Abstract
Scedosporium is a genus comprising at least 10 species of airborne fungi (saprobes) that survive and grow on decaying organic matter. These fungi are found in high density in human-affected areas such as sewage-contaminated water, and five species, namely Scedosporium apiospermum, S. boydii, S. aurantiacum, S. dehoogii, and S. minutisporum, cause human infections. Thailand is a popular travel destination in the world, with many attractions present in densely populated areas; thus, large numbers of people may be exposed to pathogens present in these areas. We conducted a comprehensive survey of Scedosporium species in 350 soil samples obtained from 35 sites of high human population density and tourist popularity distributed over 23 provinces and six geographic regions of Thailand. Soil suspensions of each sample were inoculated on three plates of Scedo-Select III medium to isolate Scedosporium species. In total, 191 Scedosporium colonies were isolated from four provinces. The species were then identified using PCR and sequencing of the beta-tubulin (BT2) gene. Of the 191 isolates, 188 were S. apiospermum, one was S. dehoogii, and species of two could not be exactly identified. Genetic diversity analysis revealed high haplotype diversity of S. apiospermum. Soil is a major ecological niche for Scedosporium and may contain S. apiospermum populations with high genetic diversity. This study of Scedosporium distribution might encourage health care providers to consider Scedosporium infection in their patients.
Introduction
Scedosporium is a genus of filamentous fungi with septate hyphae. These fungi are airborne saprobes that survive and grow on decaying organic matter, and thus, are frequently found in high density in human-affected areas such as sewage, contaminated water, and urban soil. The genus currently comprises 10 species, five of which, namely Scedosporium apiospermum, S. boydii, S. aurantiacum, S. dehoogii, and S. minutisporum, cause Scedosporiosis. [1]. This disease has recently emerged as a severe fungal infection from environmental sources. Scedosporium biology has been studied mainly after its isolation from the environment. In Thailand, S. apiospermum was reported in brain abscesses of near-drowning individuals [2]. Moreover, two Swiss tourists who nearly drowned in a tsunami disaster were infected with S. apiospermum [3].
The distribution of Scedosporium is of increasing clinical importance considering several severe Scedosporium species infections reported throughout Asia. In Japan, Nakamura et al. reported multiple brain abscesses caused by S. aurantiacum [4], and Shimizu et al. reported vertebral osteomyelitis caused by S. apiospermum in patients who nearly drowned during the Great East Japan Earthquake and Tsunami [5]. In Taiwan, Chen et al. [6] reported a case of disseminated S. apiospermum infection in a near-drowning patient. Thus, a unique feature of this environmental fungus is the infection of immunocompetent humans after near-drowning incidents. Therefore, clinicians and microbiologists should be aware of this possibility in regions with high endemicity. Furthermore, additional research on disease course and treatment is required.
Therefore, our team began to study Scedosporium species in their natural habitats in Thailand. In our initial study, we surveyed and isolated colonies of Scedosporium species in soil and water samples from 10 public parks in Bangkok, the capital and most populous city in Thailand. Three major Scedosporium species, namely S. apiospermum, S. aurantiacum, and S. dehoogii, were identified, but 16 sequences could not be identified, implying the possibility of additional Scedosporium species [7].
In this study, we conducted a more comprehensive survey of Scedosporium species in soil samples by investigating soil samples in Thailand from 35 public areas with high human population density and tourist popularity in six geographic regions of Thailand.
Materials and methods
Soil sample collection
Sampling at all locations in 35 public parks was authorized by the mayor’s office of the municipality or city in 23 provinces in six geographic regions: northern (Chiang Mai, Chiang Rai, and Nan Provinces), central (Phitsanulok, Nakhon Sawan, Nakhon Nayok, Phra Nakhon Si Ayutthaya, and Samut Songkhram Province), western (Tak, Kanchanaburi, and Prachuap Khiri Khan Provinces), eastern (Chon Buri and Chanthaburi Provinces), northeastern (Nakhon Ratchasima, Khon Kaen, Mukdahan, Nong Khai, Bueng Kan, and Ubon Ratchathani Provinces) and southern (Surat Thani, Phuket, Songkhla, and Narathiwat Provinces) (Table 1 and S1 Table). Soils samples were randomly collected from ten 1-m2 sites in each park, with sampling at four positions per site. All soil samples were collected from a depth of approximately 15 cm using a sterile metal spoon to avoid plant debris, weeds, and branches. Samples were placed in sterile plastic bags and stored at 4°C until processed.
Table 1. Sample collection areas and number of Scedosporium apiospermum species complex strains isolated from each area.
| Park name | Park code | Location | Province | No. of sampled sites | No. of isolates | Distribution of Scedosporium species complex members | |||
|---|---|---|---|---|---|---|---|---|---|
|
S. apiospermum |
S. dehoogii |
Unidentified species |
|||||||
| 1. Ko Loi Public Park | CRI-A | N 19.91832; E 099.83858 |
Chiang Rai |
10 | 0 | 0 | 0 | 0 | |
| 2. Anniversary Rama 9 Flag and Lamb Park | CRI-B | N 19.90855; E 099.83505 |
10 | 0 | 0 | 0 | 0 | ||
| 3. Chiang Rai Beach Park | CRI-C | N 19.91714; E 099.79384 |
10 | 0 | 0 | 0 | 0 | ||
| 4. Nong Buak Hard Public Park | CMI-D | N 18.78188; E 098.97968 |
Chiang Mai |
10 | 0 | 0 | 0 | 0 | |
| 5. Lanna Rama 9 Park | CMI-E | N 18.81985; E 098.97861 |
10 | 0 | 0 | 0 | 0 | ||
| 6. Baan Den Health Park | CMI-F | N 18.77238; E 099.00645 |
10 | 0 | 0 | 0 | 0 | ||
| 7. Nong Thin Public Park | NKI-G | N 17.87699; E 102.72742 |
Nong Khai | 10 | 0 | 0 | 0 | 0 | |
| 8. Pumrak Park | NMA-H | N 14.97205; E 102.07129 |
Nakhon Ratchasima |
10 | 77 | 76 | 1 | 0 | |
| 9. Asdang Reservoir Park | NMA-I | N 14.98180; E 102.09743 |
10 | 44 | 44 | 0 | 0 | ||
| 10. Nongkae Chang Park | NMA-J | N 14.96639; E 102.07471 |
10 | 33 | 32 | 0 | 1 | ||
| 11. Paradise Park | NSN-K | N 15.69820; E 100.12359 |
Nakhon Sawan | 10 | 0 | 0 | 0 | 0 | |
| 12. Bueng Phraram Public Park | AYA-L | N 14.35659; E 100.56277 |
Phra Nakhon Si Ayutthaya | 10 | 34 | 33 | 0 | 1 | |
| 13. Chaloem Phrakiat Rama 9 Park (Saun Luang Chonburi) | CBI-M | N 13.33708; E 100.95692 |
Chonburi |
10 | 0 | 0 | 0 | 0 | |
| 14. 80 Anniversary Rama 9 Chaloem Phrakiat Park | CBI-N | N 13.36353; E 100.97855 |
10 | 0 | 0 | 0 | 0 | ||
| 15. Health Park | CBI-O | N 13.36463; E 100.98007 |
10 | 0 | 0 | 0 | 0 | ||
| 16. Somdet Phra Nyanasamvara Park | KRI-P | N 14.02141; E 099.52165 |
Kanchanaburi | 10 | 0 | 0 | 0 | 0 | |
| 17. Municipal Public Park | PKN-Q | N 11.80984; E 099.79892 |
Prachuap Khiri Khan | 10 | 2 | 0 | 0 | 2 | |
| 18. Chaloem Phrakiat Rama 9 Park | PKT-R | N 07.87949; E 098.37398 |
Phuket | 10 | 0 | 0 | 0 | 0 | |
| 19. Free Park (Japan Park) | SKA-S | N 07.21214; E 100.59496 |
10 | 0 | 0 | 0 | 0 | ||
| 20. Courtyard Park | SKA-T | N 07.19175; E 100.59415 |
Songkhla | 10 | 0 | 0 | 0 | 0 | |
| 21. Huai Muang Park | UBN-U | N 15.24694; E 104.84307 |
Ubon Ratchathani |
10 | 0 | 0 | 0 | 0 | |
| 22. Tung Sri Muang Park | UBN-V | N 15.22993; E 104.85844 |
10 | 0 | 0 | 0 | 0 | ||
| 23. Rama 5 Public PArk | NWT-W | N 06.42206; E 101.80879 |
Narathiwat | 10 | 0 | 0 | 0 | 0 | |
| 24. Chaloem Phrakiat Health Park | SKM-X | N 13.411140; E 100.00183 |
Samut Songkhram | 10 | 1 | 1 | 0 | 0 | |
| 25. Municipal Public Park | NYK-Y | N 14.20273; E 101.21530 |
Nakhon Nayok | 10 | 0 | 0 | 0 | 0 | |
| 26. Bueng Kaen Nakhon Public Park | KKN-Z | N 16.41813; E 102.83589 |
Khon Kaen |
10 | 0 | 0 | 0 | 0 | |
| 27. Thanarak Anusorn Public Park | KKN-AA | N 16.43029; E 102.82467 |
10 | 0 | 0 | 0 | 0 | ||
| 28. Bueng Kan Public Park | BKN-AB | N 18.36135; E 103.66105 |
Bueng Kan | 10 | 0 | 0 | 0 | 0 | |
| 29. Somdej Pra Chao Tak Sin Maharat Public Park | CTI-AC | N 12.60178; E 102.10439 |
Chanthaburi | 10 | 0 | 0 | 0 | 0 | |
| 30. Chaloem Phrakiat Rama 9 Public PArk | CTI-AD | N 12.59525; E 102.08495 |
10 | 0 | 0 | 0 | 0 | ||
| 31. Si Mueang Park | NAN-AE | N 18.77608; E 100.77496 |
Nan | 10 | 0 | 0 | 0 | 0 | |
| 32. Chom Nan Chaloem Phrakiat Public Park | PLK-AF | N 16.491.44; E 100.15357 |
Phitsanulok | 10 | 0 | 0 | 0 | 0 | |
| 33. Somdej Phra Naresuan Maharat Shrine Maesod Park | TAK-AG | N 16.43196; E 98.3437 |
Tak | 10 | 0 | 0 | 0 | 0 | |
| 34. Rama 9 Park | SNI-AH | N 9.13820; E 99.34894 |
Surat Thani | 10 | 0 | 0 | 0 | 0 | |
| 35. Mueang Mukdahan Municipal Golden Jubilee Commemoration Public Park | MDH-AI | N 16.54077; E 104.71962 |
Mukdahan | 10 | 0 | 0 | 0 | 0 | |
| Total | 35 | 35 | 23 | 350 | 191 | 188 | 1 | 2 | |
Isolation of S. apiospermum species complex
Fungal isolation was performed according to the procedure provided by Luplertlop et al. [7]. In brief, 5 g of soil were suspended in 15 ml sterile distilled water, vigorously mixed, and filtered through 100-μm nylon cell strainers (Falcon, Durham, NC, USA). The filtrate was centrifuged at 7,000 ×g for 5 min, and the supernatant was discarded. The pellet was then re-suspended in 5 ml distilled water. Three 100-μl aliquots were inoculated on three separate plates of Scedo-Select III medium, which was designed and developed to minimize the growth of other rapidly growing fungal species and specifically for the isolation of Scedosporium colonies [8]. The plates were incubated at 35°C for 5 days.
Morphological identification of S. apiospermum species complex
Colony morphologies were visually and microscopically examined according to the procedure of Gilgado et al. [9–10]. A single colony of each morphological type on a given plate was selected for further analysis. Colonies identified as S. apiospermum species complex on the basis of their morphology were inoculated on Scedo-Select III for purification. The colonies isolated from Scedo-Select III plates were then collected and inoculated onto Sabouraud dextrose agar for detailed macroscopic and microscopic observations.
Molecular identification of S. apiospermum species complex
Species isolated from soil, as described above, were inoculated in yeast peptone dextrose broth and incubated at 35°C for 7 days. DNA was extracted using the E.Z.N.A. Fungal DNA mini kit (Omega Bio-tek, Norcross, GA, USA) and amplified using PCR with the β-tubulin (Bt2) gene-specific primers Bt2a: 5′GGTAACCAAATCGGTGCTGCTTTC3′ and Bt2b: 5′ACCCTCAGTGTAGTGACCCTTGGC3′ [11]. Each PCR reaction was performed in a 25-μl mixture that contained 0.5 μM of each primer, KAPA 2G Fast HS ReadyMix PCR kit with a loading dye (KAPA Biosystems, USA), nuclease-free water, and genomic DNA using a T100 Thermal Cycler (Bio-Rad) according to the following protocol: 95°C for 6 min, 35 cycles of 95°C for 1 min, 58°C for 1 min, and 72°C for 45 s, and a final extension step of 72°C for 10 min. Then, 5 μl of the PCR product was electrophoresed on a 1.5% agarose gel that contained SERVA DNA Stain G (SERVA Electrophoresis GmbH, Germany) in 1× TBE buffer. Banding patterns were photographed using the Gel Doc XR+ system (Bio-Rad). PCR products (product size ~ 650 bp) were purified using the FavorPrep GEL/PCR Purification Mini Kit (Favorgen Biotech Corporation, Taiwan) and sequenced using gene-specific forward and reverse primers by AITbiotech Pty Ltd (Singapore). The retrieved sequence files were edited and subjected to pairwise alignment using the BioEdit software (http://www.mbio.ncsu.edu/bioedit/bioedit.html). Edited sequences were compared with existing sequences in GenBank using BLASTn (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The generated nucleotide sequences were deposited in GenBank under accession numbers MF991891 and MG204345−MG204534 (The Genbank accession number provided in Supplementary data S1 Table).
Phylogenetic and genetic diversity analysis
Each sequence was trimmed to the start and end of the gene. The allele number of each sequence was determined using the MLSTest v1.0.1.23 software (downloaded from http://ipe.unsa.edu.ar/software) [12]. Graphic representations of multiple nucleic acid sequence alignments were created using WebLogo 3 (weblogo.threeplusone.com). The best model of evolution was selected from the Bayesian Information Criterion (BIC) in MEGA7 [13]. The model with the lowest BIC score was selected to construct a maximum likelihood phylogenetic tree. A phylogenetic tree of all aligned sequences, excluding gaps, and missing data for the heuristic search was obtained by applying the maximum likelihood approach based on the best model in MEGA7. The tree is drawn to scale, with branch lengths measured in number of substitutions per site. A bootstrap analysis was conducted with 1000 replications, and bootstrap values of ≥50% are shown above the branches. Sequences of reference strains were downloaded from GenBank (S2 Table). All sequences were included in a phylogenetic network of the Bt2 gene created by using the neighbor-net algorithm of SplitsTree4 (downloaded from http://www.splitstree.org/) [14].
Ethics statement
This field study was performed under permission from the Ministry of Education (letter 0517.115/00331), as well as the following authorities concerned with protection of wildlife: Thanong Donchai, Deputy mayor; Chiangmai Province permitted by Chatri Cheuamanochan, Deputy mayor; Nan Province permitted by Arisa Boonsom, Deputy mayor; Phitsanulok Province permitted by Pongsin Sanepong, Deputy mayor; Phra Nakhon Si Ayutthaya Province permitted by Suvera Rinvet, Municipal Clerk; Samut Songkhram Province permitted by Somchai Tonpasert, Mayor; Tak Province permitted by Ananchai Taweeguekolkit, Mayor; Kanchanaburi Province permitted by Kumtorn Pusitkarnchana, Deputy mayor; Prachuap Khiri Khan Province permitted by Pichit Santimethakul, Deputy mayor; Chon Buri permitted by Jutharat Parinwachirapat, Municipal Clerk; Chanthaburi Province permitted by Pirat Atikarnkul, Municipal Clerk; Nakhon Ratchasima Province permitted by Nutcharat Chuhirunwat, Director of Public Works; Khon Kean Province permitted by Thawatchai Wanapithakkul, Mayor; Mukdahan Province permitted by Trirong Thawinprai, Deputy mayor; Nong Khai Province permitted by Winchai Waipat, Deputy mayor; Bueng Kan Province permitted by Witaya Saynjanthichai, Mayor; Ubon Ratchathani Province permitted by Kritchapol Muangnue, Deputy mayor; Surat Thani Province permitted by Suphang Saewong, Deputy mayor; Phuket Province permitted by Thavorn Jirapatsophon, Deputy mayor; Songkhla Province pemitted by Somsak Tanthiseranee, Mayor and Narathiwat Province permitted by Udom Densanthikul, Mayor. The field study did not involve endangered or protected species.
Results
In this study, 350 soil samples were collected from 35 public parks that were distributed across 23 provinces of Thailand (Table 1). In total, 191 morphologically distinct colonies of Scedosporium were selected for species and strain identification based on Bt2 gene sequencing. Of the 191 isolates, 188 were S. apiospermum (76 isolates from Pumrak Park, 44 isolates from Asdang Park, and 32 isolates from Nongkae Chang Park in Nakhon Ratchasima Province; 33 isolates from Bueng Phraram Public Park in Phra Nakhon Si Ayutthaya Province; one isolate from Chaloem Phrakiat Health Park in Samut Songkhram Province; and two isolates from Municipal Public Park in Prachuap Khiri Khan Province), and one isolate of S. dehoogii (TMMI154; isolated from Pumrak Park in Nakhon Ratchasima Province) as summarized in Fig 1. In addition, the species of two isolates (TMMI275 from Nongkae Chang Park in Nakhon Ratchasima Province and TMMI293 from Bueng Phraram Public Park in Phra Nakhon Si Ayutthaya Province) could not be identified.
Fig 1. The distribution of Scedosporium species across six regions of Thailand.
Given the large number of S. apiospermum sequences, we determined the number of Bt2 allele types according to sequence similarity before multiple alignment. From the 188 sequences, we found 67 alleles, with allele frequencies ranging from 1 to 34 individuals sampled (Table 2). A graphic representation of the multiple nucleic acid sequence alignment for these 67 allele types was created, and a phylogenetic tree was constructed (Fig 2). The best model for Bt2 gene analyses was the K2+G model (K2: Kimura-2-Parameter; +G: Gamma distribution), with the BIC score of 6327.810. Therefore, the maximum likelihood phylogenetic tree of the concatenated data set was created based on the K2+G model. A discrete gamma distribution was used to model the evolutionary rate differences among sampling sites [five categories (+G, parameter = 0.0500)].
Table 2. Alleles (A), their frequencies, and the strains with each allele.
| A | Frequency | Strains (Genbank accession number) |
|---|---|---|
| 1 | 15 | TMMI111 (MG204346), TMMI112 (MG204347), TMMI113 (MG204348), TMMI114 (MG204349), TMMI115 (MG204349), TMMI116 (MG204351), TMMI118 (MG204353), TMMI119 (MG204354), TMMI123 (MG204358), TMMI124 (MG204359), TMMI126 (MG204361), TMMI128 (MG204363), TMMI129 (MG204364), TMMI130 (MG204365), TMMI155 (MG204389) |
| 2 | 34 | TMMI117 (MG204352), TMMI120 (MG204355), TMMI122 (MG204357), TMMI137 (MG204372), TMMI138 (MG204373), TMMI143 (MG204378), TMMI150 (MG204385), TMMI158 (MG204392), TMMI160 (MG204394), TMMI166 (MG204400), TMMI172 (MG204406), TMMI175 (MG204409), TMMI182 (MG204416), TMMI190 (MG204424), TMMI191 (MG204425), TMMI201 (MG204435), TMMI203 (MG204437), TMMI204 (MG204438), TMMI208 (MG204442), TMMI210 (MG204444), TMMI211 (MG204445), TMMI219 (MG204453), TMMI221 (MG204455), TMMI223 (MG204457), TMMI246 (MG204480), TMMI248 (MG204482), TMMI250 (MG204484), TMMI253 (MG204487), TMMI256 (MG204490), TMMI272 (MG204506), TMMI274 (MG204508), TMMI283 (MG204516), TMMI294 (MG204527), TMMI296 (MG204529) |
| 3 | 2 | TMMI121 (MG204356), TMMI225 (MG204459) |
| 4 | 1 | TMMI125 (MG204360) |
| 5 | 17 | TMMI127 (MG204362), TMMI132 (MG204367), TMMI141 (MG204376), TMMI163 (MG204397), TMMI168 (MG204402), TMMI185 (MG204419), TMMI243 (MG204477), TMMI247 (MG204481), TMMI251 (MG204485), TMMI252 (MG204486), TMMI261 (MG204495), TMMI262 (MG204496), TMMI263 (MG204497), TMMI280 (MG204513), TMMI281 (MG204514), TMMI285 (MG204518), TMMI292 (MG204525) |
| 6 | 2 | TMMI131 (MG204366), TMMI268 (MG204502) |
| 7 | 14 | TMMI133 (MG204368), TMMI153 (MG204388), TMMI161 (MG204395), TMMI179 (MG204413), TMMI238 (MG204472), TMMI239 (MG204473), TMMI244 (MG204478), TMMI249 (MG204483), TMMI257 (MG204491), TMMI270 (MG204504), TMMI271 (MG204505), TMMI282 (MG204515), TMMI286 (MG204519), TMMI301 (MG204534) |
| 8 | 3 | TMMI134 (MG204369), TMMI139 (MG204374), TMMI145 (MG204380) |
| 9 | 15 | TMMI135 (MG204370), TMMI140 (MG204375), TMMI142 (MG204377), TMMI144 (MG204379), TMMI146 (MG204381), TMMI148 (MG204383), TMMI149 (MG204384), TMMI152 (MG204387), TMMI162 (MG204396), TMMI216 (MG204450), TMMI218 (MG204452), TMMI224 (MG204458), TMMI226 (MG204460), TMMI258 (MG204492), TMMI287 (MG204520) |
| 10 | 2 | TMMI136 (MG204371), TMMI197 (MG204431) |
| 11 | 1 | TMMI147 (MG204382) |
| 12 | 1 | TMMI151 (MG204386) |
| 13 | 6 | TMMI156 (MG204390), TMMI157 (MG204391), TMMI213 (MG204447), TMMI214 (MG204448), TMMI284 (MG204517), TMMI289 (MG204522) |
| 14 | 1 | TMMI159 (MG204393) |
| 15 | 4 | TMMI164 (MG204398), TMMI167 (MG204401), TMMI236 (MG204470), TMMI242 (MG204476) |
| 16 | 1 | TMMI165 (MG204399) |
| 17 | 1 | TMMI169 (MG204403) |
| 18 | 1 | TMMI170 (MG204404) |
| 19 | 1 | TMMI171 (MG204405) |
| 20 | 6 | TMMI173 (MG204407), TMMI188 (MG204422), TMMI194 (MG204428), TMMI220 (MG204454), TMMI265 (MG204499), TMMI290 (MG204523) |
| 21 | 1 | TMMI174 (MG204408) |
| 22 | 1 | TMMI176 (MG204410) |
| 23 | 2 | TMMI177 (MG204411), TMMI259 (MG204493) |
| 24 | 2 | TMMI178 (MG204412), TMMI267 (MG204501) |
| 25 | 1 | TMMI180 (MG204414) |
| 26 | 1 | TMMI181 (MG201145) |
| 27 | 1 | TMMI183 (MG204417) |
| 28 | 1 | TMMI184 (MG204418) |
| 29 | 1 | TMMI186 (MG204420) |
| 30 | 1 | TMMI187 (MG204421) |
| 31 | 2 | TMMI189 (MG204423), TMMI195 (MG204429) |
| 32 | 6 | TMMI192 (MG204426), TMMI193 (MG204427), TMMI198 (MG204432), TMMI199 (MG204433), TMMI278 (MG204511), TMMI298 (MG204531) |
| 33 | 1 | TMMI196 (MG204430) |
| 34 | 1 | TMMI200 (MG204434) |
| 35 | 1 | TMMI202 (MG204436) |
| 36 | 1 | TMMI205 (MG204439) |
| 37 | 1 | TMMI206 (MG204440) |
| 38 | 1 | TMMI207 (MG204441) |
| 39 | 1 | TMMI209 (MG204443) |
| 40 | 1 | TMMI212 (MG204446) |
| 41 | 2 | TMMI215 (MG204449), TMMI254 (MG204488) |
| 42 | 1 | TMMI217 (MG204451) |
| 43 | 1 | TMMI222 (MG204456) |
| 44 | 1 | TMMI227 (MG204461) |
| 45 | 2 | TMMI228 (MG204462), TMMI240 (MG204474) |
| 46 | 1 | TMMI229 (MG204463) |
| 47 | 1 | TMMI230 (MG204464) |
| 48 | 1 | TMMI231 (MG204465) |
| 49 | 1 | TMMI232 (MG204466) |
| 50 | 1 | TMMI233 (MG204467) |
| 51 | 1 | TMMI234 (MG204468) |
| 52 | 1 | TMMI235 (MG204469) |
| 53 | 2 | TMMI237 (MG204471), TMMI245 (MG204479) |
| 54 | 1 | TMMI241 (MG204475) |
| 55 | 1 | TMMI255 (MG204489) |
| 56 | 1 | TMMI260 (MG204494) |
| 57 | 1 | TMMI264 (MG204498) |
| 58 | 3 | TMMI266 (MG204500), TMMI291 (MG204524), TMMI297 (MG204530) |
| 59 | 1 | TMMI269 (MG204503) |
| 60 | 1 | TMMI273 (MG204507) |
| 61 | 1 | TMMI276 (MG204509) |
| 62 | 1 | TMMI277 (MG204510) |
| 63 | 1 | TMMI279 (MG204512) |
| 64 | 1 | TMMI288 (MG204521) |
| 65 | 1 | TMMI295 (MG204528) |
| 66 | 1 | TMMI299 (MG204532) |
| 67 | 1 | TMMI300 (MG204533) |
Fig 2. Molecular phylogenetic maximum likelihood analysis of the Bt2 gene.
A1−A67 are the allele types.
We then performed a genetic diversity analysis using the Splits Tree algorithm. Fig 3 shows the genetic associations among all 191 genotyped variants of the Bt2 gene. Strain TMMI154 was clustered with S. dehoogii, whereas TMMI275 and TMMI293 were alone in the Bt2 gene parallelogram, suggesting new species.
Fig 3. Phylogenetic network.
SplitTree decomposition analysis using the neighbor-net algorithm for the Bt2 gene.
Discussion
There are several molecular techniques applied to identify Scedosporium species. Sequencing techniques, including Multi-Locus Sequence Typing (MLST), is widely used for identification of these fungi. The target gene using for sequencing are internal transcribed spacer (ITS), actin, calmodulin exons 3 and 4, the second largest subunit of the RNA polymerase II and Beta-tubulin exon 2–4, manganese superoxide dismutase, transcription elongation 1 alpha, Beta -tubulin exon 5–6 [15]. Researchers have also used the internal transcribe spacer-restriction fragment length polymorphism (ITS-RFLP) technique, M13 PCR fingerprint, quantitative Real-Time PCR (qPCR), PCR-based reverse line blotting (PCR-RLB) and loop-mediated isothermal amplification (LAMP) [16–17]. Isolates should be characterized phenotypically as well as with molecular techniques to confirm Scedosporium species identification.
Based on molecular variation, the S. aspiospermum species complex is comprised of S. apiospermum, S. boydii, S. dehoogii, S. aurantiacum, and S. minutisporum (Pseudallescheria minutispora) according to the European Confederation of Medical Mycology/International Society for Human and Animal Mycology [1]. More recently, a new species, S. cereisporum, was isolated by Rougeron et al.; the species was phylogenetically and morphologically closely related to S. aurantiacum [18]. Chen et al. [19] defined the S. apiospermum species complex as S. apiospermum, S. boydii, and S. angusta (P. angusta) based on the phylogenetic analysis of BT2, γ-actin, transcriptional elongation factor 1α, and internal transcribed spacer of the small ribosomal protein 60sS L10 (L1), which distinguished S. minutisporum, S. aurantiacum, and S. dehoogii from the three S. apiospermum species complex. There are currently >10 species of the S. apiospermum species complex [1]. Furthermore, at least five are pathogenic, with infection cases reported in Thailand and across Asia. Therefore, we examined Scedosporium species distribution in the present study.
In addition to S. apiospermum, S. boydii infection has been documented in Thailand. S. boydii was specifically isolated from the brain tissue of a renal transplant patient. In the present study, samples from only four of 23 provinces (Nakhon Ratchasima, Phra Nakhon Si Ayutthaya, Samut Songkhram, and Prajuap Khiri Khan) were positive for Scedosporium species; however, at these sites, numerous S. apiospermum strains (188 from 191 isolates) were found. In addition, one isolate of S. dehoogii was identified, whereas two isolates were unidentifiable and thus could be novel species. The two unclassified strains, TMMI 275 and TMMI 293, were closely related to S. angusta and S. apiospermum, respectively. The present study confirms that S. apiospermum inhabits soil in diverse regions of Thailand (northeastern, central, and western), and S. aurantiacum was only isolated from a single site around Bangkok.
Therefore, this study demonstrated that Scedosporium distribution for guiding the further perspective in factor related fungal distribution and an impact. Our survey data indicate the prevalence of Scedosporium in different regions of Thailand, which should be useful for the clinician and medical mycologist in diagnosing fungal infections. This information may help clinicians to exclude Aspergillus as a cause of fungal infection.
Conclusion
In conclusion, this study identified soil as an ecological niche of Scedosporium in Thailand. The results provide valuable knowledge to assist future studies to compare genetic relatedness among pathogenic species in the clinical setting and to evaluate infection risk in specific regions.
Supporting information
(PDF)
(PDF)
Acknowledgments
The authors are thankful to the mayors’ offices in 23 provinces for granting permission to collect soil samples.
Data Availability
All relevant data are within the paper and its Supporting Information files.
Funding Statement
This research project is supported by Mahidol University (contract no. 80/2560) and Health System Research Institute agreement no. HRSI-61-002 to Natthanej Luplertlop.
References
- 1.Rougeron A, Giraud S, Alastruey-Izquierdo A, Cano-Lira J, Rainer J, Mouhajir A, Le Gal S, Nevez G, Meyer W, Bouchara JP. Ecology of Scedosporium species: present knowledge and future research. Mycopathologia. 2017; 10.1007/s11046-017-0200-2 [DOI] [PubMed] [Google Scholar]
- 2.Leechawengwongs M, Milindankura S, Liengudom A, Chanakul K, Viranuvatti K, Clongsusuek P. Multiple Scedosporium apiospermum brain abscesses after near-drowning successfully treated with surgery and long-term voriconazole: a case report. Mycoses. 2007;50:512–516. 10.1111/j.1439-0507.2007.01410.x [DOI] [PubMed] [Google Scholar]
- 3.Garzoni C, Emonet S, Legout L, Benedict R, Hoffmeyer P, Bernard L, Garbino J. Atypical infections in tsunami survivors. Emerg Infect Dis. 2005;11:1591–1593. 10.3201/eid1110.050715 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Nakamura Y, Suzuki N, Nakajima Y, Utsumi Y, Murata O, Nagashima H, Saito H, Sasaki N, Fujimura I, Ogino Y, Kato K. Scedosporium aurantiacum brain abscess after near-drowning in a survivor of a tsunami in Japan. Respir Investig. 2013;51:207–211. 10.1016/j.resinv.2013.07.001 [DOI] [PubMed] [Google Scholar]
- 5.Shimizu J, Yoshimoto M, Takebayashi T, Ida K, Tanimoto K, Yamashita T. Atypical fungal vertebral osteomyelitis in a tsunami survivor of the Great East Japan Earthquake. Spine. 2014;39:E739–E742. 10.1097/BRS.0000000000000317 [DOI] [PubMed] [Google Scholar]
- 6.Chen TC, Ho MW, Chien WC, Lin HH. Disseminated Scedosporium apiospermum infection in a near-drowning patient. J Formos Med Assoc. 2016;115:213–214. 10.1016/j.jfma.2015.02.007 [DOI] [PubMed] [Google Scholar]
- 7.Luplertlop N, Pumeesat P, Muangkaew W, Wongsuk T, Alastruey-Izquierdo A. Environmental screening for the Scedosporium apiospermum species complex in public parks in Bangkok, Thailand. PloS One. 2016;11:e0159869 10.1371/journal.pone.0159869 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Pham T, Giraud S, Schuliar G, Rougeron A, Bouchara JP. Scedo-Select III: a new semi-selective culture medium for detection of the Scedosporium apiospermum species complex. Med Mycol. 2015;53:512–519. 10.1093/mmy/myv015 [DOI] [PubMed] [Google Scholar]
- 9.Gilgado F, Cano J, Gene J, Guarro J. Molecular phylogeny of the Pseudallescheria boydii species complex: proposal of two new species. J Clin Microbiol. 2005;43:4930–4942. 10.1128/JCM.43.10.4930-4942.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Gilgado F, Cano J, Gene J, Sutton DA, Guarro J. Molecular and phenotypic data supporting distinct species statuses for Scedosporium apiospermum and Pseudallescheria boydii and the proposed new species Scedosporium dehoogii. J Clin Microbiol. 2008;46:766–771. 10.1128/JCM.01122-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Bernhardt A, Sedlacek L, Wagner S, Schwarz C, Wurstl B, Tintelnot K. Multilocus sequence typing of Scedosporium apiospermum and Pseudallescheria boydii isolates from cystic fibrosis patients. J Cyst Fibros. 2013;12:592–598. 10.1016/j.jcf.2013.05.007 [DOI] [PubMed] [Google Scholar]
- 12.Tomasini N, Lauthier JJ, Llewellyn MS, Diosque P. MLSTest: novel software for multi-locus sequence data analysis in eukaryotic organisms. Infect Genet Evol. 2013;20:188–196. 10.1016/j.meegid.2013.08.029 [DOI] [PubMed] [Google Scholar]
- 13.Kumar S, Stecher G, Tamura K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for Bigger Datasets. Mol Biol Evol. 2016;33:1870–1874. 10.1093/molbev/msw054 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Huson DH, Bryant D. Application of phylogenetic networks in evolutionary studies. Mol Biol Evol. 2006;23:254–267. 10.1093/molbev/msj030 [DOI] [PubMed] [Google Scholar]
- 15.Luplertlop N, Pumeesat P, Muangkaew W, Wongsuk T, Alastruey-Izquierdo A. Environmental screening for the Scedosporium apiospermum species complex in public park in Bangkok, Thailand. PLoS ONE. 2016;11:e0159869 10.1371/journal.pone.0159869 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Delhaes L, Harun A, Chen SCA, Nguyen Q, Slavin M, Heath CH, Maszewska K, Halliday C, Robert V, Sorrell TC, Meyer W. Molecular typing of Australian Scedosporium isolates showing genetic variability and numerous S. aurantiacum. Emerg Infect Dis. 2008;14;282–290. 10.3201/eid1402.070920 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Lu Q, Gerrits van den Ende AH, Bakkers JM, Sun J, Lackner M, Najafzadeh MJ, Melchers WJ, Li R, de Hoog GS. Identification of Pseudallescheria and Scedosporium species by three molecular methods. J Clin Microbiol. 2011;49:960–967. 10.1128/JCM.01813-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Crous PW, Wingfield MJ, Burgess TI, Hardy GE, Crane C, Barrett S, Cano Lira JF, Le Roux JJ, Thangavel R, Guarro J, Stchigel AM. Fungal planet description sheets: 469–557. Persoonia. 2017;37:218–403. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Chen M, Zeng J, De Hoog GS, Stielow B, Gerrits Van Den Ende AH, Liao W, Lackner M. The species complex issue in clinically relevant fungi: a case study in Scedosporium apiospermum. Fungal Biol. 2016;12:137–146. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
(PDF)
(PDF)
Data Availability Statement
All relevant data are within the paper and its Supporting Information files.