Abstract
Mesenchymal stromal cells (hMSCs) are key components of the bone marrow microenvironment (BMM). A molecular signature in hMSCs from Acute myeloid leukemia patients (hMSC-AML) has been proposed where BMP4 is decreased and could be regulated by WNT signaling pathway. Therefore, the aim of this work was to verify whether the WNT signaling pathway can regulate the BMP4 gene in hMSCs. The results showed differentially expressed genes in the WNT canonical pathway between hMSC-AML and hMSCs from healthy donors and a real-time quantitative assay corroborated with these findings. Moreover, the main WNT canonical pathway regulators were decreased in hMSC-AML, such as LEF-1, β-catenin and the β-catenin/TCF-LEF regulatory complex in the nucleus. This result, together with functional assays, suggests that the induction of BMP4 expression by the WNT signaling pathway is decreased in hMSC-AML. Overall, the WNT canonical pathway is able to regulate the BMP4 gene in hMSC-AML and its reduced activation could also lead to the lower expression of BMP4 in hMSC-AML. Due to the important role of the BMM, changes in BMP4 expression through the WNT canonical pathway may be a potential mechanism of leukemogenesis.
Introduction
Acute myeloid leukemia (AML) is a hematological disease characterized by cellular differentiation arrest, decreased apoptosis levels, increases in proliferation and the accumulation of myeloid precursors in the bone marrow (BM) [1].
AML is extremely heterogeneous, and the cellular and molecular basis for this heterogeneity represents a fundamental problem. Despite this heterogeneity, Lapitop and coworkers described that AML has a unique origin: the malignant transformation of normal hematopoietic stem cells (HSCs) into leukemic stem cells (LSCs). Similar to normal HSCs, LSCs maintain the ability to self-renew and the potential to repopulate and produce progeny cells. However, these cells generate leukemia progenitors and leukemic blast cells, consequently perpetuating the leukemia population [2]. To date, other studies have also confirmed this proposed model [3], [4], [5]; nevertheless, the events related to AML initiation and progression remain unclear.
The idea that LSCs have stem cell characteristics suggests that HSCs undergo mutation(s), an intrinsic mechanism of tumor biology, that gives rise to LSCs [6]. In seeking to identify mutations present in LSCs from AML patients that could be related to leukemic transformation, Shlush and coworkers identified mutations in the DNMT3A and NMP1 genes that were present in LSCs from several AML patients. However, not all LSCs presented these mutations [7]. The evidence suggests that other factors could play important roles in cancer progression. In this context, changes in signaling in the BM microenvironment, where HSCs are located, could promote malignant transformation [8].
The BM microenvironment is complex and dynamic and has a cellular and molecular signaling network coordinated to maintain and regulate the functions of HSCs [9], [10]. Alterations in the different components of the BM microenvironment, including fibroblasts, adipocytes, endothelial cells, the extracellular matrix and mesenchymal stromal cells (hMSCs), could play important roles in the context of leukemia initiation [11].
hMSCs are critical for regulating and maintaining HSCs [12], [13]. hMSCs are multipotent cells that are present in the niche that generates most marrow stromal cell lineages, including osteoblasts, chondrocytes, fibroblasts, adipocytes, endothelial cells and myocytes [14]. These cells can regulate the balance between self-renewal and differentiation of HSCs through cell–cell interactions and paracrine secretion of cytokines and growth factors in the extracellular matrix [15].
Due to the importance of hMSC, the malignant transformation that generates LSCs could be related to changes in mesenchymal stromal cell signaling.
Based on this supposition, Binato et al. showed a molecular signature in AML mesenchymal stromal cells (hMSC-AML) that was different from that of hMSCs derived from healthy donors (hMSC-HD). Among the genes found in this molecular signature, BMP4 presented decreased expression in hMSC-AML and in plasma from the same patients, indicating changes in the signaling of hMSC-AML [16].
BMP4 (Bone Morphogenetic Protein 4), a member of the superfamily of TGF-β growth factors, is a protein that is secreted into the BM microenvironment, and decreases in its expression can result in the alteration of HSC function [16], [17], as Goldman and coworkers showed that BMP4 is able to regulate the number of HSCs [18]. Therefore, decreased BMP4 expression in hMSC-AML can promote alterations in the maintenance of HSCs and, consequently, could be related to leukemic transformation.
In silico analyses have provided evidence that BMP4 could be regulated by the WNT signaling pathway [16]. The interactions between the WNT and BMP4 signaling pathways are well described during embryonic development [19], [20], [21], the induction of myogenic differentiation [22] and in human colon cancer [23]. However, BMP4 gene regulation by the WNT signaling pathway in hMSCs remains unclear.
In this context, the aim of this work was to verify whether the WNT signaling pathway can act in BMP4 gene regulation in hMSCs. The data presented in this work provides evidence that the canonical WNT signaling pathway is less active in hMSC-AML than in hMSC-HD. We also suggest that the decrease in BMP4 in hMSC-AML is associated with a reduction in β-catenin/TCF-LEF complex formation in the BMP4 promoter region.
Materials and Methods
Patient and Donor Samples
BM-derived samples were obtained from patients with AML at diagnosis (without any treatment) and from healthy donors (HD) registered at the Bone Marrow Transplantation Unit, National Cancer Institute (INCA) (Rio de Janeiro, Brazil). The AML samples (mean age: 41.3) were morphologically characterized according to the FAB classification [24] (Table 1). The samples used as controls were obtained from HD with a mean age of 30.1 years (Table 2). These patients and donors were stratified into six cohorts (Table 1, Table 2). All samples were obtained in accordance with the guidelines of the local Ethics Committee and the Declaration of Helsinki. This study was approved by the INCA Ethics Committee (no.034/06), and all participants signed informed consent forms.
Table 1.
List of AML patients that participated in this study
| Laboratory code | FAB subtype | % Blasts | Sex | Age | PCR array cohort | RT-qPCR cohort | WB cohort | IF cohort | IP cohort |
|---|---|---|---|---|---|---|---|---|---|
| 005/12 | M4/M5 | 80% | Male | 43 | X | X | X | ||
| 006/12 | M3 | 85% | Male | 68 | X | X | |||
| 007/12 | M1/M2 | 75% | Female | 9 | X | ||||
| 011/12 | M1/M2 | 64% | Female | 13 | X | ||||
| 012/12 | M1/M2 | 60% | Female | 13 | X | ||||
| 008/13 | M2 | 98% | Male | 42 | X | ||||
| 009/13 | M2 | 56% | Male | 30 | X | ||||
| 010/13 | M2 | 38% | Male | 25 | X | X | X | ||
| 014/13 | LMA unclassified | 60% | Male | 55 | X | ||||
| 017/13 | M3 | 71.8% | Female | 21 | X | ||||
| 023/13 | M3 | 53,2% | Male | 38 | X | X | |||
| 025/13 | M4/M5 | 75% | Male | 46 | X | ||||
| 026/13 | LMA unclassified | 34% | Female | 86 | X | ||||
| 028/13 | M2 | 17% | Male | 26 | X | ||||
| 036/13 | M3 | 84% | Female | 29 | X | X | |||
| 045/13 | M3 | 75% | Male | 31 | X | ||||
| 050/13 | M2 | 25% | Male | 28 | X | ||||
| 051/13 | M1 | 67% | Male | 50 | X | ||||
| 053/13 | M1 | 90% | Male | 32 | X | ||||
| 055/13 | LMA unclassified | 60% | Male | 32 | X | ||||
| 056/13 | M4/M5 | 90% | Female | 60 | X | ||||
| 059/13 | M3 | 98% | Female | 47 | X | ||||
| 051/14 | M1 | 67% | Male | 52 | X | X | X | ||
| 054/14 | LMA unclassified | 60% | Male | 42 | X | ||||
| 017/16 | M3 | 20% | Male | 37 | X | X | |||
| 018/16 | M3 | 68% | Male | 37 | X | X | |||
| 019/16 | M1/M2 | - | Male | 64 | X | ||||
| 022/16 | M3 | 60% | Female | 38 | X | X | |||
| 031/16 | LMA unclassified | 65% | Male | 53 | X | X | |||
| 033/16 | M3 | 55% | Male | 32 | X | X | X | ||
| 035/17 | LMA | 20% | Male | 61 | X | ||||
| 036/17 | M3 | 35% | Male | 60 | X | X | |||
| 051/17 | LMA | 37% | Female | 60 | X | X | X | ||
| 055/17 | M4/M5 | 50% | Female | 46 | X | X | X |
WB = Western Blot, IF- Immunofluorescence, IP- Chromatin immunoprecipitation.
Table 2.
List of healthy donors that participated in this study
| Laboratory code | Sex | Age | PCR array cohort | RT-qPCR cohort | WB cohort | IF cohort | IP cohort |
|---|---|---|---|---|---|---|---|
| DOD 2 | Female | 25 | X | X | |||
| DOD 3 | Female | 32 | X | X | |||
| DOD 5 | Male | 23 | X | X | X | ||
| DOD 08/16 | Male | 32 | X | X | |||
| DOD 09/16 | Male | 25 | X | X | |||
| DOD 10/16 | Male | 18 | X | X | |||
| DOD 3/17 | Female | 30 | X | X | X | X | |
| DOD 4/17 | Male | 28 | X | X | X | X | |
| DOD 5/17 | Male | 45 | X | X | X | ||
| DOD 6/17 | Female | 22 | X | ||||
| DOD 48 | Female | 32 | X | ||||
| DOD 50 | Male | 29 | X | ||||
| DOD 55 | Female | 55 | X | ||||
| DOD 60 | Male | 61 | X | ||||
| DOD 61 | Male | 32 | X | ||||
| DOD 96 | Male | 25 | X | X | |||
| DOD 97 | Male | 18 | X | ||||
| DOD 100 | Male | 19 | X | X | X | ||
| DOD 101 | Female | 24 | X | X | X | ||
| DOD 102 | Female | 60 | X | X | |||
| DOD 103 | Male | 26 | X | ||||
| DOD 104 | Female | 33 | X | X | |||
| DOD 106 | Female | 19 | X | ||||
| DOD 107 | Male | 25 | X | ||||
| DOD 108 | Female | 35 | X | X |
WB = Western Blot, IF- Immunofluorescence, IP- Chromatin immunoprecipitation.
Isolation and Culture of hMSCs
hMSCs derived from BM samples from AML patients and HD were cultured as previously described [16]. The cells were maintained at 37°C in a humidified atmosphere with 5% CO2. When the hMSC cultures reached 80% confluence, the hMSCs were removed from the plates by treatment with 0.05% trypsin (Invitrogen™) for 5 min at 37°C and then replated in another culture flask at a density of 2 × 103 cells/cm2 (passage 1). These processes were repeated until passage 3, when the hMSCs were used for all experiments.
Confirmation of hMSCs
To characterize the hMSCs, experiments were performed as previously described [16], in accordance with the minimal criteria for defining multipotent mesenchymal stromal cells as defined by the International Society for Cellular Therapy (ISCT) [25].
WNT Signaling Pathway Analysis
RNA was isolated using a RNeasy® mini kit (Qiagen) according to the manufacturer's instructions. A total of 800 ng of high-quality RNA was then reverse transcribed using the RT2 First Strand Kit (Qiagen), and the cDNA was subsequently loaded into a Human WNT Signaling Pathway RT2 Profiler PCR Array according to the manufacturer's instructions (PAHS-043Z, Qiagen). Data were normalized to the average expression of GAPDH, B2M and ACTB. The data were analyzed using the platform GeneGlobe (www.qiagen.com/br/shop/genes-and-pathways/data-analysis-center-overview-page/).
Real-Time Quantitative PCR (RT-qPCR) Analysis
RNA was extracted using TRIzol reagent (Invitrogen™) according to the manufacturer's instructions.
RT-qPCR analyses were performed using 4 μg of mRNA treated with amplification-grade DNaseI (Invitrogen™) and reverse transcribed with SuperScriptIII Reverse transcriptase® (Invitrogen™) following the manufacturer's protocol. Each reaction was performed with 5 μL of SYBR Green PCR Master Mix® (Applied Biosystems), 2.5 μL of cDNA (10 ng) and 2 μM of each primer. Reactions were performed in a Rotor-Gene 6000 thermocycler (Qiagen) as follow: 95°C for 10 min, followed by 40 cycles of 95°C for 20s and 60°C for 30s with a final extension at 72°C for 30s.
The relative quantification was performed according to a standard curve-based method [26]. The expression levels of specific genes (Table 3) were estimated and B2M and GAPDH were used as normalization genes.
Table 3.
List of primers used in this study
| Gene | Forward | Reverse |
|---|---|---|
| Primers used for RT-qPCR analysis | ||
| BMP4 | CCATGATTCCTGGTAACCGA | CCTGAATCTCGGCGACTT |
| KREMEN1 | CGTCTCTCTGGACTTCGTCATCTT | CCTGTGGCAGTTCTTCCTTGA |
| LEF1 | CAGACATCCTCCAGCTCCTGATAT | CGTGATGGGATATACAGGCTGAC |
| PORCN | CCCTCCTACATGGCTTCAGTT | CCGCTTTGACAAGACACAGG |
| PRICKLE1 | GGTGCTCAGCATGTGACGAGATAA | TCACACTCAAGGCAGCAGAAGT |
| TCF7 | ACTCTTCCCGGACAAACTTCC | GCAGATTGAAGGCGGAGTAGAC |
| GAPDH | ATTCCACCCATGGCAAATTC | GGCGTGGATGGGTCTTTCA |
| B2M | ATGAGTATGCCTGCCGTGTGA | CGGCATCTTCAAACCTCCATG |
| Primers used for RTq-PCR after chromatin immunoprecipitation assays | ||
| S1 ChipBMP4 | ACTGTAAAAAACGTGGCCCCAGC | ACCCTGAGGTAGACCCCAGTAAAT |
| S2 ChipBMP4 | GTGATTGATTTAGGGGCTCAGTGA | CCTAATGTTTCTCCTGCAGCATCAG |
| S3 ChipBMP4 | TTGGAAACTCCTGGACTGTGAGTG | GCACCAATGTCATTTCGGGGT |
| S4 ChipBMP4 | GTGGGGAGAGAAATAAAGCTGTCC | CGACATACCATGTTTAGACCCCTG |
| S5 ChipBMP4 | GGACCAGGAAGTCTGCATTTCA | TAGCTGGTCAATAGCCTGTCTGC |
| S6 ChipBMP4 | GCCCAGCATATTCTTTGCCTGT | CAAGGTTCTCTGGTCATTCTGAGC |
Western Blot Analysis
Protein extracts were obtained as previously described [27]. Protein extracts (30 μg) were separated with 10% SDS-PAGE gel electrophoresis, transferred to nitrocellulose membranes (Bio-Rad), and incubated with anti-LEF1 antibody (Santa Cruz Biotechnology) at 4°C overnight, followed by incubation with the appropriate secondary antibody at room temperature (RT) for 2 h. Rouge Ponceau staining was used as the loading control. Signal was acquired using Image Studio Digits software v3.1 with a LI-COR instrument (Uniscience Co.), after chemiluminescence reaction (Pierce™ ECL Plus Western Blotting Substrate, Thermo Scientific).
Immunofluorescence Assay
hMSCs plated on coverslips were fixed with 4% paraformaldehyde, permeabilized with 0.3% Triton X-100 diluted in PBS (T-PBS) and incubated for 75 min at RT with 1% bovine serum albumin (BSA) and 0.1% T-PBS. The coverslips were rinsed with 0.3% T-PBS and incubated with appropriately diluted primary antibodies (anti-β-catenin and anti-LEF1 antibodies-Santa Cruz Biotechnology) in 0.05% Tween and 0.1% BSA diluted in PBS for 3 days at 4°C in a humid chamber. After incubation, the coverslips were rinsed with 0.3% T-PBS and incubated with Alexa Fluor® 488-conjugated anti-mouse IgG or Alexa Fluor® 555-conjugated anti-goat IgG (Molecular Probes) for 2 h at RT. The coverslips used as controls were incubated only with the secondary antibody or the diluted primary antibodies. The coverslips were mounted with VECTASHIELD antifade medium containing DAPI (Vector Labs). Proteins were evaluated for their expression and location with a Leica TCS SP5 confocal laser scanning microscope (Leica®) to capture representative images of each sample.
Prediction of TCF/LEF Binding Sites in the BMP4 Promoter
To screen for putative TCF/LEF consensus binding sites, 3 kb upstream of the transcription start site of the BMP4 gene was acquired from the NCBI database. Next, we identified the consensus binding sequence for TCF/LEF transcription factors (5′-CTTTGA-3′; 5′-CTTTAG-3′) [28], [29].
The consensus binding sites were confirmed using online tools: TRANSFAC (http://www.gene-regulation.com), Tfsitescan (www.ifti.org/Tfsitescan/), Genomatix (www.genomatix.de) and GenAtlas (genatlas.medecine.univ-paris5.fr/).
The alignment among sequences from mammals was performed using the Ensembl orthology tool (https://www.ensembl.org). The primers presented in Table 3 were used for RTq-PCR after chromatin immunoprecipitation assays.
Chromatin Immunoprecipitation (ChIP) Assays
ChIP assays were conducted using the SimpleChIP® Enzymatic Chromatin IP kit according to the manufacturer's instructions (Cell Signaling Technology). Briefly, chromatins that had been previously prepared and digested was incubated with 2 μg of LEF-1 antibody (Santa Cruz Biotechnology) or with normal anti-IgG rabbit antibody (negative control). Then, the DNA was purified, and RT-qPCR assays were performed using the specific primers for each putative BMP4 binding site listed above. The reactions were performed in a Rotor-Gene 6000 thermocycler (Qiagen) using the following program: 95°C for 10 min, followed by 40 cycles at 95°C for 20s and 60°C for 30s with a final extension at 72°C for 30s. Changes in LEF1 binding to DNA were calculated in relation to that of the IgG-precipitated control, normalized to the input.
Statistical Analysis
All experiments were carried out in triplicate, and the data are expressed as the mean ± standard error of the mean. The data were compared using unpaired Mann–Whitney tests, and a p-value <0.05 was considered statistically significant (*P <0.05, **P < 0.01, ***P < 0.001, and ****P <0 .0001). Statistical analysis was performed and graphical representations were created using GraphPad Prism™ software (GraphPad Software Inc.).
Results
InVitro Differentiation Potential of hMSC Cultures and Down-regulation of BMP4
To verify the hMSC multipotent differentiation capacity from all cultures used in this study, we induced hMSC-HD and hMSC-AML in passage 3 to differentiate into adipogenic and osteogenic cells in vitro. Undifferentiated hMSC-HD and hMSC-AML were used as controls (Figure 1, A and B). Our results showed that both cultures were able to differentiate, indicating preservation of their multipotent capacity according to the criteria of the ISTC. However, it was interesting to observe that while no differences between cultures were observed after adipogenic differentiation (Figure 1, C and D), the calcium accumulation observed after osteogenic differentiation presented some differences in hMSC-AML compared to hMSC-HD (Figure 1, E and F). Both cultures were able to differentiate into osteogenic cells, but hMSC-AML presented a reduced potential for osteogenic differentiation (Figure 1, E and F). This reduced potential could be related to decreased expression of the BMP4 gene, which was found to be down-regulated in hMSC-AML, as this gene is essential for osteogenic differentiation.
Figure 1.
hMSC multipotency capacity. (A and B) Undifferentiated hMSC-HD and hMSC-AML, respectively (200× magnification). (C and D) Adipogenic differentiation of hMSC-HD and hMSC-AML, respectively. The accumulation of neutral lipid vacuoles stained with Oil Red O indicates cell differentiation (200× magnification). (E and F) Osteogenic differentiation of hMSC-HD and hMSC-AML, respectively. The calcium deposition stained with Alizarin Red indicates cell differentiation (50× magnification). hMSC-HD: mesenchymal stromal cells derived from healthy donors; hMSC-AML: mesenchymal stromal cells derived from AML patients.
We also verified the BMP4 expression in our hMSC cultures. For this, we performed RT-qPCR assay with all hMSC cultures used in this study (Table 1, Table 2). As shown in Figure 2, BMP4 was decreased in all hMSC-AML cultures compared to hMSC-HD, corroborating with Binato et al. [16].
Figure 2.

BMP4 is down-regulated in hMSC-AML. To verify the BMP4 expression, we used RT-qPCR assay to determine changes in the mRNA expression obtained from hMSC-AML and from hMSC-HD cultures. Data normalization was performed using the endogenous genes B2M and GAPDH. The bars indicate the mean mRNA levels (± standard deviation). **** P <0 .0001. hMSC-HD: mesenchymal stromal cells derived from healthy donors; hMSC-AML: mesenchymal stromal cells derived from AML patients.
The Differentially Expressed Genes Mainly Participate in The WNT Canonical Signaling Pathway
Before evaluating whether the WNT signaling pathway could act in BMP4 gene regulation, we determined the expression profiles of the WNT signaling pathway in hMSC-AML cultures and compared them with the WNT signaling pathway expression in hMSC-HD cultures to verify whether this signaling pathway differed between the hMSC cultures.
We performed a PCR array assay to evaluate the expression profile of 84 genes related to the WNT signaling pathway (Supplementary file 1). Using a ≥ 1,5-fold change as a cutoff to define overexpression or down-regulation, 26 genes were identified to be differentially expressed between hMSC-AML and hMSC-HD (Table 4), suggesting a potential relationship with leukemic transformation.
Table 4.
List of the 26 differentially expressed genes identified by WNT signaling pathway PCR array assay
| Symbol | RefSeq | Description | Fold Change |
|---|---|---|---|
| WNT7B | NM_058238 | Wingless-type MMTV integration site family, member 7B | −23,75 |
| WNT11 | NM_004626 | Wingless-type MMTV integration site family, member 11 | −3,4 |
| WIF1 | NM_007191 | WNT inhibitory factor 1 | −2,99 |
| CXXC4 | NM_025212 | CXXC finger protein 4 | −2,44 |
| TCF7 | NM_003202 | Transcription factor 7 (T-cell specific, HMG-box) | −2,29 |
| PORCN | NM_022825 | Porcupine homolog (Drosophila) | −2,05 |
| LEF1 | NM_016269 | Lymphoid enhancer-binding factor 1 | −1,86 |
| WNT16 | NM_057168 | Wingless-type MMTV integration site family, member 16 | −1,83 |
| WNT5B | NM_032642 | Wingless-type MMTV integration site family, member 5B | −1,73 |
| PITX2 | NM_000325 | Paired-like homeodomain 2 | −1,61 |
| RHOA | NM_001664 | Ras homolog gene family, member A | −1,57 |
| TCF7L1 | NM_031283 | Transcription factor 7-like 1 (T-cell specific, HMG-box) | −1,56 |
| PPARD | NM_006238 | Peroxisome proliferator-activated receptor delta | −1,54 |
| PRICKLE1 | NM_153026 | Prickle homolog 1 (Drosophila) | 1,52 |
| WNT10A | NM_025216 | Wingless-type MMTV integration site family, member 10A | 1,56 |
| BCL9 | NM_004326 | B-cell CLL/lymphoma 9 | 1,57 |
| FZD3 | NM_017412 | Frizzled family receptor 3 | 1,64 |
| KREMEN1 | NM_1039570 | Kringle containing transmembrane protein 1 | 1,76 |
| VANGL2 | NM_020335 | Vang-like 2 (van gogh, Drosophila) | 1,85 |
| FRZB | NM_001463 | Frizzled-related protein | 2,39 |
| FZD1 | NM_003505 | Frizzled family receptor 1 | 2,42 |
| MMP7 | NM_002423 | Matrix metallopeptidase 7 (matrilysin, uterine) | 3,11 |
| SFRP1 | NM_003012 | Secreted frizzled-related protein 1 | 3,2 |
| FZD9 | NM_003508 | Frizzled family receptor 9 | 3,56 |
| SFRP4 | NM_003014 | Secreted frizzled-related protein 4 | 3,61 |
| NKD1 | NM_033119 | Naked cuticle homolog 1 (Drosophila) | 9,56 |
To confirm the results obtained in the PCR array assay, RT-qPCR analysis was performed with a larger number of hMSC-AML derived from different subtypes (n = 30) and with hMSC-HD (n = 19) (Table 1, Table 2). The genes selected included KREMEN1 and PRICKLE1, which were overexpressed in hMSC-AML cultures and which act as inhibitors of the WNT pathway [30], [31], and the genes TCF7, LEF1, and PORCN, which were down-regulated in hMSC-AML cultures. The PORCN gene is responsible for the secretion of WNT protein and is thus essentially associated with WNT protein processing [32], [33], [34]. Moreover, the TCF and LEF proteins act as transcription factors responsible for the transcriptional activation of target genes [28]. The results presented in Figure 3 confirmed the PCR array findings, indicating that the differentially expressed genes are altered in all hMSC-AML cultures.
Figure 3.
WNT signaling pathway components were differentially expressed in hMSC-AML. To confirm the PCR array results, we used RT-qPCR assays to determine changes in the mRNA expression of some differentially expressed genes using 30 samples obtained from hMSC-AML and 19 samples obtained from hMSC-HD. Data normalization was performed using the endogenous genes B2M and GAPDH. The RT-qPCR analyses of PRICKLE (A) and KREMEN1 (B) (overexpressed in hMSC-AML) and PORCN (C), TCF7 (D) and LEF1 (E) (down-regulated in hMSC-AML) confirmed the PCR array assay results. The bars indicate the mean mRNA levels (± standard deviation). * P < 0.05/** P < 0.01/*** P <0 .001/**** P <0 .0001. hMSC-HD: mesenchymal stromal cells derived from healthy donors; hMSC-AML: mesenchymal stromal cells derived from AML patients.
To verify in which of the WNT pathways our 26 differentially expressed genes were involved, we performed in silico analysis using KEGG software. The results showed that among the 26 differentially expressed genes, 61.5% of then (16 genes) were related to the canonical or Wnt/β-catenin-dependent pathway. Based on this result, our subsequent experiments focused on this β-catenin-dependent pathway.
The Levels of β-Catenin Are Decreased in hMSC-AML Nuclei, and LEF1 Protein Expression and a β-Catenin/TCF-LEF Regulatory Complex are Also Decreased in hMSC-AML
Although PCR array results did not show any alteration of β-catenin expression (mRNA), the location of β-catenin is essential to promote transcriptional regulation [35]. To determine whether there was any difference in the localization of β-catenin between hMSC-AML and hMSC-HD, we performed an immunofluorescence assay. As shown in Figure 4, a lower accumulation of β-catenin in the nucleus was observed in hMSC-AML, indicating that even if we did not find any differences in β-catenin expression, the levels of this protein were decreased in the nucleus of hMSC-AML.
Figure 4.
The levels of β-catenin were decreased in the nucleus of hMSC-AML. (A) Through immunofluorescence assays and confocal microscopy, we observed differences in the nuclear localization of β-catenin in hMSC-AML (n = 5) compared with that in hMSC-HD (n = 6). The nuclei were stained with DAPI (blue) and an antibody for β-catenin (green-labeled) (63× magnification). (B) Quantitative representation of β-catenin accumulation in the nucleus from LAS AF software (Leica, Hessen, Germany). The bars indicate the localization of β-catenin in the nucleus (± standard deviation). **P <0 .01. hMSC-HD: mesenchymal stromal cells derived from healthy donors; hMSC-AML: mesenchymal stromal cells derived from AML patients.
Since we observed a decrease in the accumulation of β-catenin in the nucleus and a down-regulation of TCF7 and LEF1 mRNA expression in hMSC-AML, we evaluated whether the LEF1 protein expression profile was also altered. For this, we performed Western blot analysis. As shown in Figure 5, LEF1 protein expression was also decreased in hMSC-AML compared to that in hMSC-HD, corroborating the PCR array and RT-qPCR results. These results suggest that less β-catenin/TCF-LEF regulatory complexes responsible for the regulation of target genes are formed in the nuclei of hMSC-AML.
Figure 5.
LEF1 protein expression is decreased in hMSC-AML. (A) Western blot analysis of LEF1. Protein extracts (30 μg) from hMSC-HD (1–8) and hMSC-AML (9–16) were separated by SDS-PAGE and probed with an LEF1 antibody. Ponceau staining was used as a loading control. (B) Representative graphic of the electrophoresis results confirming the decrease in LEF1 expression in hMSC-AML compared to that in hMSC-HD. The bars indicate the mean protein levels (± standard deviation). * P <0 .05. hMSC-HD: mesenchymal stromal cells derived from healthy donors; hMSC-AML: mesenchymal stromal cells derived from AML patients.
To confirm this hypothesis, we performed immunofluorescence assays with colocalization of β-catenin and LEF proteins. As shown in Figure 6, there was less overlap of the β-catenin and LEF1 proteins in hMSC-AML than in hMSC-HD, indicating a reduction in β-catenin/TCF-LEF complex formation.
Figure 6.
Formation of the β-catenin/TCF-LEF complex is decreased in hMSC-AML. (A) Through immunofluorescence assays and confocal microscopy, we observed differences in β-catenin/TCF-LEF complex formation in hMSC-AML (n = 5) and hMSC-HD (n = 6). The nuclei were stained with DAPI (blue); LEF1 is labeled with red, and β-catenin is labeled with green (63× magnification). (B) Quantitative representation of the colocalization of β-catenin and LEF1 from LAS AF software (Leica, Hessen, Germany). The bars indicate the colocalization of β-catenin and LEF1 (± standard deviation). **P < 0.01. hMSC-HD: mesenchymal stromal cells derived from healthy donors; hMSC-AML: mesenchymal stromal cells derived from AML patients.
Taken together, these results suggested that there is a decrease in β-catenin/TCF-LEF complex formation in hMSC-AML compared to that in hMSC-HD, which may result in compromised target gene regulation in hMSC-AML.
Decrease in LEF1 Binding to the BMP4 Gene Promoter in hMSC-AML
If the BMP4 gene is regulated by the canonical WNT signaling pathway, it is necessary that the β-catenin/TCF-LEF complex recognizes a specific region in the BMP4 gene promoter and consequently activates its transcription [29]. For this, the presence of consensus binding sites for TCF-LEF in the BMP4 promoter region is required.
To verify the TCF-LEF consensus binding sites, we analyzed 3 kb of the BMP4 gene promoter. As shown in Figure 7, six TCF/LEF consensus binding sites were identified in the analyzed region (−613, −1860, −2100, −2240, −2680 and −2810 pb). Alignment analyses were also performed and revealed that these consensus binding sites were highly conserved among mammalian species.
Figure 7.
The BMP4 gene promoter presents 6 putative TCF/LEF sites in 3 kb. Schematic representation of putative TCF/LEF consensus binding sites in 3 kb of the BMP4 gene promoter region predicted manually and with the TRANSFAC, Tfsitescan, Genomatix and GenAtlas bioinformatics tools. Six TCF/LEF consensus binding sites were identified in the 3 kb region of the BMP4 promoter (5′-CTTTGA-3′; 3′-TCAAAG-5′ or 5′-CTTTAG-3′; 3′-CTAAAG-5′). An alignment of the DNA region showed evolutionary conservation among mammalian species. Identical nucleotides are in bold. The gray lines indicate regions investigated by chromatin immunoprecipitation. +1: transcription start site.
To address whether LEF1 binds directly to the predicted sites in the BMP4 promoter, we performed ChIP assay using hMSC-HD and hMSC-AML. Our results showed specific binding of LEF1 for five of the six TCF/LEF consensus binding sites in both hMSC-HD and hMSC-AML. Moreover, consistent with all the previous results, a significant decrease in LEF1 binding was observed in all TCF/LEF consensus binding sites in hMSC-AML compared to that in hMSC-HD (−613, −1860, −2240, −2680 and −2810 bp sites) (Figure 8).
Figure 8.
Decrease in LEF1 binding to the BMP4 gene promoter in hMSC-AML. Through a chromatin immunoprecipitation assay (ChiP) with LEF1 followed by RT-qPCR of the predicted TCF/LEF binding sites (A-E) in the BMP4 gene promoter, we observed reduced binding of LEF1 to the TCF/LEF in all consensus binding sites in hMSC-AML compared to that in hMSC-HD. The bar graphs show changes in LEF1 binding to DNA were calculated in relation to that of the IgG-precipitated control, normalized to the input the fold-change at each site compared to the binding of the input control. The data are expressed as the mean (± standard deviation). * P < 0.05/** P < 0.01. hMSC-HD: mesenchymal stromal cells derived from healthy donors; hMSC-AML: mesenchymal stromal cells derived from AML patients.
Overall, these results indicate that there are not only fewer β-catenin/TCF-LEF complexes formed in hMSC-AML but there is also less binding at the BMP4 gene promoter, suggesting that the canonical WNT signaling pathway could be responsible for the lower expression of BMP4 in hMSC-AML. The reduced activation of the canonical WNT signaling pathway in hMSC-AML could be related to the down-regulation of BMP4 gene expression.
Discussion
Although AML is considered extremely heterogeneous, it is known that AML has a unique origin, and changes in signaling between the microenvironment and HSCs may be responsible for the leukemic transformation [36]. It has been observed that perturbations in microenvironment components are directly associated with hematopoietic insufficiency [13]. Among the components, mesenchymal stromal cells are fundamental in the maintenance of HSCs, regulating their self-renewal, quiescence and mobilization in BM [4] and providing essential signals to support hematopoiesis [15].
Several studies have shown that hMSC-AML, compared to hMSC-HD, present differences that may be related to the development of AML [4]. Geyh and coworkers verified that hMSC-AML are molecularly and functionally altered and contribute to hematopoietic insufficiency [13]. Chandran and colleagues showed that the ability of hMSC-AML to support the expansion of committed hematopoietic progenitors is impaired and that the expression of genes related to hematopoietic quiescence is increased in hMSC-AML [37]. In addition, a molecular signature capable of distinguishing hMSC-AML from hMSC-HD, has been identified. Among the differentially expressed genes presented in the molecular signature, BMP4 shows decreased mRNA expression in hMSC-AML and plasma from AML patients [16].
Goldman and coworkers were the first group that highlighted in vivo the importance of BMP4 in HSC maintenance, specifically in the regulation of the differentiation and proliferation of HSCs [18]. BMP4 regulates the number and function of HSCs, which directly influences hematopoiesis [38] and has the ability to induce osteogenic differentiation in hMSCs [39], [40].
One of the characteristics of hMSCs is their potential for adipogenic, chondrogenic and osteogenic differentiation. Osteogenic cells are an important component of the BM microenvironment that play an essential role in regulating normal hematopoiesis [41], and BMP4 signaling is one of the central signaling pathways involved in the induction of osteogenic differentiation and the regulation of bone formation. Disrupting the osteoblastic compartment results in aberrant hematopoiesis [18], [38].
Thus, expectedly, we found in our study a decrease in osteogenic differentiation potential in hMSC-AML, which corroborates the descriptions in some studies of a reduced capacity of hMSC-AML for osteoblast formation [13], [42]. This capacity reduction can promote the suppression of normal hematopoiesis, increase the number of circulating blasts [13], [43] and can cause alterations in the HSCs [44]. The decreased expression of BMP4 in hMSC-AML may be responsible for the reduction in osteogenic differentiation potential. If fewer cells of the osteogenic lineage are present in BM, an imbalance among osteoblasts and osteoclasts is likely to occur, producing an environment favorable for LSC proliferation.
The contribution of BMP4 produced by the microenvironment to the pathogenesis of hematological tumors has been discussed [45]; nevertheless, the regulatory mechanism in hMSCs remains unclear [46]. In silico analyses from our group suggested that BMP4 in hMSCs could be regulated by the WNT signaling pathway [16]. In hMSCs, the WNT signaling pathways have been implicated in the regulation of hematopoiesis, which is necessary for the maintenance and self-renewal of HSCs [47]. Moreover, these pathways have been described in the development of several hematological malignancies [48], [49].
The WNT signaling pathway has already been described as dysregulated in AML-HSC [50], [51]. However, the expression profile of this pathway in hMSC-AML is still unknown.
The regulation of BMP4 through the WNT signaling pathway has been described in colon cancer cells, and it has been observed that increases in BMP4 expression are related to the activation of the canonical β-catenin-dependent WNT pathway [23]. In epidermal stem cell differentiation, increased β-catenin expression is accompanied by increased BMP4 expression [52]. In rat mesenchyme, β-catenin together with LEF1 and TCF1 is required to activate BMP4 expression during incisor development [53]. However, in Xenopus embryos, WNT signaling inhibits BMP4 expression and activates neural development [19].
In our study, 26 genes from the WNT signaling pathway were differentially expressed between hMSC-AML and hMSC-HD, suggesting a dysregulation of the WNT pathway in hMSC-AML. Thus, altered expression of these genes indicates that the WNT signaling pathway is altered in hMSC-AML. Interestingly, most of these differentially expressed genes are related to the WNT canonical or Wnt/β-catenin-dependent pathway. We also observed that the main components responsible for the WNT canonical pathway regulation were found to be decreased in hMSC-AML, such as LEF-1, β-catenin and the β-catenin/TCF-LEF regulatory complex in the nucleus.
For gene activation, the β-catenin/TCF-LEF complex must bind to specific sequences in the target gene promoter [28]. With several bioinformatic tools, it was possible to identify six consensus binding sites for the TCF/LEF transcription factors in a 3 kb sequence from the BMP4 gene promoter region [28], [29]. All six predicted TCF/LEF binding sites were highly conserved among mammalian species, indicating the biological relevance of these sites throughout evolution. In the ChIP experiments, we observed a significant decrease in LEF1 binding at five of the six TCF/LEF consensus binding sites in the BMP4 gene promoter in hMSC-AML compared to that in hMSC-HD.
These results indicate that the WNT canonical signaling pathway is altered in hMSC-AML and that this alteration could influence BMP4 expression in hMSC-AML. The decrease in β-catenin/TCF-LEF complex formation could be related to the decrease in BMP4 expression, because this complex is required for the activation of BMP4 expression. This altered regulation could influence the dysregulation of osteogenic differentiation and consequently the decrease of osteoblasts formation, generating an imbalance among osteoblasts and osteoclast, favoring LSC proliferation.
In conclusion, the current study shows that the WNT signaling pathway is altered in all hMSC-AML. These changes in the canonical WNT signaling pathway could influence BMP4 expression. The decrease in β-catenin/TCF-LEF complex formation and the reduction in BMP4 gene promoter binding suggest that the canonical WNT signaling pathway is essential for the activation of BMP4 expression. Therefore, the decreased BMP4 expression in hMSC-AML could be related to reduction in β-catenin/TCF-LEF complex formation. Moreover, changes in the expression of components of both the WNT and BMP4 signaling pathways could be important factors in the leukemic transformation process.
The following is the supplementary data related to this article.
List of the WNT signaling pathway genes from the PCR array (PAHS-043).
Acknowledgments
Acknowledgments
This work was financially supported by Ministério da Saúde (MS), Conselho Nacional de Desenvolvimento Tecnológico (CNPq), Financiadora de Estudos e Projetos (FINEP) and Fundação de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ). We thank Dr. Mary Evelyn D. Flowers for assistance and relevant comments that greatly improved the manuscript.
Authorship
Contribution: P.L.A., isolated, cultivated and confirmed hMSC cultures, performed the experiments, analyzed data, prepared the manuscript draft, wrote the paper and contributed intellectual content.; N.C.A.C isolated, cultivated and confirmed hMSC cultures, S.C., performed WB experiments and contributed intellectual content. M.T.L.C-B, performed immunofluorescence experiments, E.A., participated in the study design and contributed intellectual content, R.B., designed the study, analyzed data, prepared the manuscript draft, wrote the paper and contributed intellectual content. All authors provided critical review of the manuscript.
Conflict-of-interest disclosure
The authors declare no competing financial interests.
Footnotes
The authors have no conflicts of interest to declare.
References
- 1.Döhner H, Weisdorf DJ, Bloomfield C. Acute Myeloid Leukemia. N Engl J Med. 2015;373:1136–1152. doi: 10.1056/NEJMra1406184. [DOI] [PubMed] [Google Scholar]
- 2.Lapidot T, Sirard C, Vormoor J, Murdoch B, Hoang T, Cacerescortes J, Minden M, Paterson B, Caligiuri MA, Dick JE. A Cell Initiating Human Acute Myeloid-Leukemia After Transplantation Into Scid Mice. Nature. 1994;367:645–648. doi: 10.1038/367645a0. [DOI] [PubMed] [Google Scholar]
- 3.Shlush LI, Zandi S, Mitchell A, Chen WC, Brandwein JM, Gupta V, Kennedy JA, Schimmer AD, Schuh AC, Yee KW. Identification of pre-leukaemic haematopoietic stem cells in acute leukaemia. Nature. 2014;506:328–333. doi: 10.1038/nature13038. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Kim JA, Shim JS, Lee GY, Yim HW, Kim TM, Kim M, Leem SH, Lee JW, Min CK, Oh IH. Microenvironmental remodeling as a parameter and prognostic factor of heterogeneous leukemogenesis in acute myelogenous leukemia. Cancer Res. 2015;75:2222–2231. doi: 10.1158/0008-5472.CAN-14-3379. [DOI] [PubMed] [Google Scholar]
- 5.Thomas D, Majeti R. Biology and relevance of human acute myeloid leukemia stem cells. Blood. 2017;129:1577–1586. doi: 10.1182/blood-2016-10-696054. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Rosen J, Jordan C. The increasing complexity of the cancer stem cell paradigm. Science. 2009;324(80):1670–1673. doi: 10.1126/science.1171837. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Shlush LI, Mitchell A, Heisler L, Abelson S, Ng SWK, Trotman-Grant A, Medeiros JJF, Rao-Bhatia A, Jaciw-Zurakowsky I, Marke R. Tracing the origins of relapse in acute myeloid leukaemia to stem cells. Nature. 2017;547:104–108. doi: 10.1038/nature22993. [DOI] [PubMed] [Google Scholar]
- 8.Morrison SJ, Scadden DT. The bone marrow niche for haematopoietic stem cells. Nature. 2014;505:327–334. doi: 10.1038/nature12984. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Giles AJ, Chien CD, Reid CM, Fry TJ, Park DM, Kaplan RN, Gilbert MR. The functional interplay between systemic cancer and the hematopoietic stem cell niche. Pharmacol Ther. 2016;168:53–60. doi: 10.1016/j.pharmthera.2016.09.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Chitteti BR, Cheng Y-H, Poteat B, Rodriguez-Rodriguez S, Goebel WS, Carlesso N, Kacena MA, Srour EF. Impact of interactions of cellular components of the bone marrow microenvironment on hematopoietic stem and progenitor cell function. Blood. 2010;115:3239–3248. doi: 10.1182/blood-2009-09-246173. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Medyouf H. The microenvironment in human myeloid malignancies: Emerging concepts and therapeutic implications. Blood. 2017;129:1617–1626. doi: 10.1182/blood-2016-11-696070. [DOI] [PubMed] [Google Scholar]
- 12.von der Heide EK, Neumann M, Vosberg S, James AR, Schroeder MP, Ortiz-Tanchez J, Isaakidis K, Schlee C, Luther M, Jöhrens K. Molecular alterations in bone marrow mesenchymal stromal cells derived from acute myeloid leukemia patients. Leukemia. 2017;31:1069–1078. doi: 10.1038/leu.2016.324. [DOI] [PubMed] [Google Scholar]
- 13.Geyh S, Rodriguez-Paredes, Jager P, Khandanpour C, Cadeddu R-P, Gutekunst J, Wilk CM, Fenk R, Zilkens C, Hermsen D. Functional inhibition of mesenchymal stromal cells in acute myeloid leukemia. Leukemia. 2015;325 doi: 10.1038/leu.2015.325. [DOI] [PubMed] [Google Scholar]
- 14.Yin T, Li L. The stem cell niches in bone. J Clin Invest. 2006;116:1195–1201. doi: 10.1172/JCI28568. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Konopleva M, Tabe Y, Zeng Z, Andreeff M. Therapeutic targeting of microenvironmental interactions in leukemia: Mechanisms and approaches. Drug Resist Updat. 2009;12:103–113. doi: 10.1016/j.drup.2009.06.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Binato R, de Almeida Oliveira NC, Du Rocher B, Abdelhay E. The molecular signature of AML mesenchymal stromal cells reveals candidate genes related to the leukemogenic process. Cancer Lett. 2015;369:134–143. doi: 10.1016/j.canlet.2015.08.006. [DOI] [PubMed] [Google Scholar]
- 17.Urist MR. Bone: Formation by Autoinduction. Science. 1965;150(80):893–899. doi: 10.1126/science.150.3698.893. [DOI] [PubMed] [Google Scholar]
- 18.Goldman DC, Bailey AS, Pfaffle DL, Al Masri A, Christian JL, Fleming WH. BMP4 regulates the hematopoietic stem cell niche. Blood. 2009;114:4393–4401. doi: 10.1182/blood-2009-02-206433. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Baker JC, Beddington RSP, Harland RM. Wnt signaling in Xenopus embryos inhibits Bmp4 expression and activates neural development. Genes Dev. 1999;13:3149–3159. doi: 10.1101/gad.13.23.3149. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Zhu XJ, Liu YD, Dai ZM, Zhang X, Yang XQ, Li Y, Qiu M, Fu J, Hsu W, Chen YP. BMP-FGF Signaling Axis Mediates Wnt-Induced Epidermal Stratification in Developing Mammalian Skin. PLoS Genet. 2014;10 doi: 10.1371/journal.pgen.1004687. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Huang HC, Klein PS. Interactions between BMP and Wnt signaling pathways in mammalian cancers. Cancer Biol Ther. 2004;3:676–678. doi: 10.4161/cbt.3.7.1026. [doi:1026 [pii]] [DOI] [PubMed] [Google Scholar]
- 22.Kuroda K, Kuang S, Taketo MM, Rudnicki MA. Canonical Wnt signaling induces BMP-4 to specify slow myofibrogenesis of fetal myoblasts. Skelet Muscle. 2013;3:1–13. doi: 10.1186/2044-5040-3-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Kim J-S, Crooks H, Dracheva T, Nishanian TG, Singh B, Jen J, Waldman T. Oncogenic beta-catenin is required for bone morphogenetic protein 4 expression in human cancer cells. Cancer Res. 2002;62:2744–2748. [ http://cancerres.aacrjournals.org/cgi/pmidlookup?view=long&pmid=12019147%5Cnfile:///Users/mmorkel/Documents/Papers2/Articles/2002/Kim/Cancer Res.2002Kim.pdf%5Cnpapers2://publication/uuid/469E2066-203B-434E-AAEB-AA48FD0F2DFB] [PubMed] [Google Scholar]
- 24.Bennett JM, Catovsky D, Daniel MT, Flandrin G, Galton DA, Gralnick HR, Sultan C. Proposed revised criteria for the classification of acute myeloid leukemia. A report of the French-American-British Cooperative Group. Ann Intern Med. 1985;103:620–625. doi: 10.7326/0003-4819-103-4-620. [DOI] [PubMed] [Google Scholar]
- 25.Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D, Deans R, Keating A, Prockop D, Horwitz E. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy. 2006;8:315–317. doi: 10.1080/14653240600855905. [DOI] [PubMed] [Google Scholar]
- 26.Larionov A, Krause A, Miller W. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics. 2005;6:62. doi: 10.1186/1471-2105-6-62. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Panis C, Pizzatti L, Herrera AC, Corrêa S, Binato R, Abdelhay E. Label-free proteomic analysis of breast cancer molecular subtypes. J Proteome Res. 2014 doi: 10.1021/pr500676x. [DOI] [PubMed] [Google Scholar]
- 28.Cadigan KM, Waterman ML. TCF/LEFs and Wnt signaling in the nucleus. Cold Spring Harb Perspect Biol. 2012;4:1–22. doi: 10.1101/cshperspect.a007906. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Gustavson MD, Crawford HC, Fingleton B, Matrisian LM. Tcf binding sequence and position determines B-catenin and Lef-1 responsiveness of MMP-7 promoters. Mol Carcinog. 2004;41:125–139. doi: 10.1002/mc.20049. [DOI] [PubMed] [Google Scholar]
- 30.Mao B, Wu W, Davidson G, Marhold J, Li M, Mechler BM, Dellus H, Hoppe D, Stannek P, Walter C. Kremen proteins are Dickkopf receptors that regulate Wnt/β-catenin signalling. Nature. 2002;417:664–667. doi: 10.1038/nature756. [DOI] [PubMed] [Google Scholar]
- 31.Chan DW, Chan CY, Yam JWP, Ching YP, Ng IOL. Prickle-1 Negatively Regulates Wnt/B-Catenin Pathway by Promoting Dishevelled Ubiquitination/Degradation in Liver Cancer. Gastroenterology. 2006;131:1218–1227. doi: 10.1053/j.gastro.2006.07.020. [DOI] [PubMed] [Google Scholar]
- 32.Klaus A, Birchmeier W. Wnt signalling and its impact on development and cancer. Nat Rev Cancer. 2008;8:387–398. doi: 10.1038/nrc2389. [DOI] [PubMed] [Google Scholar]
- 33.Yeh J-RJ, Peterson RT. Novel Wnt antagonists target porcupine and Axin. Nat Chem Biol. 2009;5:74–75. doi: 10.1038/nchembio0209-74. [DOI] [PubMed] [Google Scholar]
- 34.Takada R, Satomi Y, Kurata T, Ueno N, Norioka S, Kondoh H, Takao T, Takada S. Monounsaturated Fatty Acid Modification of Wnt Protein: Its Role in Wnt Secretion. Dev Cell. 2006;11:791–801. doi: 10.1016/j.devcel.2006.10.003. [DOI] [PubMed] [Google Scholar]
- 35.Zhan T, Rindtorff N, Boutros M. Wnt signaling in cancer. Oncogene. 2017;36:1461–1473. doi: 10.1038/onc.2016.304. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Ayala F, Dewar R, Kieran M, Kalluri R. Contribution of bone microenvironment to leukemogenesis and leukemia progression. Leukemia. 2009;23:2233–2241. doi: 10.1038/leu.2009.175. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Chandran P, Le Y, Li Y, Sabloff M, Mehic J, Rosu-Myles M, Allan DS. Mesenchymal stromal cells from patients with acute myeloid leukemia have altered capacity to expand differentiated hematopoietic progenitors. Leuk Res. 2015;39:486–493. doi: 10.1016/j.leukres.2015.01.013. [DOI] [PubMed] [Google Scholar]
- 38.Zhang J, Li L. BMP signaling and stem cell regulation. Dev Biol. 2005;284:1–11. doi: 10.1016/j.ydbio.2005.05.009. [DOI] [PubMed] [Google Scholar]
- 39.McCarthy TL, Centrella M. Novel Links among Wnt and TGF-β Signaling and Runx2. Mol Endocrinol. 2010;24:587–597. doi: 10.1210/me.2009-0379. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Chen G, Deng C, Li YP. TGF-β and BMP signaling in osteoblast differentiation and bone formation. Int J Biol Sci. 2012;8:272–288. doi: 10.7150/ijbs.2929. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Calvi L, Adams G, Weibrecht K, Weber J, Olson D, Knight M, Martin R, Schipani E, Divieti P, Bringhurst F. Others, Osteoblastic cells regulate the haematopoietic stem cell niche. Nature. 2003;425:841–846. doi: 10.1038/nature02040. [DOI] [PubMed] [Google Scholar]
- 42.Diaz de la Guardia R, Lopez-Millan B, Lavoie JR, Bueno C, Castaño J, Gómez-Casares M, Vives S, Palomo L, Juan M, Delgado J. Detailed Characterization of Mesenchymal Stem/Stromal Cells from a Large Cohort of AML Patients Demonstrates a Definitive Link to Treatment Outcomes. Stem Cell Rep. 2017;8:1–14. doi: 10.1016/j.stemcr.2017.04.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Krause DS, Scadden DT. A hostel for the hostile: The bone marrow niche in hematologic neoplasms. Haematologica. 2015;100:1376–1387. doi: 10.3324/haematol.2014.113852. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Alberts B. Mol Biol Cell. 2015 [Google Scholar]
- 45.Nishanian TG, Kim J-S, Foxworth A, Waldman Todd. Suppression of Tumorigenesis and Activation of Wnt Signaling by Bone Morphogenetic Protein 4 in Human Cancer Cells. Cancer Biol Ther. 2004;3:667–675. doi: 10.4161/cbt.3.7.965. [ http://www.landesbioscience.com/journals/6/article/965/] [DOI] [PubMed] [Google Scholar]
- 46.Vicente López Á, Vázquez García MN, Melen GJ, Entrena Martínez A, Cubillo Moreno I, García-Castro J, Ramírez Orellana M, Zapata González AG. Mesenchymal stromal cells derived from the bone marrow of acute lymphoblastic leukemia patients show altered BMP4 production: Correlations with the course of disease. PLoS One. 2014;9:1–11. doi: 10.1371/journal.pone.0084496. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Richter J, Traver D, Willert K. The role of Wnt signaling in hematopoietic stem cell development. Crit Rev Biochem Mol Biol. 2017:1–11. doi: 10.1080/10409238.2017.1325828. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Pai SG, Carneiro BA, Mota JM, Costa R, Leite CA, Barroso-Sousa R, Kaplan JB, Chae YK, Giles FJ. Wnt/beta-catenin pathway: modulating anticancer immune response. J Hematol Oncol. 2017;10:1–12. doi: 10.1186/s13045-017-0471-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Stoddart A, Wang J, Hu C, Fernald AA, Davis EM, Cheng JX, Le Beau MM. Inhibition of WNT signaling in the bone marrow niche prevents the development of MDS in the Apc del/+ MDS mouse model. Blood. 2017;129:2959–2970. doi: 10.1182/blood-2016-08-736454. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Mikesch JH, Steffen B, Berdel WE, Serve H, Müller-Tidow C. The emerging role of Wnt signaling in the pathogenesis of acute myeloid leukemia. Leukemia. 2007 doi: 10.1038/sj.leu.2404732. [DOI] [PubMed] [Google Scholar]
- 51.Staal FJT, Famili F, Perez LG, Pike-Overzet K. Aberrant Wnt signaling in leukemia. Cancers (Basel) 2016 doi: 10.3390/cancers8090078. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Huelsken J, Vogel R, Erdmann B, Cotsarelis G, Birchmeier W. β-Catenin controls hair follicle morphogenesis and stem cell differentiation in the skin. Cell. 2001;105:533–545. doi: 10.1016/s0092-8674(01)00336-1. [DOI] [PubMed] [Google Scholar]
- 53.Fujimori S, Novak H, Weissenböck M, Jussila M, Gonçalves A, Zeller R, Galloway J, Thesleff I, Hartmann C. Wnt/β-catenin signaling in the dental mesenchyme regulates incisor development by regulating Bmp4. Dev Biol. 2010;348:97–106. doi: 10.1016/j.ydbio.2010.09.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
List of the WNT signaling pathway genes from the PCR array (PAHS-043).







