Bm-iAANAT3: Expression and Characterization of a Novel Arylalkylamine N-acyltransferase from Bombyx mori

Abstract

The arylalkylamine N-acyltransferases (AANATs) are enzymes that catalyze the acyl-CoA-dependent formation of N-acylarylalkylamides: acyl-CoA + arylalkylamine → N-acylarylalkylamides + CoA-SH. Herein, we describe our study of a previously uncharacterized AANAT from Bombyx mori: Bm-iAANAT3. Bm-iAANAT3 catalyzes the direct formation of N-acylarylalkylamides and accepts a broad range of short-chain acyl-CoA thioesters and amines as substrates. Acyl-CoA thioesters possessing an acyl chain length >10 carbon atoms are not substrates for Bm-iAANAT3. We report that Bm-iAANAT3 is a “versatile generalist”, most likely, functioning in amine acetylation – a reaction in amine inactivation/excretion, cuticle sclerotization, and melanism. We propose a kinetic and chemical mechanism for Bm-iAANAT3 that is consistent with our steady-state kinetic analysis, dead-end inhibition studies, determination of the pH-rate profiles, and site-directed mutagenesis of a catalytically important amino acid in Bm-iAANAT3. These mechanistic studies of Bm-iAANAT3 will foster the development of novel compounds targeted against this enzyme and other insect AANATs for the control of insect pests.

1. Introduction

N-Acetylamides, CH₃-CO-NH-R, have been isolated and characterized from a host of vertebrates and invertebrates and are usually produced in vivo by a reaction between acetyl-CoA, CoA-S-CO-CH₃, and the corresponding amine, R-NH₂ [1–5]. Amine N-acetylation is catalyzed by the arylalkylamine N-acetyltransferases (AANATs, also known as arylalkylamine N-acyltransferases) [6,7] which are members of the GCN5-related N-acetyltransferase enzyme superfamily [8–10]. In insects, the iAANATs (iAANATs = insect AANATs) produce N-acetylserotonin, an intermediate in melatonin biosynthesis, and are thought to function in controlling melanism [11,12], the inactivation of biogenic amines [13,14], the sclerotization of the insect cuticle [14,15], and photoperiodism [7]. Our interest in the AANATs is derived from our work on the biosynthesis of the fatty acid amides [16,17], a family of cell signaling lipids [18]. We and others have found that AANAT-like (AANATL) enzymes will catalyze the formation of fatty acid amides from fatty acyl-CoA thioesters and the corresponding amines [17,19–21]. Database searches of insect genomes indicate that a number of iAANATs and iAANATLs could be expressed in a variety of insects [7,14,22]. Thus, insects should serve as model organisms to better understand the possible role played by the iAANATs and iAANATLs in the biosynthesis of N-acetyl- and N-acylarylalkylamides and to further define the biological function of these molecules. Much remains unknown about the cellular function of the long-chain N-acylarylalkylamides and other fatty acid amides [23].

Herein, we report on the over-expression in E. coli, purification, and characterization of recombinant Bm-iAANAT3, a third iAANAT from B. mori. B. mori express two other iAANATs, Bm-iAANAT [24] and Bm-iAANAT2 [25]. Our work on Bm-iAANAT3 contributes to an understanding of N-acyltransferase chemistry and will foster the development of inhibitors targeted against insect N-acyltransferases, due to their emergence as intriguing targets for insecticide design. This is due, in part, to their low interspecies sequence identity between iAANATs (often ≤30%), very low sequence identity when aligned against AANATs from mammals and vertebrates (≤15%), their broad range of substrates from isoform to isoform, and their relative importance in the survival of the insect. [26–28]. In addition, we plan to extend our mechanistic work on the AANATs to focus on structural elucidation by NMR spectroscopy and X-ray crystallography. The other iAANATs we have over-expressed [20,21,29–32] have thwarted such experiments because these enzymes precipitate at high protein concentrations. Bm-iAANAT3 does not precipitate at high protein concentration enabling structural studies of this enzyme by NMR [33,34].

2. Material and Methods

2.1. Materials and general methods

Unless otherwise noted, all reagents were of the highest quality available from commercial sources. Codon-optimized Bm-iAANAT3 was purchased from Genscript. Oligonucleotides were purchased from Eurofins MWG Operon. BL21 (DE3) E. coli competent cells, XL-10 E. coli competent cells, and the pET-28a(+) vector were purchased from Novagen. PfuUltra High-Fidelity DNA polymerase was purchased from Agilent. XhoI, NdeI, Antarctic phosphatase, and T4 DNA ligase were purchased from New England Biolabs. Kanamycin monosulfate and isopropyl-β-D-thiogalactopyranoside (IPTG) were purchased from Gold Biotechnology. ProBond nickel-chelating resin was purchased from Invitrogen. N-acetyltryptamine was purchased from Cayman Chemical. Acyl-CoA and amine substrates were purchased from Sigma-Aldrich. Spectrophotometric analyses were performed on a Cary 300 Bio UV-Visible spectrophotometer.

2.2. Cloning of Bm-iAANAT3

Bm-iAANAT3 (Accession no. NM_001190842.1) was codon optimized for expression in E. coli, with the addition of terminal 5’-NdeI and 3’-XhoI restriction sites, and synthesized into a pUC57 vector. The full-length gene was excised from the pUC57 vector and cloned into the NdeI and XhoI restriction sites of the pET-28a vector. The Bm-iAANAT3-pET28a vector was then transformed into E. coli XL-10 competent cells, plated on a Luria Broth (LB) agar plate supplemented with 50 μg/mL kanamycin, and grown overnight at 37°C. A single colony from each vector transformation was cultured overnight in LB media supplemented with 50 μg/mL kanamycin overnight at 37°C. The Bm-iAANAT3-pET28a plasmid was purified from the overnight cultures using the Promega Wizard Plus SV Minipreps DNA purification kit, sequenced by Eurofins MWG Operon to confirm correct gene insertion, and, finally, transformed into E. coli BL-21 (DE3) cells for the expression of Bm-iAANAT3.

2.3. Expression and purification of wild-type Bm-iAANAT3

The E. coli BL-21 (DE3) competent cells containing the Bm-iAANAT3-pET28a vector were cultured in LB media supplemented with 50 μg/mL kanamycin at 37°C. Once the culture reached an OD₆₀₀ of 0.6, the cells were induced with the addition of 1.0 mM IPTG for 4 hours at 37°C. The final culture was harvested by centrifugation at 6,000 × g for 10 min. at 4°C, and the pellet frozen at −80°C for later analysis.

Cell pellets were thawed and resuspended in binding buffer: 20 mM Tris pH 7.9, 500 mM NaCl, and 5 mM imidazole. Cells were lysed by sonication and the cellular debris was pelleted by centrifugation at 16,000 × g for 20 min. at 4°C. The supernatant was collected and loaded onto a 5 mL column of ProBond nickel-chelating resin. The column was washed with 5 column volumes (CVs) of binding buffer, followed by 10 CVs of wash buffer: 20 mM Tris pH 7.9, 500 mM NaCl, and 60 mM imidazole. Finally, purified enzyme was eluted from the column in 1 mL fractions with 2–3 CVs of elution buffer: 20 mM Tris pH 7.9, 500 mM NaCl, and 500 mM imidazole. Fractions were evaluated for purity using 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The protein concentration was determined using the Bradford binding assay [35]. Fractions containing the desired, purified Bm-iAANAT3 enzyme were pooled, dialyzed overnight into 20 mM Tris pH 7.4, 200 mM NaCl, and stored at −80°C.

2.4. Substrate identification for Bm-iAANAT3

An activity-based screening protocol was used to identify substrates for Bm-iAANAT3. First, the enzyme was evaluated using acetyl-CoA (representative of a short-chain CoA) or oleoyl-CoA (representative of a long-chain CoA) separately, with different groups of pooled amines. The groups of amines are listed in Table 1. Each assay consisted of 300 mM Tris pH 8.0, 150 μM DTNB (Ellman’s reagent, 5,5’-dithiobis(2-nitro-benzoic acid), 500 μM acyl-CoA, and individual amines at 20 mM or 60 mM (Table 1). Initial velocities were determined by measuring the release of CoA at 412 nm using Ellman’s reagent (ε₄₁₂ = 13,600 M⁻¹ cm⁻¹) and were calculated after the background rate of CoA thioester hydrolysis was subtracted from the observed velocity. Any amine pool that displayed a background corrected specific activity of ≥0.1 μmoles/min/mg (≥0.04 M⁻¹ s⁻¹) in combination with acetyl-CoA or oleoyl-CoA was further evaluated to identify the specific Bm-iAANAT3 substrate(s) contained within that pool. Each amine within that group was individually interrogated at a relatively high concentration in the presence of acetyl-CoA or oleoyl-CoA to determine if the amine was truly a substrate for Bm-iAANAT3. The assay conditions were identical to that described for the screening protocol using the amine pools. Individual amines that displayed a background corrected specific activity of ≥0.1 μmoles/min/mg were included in our measurements for additional kinetic analysis.

Table 1.

Pooled Amine Substrates for the Initial Screening Assay

Pool	Concentration of Each Amine (mM)	Amino Donors
1	60	Lysine, Threonine, Glycine, Histamine, and Dopamine
2	60	Alanine, Arginine, Histidine, Tyramine, and Norepinephrine
3	60	Serine, Proline, Methionine, Serotonin, and Tryptamine
4	20	Glutamate, Asparagine, Valine, Ethanolamine, and Octopamine
5	20	Aspartate, Isoleucine, Tryptophan, and Glutamine
6	60	Leucine, Phenylalanine, γ-Aminobutyric acid, and Taurine
7	20	Spermidine, Agmatine, Cadaverine, Putrescine, and β-Alanine

2.5. Determination of the steady-state kinetic constants

Steady-state kinetic characterization of Bm-iAANAT3 was carried out using Ellman’s reagent to measure the release of CoA under the following conditions: 300 mM Tris pH 8.0, 150 μM DTNB, and varying concentrations of acyl-CoA and amine substrates at 22°C.

To determine the kinetic constants for the acyl-CoA substrates, the initial tryptamine concentration was 8.0 mM, while varying the concentration of the acyl-CoA substrates. To determine the kinetic constants for the amine substrates, the initial acetyl-CoA concentration was 500 μM, while varying the amine.

The kinetic constants for the acyl-CoA and amine substrates for Bm-iAANAT3 were determined by fitting the resulting data to Equation 1 using SigmaPlot 12.0: v_o represents initial velocity, V_max is the maximal velocity, K_m is the Michaelis constant, and [S] is the concentration of the varied substrate. Note that the concentration of the other substrate was fixed at relatively high (saturating) concentration. Assays were performed in triplicate and the uncertainty for the k_cat and (k_cat/K_m) values were calculated using Equation 2, with σ as the standard error [36].

$${\text{v}}_{\text{o}}=\frac{{\text{V}}_{\text{max}}[\text{S}]}{{\text{K}}_{\text{m}}+[\text{S}]}$$ Equation 1

$$\sigma \left(\frac{\text{X}}{\text{y}}\right)=\frac{\text{x}}{\text{y}}\sqrt{{\left(\frac{{\sigma }_{\text{x}}}{\text{x}}\right)}^2+{\left(\frac{{\sigma }_{\text{y}}}{\text{y}}\right)}^2}$$ Equation 2

2.6. Bm-iAANAT3 product characterization

The product of the reaction catalyzed by Bm-iAANAT3 was generated by incubating 100 μg of enzyme with 1 mM acetyl-CoA and 1 mM tryptamine ( ~ 10 × K_m for both) and 300 mM Tris, pH 8.0, to a final volume of 2 mL, for 10 minutes at 30°C. The enzyme was then removed via centrifugation using a Millipore 10 kDa spin column. The remaining solution was diluted 500-fold and 20 μL injected into a Phenomenex Kinetex 2.6 μm C₁₈ 100 Å (50 mm × 2.1 mm) reverse phase column coupled to an Agilent 6540 liquid chromatography/quadrupole time-of-flight mass spectrometry (LC/QTOF-MS) in positive ion mode. The elution gradient for liquid chromatography was as described by Dempsey et al. [20]. The resulting retention time and high-resolution mass-to-charge ratio for the sample was compared with that of a commercial standard of N-acetyltryptamine to confirm the catalytic activity of the enzyme.

2.7. Kinetic mechanism for Bm-iAANAT3

2.7.1. Double reciprocal analysis

To differentiate between sequential and classic ping-pong kinetic mechanisms, double-reciprocal plots of the initial velocity data were generated for acetyl-CoA and tryptamine in SigmaPlot 12.0. Non-linear regression analysis of initial rates and model discrimination analyses were performed in WaveMetrics IGOR Pro 6.34A. Initial velocities were determined by varying the concentration of one substrate, while holding the other substrate at a fixed concentration. The two plots were generated by holding the tryptamine concentration constant (40 μM, 60 μM, 120 μM, 250 μM, and 500 μM) and varying the concentration of acetyl-CoA. Accordingly, the second plot held the concentration of acetyl-CoA constant (15 μM, 25 μM, 40 μM, 90 μM, and 200 μM) and varied the tryptamine concentration. The resulting initial velocity data was fit to Equation 3 for an ordered bi-bi mechanism and to Equation 4 for ping-pong mechanism, where v_o is the initial velocity, V_max is the maximal velocity, [A] is the concentration of substrate A, [B] is the concentration of substrate B, K_ia is the dissociation constant for substrate A, K_b is the Michaelis constant for substrate B, and K_a is the Michaelis constant for substrate A. K_ia, the dissociation constant for acetyl-CoA, was fixed at 0.7 μM, based on the direct measurement of acetyl-CoA binding to Bm-iAANAT3 by isothermal calorimetry (ITC) [34].

$${\text{v}}_{\text{o}}=\frac{{\text{V}}_{\text{max}}[\text{A}][\text{B}]}{{\text{K}}_{\text{ia}}{\text{K}}_{\text{b}}+{\text{K}}_{\text{a}}[\text{B}]+{\text{K}}_{\text{b}}[\text{A}]+[\text{A}][\text{B}]}$$ Equation 3

$$\frac{{\text{V}}_{\max }[\text{A}][\text{B}]}{{\text{K}}_{\text{a}}[\text{B}]+{\text{K}}_{\text{b}}[\text{A}]+[\text{A}][\text{B}]}$$ Equation 4

2.7.2. Dead-end inhibition with oleoyl-CoA, tyrosol, and N-acetyltryptamine

To further define the kinetic mechanism of Bm-iAANAT3, we performed dead-end and product inhibition analysis using oleoyl-CoA, tyrosol, and N-acetyltryptamine. The initial velocities were generated by holding one substrate (either acetyl-CoA or tryptamine) at a fixed concentration, varying the concentration of the other substrate, at different fixed concentrations of each inhibitor. All assays were performed in triplicate, and the resulting data was fit to Equations 5 – 7 in SigmaPlot 12.0 for competitive, noncompetitive, and uncompetitive inhibition, respectively. For Equations 5 – 7, v_o is the initial velocity, V_max is the maximal velocity, K_m is the Michaelis constant, [S] is the substrate concentration, [I] is the inhibitor concentration, and K_i,s is the dissociation constant for the dissociation of I from the E•I complex, and K_i,i is the dissociation constant for the dissociation of I from the E•S•I complex.

$${\text{v}}_{\text{o}}=\frac{{\text{V}}_{\max }[\text{S}]}{{\text{K}}_{\text{m}}\left(1+\frac{[\text{I}]}{{\text{K}}_{\text{i},\text{s}}}\right)+[\text{S}]}$$ Equation 5

$${\text{v}}_{\text{o}}=\frac{{\text{V}}_{\text{max}}[\text{S}]}{{\text{K}}_{\text{m}}\left(1+\frac{[\text{I}]}{{\text{K}}_{\text{i},\text{s}}}\right)+[\text{S}]\left(1+\frac{[\text{I}]}{{\text{K}}_{\text{i},\text{i}}}\right)}$$ Equation 6

$${\text{v}}_{\text{o}}=\frac{{\text{V}}_{\text{max}}[\text{S}]}{{\text{K}}_{\text{m}}+[\text{S}]\left(1+\frac{[\text{I}]}{{\text{K}}_{\text{i},\text{i}}}\right)}$$ Equation 7

2.7.3. pH dependence of the steady-state kinetic constants

The pH dependence of the kinetic constants for acetyl-CoA (in the presence of saturating 8.0 mM tryptamine) were determined at intervals of 0.5 pH units ranging from pH 6.0 to 9.5. The buffers used were the following: MES (pH 6.0 – 6.5), Tris (pH 7.0 – 9.0) and AmeP (pH 9.0 – 9.5). The resulting kinetic data was fit to Equation 8 in WaveMetrics IGOR Pro 6.34A to delineate the pKa values of measured ionizable groups. In this equation, y represents either k_cat/K_m or K_m, c is the pH-independent plateau, H is the hydrogen ion concentration, and K_a represents the two unresolvable hydrogen ion dissociation constants.

$$\log (y)=\text{log}\left[\text{c}/\left(1+\frac{H^2}{{K_a}^2}\right)\right]$$ Equation 8

2.8. Cloning, expression, and purification of site-directed mutants

The E27A mutant was produced to investigate the role of Glu-27 in substrate binding and catalysis. The generation of the E27A mutant was carried out using the overlap extension method [37]. Mutants were amplified with the PfuUltra High-Fidelity DNA polymerase with the following PCR conditions: an initial denaturation step of 95°C for 2 minutes, followed by 30 cycles of PCR amplification (95°C for 30 s, 58°C for 30 s, 72°C for 1 min), and a final extension step of 72°C for 10 minutes. Primers were designed on the Agilent QuickChange Primer Design tool and purchased from Eurofins MWG Operon (Table 2). PCR products were digested with NdeI and XhoI restriction enzymes and ligated into the pET28a vector with DNA ligase acquired from New England Biolabs. The E27A mutant was expressed and purified in the same manner as wild type Bm-iAANAT3.

Table 2.

Primers for the Creation of Site-directed Mutants of Bm-iAANAT3

Clone	Primer	Sequence
Wildtype	Forward	GTAGCATATGGCTGATTTTGTTGTTGT
	Reverse	GTAGCTCGAGTTACGGCAGTTTCAG
E27A	Antisense	TCCTTCTTTGCCGATGCACCGCTGAACAAAGCC
	Sense	GGCTTTGTTCAGCGGTGCATCGGCAAAGAAGGA

3. Results and discussion

3.1. Cloning, expression, and purification of Bm-iAANAT3

Bm-iAANAT3 from Bombyx mori was successfully cloned, expressed, and purified from E. coli using a codon-optimized gene, yielding 10.9 mg of Bm-iAANAT3 purified protein per liter of culture. Purity was ≥95% as assessed by SDS-PAGE (Figure S1, Supplementary Materials) and the molecular weight of the protein was in good agreement with its mass, 23.9 kDa for Bm-iAANAT3. Bm-iAANAT3 is a previously uncharacterized enzyme, and shares 32%, 24%, and 30% sequence identity with Bm-iAANAT, Bm-iAANAT2, and Dm-AANATA, respectively (Figure 1). It shares slightly less identity with the mammalian AANATs from human and sheep, at 21% and 17% identity, respectively. These data provide additional evidence that AANATs typically share low sequence identity when compared against each other, even between enzymes from organisms of the same phylum and class [9].

Figure 1.

Homology overlays of iAANAT enzymes from Bombyx mori and Drosophila melanogaster. The sequence data used in creating this figure are: D. melanogaster AANATA (Dm-AANATA, accession number is NP_523839), B. mori iAANAT _Bm-iAANAT, accession number is NP_001073122.1), B. mori iAANAT2 (Bm-iAANAT2, accession number is XP_004928436.2), and B. mori iAANAT3 (Bm-iAANAT3, accession number is NP_001177771.1).

3.2. Identification of amine and acyl-CoA substrates for Bm-iAANAT3

We have developed a screening strategy employing different pools of various amine substrates (arylalkylamines, polyamines, aminoglycosides, ethanolamine, histamine, and amino acids; see Table 1) that enables the rapid identification of substrates for any putative N-acyltransferase. We have successfully utilized this strategy to identify substrates for N-acyltransferases from Drosophila melanogaster [29–32].

In applying this strategy to identify amine substrates for Bm-iAANAT3, a relatively high concentration of each amine (20 mM or 60 mM, Table 1) was included in the pool because the K_m value for glycine is reported at ≥6 mM for some of the glycine N-acyltransferases [38–40]. Pools of acyl-CoA substrates were not constructed because of the reports of long-chain acyl-CoAs acting as AANAT inhibitors [29,40,41]; therefore, we individually cross-screened amine pools against archetypal short and long-chain acyl-CoA thioesters, acetyl-CoA and oleoyl-CoA, because both have been reported as substrates for other GNAT family acyltransferases [20,21]. For Bm-iAANAT3, we found no initial velocity increase with oleoyl-CoA above the low enzyme-independent, background rate of oleoyl-CoA hydrolysis, suggesting that this enzyme does not catalyze the formation of long-chain N-acylamides. Employing acetyl-CoA as substrate, a broad range of amines were substrates exhibiting specific activities far above our background threshold specific activity of 0.1 μmoles/min/mg. Six arylalkylamines (tryptamine, tyramine, dopamine, octopamine, serotonin, and norepinephrine) and histamine were identified as substrates from the four amine pools that yielded Ellman-positive results. Ranking the amine substrates from the highest to the lowest (k_cat/K_m) values is as follows: tryptamine, tyramine, dopamine, octopamine, serotonin, norepinephrine, and histamine (Table 3). The (k_cat/K_m) value for the best amine substrate, tryptamine = (6.2 ± 0.6) × 10⁵ M⁻¹ s⁻¹, is ~30-fold higher than the value for the worst amine substrate, histamine = (1.9 ± 0.1) × 10⁴ M⁻¹ s⁻¹. Octopamine displayed the lowest K_m value of 18 ± 1 μM, while histamine displayed the highest K_m of 1.7 ± 0.1 mM. None of the polyamines, aminoglycosides, or amino acids we tested served as substrates for BmiAANAT3.

Table 3.

Kinetic Constants for the Amine Substrates for Bm-iAANAT3^a

Amine	Km (μM)	kcat (s−1)	(kcat/km) (M−1 s−1)	Relative (kcat/km)
Tryptamine	97 ± 8.8	60 ± 1.2	(6.2 ± 0.6) × 105	33
Tyramine	63 ± 6.7	27 ± 0.6	(4.3 ± 0.5) × 105	23
Dopamine	330 ± 23	55 ± 1.1	(1.6 ± 0.1) × 105	8.4
Octopamine	18 ± 0.8	2.2 ± 0.02	(1.2 ± 0.05) × 105	6.3
Serotonin	1100±63	59 ± 1.0	(5.2 ± 0.3) × 104	2.7
Norepinephrine	140 ± 8.6	5.3 ± 0.07	(3.7 ± 0.2) × 104	1.9
Histamine	1700±98	33 ± 0.68	(1.9 ± 0.1) × 104	1.0

^aKinetic constants for the amine substrates measured at one, fixed initial concentration of acetyl-CoA. Reactions were run at 22°C in 300 mM Tris pH 8.0, 150 μM DTNB, 500 μM acetyl-CoA, and the amine concentration was varied in the range 0.3 to 3.0 × K_m.

Interestingly, acetyl-CoA displayed the highest K_m value of the acyl-CoA substrates, 90 ± 4 μM. The other four acyl-CoA substrates, buytryl-CoA, hexanoyl-CoA, octanoyl-CoA, and decanoyl-CoA, exhibited nearly identical K_m values of 10 to 14 μM (Table 5). As we have observed with other insect AANATs [20,29–32], the (k_cat/K_m)acyl-CoA values decreased as the length of the acyl chain increased for the acyl-CoA substrates: the (k_cat/K_m)acetyl-CoA is 170-fold higher than the (k_cat/K_m)decanocyl-CoA (Table 5). Decanoyl-CoA was the acyl-CoA substrate with the longest acyl-chain that showed rates of CoA-SH formation that were significantly above the background rate of activity of enzyme-independent acyl-CoA hydrolysis. In addition, we found that malonyl-CoA is a substrate for Bm-iAANAT3 with a (k_cat/K_m)malonyl-CoA that is ~6-fold lower than the (k_cat/K_m)decanocyl-CoA (Table 5). To the best of our knowledge, only one other GNAT enzyme, aminoglycoside 2’-N-acetyltransferase (AAC(2’)-Ic), will accept malonyl-CoA as a substrate [42]. N-Succinoylation, however, has been demonstrated in the detoxification of mammalian xenobiotics [43,44], N-succinoyl conjugates of octopomine, serotonin, dopamine, and tyramine have been identified in C. elegans [45], N-succinoylserotonin (bufobutanoic acid) is found in the venom of various toad species (the traditional Chinese medicine, Ch’an Su) [46], and crystallographic results identified succinoyl-CoA bound in two GNAT enzymes [47,48]. Our data showing that malonyl-CoA is a Bm-iAANAT3 substrate in combination with these other works hints that a panel of N-malonylated and N-succinoylated amines may exist in both vertebrates and invertebrates.

Table 5.

Kinetic Constants for the CoA Thioester Substrates (R-CO-S-CoA) for Bm-iAANAT3^a

Acyl-CoA	R	Km (μM)	kcat (s−1)	(kcat/km) (M−1 s−1)	Relative (kcat/km)
Acetyl	CH3-	90 ± 3.6	64 ± 0.7	(7.1 ± 0.3) × 105	170
Malonyl	HOOC-CH2-	1900 ± 300	13 ± 1.5	(7.0 ± 1.3) × 103	0.17
Butyryl	CH3(CH2)2-	14 ± 0.8	4.0 ± 0.04	(2.9 ± 0.2) × 105	70
Hexanoyl	CH3(CH2)4-	13 ± 0.5	1.3 ± 0.01	(9.5 ± 0.4) × 104	23
Octanoyl	CH3(CH2)6-	10 ± 1.0	0.36 ± 0.005	(3.4 ± 0.3) × 104	8.1
Decanoyl	CH3(CH2)8-	12 ± 5.5	0.05 ± 0.004	(4.2 ± 1.9) × 104	1.0

^aKinetic constants for the amine substrates measured at one, fixed initial concentration of tryptamine. Reactions were run at 22°C in 300 mM Tris pH 8.0, 150 μM DTNB, 8.0 mM tryptamine, and the acyl-CoA concentration was varied in the range 0.3 to 3.0 × K_m.

Our work on Bm-iAANAT3 follows earlier studies of two other iAANATs from B. mori, Bm-iAANAT [24] and Bm-iAANAT2 [25]. One of these, Bm-iAANAT, exhibited a wide expression pattern and accepted a diverse set of amines as substrates for N-acetylation [24]. The combination of its broad tissue distribution and amine substrate promiscuity led to the suggestion that Bm-iAANAT is the major enzyme of monoamine catabolism in B. mori [24]. The N-acetylation of dopamine is of particular significance in monoamine catabolism. The production of N-acetyldopamine is a reaction critical to cuticular sclerotization in insects [15]. Dopamine is required for the formation of the brown pigment, dopamine melanin, while N-acetyldopamine is the precursor for a colorless pigment [49]. In fact, B. mori defective in dopamine biosynthesis have a colorless and improperly formed cuticle [50]. The N-acetylation of serotonin is one of the reactions in the conversion of tryptophan to melatonin [2,6]. Since Bm-iAANAT catalyzes the acetylation of both serotonin and dopamine, the enzyme is likely involved in melatonin and dopamine melanin production in B. mori. Bm-iAANAT mutants exhibit higher than normal levels of dopamine and widespread black pigmentation in the larvae and adult moths [11,50]. Later, a second B. mori iAANAT was discovered and characterized, Bm-iAANAT2 [25]. Transgenic flies suppressing Bm-iAANAT2 expression exhibited elevated dopamine levels and melanin deposition in the head and integument. These results suggest that Bm-iAANATL2 contributes to the regulation of melanism in B. mori.

Our substrate specificity studies of Bm-iAANAT3 show that this enzyme is a “versatile generalist” capable of acylating a broad range of amines, with a preference for acetyl-CoA as a co-substrate. All amines included in Table 3, apart from tryptamine, have been identified in B. mori [51–55]; thus, it is possible that Bm-iAANAT3 does catalyze their acetylation in vivo. Information regarding the cellular concentration of the amines we have identified as Bm-iAANAT3 substrates is limited. The hemolymph concentrations of dopamine, tyramine, and serotonin from the fourth instar, fifth instar, and pupa stages are low, <10 μM [51], but it is not clear how these concentrations relate to their respective intracellular concentrations. There are two reports of the brain concentrations of biogenic amines in B. mori, all reported as pg/brain [51,52]. If the volume of a B. mori brain is ~1 μL, the highest concentration of dopamine and serotonin would be ~0.8 mM. These estimated intracellular concentrations for dopamine and serotonin are comparable to the K_m values we determined for these amines, K_m for dopamine = 0.33 and K_m for serotonin = 1.1 mM (Table 3). Thus, Bm-iAANAT3 could have a role in the acetylation of dopamine and serotonin in vivo; therefore, functioning in sclerotization, pigmentation, and melatonin production.

3.3. Product Characterization

The product formed from by Bm-iAANAT3-catalyzed acetylation of tryptamine was confirmed via LC/QToF-MS in positive ion mode and compared to that of a commercial standard of N-acetyltryptamine. The enzymatically generated N-acetyltryptamine was successfully identified in the sample with an equivalent retention time and m/z compared to the commercial standard (Table 4).

Table 4.

Bm-iAANAT3 product characterization

Sample	Retention Time (min)	Mass/Charge [M + H] (m/z)
N-acetyltryptamine Standard	3.487	203.1188
Bm-iAANAT3 Assaya	3.438	203.1187

^aAssay conditions – 300 mM Tris, pH 8.0, 1 mM acetyl-CoA, 1 mM tryptamine, 100 μg Bm-iAANAT3

3.4. Kinetic mechanism

Two different experimental approaches were used to deduce the kinetic mechanism of Bm-iAANAT3. One set of experiments was to vary one substrate, acetyl-CoA or tryptamine, while holding the other substrate at a fixed initial concentration. Our initial velocity data were subjected to global non-linear regression analysis to discriminate between several bi-bi kinetic mechanisms [56]. The data fit equally well to Equation 3 for a steady-state ordered kinetic mechanism and Equation 4 for a ping-pong mechanism; Chi-squared values for the fits to equations 3 and 4 were the same within experimental error. An equilibrium ordered kinetic mechanism would yield one plot of 1/v vs. 1/[substrate] that intersect on the 1/v-axis, clearly inconsistent with the data shown in Figure 2. A pattern of parallel lines for the plot of 1/v vs. 1/[substrate] at fixed concentrations of the second substrate is often indicative of a ping-pong kinetic mechanism; however, a steady-state ordered kinetic mechanism can yield a parallel pattern if the K_m for substrate A is greater than the dissociation constant for substrate A [56]. This is exactly what we found for acetyl-CoA, K_m = 90 μM and K_d = 0.7 μM [34].

Figure 2.

Bm-iAANAT3 double-reciprocal analysis of initial velocities for acetyl-CoA and tryptamine, fit to equation 3 in a global non-linear regression analysis. (A) Velocities measured at fixed concentrations of tryptamine: 500 μM (□), 250 μM (✦), 120 μM (◆), 60 μM (◯) and 40 μM (▼). (B) Velocities measured at fixed concentrations of acetyl-CoA: 200 μM (✦), 90 μM (□), 40 μM (◆), 25 μM (◯) and 15 μM (▼).

Next, a set of dead-end inhibition studies were performed to provide additional support for an ordered kinetic mechanism. Oleoyl-CoA and tyrosol were exploited as dead-end inhibitors against acetyl-CoA and tryptamine, respectively. Neither analog exhibited a rate of reaction above the baseline rate of hydrolysis, and both have been previously utilized as dead-end inhibitors in studies of the D. melanogaster AANATs [29,31,32] and mammalian serotonin N-acetyltransferase [41]. Oleoyl-CoA was competitive vs. acetyl-CoA (Figure 3A) and noncompetitive vs. tryptamine (Figure 3B) with a K_i,s value of 220 ± 20 nM and K_i,s = K_i,i values of 790 ± 30 nM, respectively. Tyrosol was uncompetitive vs. acetyl-CoA (Figure 3C) and competitive vs. tryptamine (Figure 3D), with a K_i,i value of 230 ± 10 μM and a K_i,s value of 90 ± 10 μM, respectively. Furthermore, these data indicate that enzymatic generation of N-acetyltryptamine from acetyl-CoA and tyramine as catalyzed by Bm-iAANAT3, most likely, occurs via an ordered sequential mechanism with acetyl-CoA binding first followed by the binding of tryptamine to yield the catalytically competent Bm-iAANAT3•acetyl-CoA•tryptamine ternary complex. An ordered sequential kinetic mechanism has been attributed to several D. melanogaster AANATs [29–32] and GNAT enzymes [57–60].

Figure 3.

Dead-end inhibition plots for Bm-iAANAT3. (A) Velocities measured at a fixed concentration of tryptamine (100 μM) with varied concentrations of acetyl-CoA (10 μM, 25 μM, 50 μM, and 100 μM), at varied concentrations of the inhibitor, oleoyl-CoA: 0 nM (●), 250 nM (◯), and 500 nM (▼); K_i = 220 ± 20 nM (B) Velocities measured at a fixed concentration of acetyl-CoA (100 μM) with varied concentrations of tryptamine (50 μM, 100 μM, 150 μM, and 300 μM), at varied concentrations of the inhibitor, oleoyl-CoA: 0 nM (●), 250 nM (◯), and 500 nM (▼), K_i = 790 ± 30 nM (C) Velocities measured at a fixed concentration of tryptamine (100 μM) with varied concentrations of acetyl-CoA (10 μM, 25 μM, 50 μM, and 100 μM), at varied concentrations of the inhibitor, tyrosol: 0 μM (●), 150 μM (◯), and 300 μM (▼); K_i = 230 ± 10 μM (D) Velocities measured at a fixed concentration of acetyl-CoA (100 μM) with varied concentrations of tryptamine (50 μM, 100 μM, 150 μM, and 300 μM), at varied concentrations of the inhibitor, tyrosol: 0 μM (●), 150 μM (◯), and 300 μM (▼); K_i = 90 ± 10 μM

Product inhibition is one method useful in defining the order of product release. N-Acetyltryptamine produced competitive and noncompetitive inhibition plots against acetyl-CoA and tryptamine, respectively (Figure. S2, Supplementary Materials). These data are most consistent with an ordered sequential product release with CoA-SH being released first followed by release of the acetylated product, N-acetyltryptamine. This is similar to the order of product release reported for N-myristoyltransferase [60]. We found that order of product release for D. melanogaster agmatine N-acetyltransferase (AgmNAT) was the N-acetylated product first followed by CoA-SH [32], similar to that reported for human histone acetyltransferase (HAT) [58] and Enterococcus faecium aminoglycoside acetyltransferase (AAC(6’)-I) [59]. The product inhibition patterns for Bm-iAANAT3 (Figure S2) differed from those reported for AgmNAT, HAT, and AAC(6’)-I.

A steady-state ordered bi-bi kinetic mechanism with acetyl-CoA binding first and N-acetyltryptamine being released last (Scheme 1) is consistent with the binding data of Aboalroub et al. [34]. Direct binding measurements by ITC and/or NMR showed that acetyl-CoA and N-acetyltryptamine bound to Bm-iAANAT3 with K_d values of 0.7 ± 0.03 μM and 12 ± 3 μM. The binding of N-acetyltryptamine was eliminated by the addition of acetyl-CoA and was not affected by the addition of CoA-SH. The binding of tryptophol, the non-substrate alchohol analog of tryptamine, was significantly enhanced by the presence of acetyl-CoA, the K_d value decreasing from 230 ± 12 μM to 50 ± 2 μM. Lastly, CoA-SH binds to Bm-iAANAT3 with low affinity, a K_d of 30 ± 1 μM. Relatively weak binding of tryptamine, K_d = 220 ± 8 μM, and CoA SH to free Bm-iAANAT indicates that kinetic mechanism is actually random bi-bi with a strong preference for acetyl-CoA binding first and N-acetyltryptamine being released last (Scheme 1).

Scheme 1.

Proposed kinetic mechanism for the Bm-iAANAT3-catalyzed N-acetylation of tryptamine. The thick lines in the scheme represent a preferred pathway in a random kinetic mechanism with acetyl-CoA binding first and N-acetyltryptamine being released last. A = Acetyl-CoA, B = tryptamine, P = CoA-SH, and Q = N-acetyltryptamine.

3.5. pH dependence of the kinetic constants and identification of a catalytic base

We determined the pH-dependence of the kinetic constants for acetyl-CoA to aid in our identification of amino acids important in catalysis and substrate binding in Bm-iAANAT3. Both the k_cat, and (k_cat/K_m)acetyl-CoA pH-rate profiles exhibited a pH-dependent rise with a slope of 2 from pH 6.25 to 7.5 following by a pH-independent plateau above pH 7.5. These data are best fit to equation 8, pointing towards two unresolvable amino acids that are deprotonated for optimal catalytic activity. For both profiles, a pK_a value of 7.2 ± 0.1 provide the fit to the data (Figure 4). These pK_a values likely correspond to a general base deprotonating the primary amine of tryptamine; alternatively, it could be attributed to the zwitterionic tetrahedral intermediate that is produced after the nucleophilic attack of the acetyl-CoA thioester by tryptamine. This set of experiments did not uncover a third, higher pK_a value; this additional pK_a (~8.5 – 10.0) would correspond to a general acid in catalysis, routinely observed for NAT enzymes [9,31,61]. We hypothesize that Bm-iAANAT3 either lacks a general acid in catalysis, or the general acid has a pK_a value > 9.5, a number too high for us to ascertain due to limitations of acetyl-CoA hydrolysis and/or DTNB instability at elevated pH ranges.

Figure 4.

pH rate profiles for Bm-iAANAT3. (A) log(k_cat) versus pH for acetyl-CoA. (B) log(k_cat/K_m) versus pH for acetyl-CoA.

3.6. Identification of a catalytic base and a potential chemical mechanism for catalysis

Alignment of the amino acid sequence of Bm-iAANAT3 to those for other insect AANATs shows that Glu-27 of Bm-iAANAT3 corresponds to Glu-47 of AANATA from D. melanogaster (Figure 1). Dempsey et al. [29] have shown that Glu-47 is likely the catalytic base in that enzyme. Thus, we mutated Glu-27 to Ala in Bm-iAANAT3. The E27A mutant enzyme was cultured, purified, and characterized in the same manner as the wild-type Bm-iAANAT3. The kinetic constants we measured for the E27A mutant were: K_m,acetyl-CoA = 20 ± 2.2 μM, k_cat,acetyl-CoA = 4.0 ± 0.09 × 10⁻² s⁻¹, K_m, = 9400 ± 990 μM, and k −2 tryptamine , = 8.0 ± 0.3 × 10 −1 cat tryptamine s . Thus, the E27A mutant retained only 0.06% to 0.13% the wild-type k_cat while exhibiting 100-fold increase in the K_m for tryptamine. The significant decline in catalytic activity as compared to wild-type Bm-iAANAT3, in addition to the large perturbation in the K_m,tryptamine, suggests that this residue functions as a general base in catalysis, as well as playing a role in substrate binding. Glu-27 likely represents the pK_a value of ~7.2 observed in the pH-rate profile (Figure 4). The ~1000-fold decrease in k_cat value for the E27A mutant falls in the range of values measured for general base mutants of other insect N-acyltransferases in GCN5 family (Table 6). A larger k_cat effect was measured after the mutation of the catalytic base in mandelate racemase, a ~10,000-fold decrease in the k_cat of the D270N mutant [62]. Given the results for the D270N mutant in mandelate racemase, the general base mutants of Bm-iAANAT3 and the other N-acyltransferases in Table 6 have surprisingly high k_cat values. Most likely, this results from another chemical species serving as a base in catalysis. We suggest that the second pK_a observed in our pH-rate profiles, also with a pK_a value of ~7.2, is likely the adjacent aspartate residue (Asp-26), that serves as a “back-up” or redundant role in Bm-iAANAT catalysis. Similarly, Scheibner et al. [61] argue that His-120 is the catalytic base in the mammalian N-acyltransferase, serotonin N-acetyltransferase, and that the nearby His-122 is catalytically redundant, serving as the base in the H120A mutant.

Table 6.

Ratio of k_cat,wildtype/k_cat,mutant for General Base Mutant Enzymes

Enzymea	Mutation	(kcat)wildtype/(kcat)mutant	Ref.
Dm-AgmNAT	E34A	~2100	32
Bm-iAANAT3	E27A	~1000	This work
Dm-AANATL7	E26A	~22	31
Dm-AANATA	E47A	~13–170	29,63
Dm-AANATL2b	E29A	~1.0	30

^aDm = Drosophila melanogaster and Bm = Bombyx mori

^bGlu-29 is not, most likely, the catalytic base for Dm-AANATL2.

When taken together, our data strongly supports the chemical mechanism depicted in Scheme 2. The double-reciprocal plots and dead-end inhibition analysis indicate a preference for an ordered sequential mechanism: acetyl-CoA binds first, followed by tryptamine, leading to the Bm-iAANAT3•acetyl-CoA•tryptamine ternary complex before catalysis occurs. After the binding of both substrates into the active site, the positively charged amine moiety of tryptamine is deprotonated by Glu-27, the catalytic base. The amine deprotonation step is followed by nucleophilic attack of the deprotonated amine at the carbonyl of the acetyl-CoA thioester to generate a tetrahedral intermediate. The zwitterionic tetrahedral intermediate collapses as the coenzyme A thiolate is protonated by the positively charged amine of the intermediate to yield the two products: CoA-SH and N-acetyltryptamine. Our product inhibition studies show that product release has a preferred order with CoA-SH exiting first, followed by N-acetyltryptamine.

Scheme 2.

Proposed chemical mechanism for the Bm-iAANAT3-catalyzed N-acetylation of tryptamine.

4. Conclusions

We have cloned, over-expressed in E. coli, and characterized a previously unknown iAANAT from B. mori, Bm-iAANAT3. The kinetic mechanism for Bm-iAANAT3 with acetyl-CoA and tryptamine is random bi-bi, but with a strong preference for a steady-state ordered mechanism with acetyl-CoA binding first and N-acetyltryptamine released last. Studies of the chemical mechanism suggest that Glu-27-mediated deprotonation of the amine substrate facilitates nucleophilic attack of the amine at the carbonyl of the acetyl-CoA thioester. Collapse of the resulting tetrahedral intermediate immediately leads to product release, the N-acetylated amine likely leaving first, followed by the CoA-SH by-product.

Substrate specificity data reveal that Bm-iAANAT3 prefers short-chain acyl-CoA thioesters with acetyl-CoA as the best acyl-CoA substrate. While fatty acid amides have been recently identified in B. mori [21], Bm-iAANAT3 is probably not involved in their biosynthesis in vivo. Bm-iAANAT3 accepts a variety of amines as substrates pointing towards a cellular role for this enzyme in amine inactivation and/or excretion. In addition, Bm-iAANAT3 may have role in sclerotization, melanism, and melatonin biosynthesis by catalyzing dopamine and serotonin acetylation. Our identification of malonyl-CoA as a Bm-iAANAT3 substrate suggests that a series of biologically-occurring N-malonylated and N-succinoylated amines await discovery and characterization; a suggestion consistent with the identification of N-succinoylated amines in C. elegans. Why B. mori would express three iAANATs, BmiAANAT, Bm-iAANAT2, and Bm-iAANAT3, with potentially overlapping cellular functions is unknown. Future Bm-iAANAT3 knockdown-experiments in B. mori are planned to address the question of its cellular function.

Highlists:

• Bm-iAANAT3 exhibits promiscuous substrate specificity for acyl-CoA and amine substrates.

• Bm-iAANAT3 catalyzes the formation of N-acetyltryptamine through a bi-bi ordered sequential kinetic mechanism, with acetyl-CoA binding first and the N-acetyltryptamine released last.

• pH-activity profiles for Bm-iAANAT3 suggest a chemical mechanism with Glu-27 functioning as a base during catalysis.

Abbreviations:

AANAT

arylalkylamine N-acetyltransferase

AANATA

arylalkylamine N-acetyltransferase variant A

AANATL

arylalkylamine N-acyltransferase like

AgmNAT

agmatine N-acetyltransferase

CoA

coenzyme A

DTNB

5,5’-dithiobis(2-nitro-benzoic acid)

GNAT

GCN5-related N-acetyltransferase

HAT

histone N-acetyltransferase

iAANAT

insect arylalkylamine N-acetyltransferase

IPTG

isopropyl β-D-1-thiogalactopyranoside

SDS-PAGE

sodium dodecyl sulfate polyacrylamide gel electrophoresis

SNAT

serotonin N-acetyltransferase