ancient materials was completed, making contamination highly unlikely.

MATERIALS AND METHODS

Plant materials.

The maize cultivars and teosinte accessions used in this study are commercial seeds that were provided by the Hudson Valley Seed Company or germplasm provided by the U.S. Department of Agriculture (USDA) (Table 2). Most of the maize varieties are local cultivars. Maize and teosinte plants were grown in an insect-proof growth chamber to protect them from acute plant viruses, which are predominantly transferred by vectors. Seeds were planted at one seed per 10-cm plastic pot and placed in a climate-controlled growth chamber set at 25°C with a photoperiod of 16 h of light and 8 h of darkness. Plant leaves were used for dsRNA extraction.

dsRNA extraction and molecular characterization.

Extraction of dsRNA from ancient tissues was performed in a HEPA filter-equipped clean lab, using protective clothing, to prevent contamination of the samples. Approximately 4 g of ancient tissue was chopped using a razor blade into pieces of about 3 mm3 and placed into 2 Bio 101 tubes containing 750 µl of extraction buffer (28) and 750 µl of Tris-EDTA (TE)-saturated phenol-chloroform (1:1). Tubes were placed in a Savant 120 cell disruptor and pulverized twice for 45 s at a speed setting of 6.5. The resulting paste was removed and placed into a 50-ml centrifuge tube containing 3.5 ml of extraction buffer and 3.5 ml of TE-saturated phenol-chloroform. The remainder of the dsRNA extraction protocol was as described previously (28). The extracted dsRNAs were used to synthesize cDNA using tagged random priming, as previously described (29), followed by pooling of up to 96 samples for sequence analysis on Illumina HiSeq 2000. Sequence data were assembled using PRICE (36) for 10 cycles, seeding with 25 randomly chosen reads. Assembled contigs were compared to GenBank using BLASTX and tBLASTX.

The dsRNAs were extracted from modern maize cultivars and teosinte accessions by CF11 (Whatman, UK) cellulose chromatography, as described previously for fungal samples (28), from 5 g of fresh leaf tissue. The extracted dsRNAs were tested for the presence of ZMCV1 by RT-PCR using specific primers of CP, RdRp, and p98. Several primers were designed based on the RdRp, CP, and p98 sequences of ancient maize samples and used for RT-PCR, followed by sequence analysis of the PCR products at the Genomic Core Facility of Pennsylvania State University, University Park, PA. Sequence data were assembled, and nucleotide sequence and putative protein sequences of ZMCV1 RNA 1, RNA 2, and RNA 3 were analyzed for ORFs using the ORF finding operation in Geneious version 10.1.3 (37). Sequence similarity searches using each dsRNA segment of ZMCV1 to screen for virus-related sequences in eukaryotic genomes were conducted using the BLAST N program available online from National Center for Biotechnology Information (NCBI).

The putative amino acid RdRp sequences of ancient and modern ZMCV1 and those of related chrysoviruses were aligned using the MUSCLE default settings in the Geneious program. After manual editing of the alignments, they were used for phylogenetic analyses and tree construction using MrBayes (38) via the Geneious plugin. The RdRp sequence of Raphanus sativus chrysovirus 1 (RasCV1) was used as the outgroup. The ZMCV1 sequence was the consensus sequence of the three nearly complete RdRp sequences from ancient corn. The rate matrix was set to a Poisson distribution with a gamma rate variation. The total chain length was 100,000, and branch lengths were unconstrained. Amino acid signatures and protein motifs were identified by searching the Conserved Domain Database in the NCBI proteomics tools.

Numerous attempts at 5′ and 3′ RACE using various methods were unsuccessful (data not shown) due to common problems with dsRNA viruses of plants and fungi.

Primers used in this study.

The following primers were used in this study: RdRp-1F, GGCATGGTACCTGATG; RdRp-1R, GGCTTCAACGGTATCC; RdRp-2F, GGTCCACGATTTGGTACG; RdRp-2R, GTGTACAGGACGTACG; RdRp-3F, GCCAAAGTTTGAATCCGCC; RdRp-3R, CCTTATTCGAGGCCAAGCCC; RdRp-4F, CGATGCGCAAGTACGGG; RdRp-4R, CCAGTCACGGCTCATAGCC; RdRp-5F, CCAGATGGCTGTGGCAGG; RdRp-5R, CCTGTGCATACGCATTGC; RdRp-6F, GCGCTATGGTGTAAAG; RdRp-6R, GGTTACTTACCTCACG; RdRp-7F, GGGAGGCAAGTGCTACCC; RdRp-7R, CGACAAGTGGTTCTGCTCC; RdRp-8F, GGTACACCATGGTGAATG; RdRp-8R, CCCTGCCTCATAGACCC; RdRp-5′ RACE, CTTGAGATGGCCGCAC; RdRp-3′ RACE, GGTAGATAGCTGACTG; RdRp-degenerate-F, ACCGTCGTGCAYGARGGNGA; RdRp-degenerate-R, GCGACATACATRTANGCRTG; CP-1F, CCATATCATCCAAGTCATC; CP-1R, GCTAAAGACCTCAGTAAGCC; CP-2F, GATGCTAGAGCGACGGCCCG; CP-2R, CACCCGAATGGGCACATCAAG; CP-3F, CCGGGATTTGGTGTGAG; CP-3R, GTCACGTTCTTCTCGGC; CP-4F, GCATGGGGCTTTGTGTG; CP-4R, CCATCATCCTTCTTACTGGC; CP-5F, CGGGTGGGGATGATTC; CP-5R, GTATGGCCAGAGCTAACC; CP-6F, GGTCAGGACAAGCCTGATG; CP-6R, CTTCTTGTCACTCAGC; CP-7F, GGGCATGGAACTGTCG; CP-7R, CTCCTGTAGGTTGGTACG; CP-8F, GCGGGTGAACCAAGTC; CP-8R, GGCAGCCTTGGCTATC; CP-9F, GGCATCTGTGTTAAGTCGG; CP-9R, CCAATGAAGGACTCAGC; CP-10F, GCACGACTGCTGGAATCAC; CP-10R, GCACGTACGCCTTATCAAGG; CP-11F, GGACGCACAGGACATAAG; CP-11R, GGTGGTGTACGTGCTGC; CP-12F, GCGTCGAGTAGAAGTAG; CP-12R, CTCAGCGTGCGCCTGCTC; CP-13F, GCCCATGAAGACAAAC; CP-13R, GCTTTCCTAGCCTTATGCC; CP-14F, CCCAAAGGATGGCAGAAGC; CP-14R, CGCACACCTCATCACAACG; CP-15F, GGCTGCGATGTATGAT; CP-15R, CATATGCCCATAGCGGC; CP-16F, GGATGACTGGTCTAGAAG; CP-16R, CTACACAATATACAAGC; CP-5′ RACE, CCTGGAGACTTGGTTCACC; CP-3′ RACE, CCAACCTACAGGAGGAG; CP-degenerate-F, GAGGCTGATAAGATHGCNAARGC; CP-degenerate-R, GACGTGGTTNACRTACCARTAYT; p98-1F, GGCAAGTGCCAGGAATCATATGG; p98-1R, CAGTTCAGCATTTCTTGACC; p98-2F, GGTCAAGAAATGCTGAACTG; p98-2R, GTTATTCATCACCTTGGGCACC; p98-3F, GCCTCAGAGGCGTGACAAG; p98-3R CGTACCTTCATTGTCTACCTCC; p98-4F, GGCATTGAGAGTTTGCCC; p98-4R, CTTGCCATAGTCCACACC; p98-5F, GGTCTACGACCTAAGG; p98-5R, CCTCGTAACTCCGAAGG; p98-6F, CGGGCCCATGTGTAAG; p98-6R, CGATAAGTACCGTTGGC; p98-7F, CGGATGCTCCTGTTGTG; p98-7R, GTGCCAAACCAATGGAGG; p98-8F, GCAGTACCCTAGCATAG; p98-8R, CCTAGATGATAGAAGCCTGC; p98-9F, GCTCCAGGATATTGGTC; p98-9R, CACCATCTTTTCCCCGG; p98-10F, CCGTCAAAACCTCTCCG; p98-10R, CAGGGCTCCTGTCCTCAG; p98-11F, GCCATCATCCCTGGTAAG; p98-11R GCCTTGTAGTGACAAACC; p98-5′ RACE, CCATATAGCAACCATGCC; p98-3′ RACE, GAGGAATCCGCTGGGG; p98-degenerate-F, GGGAAGCAAGAYTAYACNATG; and p98-degenerate-R, TGACCCACNGCCCARTCRCA.

Estimation of genetic diversity.

The consensus sequence for each genome segment of ancient ZMCV1 was determined using the MUSCLE default settings in the Geneious program. The genetic diversity was estimated for each genomic dsRNA molecule of ancient ZMCV1 by comparing sequences of contigs of ≥500 bp to the consensus sequence, and changes were recorded. The mutation frequency (total number of changes/total number of bases sequenced) was used as an indicator of genetic diversity in RNAs 1, 2, and 3. Comparisons between different genome segments of ancient ZMCV1 were tested for statistical significance using the one-way analysis of variance (ANOVA) from the R statistical package (https://www.R-project.org/).

Northern blot hybridization.

Digoxigenin (DIG)-11-dUTP-labeled DNA fragments were prepared according to the method recommended by the manufacturer (Roche Diagnostics). The ZMCV1 CP-1, RdRp-1, and p98-3 primers were used to amplify templates for probes from cDNA clones that were representative of ZMCV1 RNAs 1, 2, and 3, respectively. The labeling was done during fragment amplifications using DIG-11-dUTP and a deoxynucleoside triphosphate mix (DIG-11-dUTP: dTTP, 1:3; with equimolar amounts of dATP, dCTP, and dGTP) in an Idaho Technologies Rapid Cycler. These PCR products (540, 670, and 570 bp, respectively) were purified by a Cycle Pure kit (Omega) and used as probes to detect ZMCV1 (RNAs 1, 2, and 3) in dsRNA from modern maize cultivars and teosinte accessions.

The dsRNAs were isolated from leaf tissues, separated by 1.2% agarose gel electrophoresis in Tris-borate-EDTA, and denatured by soaking the gel in 50 mM NaOH for 30 min. The gel was soaked in 50 mM sodium borate with three changes, for 5 min each time, and the denatured RNA was transferred to Hybond N+ nylon membrane (Amersham/GE Healthcare) via capillary action in 20× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate) buffer overnight. The RNA was fixed on the membrane by UV cross-linking in a Stratalinker at 200 J. Prehybridization, hybridization, and stringency washes were performed as previously described (39), except that prehybridization and hybridization were carried out at 52°C. For chemiluminescence detection, the blot was incubated in antibody solution, anti-DIG AP conjugate (Roche), and CDP-STAR (Roche) according to the manufacturer’s instructions.

Carbon dating.

Five maize cob samples positive for ZMCV1 (i.e., 48, 74, 154, 175, and 201) were processed for radiocarbon measurement at the Human Paleoecology and Isotope Geochemistry Lab at Pennsylvania State University. Cobs were sonicated in 18.2MΩ water to removed adhering sediment and then subjected to acid/base/acid pretreatment of sequential baths in 1 N HCl and 0.1 N NaOH at 70°C for 20 min on a heater block. The initial acid wash dissolved using exogenous carbonate, and repeated base washes extracted organic contaminants such as humic acids. The final acid wash removed any secondary carbonates formed during the base treatment, and then the samples were rinsed in 18.2 MΩ water at 70°C to remove chlorides. Sample CO2 was produced by combustion at 900°C for 3 h in evacuated sealed quartz tubes using a CuO oxygen source and Ag wire to remove chlorides. Primary (OXII) and secondary (FIRI-H) standards, as well as a >50k BP wood background, were processed along with the unknowns. Sample CO2 was reduced to graphite at 550°C by hydrogen reduction onto a Fe catalyst with reaction water drawn off with Mg(ClO4)2.

Radiocarbon measurements were made on a National Electrostatics Corporation 500-kV 1.5SDH-1 compact accelerator mass spectrometer at the PSU AMS 14C Laboratory. Ratios were corrected with background subtractions and normalized to the OXII standard. Conventional 14C ages were δ13C corrected for mass-dependent fractionation with δ13C values measured on the AMS (40). Because fractionation during sample graphitization or AMS measurement can cause these values to differ from the δ13C of the original material, these values are not reported.

Accession number(s).

Viruses used in the phylogenetic analysis were as follows: Grapevine-associated chrysovirus (GaCV1), ADO60926.1; Isaria javanica chrysovirus 1 (IjCV1), YP_009337840.1; Aspergillus fumigatus chrysovirus (AfuCV), CAX48749.1; Penicillium chrysogenum chrysovirus (PcV), YP_392482.1; Amasya cherry disease-associated chrysovirus (ACDACV), CAH03664.1; Anthurium mosaic-associated virus (AMaV), ACU11563.1; Brassica campestris chrysovirus 1 (BcCV1), AKU48197.1; Colletotrichum gloeosporioides chrysovirus 1 (CgCV1), ALW95408.1; Cryphonectria nitschkei chrysovirus 1 (CnCV1), ACT79255.1; Fusarium oxysporum chrysovirus 1 (FoCV1), ABQ53134.1; Helminthosporium victoria 145 s virus (Hv145SV), YP_052858.1; Macrophomina phaseolina chrysovirus 1 (MpCV1), ALD89090.1; Persea americana chrysovirus (PaCV), AJA37498.1; Raphanus sativus chrysovirus 1 (RasCV1), AFE83590.1; and Verticillium dahlia chrysovirus 1 (VdCV1), ADG21213.1. For sequences of ZMCV1, which were newly determined in the present study, JS is from modern corn, and the remainder are numbered according to sample number: ZMCV1-JS-CP, MH931186; ZMCV1-JS-RdRp, MH931187; ZMCV1-JS-p98, MH931188; ZMCV1-154-CP, MH931189; ZMCV1-154-RdRp, MH931190; ZMCV1-154-p98, MH931191; ZMCV1-48-CP, MH931192; ZMCV1-48-RdRp, MH931193; ZMCV1-48-p98, MH931194; ZMCV1-74-CP, MH931195; ZMCV1-74-RdRp, MH931196; ZMCV1-74-p98, MH931197; ZMCV1-201-CP, MH936007; ZMCV1-201-RdRp, MH931198; ZMCV1-201-p98 MH931199; ZMCV1-141-CP, MH931200; ZMCV1-141-RdRp, MH931201; ZMCV1-141-p98, MH936006; ZMCV1-63-CP, MH931203; ZMCV1-63-RdRp, MH931202; ZMCV1-80-CP, MH931204; ZMCV1-80-RdRp, MH936014; ZMCV1-241-CP, MH931205; ZMCV1-241-RdRp, MH936017; ZMCV1-305-RdRp, MH931206; ZMCV1-248-RdRp, MH931207; ZMCV1-306-RdRp, MH931208; ZMCV1-304-RdRp, MH936015; and ZMCV1-147-RdRp, MH936016.

Supplementary Material

Supplemental file 1

ACKNOWLEDGMENTS

We thank Douglas J. Kennett and Brendan J. Culleton for assistance in carbon dating, which was performed at the Human Paleoecology and Isotope Geochemistry Lab at Pennsylvania State University. We thank the Western Archeological Center for allowing us to perform destructive analysis on the maize samples. We thank Michael Clegg for supporting the early stages of this work.

This study was supported by the Samuel Roberts Noble Foundation, The Pennsylvania State University College of Agricultural Science, and the Huck Institutes of Life Sciences.

Footnotes

Supplemental material for this article may be found at https://doi.org/10.1128/JVI.01188-18.

REFERENCES

  • 1.Doebley J, Stec A, Wendel J, Edwards M. 1990. Genetic and morphological analysis of a maize-teosinte F2 population: Implications for the origin of maize. Proc Natl Acad Sci U S A 87:9888–9892. doi: 10.1073/pnas.87.24.9888. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Doebley J. 2004. The genetics of maize evolution. Annu Rev Genet 38:37–59. doi: 10.1146/annurev.genet.38.072902.092425. [DOI] [PubMed] [Google Scholar]
  • 3.Matsuoka Y, Vigouroux Y, Goodman MM, Sanchez GJ, Buckler E, Doebley J. 2002. A single domestication for maize shown by multilocus microsatellite genotyping. Proc Natl Acad Sci 99:6080–6084. doi: 10.1073/pnas.052125199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Piperno DR, Flannery KV. 2001. The earliest archaeological maize (Zea mays L.) from highland Mexico: new accelerator mass spectrometry dates and their implications. Proc Natl Acad Sci U S A 98:2101–2103. doi: 10.1073/pnas.98.4.2101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Redinbaugh MG, Zambrano JL. 2014. Control of virus diseases of maize. Adv Virus Res 90:391–429. doi: 10.1016/B978-0-12-801246-8.00008-1. [DOI] [PubMed] [Google Scholar]
  • 6.Roossinck MJ. 2016. Evolution of persistent viruses in plants, p 261–270. In Weaver S, Denison M, Roossinck MJ, Vignuzzi M (ed), Virus evolution: current research and future directions. Caister Academic Press/Horizon Scientific Press, Poole, United Kingdom. [Google Scholar]
  • 7.Roossinck MJ. 2012. Persistent plant viruses: molecular hitchhikers or epigenetic elements?, p 177–186. In Witzany G. (ed), Viruses: essential agents of life. Springer, Dordrecht, The Netherlands. [Google Scholar]
  • 8.Roossinck MJ. 2012. Plant virus metagenomics: biodiversity and ecology. Annu Rev Genet 46:357–367. [DOI] [PubMed] [Google Scholar]
  • 9.Li L, Liu J, Xu A, Wang T, Chen J, Zhu X. 2013. Molecular characterization of a trisegmented chrysovirus isolated from the radish Raphanus sativus. Virus Res 176:169–178. doi: 10.1016/j.virusres.2013.06.004. [DOI] [PubMed] [Google Scholar]
  • 10.Urayama S, Ohta T, Onozuka N, Sakoda H, Fukuhara T, Arie T, Teraoka T, Moriyama H. 2012. Characterization of Magnaporthe oryzae chrysovirus 1 structural proteins and their expression in Saccharomyces cerevisiae. J Virol 86:8287–8295. doi: 10.1128/JVI.00871-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Darissa O, Willingmann P, Schäfer W, Adam G. 2011. A novel double-stranded RNA mycovirus from Fusarium graminearum: nucleic acid sequence and genomic structure. Arch Virol 156:647–658. doi: 10.1007/s00705-010-0904-9. [DOI] [PubMed] [Google Scholar]
  • 12.Yu J, Lee K-M, Son M, Kim K-H. 2011. Molecular characterization of Fusarium graminearum virus 2 isolated from Fusarium graminearum strain 98-9-60. Plant Pathol J 27:285–290. doi: 10.5423/PPJ.2011.27.3.285. [DOI] [Google Scholar]
  • 13.Sanjuán R, Nebot MR, Chirico N, Mansky L, Belshaw R. 2010. Viral mutation rates. J Virol 84:9733–9748. doi: 10.1128/JVI.00694-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Safari M, Roossinck MJ. 2014. How does the genome structure and lifestyle of a virus affect its population variation? Curr Opin Virol 9:39–44. doi: 10.1016/j.coviro.2014.09.004. [DOI] [PubMed] [Google Scholar]
  • 15.Fraile A, Escriu F, Aranda MA, Malpica JM, Gibbs AJ, García-Arenal F. 1997. A century of tobamovirus evolution in an Australian population of Nicotiana glauca. J Virol 71:8316–8320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Malmstrom CM, Shu R, Linton EW, Newton LA, Cook MA. 2007. Barley yellow dwarf viruses (BYDVs) preserved in herbarium specimens illuminate historical disease ecology of invasive and native grasses. J Ecology 95:1153–1166. doi: 10.1111/j.1365-2745.2007.01307.x. [DOI] [Google Scholar]
  • 17.Smith O, Clapham A, Rose P, Li Y, Wang J, Allaby RG. 2014. A complete ancient RNA genome: identification, reconstruction and evolutionary history of archeological Barley stripe mosaic virus. Sci Rep 4:4003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Morris DP. 1986. Archeological Investigations at Antelope House. National Parks Service, Washington, DC. [Google Scholar]
  • 19.Jamal A, Bignell EM, Coutts RHA. 2010. Complete nucleotide sequences of four dsRNAs associated with a new chrysovirus infection Aspergillus fumigatus. Vir Res 153:64–70. doi: 10.1016/j.virusres.2010.07.008. [DOI] [PubMed] [Google Scholar]
  • 20.Jiang D, Ghabrial SA. 2004. Molecular characterization of Penicillium chrysogenum virus: reconsideration of the taxonomy of the genus Chrysovirus. J Gen Virol 85:2111–2121. doi: 10.1099/vir.0.79842-0. [DOI] [PubMed] [Google Scholar]
  • 21.Liu H, Fu Y, Jiang D, Li G, Xie J, Cheng J, Pend Y, Ghabriel SA, Yi X. 2010. Widespread horizontal gene transfer from double-stranded RNA viruses to eukaryotic nuclear genomes. J Virol 84:11879–11887. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Covelli L, Coutts RHA, Serio FD, Citir A, Acikoz S, Hernadez C, Ragozzino A, Flores R. 2004. Cherry chlorotic rusty spot and Amasya cherry diseases are associated with a complex pattern of mycoviral-like double-stranded RNAs. I. Characterization of a new species in the genus Chrysovirus. J Gen Virol 85:3389–3397. doi: 10.1099/vir.0.80181-0. [DOI] [PubMed] [Google Scholar]
  • 23.Frias-Staheli N, Giannakopoulos NV, Kikkert M, Taylor SL, Bridgen A, Paragas J, Richt JA, Rowland RR, Schmaljohn CS, Lenschow DJ, Snijder EJ, García-Sastre A, Virgin HW. 2007. Ovarian tumor domain-containing viral proteases evade ubiquitin- and ISG15-dependent innate immune responses. Cell Host Microbe 2:404–419. doi: 10.1016/j.chom.2007.09.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Li D, Wei T, Abbott CM, Harrich D. 2013. The unexpected roles of eukaryotic translation elongation factors in RNA virus replication and pathogenesis. Microbiol Mol Biol Rev 77:253–266. doi: 10.1128/MMBR.00059-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Makarova KS, Aravind L, Koonin EV. 2000. A novel superfamily of predicted cysteine proteases from eukaryotes, viruses and Chlamydia pneumoniae. TIBS. [DOI] [PubMed] [Google Scholar]
  • 26.Ramsey CB, Lee S. 2013. Recent and planned developments of the program oxcal. Raciocarbon 55:720–730. doi: 10.1017/S0033822200057878. [DOI] [Google Scholar]
  • 27.Reimer PJ, Bard E, Bayliss A, Beck JW, Blackwell PG, Ramsey CB, Buck CE, Cheng H, Edwards RL, Friedrich M, Grootes PM, Guilderson TP, Haflidason H, Hajdas I, Hatté C, Heaton TJ, Hoffmann DL, Hogg AG, Hughen KA, Kaiser KF, Kromer B, Manning SW, Niu M, Reimer RW, Richards DA, Scott EM, Southon JR, Staff RA, Turney CSM, van der Plicht J. 2013. Intcal13 and marine13 radiocarbon age calibration curves 0-50,000 years cal bp. Radiocarbon 55:1869–1887. doi: 10.2458/azu_js_rc.55.16947. [DOI] [Google Scholar]
  • 28.Márquez LM, Redman RS, Rodriguez RJ, Roossinck MJ. 2007. A virus in a fungus in a plant –three way symbiosis required for thermal tolerance. Science 315:513–515. doi: 10.1126/science.1136237. [DOI] [PubMed] [Google Scholar]
  • 29.Roossinck MJ, Saha P, Wiley GB, Quan J, White JD, Lai H, Chavarría F, Shen G, Roe BA. 2010. Ecogenomics: Using massively parallel pyrosequencing to understand virus ecology. Mol Ecol 19:81–88. doi: 10.1111/j.1365-294X.2009.04470.x. [DOI] [PubMed] [Google Scholar]
  • 30.Liu X, Gorovsky MA. 1993. Mapping the 5′ and 3′ ends of Tetrahymena thermophila mRNAs using RNA ligase-mediated amplification of cDNA ends (RLM-RACE). Nucleic Acids Res 21:4954–4960. doi: 10.1093/nar/21.21.4954. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Combe M, Sanjuán R. 2014. Variation in RNA virus mutation rates across host cells. PLoS Pathog 10:e1003855. doi: 10.1371/journal.ppat.1003855. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Sanjuán R. 2012. From molecular genetics to phylodynamics: evolutionary relevance of mutation rates across viruses. PLoS Pathog 8:e1002685. doi: 10.1371/journal.ppat.1002685. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Aiewsakun P, Katzourakis A. 2015. Endogenous viruses: connecting recent and ancient viral evolution. Virology 479–480:26–37. doi: 10.1016/j.virol.2015.02.011. [DOI] [PubMed] [Google Scholar]
  • 34.Smith O, Clapham A, Rose P, Liu Y, Wang J, Allaby RG. 2014. A complete ancient RNA genome: identification, reconstruction, and evolutionary history of archaeological barley stripe mosaic virus. Sci Rep 4:4003. doi: 10.1038/srep04003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Fordyce SL, Kampmann M-L, van Doorn NL, Gilbert MTP. 2013. Long-term RNA persistence in post-mortem contexts. Investig Genet 4:7. doi: 10.1186/2041-2223-4-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Ruby JG, Bellare P, DeRisi JL. 2013. PRICE: software for the targeted assembly of components of (meta)genomic sequence data. G3 (Bethesda) 3:865–880. doi: 10.1534/g3.113.005967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Drummond AJ, Ashton B, Buxton S, Cheung M, Cooper A, Duran C, Field M, Heled J, Kearse M, Markowitz S, Moir R, Stones-Havas S, Sturrock S, Theirer T, Wilson A. 2011. Geneious, v6.1. http://www.geneious.com/.
  • 38.Huelsenbeck JP, Ronquist F. 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17:754–755. doi: 10.1093/bioinformatics/17.8.754. [DOI] [PubMed] [Google Scholar]
  • 39.Li W, Zarka KA, Douches DS, Coombs JJ, Pett WL, Grafius EJ. 1999. Coexpression of potato PVY° coat protein and cry-BT genes in potato. J Am Soc Hort Sci 124:218–223. [Google Scholar]
  • 40.Stuiver M, Polach HA. 1977. Discussion reporting of 14C data. Radiocarbon 19:355–363. doi: 10.1017/S0033822200003672. [DOI] [Google Scholar]
  • 41.Bruenn J. 2003. A structural and primary sequence comparison of the viral RNA-dependent RNA polymerases. Nucleic Acids Res 31:1821–1829. doi: 10.1093/nar/gkg277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Bruenn JA. 1993. A closely related group of RNA-dependent RNA polymerases from double-stranded RNA viruses. Nucleic Acids Res 21:5667–5669. doi: 10.1093/nar/21.24.5667. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES