Skip to main content
Molecular Systems Biology logoLink to Molecular Systems Biology
. 2019 Mar 4;15(3):e8584. doi: 10.15252/msb.20188584

Path‐seq identifies an essential mycolate remodeling program for mycobacterial host adaptation

Eliza JR Peterson 1, Rebeca Bailo 2, Alissa C Rothchild 3, Mario L Arrieta‐Ortiz 1, Amardeep Kaur 1, Min Pan 1, Dat Mai 3, Abrar A Abidi 1, Charlotte Cooper 2, Alan Aderem 3, Apoorva Bhatt 2,, Nitin S Baliga 1,4,5,
PMCID: PMC6398593  PMID: 30833303

Abstract

The success of Mycobacterium tuberculosis (MTB) stems from its ability to remain hidden from the immune system within macrophages. Here, we report a new technology (Path‐seq) to sequence miniscule amounts of MTB transcripts within up to million‐fold excess host RNA. Using Path‐seq and regulatory network analyses, we have discovered a novel transcriptional program for in vivo mycobacterial cell wall remodeling when the pathogen infects alveolar macrophages in mice. We have discovered that MadR transcriptionally modulates two mycolic acid desaturases desA1/desA2 to initially promote cell wall remodeling upon in vitro macrophage infection and, subsequently, reduces mycolate biosynthesis upon entering dormancy. We demonstrate that disrupting MadR program is lethal to diverse mycobacteria making this evolutionarily conserved regulator a prime antitubercular target for both early and late stages of infection.

Keywords: gene regulatory networks, host–pathogen interactions, Mycobacterium tuberculosis, Path‐seq, systems biology

Subject Categories: Genome-Scale & Integrative Biology; Microbiology, Virology & Host Pathogen Interaction

Introduction

Mycobacterium tuberculosis (MTB) infection occurs by inhalation of bacilli‐containing aerosols. Alveolar macrophages, which line the airway, are the first host cells to phagocytize the bacteria. This initial contact of MTB with alveolar macrophages begins a complex battle between bacterial virulence and host immunity, orchestrated in large part by intricate gene regulatory pathways (Galan & Wolf‐Watz, 2006; Medzhitov, 2007). As such, measuring gene expression in vivo is central to our understanding of TB disease control and progression (Flynn et al, 2011).

RNA‐seq provides a sensitive method for global gene expression analysis. Specific for infection biology, dual RNA‐seq methods have allowed simultaneous profiling of host and pathogen RNA. However, the striking excess of eukaryotic over bacterial RNA limits the coverage of pathogen transcripts in dual RNA‐seq studies (Avraham et al, 2015, 2016, Rienksma et al, 2015; Westermann et al, 2012; Westermann et al, 2016), and methods to partially enrich for bacterial transcripts have had limited success (Humphrys et al, 2013; Mavromatis et al, 2015). It is clear that more sensitive approaches are needed to profile the transcriptional state of the pathogen during infection, especially in vivo.

To improve the coverage of pathogen transcripts, we made use of biotinylated oligonucleotide baits that are complementary to the pathogen transcriptome. The baits are hybridized to mixed host–pathogen RNA and used to enrich pathogen transcripts for sequencing. Approaches using biotinylated genome fragments have previously been used to enrich specific transcripts of intracellular pathogens (Graham & Clark‐Curtiss, 1999; Morrow et al, 1999) or perform genome‐wide transcriptome profiling of fungal RNA from infected host cells (Amorim‐Vaz et al, 2015). Here, we applied our pathogen‐sequencing (Path‐seq) method to explore transcriptional changes in MTB (one‐fourth the size of fungus, Candida albicans) following infection in mice. Path‐seq data along with network modeling have led to discovery that MTB transcriptionally regulates mycolic acids during infection of host cells, influencing virulence and persistence of the pathogen.

Results

Development of Path‐seq

To enrich the bacterial pathogen transcripts, we used Agilent eArray (Ong et al, 2011) to create a custom bait library that covers all MTB transcripts at even intervals. Our MTB library contains 35,624 probes, each with biotinylated oligonucleotides of 120 base lengths. The bait library composition is modular and can be designed to cover specific transcripts of interest. Similarly, transcripts such as rRNA can be excluded or gene sequences altered for polymorphisms found in clinical strains (Fleischmann et al, 2002). For this study, we chose all transcripts of MTB H37Rv for complete coverage and comparison with standard RNA‐seq results.

To assess enrichment of pathogen transcripts, we first used RNA isolated from murine bone marrow‐derived macrophages (BMDMs) spiked with 0.1% MTB RNA. A typical mammalian cell contains on the order of 20 picograms of RNA, which is roughly two orders of magnitude more than a single bacterial cell (Alberts et al, 1994). Accounting for BMDMs that might not be infected and based on intracellular sequencing studies from literature (Avraham et al, 2016; Westermann et al, 2016), we estimated 0.1% pathogen RNA would be representative of a typical in vitro infection. We performed double rRNA depletion using Illumina Ribo‐Zero Gold Epidemiology Kit and used the SureSelect protocol to generate strand‐specific libraries for sequencing. Half of the library was then indexed for sequencing as the “RNA‐seq” sample, and the other was hybridized to the probes, amplified, and indexed as the “Path‐seq” sample (Fig 1A). We performed three replicate experiments of the mock infection using the same MTB RNA. With the probe hybridization, the percentages of reads aligned to MTB were increased up to 840‐fold. Both the normalized read counts (Fig 1B) and enrichment efficiency (inset Fig 1B) were highly reproducible across three replicate samples. Repeating the Path‐seq method with spiked RNA samples, we increased the proportion of macrophage RNA and were able to quantify MTB transcripts from one millionth of the host RNA (1.75% of all reads aligned to MTB genomes).

Figure 1. Path‐seq workflow and validation.

Figure 1

  1. Total RNA from mock infection or infected cells was depleted of rRNA, and cDNA libraries were prepared. Libraries were then either indexed and sequenced directly for host transcripts or enriched using pathogen‐specific oligonucleotides bound to beads. After hybridization, enriched libraries were indexed, sequenced, and reads assigned to host or pathogen genomes in silico.
  2. Correlation between replicate mock infections. Path‐seq reads were recovered from samples of macrophage RNA spiked with 0.1% MTB RNA. Scatter plot of log2 RPKM values is shown with Pearson correlation, P‐value < 0.0001. Inset summarizes the mock infection replicates and their fraction of MTB reads (of all aligned reads) from Path‐seq and standard RNA‐seq methods.
  3. Correlation between MTB RNA sequenced by RNA‐seq (Illumina TruSeq Library Prep) and the same MTB RNA sample combined with macrophage RNA at 1:1,000 ratio and processed using Path‐seq method. Scatter plot of log2 RPKM values is shown with Pearson correlation, P‐value < 0.0001.

To validate the enrichment protocol yielded quantitatively reliable read counts, we investigated the correlation between the RPKMs obtained from the sequencing of RNA from in vitro grown MTB, without enrichment (RNA‐seq), and the RPKM values obtained with the enrichment protocol (Path‐seq) using the same 0.1% MTB RNA with host RNA (BMDMs). Even using different library preparation kits (Illumina for RNA‐seq and Agilent for Path‐seq), the correlation of RPKMs was 0.92–0.93 (Fig 1C), demonstrating the enrichment process was efficient and accurate for gene expression analysis.

Analysis of MTB transcriptome during in vivo infection using Path‐seq method

Little is known about the transcriptional state of the pathogen during infection of animal models (Talaat et al, 2004); technical challenges have limited these studies. Given the enrichment capabilities of the Path‐seq method, we evaluated the use of the approach to study the transcriptome of MTB isolated from alveolar macrophages (AMs) of infected mice. We used fluorescence‐activated cell sorting (FACS) and gating strategies to isolate AMs from bronchoalveolar lavage (BAL) of mice at 24 h post‐aerosol infection with MTB. We isolated AMs from BAL, instead of whole lung tissue, to avoid the harsh digestion step at 37°C that can alter the transcriptional state of the cells. RNA extracted from AMs in BAL of 10 mice yielded ~100 μg of total RNA. Therefore, we first evaluated the Path‐seq method using 0.3 μg of BMDM RNA spiked with 0.005% MTB RNA, to simulate mixed host and pathogen RNA composition of a sample from an in vivo infection. We performed Path‐seq with two replicates, and alignment analysis revealed the percentages of reads that aligned to MTB were 38 and 27%, an approximate 10,000‐fold enrichment.

After evaluating the Path‐seq methods’ feasibility for in vivo MTB transcriptome analysis, we used flow cytometry to isolate AMs (average of 4.3% of all cells and 83.1% of live, CD45+ cells) in BAL of 30 mice 24 h after infection with wild‐type MTB (Appendix Fig S1A). Infection, FACS sorting (Appendix Fig S1B), and RNA extraction were repeated with three independent mouse infections (three biological replicates), yielding an average of ~300 μg total RNA per replicate. The Path‐seq enrichment was performed and resulted in 17, 8, and 5% of the entire reads aligning to MTB from each of the replicates. We compared the MTB read counts between the in vivo samples with extracellular samples, biological replicates of RNA extracted from MTB grown in 7H9 media for 24 h (starting OD600 = 0.1). Both the in vivo and extracellular samples were processed by Path‐seq. While the percentage of non‐zero reads and total read counts are lower in the in vivo samples, the mean count per gene and coefficient of variation are the same between the two conditions (Appendix Table S1). This gives us confidence that for genes with detectable reads, we are measuring real expression levels. We suspect genes with non‐detectable reads are a result of the miniscule amount of MTB RNA compared to host RNA in the in vivo samples, and not a reflection of real gene expression changes. Therefore, excluding genes with zero counts in all in vivo replicates resulted in 3,505 MTB genes (62% of genome) with sequenced expression measurements from in vivo infection using Path‐seq. These results (raw data and normalized read counts for ALL genes are available in GEO: GSE116394) present the most comprehensive transcriptome profiling of MTB from in vivo infection and a major technical advancement for researchers studying host–pathogen interactions.

To calculate differentially expressed genes between the in vivo and extracellular samples, we excluded in vivo biological replicate 3, which had significantly lower total read counts compared to all other samples (summarized in Appendix Table S1). The lower deposition of replicate 3 suggests a lower amount of starting MTB could be the reason for the low read count. Differential expression analysis between in vivo intracellular MTB and extracellular MTB identified 431 significantly differentially expressed transcripts (log2 fold change < −1.0 or > 1.0 and multiple hypothesis‐corrected P‐value < 0.05, Dataset EV1).

Among the differentially expressed transcripts that code for annotated proteins (376 genes), 121 were down‐regulated and significantly enriched (multiple hypothesis‐corrected P‐value = 0.005), in the Mycobrowser category (Kapopoulou et al, 2011) of proline–glutamic acid (PE)/proline–proline–glutamic acid (PPE) family of proteins. The exact physiological role of the PE and PPE proteins in MTB is yet to be fully understood, but they are thought to play important roles in immune evasion (Tiwari et al, 2012). It is interesting that PE and PPE genes were down‐regulated in AMs and might indicate that they are unnecessary within these host cells. In addition, 255 genes were up‐regulated in AMs at 24 h post‐infection and were significantly enriched (< 0.05) in the Mycobrowser functional categories: “insertion sequences and phages”, “information pathways”, and “lipid metabolism”. Most interesting, many of the genes whose protein products are associated with “lipid metabolism” are involved in the biosynthesis of mycolic acid. These up‐regulated mycolic acid biosynthesis genes included umaA, pcaA, desA1, desA2, fadD32, and fabD. In addition, genes of the operon involved in phthiocerol dimycocerosate (PDIM) biosynthesis were also up‐regulated. The biosynthesis of new cell wall material is an energetically expensive process and found to be repressed in MTB upon entry into dormancy (Galagan et al, 2013; Jamet et al, 2015). This suggests that MTB in AMs 24 h post‐infection are not in a dormant state. Instead, the transcriptional response indicates MTB is actively remodeling the cell wall, perhaps with modifications that specifically contribute to survival within AMs. Interestingly, the up‐regulated genes, umaA and pcaA, are required for cyclopropane ring formation in mycolic acids of MTB. Furthermore, desA1 and desA2 (with log2 fold change of 4.0 and 4.7, respectively, within AMs) encode fatty acid desaturases that introduce double bonds into fatty acids (Singh et al, 2016). Desaturation is a necessary step prior to cyclopropanation and other mycolic acid modifications. It is interesting to speculate that conditions within AMs induce desaturation events, enabling MTB to fine‐tune subsequent cyclopropanation and other modifications of mycolic acids that contribute to cell wall permeability and adaptation within these host cells. The significant up‐regulation of mycolic acid remodeling genes following in vivo infection was interesting and deserved further investigation of their transcriptional control.

Genome‐wide expression analysis during in vitro macrophage infection using Path‐seq

Several genome‐wide expression studies of MTB challenged with dormancy‐inducing stresses, such as nutrient starvation (Jamet et al, 2015) and hypoxia (Galagan et al, 2013; McGillivray et al, 2015), have shown that genes involved in mycolic acid biosynthesis are generally down‐regulated. In contrast, we observed up‐regulation of mycolate biosynthesis genes in MTB from AMs of infected mice at 24 h. Therefore, we sought to study the expression of these mycolic acid modification genes at multiple time points during infection using the Path‐seq method and MTB‐infected bone marrow‐derived macrophages (BMDMs). An in vitro infection system was used due to the large number of mice required for additional time points during in vivo infection. We isolated murine BMDMs and infected them with MTB at a MOI of 10. Infected cells were collected at 2, 8, and 24 h after infection along with extracellular MTB grown in 7H9 media as control. Total RNA was extracted, depleted of rRNA, and handled as described above (Fig 1A). All extracellular MTB samples were processed by Path‐seq as well. For the in vitro infection samples (Appendix Fig S2), we split each sample into RNA‐seq and Path‐seq fractions to evaluate the enrichment efficiency and to simultaneously obtain both host and pathogen transcriptomes from the same infection sample. While we did not perform transcriptome analysis of the host cells in this study, the raw data are available (GSE116357) along with uninfected BMDM controls and represents the first duel monitoring of both MTB and host transcriptomes from the same infection samples. The percentage of reads that aligned to MTB was consistent at a 100‐fold increase in the enriched vs non‐enriched samples across replicates and time points (Table 1). With an average of 11 million (M) mapped reads for both intracellular (average 13.4 M) and extracellular (average 8.8 M) MTB, we obtained >100× coverage and 5,622 unique features (including ncRNA and UTRs). This is further validation of the Path‐seq method to comprehensively study the authentic intracellular state of a pathogen.

Table 1.

Genome mapping statistics from Path‐seq and RNA‐seq from in vitro infection of MTB‐infected BMDMs

Fraction of MTB reads of all aligned reads (%)
Path‐seq RNA‐seq
Intracellular 2 h: a 77.0 0.73
Intracellular 2 h: b 71.1 0.53
Intracellular 2 h: c 88.5 0.65
Intracellular 8 h: a 47.7 0.54
Intracellular 8 h: b 87.5 0.66
Intracellular 8 h: c 82.8 0.38
Intracellular 24 h: a 97.4 3.97
Intracellular 24 h: b 75.5 1.88
Intracellular 24 h: c 97.5 3.10

Using the normalized read counts from the intracellular and extracellular MTB data, we identified two clusters by implementing the R NbClust function (Charrad et al, 2014) on principal component analysis output, a dimensionality reduction method. The two identified clusters are shown in a two‐dimensional t‐distributed stochastic neighbor embedding plot (t‐SNE, van der Maaten & Hinton, 2008) plot. Extracellular samples clustered closely together, distinct from the intracellular samples and according to their time post‐infection (Appendix Fig S3A). Biological replicates fell into related groups and demonstrated strong correlation in pairwise comparison of RPKMs (Appendix Fig S3B). Differential expression of intracellular MTB was calculated relative to extracellular, at each time point using DESeq2. Overall, there were 746, 945, and 412 significant differentially expressed (log2 fold change < −1.0 or > 1.0 and multiple hypothesis‐adjusted P‐value < 0.01) transcripts at the 2, 8, and 24 h post‐infection time points, respectively (Dataset EV2). The most up‐regulated genes at all time points included genes such as icl1, Rv1129c, prpD, prpC, and fadD19. The induced expression of these genes is consistent with known alterations in lipid degradation during infection, enhanced activity of the methylcitrate cycle (Munoz‐Elias et al, 2006), and genetic evidence that MTB utilizes cholesterol from the host during infection (Pandey & Sassetti, 2008). These carbon‐metabolizing genes were also found to be up‐regulated in microarray analysis of in vitro MTB‐infected host cells (Schnappinger et al, 2003; Data ref: Schnappinger et al, 2003; Rohde et al, 2007; Data ref: Rohde et al, 2007), along with a significant overlap of other differentially expressed genes between the datasets (Appendix Table S2). These data demonstrate that the Path‐seq method yielded data consistent with published transcriptional studies of in vitro infected host cells. Importantly, the Path‐seq method allows for simultaneous expression profiling of host and pathogen transcripts and additional transcript features that are not possible in microarray studies.

desA1 and desA2 are induced early during in vitro macrophage infection and hypoxia time course

Among the mycolic acid biosynthesis genes, only umaA was up‐regulated at all time points and desA1/desA2 were transiently up‐regulated at 2 h following MTB infection of BMDMs. Similarly, umaA, desA1, and desA2 were also found to be up‐regulated in the in vitro infection microarray analyses (Schnappinger et al, 2003; Data ref: Schnappinger et al, 2003; Rohde et al, 2007; Data ref: Rohde et al, 2007), but none of the other mycolic acid biosynthesis genes that were up‐regulated in vivo. In the in vitro infection using Path‐seq, after 2 h, desA1/desA2 returned to levels similar to extracellular MTB at 8 h and 24 h (Fig 2A). This expression dynamics of desA1/desA2 during MTB infection of BMDMs was also mirrored in RNA‐seq data of MTB entering and exiting hypoxia over a 5‐day time course (Fig 2B). In this experiment, we used mass flow controllers to regulate the amount of air and nitrogen (N2) gas streaming into cultures of MTB and achieve a gradual depletion of oxygen over 2 days. The cultures were maintained in hypoxia for 2 days by streaming only N2 and then reaerated over 1 day by a controlled increase in air flow. During the 2‐day oxygen depletion, the expression levels of desA1 and desA2 did not change significantly. However, as soon as the cultures reached complete hypoxia (0% dissolved oxygen), the expression of the desaturases increased for ~5 h, followed by a dramatic repression after ~30 h of being in hypoxia. Subsequently, reaeration of the culture returned desA1 and desA2 to basal expression levels (Fig 2B). Interestingly, umaA was not significantly differentially expressed across the hypoxia time course.

Figure 2. The expression levels of desA1 and desA2 from Path‐seq of MTB‐infected BMDMs and over a hypoxia time course.

Figure 2

  1. Path‐seq profiles of desA1 and desA2 in MTB‐infected BMDMs. Error bars show the standard deviation from three biological samples. Representative results from two experiments are presented.
  2. Upper panel: dissolved oxygen curve over 120‐h time course showing controlled depletion (1), sustained hypoxia (2), and controlled reaeration (3). Points represent the average of three biological replicates and were measured via fiber optic technology that non‐invasively probes oxygen levels in the culture (PreSens Precision Sensing GmbH). Lower panel: expression profiles (RNA‐seq) of desA1 and desA2 over the time course and oxygen levels. Error bars show the standard deviation from three biological samples.

Gene expression comparison between in vivo and in vitro infections

In addition to the mycolic acid biosynthesis gene, we further compared all significantly differentially expressed genes between the two infection models and found only a small but significant (P‐value < 0.01) subset of common genes (59 genes at 24 h and 137 genes from any in vitro time point, Dataset EV3 and Appendix Fig S4). Most of the common genes were up‐regulated in both models and included genes significantly enriched in categories related to the ribosome and response to hypoxia according to MTB annotation in DAVID (Huang da et al, 2009a,b). Interestingly, both AAA+ ATPases, clpX (Rv2457c), and clpC1 (Rv3596c) that interact with the ClpP proteolytic core (Neuwald et al, 1999; Raju et al, 2014) were also significantly up‐regulated in both models. Despite these few similarly expressed genes, the strikingly different gene expression profiles between the experimental infection models could reflect heterogeneity in host cells. Huang et al (2018) recently demonstrated in mice that MTB has lower bacterial stress in AMs compared to interstitial macrophages (IMs) at 2 weeks post‐infection. The authors theorize that different host macrophage lineages represent different intracellular environments that are permissive (AMs) or restrictive (IMs) for MTB growth (Huang et al, 2018). Our data also point toward differences in the MTB transcriptional state from macrophages of different lineages.

Systems‐level comparison of active MTB regulatory networks illustrates differences between infection models

Given the transcriptome differences between the infection models, we employed a computational framework to characterize, at systems scale, the transcriptional differences between the extracellular and intracellular states for each model. There are numerous methods for identifying the key transcriptional networks from different environments (Balazsi et al, 2008; Brynildsen & Liao, 2009; Cahan et al, 2014). Based on one such approach, NetSurgeon (Michael et al, 2016), we evaluated the role of each TF in the observed gene expression changes given a signed transcriptional network. We constructed a transcriptional network based on ChIP‐seq data from overexpression of 178 of 214 TFs in MTB (Minch et al, 2014; Data ref: Minch et al, 2015). Activating and repressing influences of TFs were inferred from consequence of TF overexpression on downstream genes (Rustad et al, 2014; Data ref: Rustad et al, 2014). Using a data‐driven transcriptional network of 4,635 interactions, each TF–target gene interaction was weighted according to the multiple hypothesis‐adjusted P‐value from differential expression analysis between intracellular and extracellular conditions. We calculated a relative score for each TF in conditions simulating deletion or overexpression of the TF. These simulations prioritized TF activities (decreased or increased) yielding a transcriptome most similar to the infected state, compared to the control (see Materials and Methods and summary schematic in Fig 3A). We performed this analysis for each time point and infection model to identify highly ranked TFs (Fig 3B).

Figure 3. Systems approach to identify active intracellular regulatory networks.

Figure 3

  1. Schematic of network analysis to identify TFs with activity (increased or decreased) in controlling the transcriptional state of MTB during infection of host cells. Abbreviations: dec; decreased, inc; increased.
  2. Heatmap of TFs with decreased (purple) or increased (green) activity at specific time points during in vitro or in vivo infection.
  3. Rv0681 regulon genes differentially expressed in vitro and the evidence for predicted high Rv0681 activity (induced expression of target genes).
  4. Zur regulon genes differentially expressed in vitro and the evidence for decreased Zur activity (derepresses target genes).
  5. Rv0691c regulon genes differentially expressed in vitro and in vivo; evidence for increased Rv0691c activity (increased up‐ and down‐regulation of target genes) at 24 h from both in vitro and in vivo infection.
Data information: (C‐E) Boxplots represent log2 fold change (FC) values of TF target genes. The boxes show the median and first/third quartiles of the log2 FC values; the whiskers extend to the smallest/largest values that are no further than 1.5 times the inter‐quartile range.

From the in vitro macrophage infection, many of the TFs had distinct temporal activity, while others were highly ranked across all time points (Fig 3B). These sustained regulons include DosR, which is known to contain a set of ~50 genes that are induced in response to multiple signals including hypoxia, nitrosative stress, and carbon monoxide (Park et al, 2003; Kendall et al, 2004; Roberts et al, 2004; Kumar et al, 2008). While DosR regulon induction is typically associated with hypoxic conditions and reactive nitrogen intermediates (RNIs), we observed activation as early as 2 h post‐infection. Encouragingly, this 2 h induction was also found in the microarray study of MTB‐infected macrophages, where high DosR regulon expression was sustained until a striking down‐regulation at Day 8 (Rohde et al, 2012). This indicates that the known cues of this regulatory network are present almost immediately during in vitro infection. In addition to DosR, two other TFs had high activity across all time points, Rv0681 (Fig 3C) and Rv0691c. Interestingly, both are TetR family transcriptional regulators and conserved across all mycobacterial genomes (Balhana et al, 2015), including the drastically reduced Mycobacterium leprae. The function of these transcriptional networks is unknown, but suggests their activity is important for survival in both environmental and intracellular niches.

Among the TFs with decreased activity, KstR and KstR2 were found across all time points of the in vitro infection and are known to repress genes required for cholesterol utilization (Kendall et al, 2010). Our analysis indicates that reduction of their repressive activity, and increased expression of their target genes, is important for driving the in vitro intracellular transcriptional state. This is consistent with the highly expressed cholesterol utilization and methyl citrate cycle genes that we and others have observed (Schnappinger et al, 2003; Rohde et al, 2007; Homolka et al, 2010). Moreover, this emphasizes the importance of altered carbon metabolism and utilization of host‐derived nutrients as key to MTB in vitro intracellular adaptation. Another repressor, Zur (previously FurB), had decreased activity across all time points (Fig 3D). Zur down‐regulates genes involved in zinc transport (Maciag et al, 2007). During MTB infection, macrophages overload the phagosome with copper and zinc as a strategy to poison the pathogen (Neyrolles et al, 2015). However, through multi‐faceted resistance mechanisms we do not fully appreciate, MTB is able to protect itself against metal toxicity. Our analysis proposes that reduced Zur activity results in increased expression of zinc transport genes which could help with regulating zinc levels in MTB during in vitro macrophage infection. Interestingly, other regulators of metal content (TFs, uptake and export) were recently found to be required for in vitro intracellular growth by high‐content imaging of an MTB transposon mutant library (Barczak et al, 2017). Leveraging our Path‐seq data, we developed a systems‐level approach that recapitulates known in vitro intracellular regulatory networks and prioritizes others for further experimental testing.

We also applied the same analysis to the in vivo expression data (using differentially expressed genes in Dataset EV1) to identify transcriptional networks involved in MTBs response within AMs. Interestingly, we observed very few networks that were active in both infection models. Only Rv0691c was highly ranked at 24 h from both AMs and BMDMs (Fig 3E). In our regulatory network, Rv0691c has ~50 target genes, a subset of which are up‐ and down‐regulated during in vitro and in vivo infection. The genes in the regulon do not categorize into a certain pathway, but our unbiased analysis suggests the Rv0691c regulon deserves further study for its role in establishing MTB infection both in vitro and in vivo. Overall, there were far fewer active networks identified in vivo, compared to the in vitro infection. While the type of differentially expressed genes (i.e., genes not belonging to regulons) could contribute to such differences, we do not see that being the case. Therefore, it is appealing to speculate that the more permissive environment within AMs or a greater heterogeneity of infection from the in vivo model could contribute to the differences in the number of active regulatory networks identified by NetSurgeon.

Identification of EGRIN module relevant to infection and desA1/desA2 transcriptional regulator, Rv0472c

Our systems analysis revealed novel and infection‐specific regulatory networks. However, none of the identified regulons included the mycolic acid biosynthesis genes up‐regulated in vivo, and particularly umaA and desA1/desA2 that were up‐regulated in both infection models. One plausible explanation could be the regulon size threshold that was implemented to reduce false positives (TFs with at least five targets were considered in this analysis). Therefore, we used an orthogonal network approach to discover regulatory mechanisms controlling the expression of these genes that could be important for mycolic acid remodeling during infection. Specifically, we used the environment and gene regulatory influence network (EGRIN) model of MTB that was previously published and demonstrated to accurately predict regulatory interactions through validation with the DNA binding sites and transcriptional targets from overexpressing > 150 MTB transcription factors (TFs; Peterson et al, 2015; Turkarslan et al, 2015). The full description of the algorithms used to construct the EGRIN model is beyond the scope of this work; readers are encouraged to refer to the original paper for more detail (Reiss et al, 2006). Briefly, the EGRIN model was constructed through semi‐supervised biclustering of a compendium of 2,325 transcriptomes assayed during MTB response to diverse environmental challenges, guided by biologically informative priors and de novo cis‐regulatory GRE detection for module (also referred to as bicluster) assignment. Overall, the EGRIN model is sufficiently predictive to formulate hypotheses of MTB regulatory interactions that respond to various environmental conditions, including new conditions not represented in the gene expression compendium such as in vivo infection. Using the EGRIN model, we identified significant enrichment (multiple hypothesis‐corrected P‐value = 4.9 × 10−9) of the in vivo up‐regulated mycolic acid biosynthesis genes in bicluster 276 and with predicted regulation by the TF, Rv0472c (Fig 4A). Bicluster 276 contains the desaturases, desA1/desA2, and PDIM synthases, ppsD/E, all of which were up‐regulated in vivo. Furthermore, bicluster 276 contains the toxin–antitoxin system, vapB/C47, which was also significantly up‐regulated in vivo (with log2 fold change of 3.5 and 3.0, respectively). The PDIM biosynthesis and transport genes, fad26, drrABC, and papA5, are additional gene members of module 276. Interestingly, all of the PDIM‐related genes of module 276 genes (ppsD/E, drrABC, papA5) were identified in a high‐content imaging analysis of bacterial mutants during macrophage infection (Barczak et al, 2017). More specifically, they found mutants of these genes impaired intracellular survival and reduced type I interferon (IFN) response in host cells (Barczak et al, 2017). Although the detrimental versus beneficial relevance of type I IFN in MTB infection remains a matter of active debate, growing evidence suggests type I IFN promotes bacterial expansion and pathogenesis within host cells (Moreira‐Teixeira et al, 2018). As such, we presume module 276 genes are up‐regulated upon in vivo infection to collectively alter cell wall composition and modulate the immune system, thereby promoting MTB survival and proliferation within AMs.

Figure 4. EGRIN model predicts module 276 relevant to in vivo infection and regulation of desA1 and desA2 by Rv0472c (MSMEG_0916).

Figure 4

  1. EGRIN model of MTB predicts a module enriched with lipid metabolism genes from Path‐seq data of in vivo infection. Overexpression data confirm the regulation of desA1 and desA2 by Rv0472c in both MTB and MSM. Graphic representation of linkages between module 276 genes, regulatory influences, functional associations, cell wall modifications, and homology to MSM.
  2. Plot of read pile‐ups from MSM with inducible overexpression of MSMEG_0916 shows ChIP binding in the promoters of desA1 and desA2.
  3. Boxplots representing RPKM values from RNA‐seq of MSM with inducible overexpression of MSMEG_0916. Significant log2 fold change (FC) between uninduced (−ATc) and induced (+ATc) samples for MSMEG_0916 (log2 FC = 4.99), desA1 (log2 FC = −1.32), and desA2 (log2 FC = −1.8) with multiple hypothesis‐adjusted P‐values < 0.0001 as calculated with DuffyNGS (see Materials and Methods). Data are from three biological samples (induced) and nine biological samples (uninduced). The boxes show the median and first/third quartiles of the log2 FC values; the whiskers extend to the smallest/largest values that are no further than 1.5 times the inter‐quartile range.

The EGRIN model predicted regulation of module 276 by a TetR‐type TF, Rv0472c, with homologs across all mycobacteria, including M. leprae (Balhana et al, 2015). When overexpressed in MTB, Rv0472c led to significant repression of 15 genes, but only desA1 and desA2 had significant binding of Rv0472c in their promoter region from ChIP‐seq analysis (Minch et al, 2014; Data ref: Minch et al, 2015). Given the conservation of Rv0472c across mycobacteria, we hypothesized that overexpression of the MSM homolog should also repress the desaturases in MSM (Fig 4A). We cloned MSMEG_0916 into an anhydrotetracycline (ATc)‐inducible Gateway shuttle vector as previously described for MTB (Galagan et al, 2013; Data ref: Minch et al, 2015) and transformed into MSM. We induced expression of MSMEG_0916 for 4 h and harvested chromatin samples for ChIP‐seq as well as RNA for transcriptional profiling by RNA‐seq. Overexpression of MSMEG_0916 resulted in nine significant ChIP peaks (P‐value < 0.01) with a peak score higher than 0.7, as analyzed by DuffyNGS ChIP peak calling method (see Methods). Among these were peaks located in the promoter of the MSM desA1 and desA2 (Fig 4B). Additionally, MSMEG_0916 overexpression resulted in significant repression of desA1 and desA2, with a log2 fold change of −1.32 and −1.72, respectively, compared to uninduced (Fig 4C). The DNA consensus motifs, generated using MEME and DNA binding data from ChIP‐seq, also had significant alignment between Rv0472c and MSMEG_0916 (Appendix Fig S5).

This analysis demonstrates the utility of EGRIN to identify the regulator of genes relevant to infection. Yet, the Rv0472c and MSMEG_0916 overexpression data support the direct regulation of only desA1/desA2, among bicluster 276 genes. It is worth noting that EGRIN biclusters can be overlapping sets of co‐regulated genes that, in some cases, group together genes from different regulons and, in other cases, subdivide genes of the same regulon, or even the same operon. This conditional modularity captures complex gene regulatory programs for combinatorial control for thousands of genes by few hundred TFs. While a significant number of bicluster 276 genes are up‐regulated during in vivo infection, not all of the genes are necessarily regulated by the same TF. As such, bicluster 276 represents a coordination of regulatory mechanisms that bring together functionally related genes. These genes, involved in biosynthesis/transport of PDIM and desaturation of mycolic acids, act together to alter cell wall composition, thereby affecting cell wall permeability and host responses during in vivo infection.

Inducible overexpression of MSMEG_0916 or Rv0472c causes loss of mycobacterial viability and reduction in mycolate biosynthesis

Motivated by our identification of Rv0472c and MSMEG_0916 as controlling the expression of desA1 and desA2, we hypothesized that overexpression‐mediated repression of the desaturases should have phenotypes similar to the desA1 knockout that was previously characterized (Singh et al, 2016). We tested the viability of the TF overexpression strains by spotting serial 10‐fold dilutions of cultures on agar plates with or without ATc. Plates with MTB and Rv0472c overexpression strain were incubated for 3 weeks, and growth patterns indicated that the presence of ATc resulted in a 4‐log fold reduction in CFU counts (Fig 5A). In comparison, plates containing the parental MTB strain showed no change in CFUs with the presence or absence of ATc (Fig 5A). Similar experiments were done in Mycobacterium bovis BCG (BCG) and MSM with Rv0472c and MSMEG_0916 overexpression, respectively. Overexpression resulted in 3‐log viability reduction in BCG (Appendix Fig S6A) and 2‐log viability reduction in MSM (Appendix Fig S6B). We also observed very limited growth in broth culture when MSMEG_0916 was induced with ATc (Appendix Fig S7).

Figure 5. Cell viability and mycolic acid characterization.

Figure 5

  1. Serial 10‐fold dilutions of MTB H37Rv wild type (wt) and MTB with inducible overexpression of Rv0472c were spotted on 7H10 agar plates with or without ATc.
  2. Argentation TLC of 14C‐labeled methyl esters of mycolic acids (MAMEs) obtained from apolar lipids and delipidated cell wall fractions of MSM wt and MSM with inducible overexpression of MSMEG_0916. The α, αʹ, epoxy (e), and cyclopropanated α‐ (X1) MAMEs species are labeled. Faster‐migrating species that co‐migrated with α‐MAMEs and accumulate with induced MSMEG_0916 overexpression are indicated as X2 and X3.
  3. BCG wt and BCG with inducible overexpression of Rv0472c cultures, labeled with 14C‐acetate, were induced (+ATc) or uninduced (−ATc) for 4 h or 8 h. The total FAMEs and MAMEs were extracted and analyzed by autoradiography–TLC using equal counts (15,000 cpm) for each lane.

Overexpression of the conserved TF resulted in a loss of mycobacterial viability, due to repression of desA1 and desA2 and ensuing decrease in mycolic acid biosynthesis. Conditional depletion of DesA1 in MSM leads to an intermediate decrease in desaturation prior to complete loss of mycolic acids (Singh et al, 2016). To test for a decrease in mycolic acid biosynthesis, we labeled cultures of MSMEG_0916 overexpression strain with 14C acetic acid following growth in the presence or absence of ATc. Thin layer chromatography (TLC) analysis of apolar lipids demonstrated that overexpression of MSMEG_0916 reduced the levels of trehalose dimycolates (TDMs; Appendix Fig S8). We also analyzed methyl esters of mycolic acids (MAMEs) obtained from apolar lipids using 2D‐argentation TLC analysis, designed to separate each subclass of mycolic acid based on saturation levels. MAME analysis revealed an accumulation of products that migrate identically to our previous observation with DesA1 depletion (Singh et al, 2016) (Fig 5B) and most likely correspond to mono‐unsaturated mycolates. Similarly, 1D TLC separation of fatty acid methyl esters (FAMEs) and MAMEs from apolar lipids confirmed the general decrease in MAMEs and an accumulation of FAMEs when Rv0472c is overexpressed in BCG (Fig 5C and densitometric analysis in Appendix Fig S9). This characteristic profile of total MAME inhibition and FAME accumulation mirrors what is seen with fatty acid synthase (FAS)‐II inhibitors, such as isoniazid (Vilcheze et al, 2000) and thiolactomycin (Kremer et al, 2000), and confirms the involvement of DesA1 and DesA2 in the biosynthesis of mycolic acids and more specifically with the FAS‐II system. Interestingly, in BCG there was no accumulation of mono‐unsaturated mycolates as those found in MSM upon detailed analysis of MAMEs by 2D‐argentation TLC (Appendix Fig S10A and B). This could be due to key differences in mycolate subclasses between MSM and MTB, particularly cyclopropane ring formation, which is abundant in MTB but not MSM and requires a precursory desaturation event.

Discussion

During MTB infection, the bacterium utilizes various mechanisms to ensure its own survival and persistence in the host. The intracellular context is paramount for identifying such mechanisms via observation and interpretation of gene expression changes. While hypoxia, low pH, and nutritional stress are used as proxies, they do not reproduce the spatiotemporal complexity of host‐induced stress. As such, there is no substitute for understanding the authentic intracellular context other than transcriptionally profiling pathogens directly from infected cells and tissues. The development of Path‐seq has enabled such studies and confirmed mycolic acid biosynthesis as a well‐known virulence factor (Barry et al, 1998). Mycolates, essential for mycobacterial cell wall rigidity, not only make up a lipid‐rich barrier in the mycobacterial cell envelope, they also act as potent immunomodulators, driving the pathogenesis of MTB, primarily as part of the cord factor (TDM; Marrakchi et al, 2014; Nataraj et al, 2015). Here, we present evidence that mycolate biosynthesis is tightly regulated in response to the intracellular environment. Using our novel Path‐seq method, we observed significantly induced expression of mycolic acid biosynthesis genes, umaA, pcaA, desA1, desA2, fadD32, and fabD, 24 h after MTB infection of mice. Using multiple systems‐level approaches to understand the regulatory control of these virulence genes, we validated that desA1 and desA2 are regulated by Rv0472c (MSMEG_0916) and that Rv0472c‐mediated repression leads to reduced mycolate biosynthesis and loss of mycobacterial viability. As DesA1 and DesA2 have been shown to be involved in mycolic acid biosynthesis via desaturation of the merochain, we have therefore named their transcriptional regulatory protein MadR (for mycolic acid desaturase regulator).

Not much is known about the regulation of mycolic acid biosynthesis apart from two transcription factors shown to regulate distinct operons, both containing genes encoding core FAS‐II proteins (Salzman et al, 2010; Jamet et al, 2015). Studying the regulatory alterations to mycolate subclasses remains an even greater challenge, especially during infection. Our studies show that MadR is involved in the in vivo and in vitro regulation of desA1 and desA2, coding for enzymes involved in mycolic acid desaturation (Singh et al, 2016). The introduction of double bonds in the mycolate merochain precedes cyclopropanation and other merochain modifications that are critical for pathogenic mycobacteria (Glickman et al, 2000; Rao et al, 2005, 2006; Barkan et al, 2012). Loss of cyclopropanation can lead to hyperinflammatory responses and attenuated infection. As the introduction of double bonds in the merochain is required for subsequent cyclopropanation and other merochain modifications, DesA1 and DesA2 could be drivers of both mycolic acid biosynthesis and composition during infection. In other words, MadR‐driven regulation not only leads to lower mycolate levels during dormancy, a state when new cell wall material is not synthesized, but also altered cyclopropane ring formation by varying desaturation levels, thus affecting virulence and persistence.

Surprisingly, we observed early (2 h post‐infection) induced expression of desA1 and desA2 during MTB infection of BMDMs, followed by return to basal levels by 8 h. This is consistent with the reported increased production of TDM within the first 30 min after in vitro phagocytosis (Fischer et al, 2001) and suggests that the desaturases play a role in cell wall modifications that occur in response to intracellular cues. However, the presence of these intracellular cues appears to be different in AMs from infected mice. The overall disparity in the transcriptional profile of MTB from BMDMs and AMs is both intriguing and disturbing. The active MTB networks we identified from BMDMs imply the presence of early and sustained bacterial stress. However, the induction of these stress‐related networks is absent in the transcriptomes of MTB from AMs, suggesting the bacteria are not experiencing the same type or amount of stimuli in AMs. These data support recent observations using fluorescent MTB reporter strains, demonstrating that bacilli in AMs exhibit lower stress and higher bacterial replication than those in interstitial macrophages (Huang et al, 2018). Similarly, we hypothesize that MTB responds divergently to macrophages of different lineages and that AMs present fewer stresses and possibly a more permissive environment compared to BMDMs. It is also worth mentioning that the data raise some concerns with respect to the use of BMDMs as an appropriate infection model.

Our data lead us to propose a model for MadR regulation of desA1 and desA2 transcription as summarized in Fig 6. Under normal growth conditions, MadR exists in equilibrium between the free and DNA‐bound forms, thus maintaining basal levels of desA1 and desA2 transcripts. Upon macrophage infection and early hypoxia, equilibrium favors unbound MadR which derepresses desA1 and desA2 transcription and increases mRNA levels. As infection progresses and reaches later stages of hypoxia, MadR has increased binding affinity in the promoters of desA1 and desA2 and represses their transcription to below basal levels. Ultimately, the MadR regulatory system enables mycobacteria to efficiently alter mycolate biosynthesis and composition in response to environmental signals. We suspect the early response to infection (desA1 and desA2 up‐regulation) increases desaturation events and allows MTB to fine‐tune cyclopropanation and other merochain modifications that contribute to the establishment of infection. However, mycolate biosynthesis is energetically expensive and MadR‐mediated repression occurs in later stages of infection. The reduction in mycolate biosynthesis allows MTB to enter dormancy and facilitates long‐term persistence.

Figure 6. Model of MadR regulation of mycolic acid desaturases.

Figure 6

Under normal growth conditions, MadR exists in equilibrium between the free and DNA‐bound forms, and a basal level of desA1 and desA2 expression is maintained. DesA1 and DesA2 act with other enzymes of the fatty acid synthase‐II (FAS‐II) complex to produce mycolic acids for new cell wall. Infection of macrophages and early stress cues shifts the equilibrium toward the free form of MadR, and the repression of desA1 and desA2 is released. The desaturase protein levels increase, introducing double bonds that allow cyclopropanation and other modifications to alter the cell wall. These changes enable the bacteria to withstand intracellular stresses and establish infection. As infection continues and stress is sustained, MadR binds tightly to the promoter of desA1 and desA2, leading to stringent repression of the desaturases. MadR‐mediated repression of desA1 and desA2 leads to irregular fatty acids of medium length and the pausing of mycolic acid biosynthesis to enter into dormancy. The DNA‐bound form of MadR is shown in complex with a yet unknown co‐factor that leads to repression of the desaturases.

The question remains how MadR is able to differentially bind to DNA in response to environmental changes. In mycobacteria, other TFs regulating mycolate biosynthesis are modulated by long‐chain acyl‐CoAs (Biswas et al, 2013; Mondino et al, 2013; Tsai et al, 2017), proposing a role for these molecules in the modulation of MadR as well. Similarly, a MadR homolog in Pseudomonas aeruginosa, DesT, was shown to have enhanced DNA binding in the presence of unsaturated acyl‐CoAs (Zhang et al, 2007). These studies support the notion that a select acyl‐CoA ligand may control MadR DNA binding affinity (as shown in Fig 6) and thus the expression of desA1 and desA2.

The characterization of the MadR regulon provides valuable insight for understanding the evolution of MTB. While we have shown the regulation by MadR is conserved from MSM to MTB, our results also suggest the fatty acid desaturation events and resulting mycolate subclasses and surface lipids have evolved, specializing for bacterial survival in the host environment. These findings propose mycobacterial evolution from saprophyte to pathogen has occurred through the adaptation of ancestral genes and regulatory networks to function in the host environment. Ultimately, this study demonstrates the in vivo significance of the desaturases and their regulation by MadR. We believe the Path‐seq method, described and employed here, offers a sensitive and tractable approach to elucidate the molecular mechanisms used by MTB during host infection, potentially at the single‐cell level. Our detailed characterization of one such mechanism has revealed that modulation of MadR activity can affect cell wall composition as well as mycobacterial viability. Accordingly, we have established Path‐seq as a powerful tool for uncovering the minimally studied in vivo biology of this pathogen and revealed the essentiality of MadR encoded program for cell wall remodeling and biosynthesis. As such, we present MadR as a new and important antitubercular target.

Materials and Methods

Reagents and Tools table

Reagent/Resource Reference or Source Identifier or Catalog Number
Experimental Models
H37Rv (M. tuberculosis) D. Sherman lab N/A
mc2155 (M. smegmatis) A. Bhatt lab N/A
BCG Pasteur (M. bovis) A. Bhatt lab N/A
C57BL/6J (M. musculus) Jackson Lab B6.129P2Gpr37tm1Dgen/J
Recombinant DNA
pDTCF‐Msmeg0916 (M. smegmatis) This study N/A
pDTCF‐Rv0472c (M. tuberculosis) D. Sherman lab, Minch et al (Data ref: Minch et al, 2015) N/A
pMV306‐eGFP‐Zeo L. Kremer lab, Bernut et al (2016) N/A
Antibodies
M2 anti‐FLAG Sigma F1804
Rat anti‐mouse CD16/32 (clone 2.4G2) BD Pharmingen 553142
Mouse anti‐Siglec F (clone E50‐2440) BD Pharmingen 552125
Mouse anti‐CD11b (clone M1/70) BioLegend 101201
Mouse anti‐CD64 (clone X54‐5/7.1) BioLegend 139321
Mouse anti‐CD45.2 (clone 104) BioLegend 109815
Mouse anti‐CD3 (clone 17A2) eBioscience 14‐0032‐81
Mouse anti‐CD19 (clone 1D3) eBioscience 11‐0193‐81
Oligonucleotides and sequence‐based reagents
Cloning primers This study see Methods and Protocols
Chemicals, enzymes and other reagents
Zombie Violet dye BioLegend 423113
TRIzol Invitrogen 15596026
RPMI Medium (1640) Gibco 11875093
Anhydrotetracyline Sigma‐Aldrich 37919
Hygromycin B Invitrogen 10687010
Protease inhibitor cocktail Sigma‐Aldrich P2714
Middlebrook OADC enrichment BD Difco 212351
Middlebrook ADC enrichment BD Difco 212352
Middlebrook 7H10 agar BD Difco 262710
Middlebrook 7H9 broth BD Difco 271310
Petroleum Ether 60–80°C Fisher Chemicals P/1480/17
Chloroform, 99.8+% Fisher Chemicals C/4960/17
Methanol, AR Fisher Chemicals M/4000/17
Sodium chloride Fisher Chemicals S/3160/65
Tetrabutylammonium hydroxide solution 40 wt. % in H2O Sigma‐Aldrich 178780
Dichloromethane, 99+% Fisher Chemicals D/1850/17
Iodomethane (stabilised with silver) for synthesis Merck 806064
Diethyl ether, AR Fisher Chemicals D/2450/17
TLC Silicagel 60 F₂₅₄ Merck 1055540001
Acetone, AR Fisher Chemicals A/0600/17
Silver nitrate, Ultrapure Grade, 99.5% Acros Organics 419361000
Acetic Acid, Sodium Salt, [1‐14C]‐, 1mCi (37MBq) PerkinElmer NEC084H001MC
Kodak® BioMax® MR film Sigma‐Aldrich Z353949‐50EA
Software
DuffyNGS Vignali et al (2011) http://networks.systemsbiology.net/mtb/
NetSurgeon Michael et al (2016) http://mblab.wustl.edu/software.html
DESeq2 Love et al (2014) https://github.com/mikelove/DESeq2
Adobe Photoshop CC 2015 https://www.adobe.com
Other
Direct‐zol RNA MicroPrep kit Zymol Research R2060
Dynabeads M‐270 Streptavidin Invitrogen 65306
Lysing Matrix B tubes MP Biomedicals MP116911050
SureSelectXT strand‐specific RNA kit Agilent 5190‐6410
SureSelectXT target enrichment kit Agilent 5190‐4393
Probe library M_tub_h37rv_ASM19595v2_32_1 Agilent This study, ELID number 3037441
TruSeq stranded mRNA library prep kit Illumina RS‐122‐2103
Ribo‐Zero magentic kit bacteria Illumina MRZB12424
Ribo‐Zero magentic kit epidemiology Illumina MRZE724
NextSeq 500/550 High output kit Illumina FC‐404‐2002
SMARTer ThruPLEX DNA‐seq kit Takara R400523
Illumina NextSeq 500 Illumina

Methods and Protocols

Culturing conditions

Mycobacteria strains were cultured in Middlebrook 7H9 with the ADC supplement (Difco), 0.05% Tween‐80 at 37°C under aerobic conditions with constant agitation. Strains containing the anhydrotetracycline (ATc)‐inducible expression vector were grown with the addition of 50 μg/ml hygromycin B to maintain the plasmid. Growth was monitored by OD600 and colony‐forming units (CFUs). For experiments featuring madR overexpression strains, overexpression was induced for the approximate duration of one cell doubling (18 h for MTB and BCG, 4 h for MSM) using an ATc concentration of 100 ng/ml culture. Wild‐type and overexpression strain cultures were grown into mid‐log phase. For assessing growth on agar plates, broth cultures were adjusted to OD600 of 0.5, and serial dilutions were spotted on 7H10 containing 0.5% (v/v) glycerol and 10% (v/v) OADC plates, with or without 100 ng/ml ATc. In the case of the overexpression strain, 50 ng/ml hygromycin was added to the solid medium. For growth in broth, MSM mid‐logarithmic phase cultures containing the integrative vector pMV306‐eGFP‐Zeo (Bernut et al, 2016) were inoculated in an initial OD600 0.05 in 200 μl of 7H9 supplement with 0.2% (v/v) glycerol, 0.05% (v/v) Tween‐80, and 10% (v/v) OADC with or without 100 ng/ml ATc in sealed 96‐well Costar 3603 black‐sided clear‐bottomed plate incubated at 37°C. Fluorescence was acquired every 30 min for 30 h at 37°C, in a PHERAstar FS microtiter plate reader (BMG Labtech), using 485 nm and 520 nm as excitation and emission wavelengths, respectively. When growing BCG or MSM for lipid extraction, cultures were cultured up to OD600 0.5. Then, they were induced with 100 ng/ml ATc (Sigma‐Aldrich) final concentration and labeled with acetic acid [1–14C] 1 mCi/ml (PerkinElmer), if hot lipid analysis was going to be performed. MSM samples were collected the following day, while BCG cultures at 4 and 8 hours post‐induction.

Strains

To investigate the growth properties of MadR overexpression, we used strains containing an ATc‐ inducible expression vector of the gene, as described previously (Galagan et al, 2013; Jaini et al, 2014; Rustad et al, 2014; Data ref: Minch et al, 2015). The pDTCF‐Rv0472c (kind gift of David Sherman) was transformed into M. bovis BCG and M. tuberculosis H37Rv for viability and mycolic acid characterization. Mycobacterium tuberculosis H37Rv (kind gift of David Sherman) was also used for Path‐seq experiments. For MadR overexpression in M. smegmatis (MSMEG_0916), we created entry clones through PCR amplification of the gene template from mc2155 gDNA, adding the necessary Gateway recombination sequences to the PCR product, as described in Minch et al (Data ref: Minch et al, 2015). The primers used for the Gateway entry cloning pDONR221 vector are 5′‐GGGGACAAGTTTGTACAAAAAAGCAGGCTCTGTGGCACAGCAGACTCCACCG‐3′ (forward) and 5′‐GGGGACCACTTTGTACAAGAAAGCTGGGTCGTCAAGCAGGTGCCGCGGCGG‐3′ (reverse). We inserted the gene into the same E. coli‐mycobacterial episomal shuttle vector (pDTCF) modified as described in Minch et al (Data ref: Minch et al 2015). The pDTCF‐MSMEG0916 plasmid was transformed into M. smegmatis mc2155.

Mice

C57BL/6 mice were purchased from the Jackson Laboratory. All mice were housed and bred under specific pathogen‐free conditions at Seattle Children's Research Institute (SCRI). All experimental protocols involving animals were approved by the Institutional Animal Care and Use Committee of (SCRI).

Aerosol infection

A mid‐log‐phase stock of MTB H37Rv was used to infect mice in an aerosol infection chamber (Glas‐Col). Bacterial load in the lungs was determined by plating serial dilutions from homogenized lungs.

Cell isolation, analysis, and sorting

  1. Bronchoalveolar lavage was performed by first exposing the trachea of euthanized mice.

  2. The exposed trachea was punctured using Vannas Micro Scissors (VWR), and 1 ml PBS was injected using a 20G‐1” IV catheter (McKesson) connected to a 1‐ml syringe.

  3. The PBS was flushed into the lung and aspirated three times, and the recovered fluid was placed in a 15‐ml tube on ice.

  4. The 1 ml PBS wash was then repeated three additional times for a total of 4 ml recovered fluid.

  5. Cells were filtered, spun down, and resuspended in a 96‐well plate for antibody staining.

  6. Cells were suspended in 1X PBS (pH 7.4) containing 0.01% NaN3 and 1% fetal bovine serum (i.e., FACS buffer).

Fc receptors were blocked with anti‐CD16/32 (2.4G2, BD Pharmingen). Cell viability was assessed using Zombie Violet dye (BioLegend). Surface staining included antibodies specific for murine Siglec F (E50‐2440, BD Pharmingen), CD11b (M1/70, BioLegend), CD64 (X54‐5/7.1, BioLegend), CD45 (104, BioLegend), CD3 (17A2, eBiosciences), and CD19 (1D3, eBiosciences). Cell sorting was performed on a FACSAria (BD Biosciences). Cells were collected in complete media, spun down, resuspended in TRIzol, and frozen at −80° overnight prior to RNA isolation.

BMDM infection

BMDMs were isolated from C57BL/6J mice and cultured in RPMI (RPMI containing 10% (v/v) FBS and 2 mM l‐glutamine) with recombinant human CSF‐1 (50 ng/ml) for 6 days and then replated. BMDMs were infected on Day 7 with MTB H37Rv strain (MOI 10), followed by washing 3× with RPMI at 2 h post‐infection, and fresh media was added. BMDMs were lysed with TRIzol (Invitrogen), and total RNA was isolated from mixed host–pathogen sample. The same MTB H37Rv cultures used for BMDM infection were also diluted to starting OD600 = 0.1 and grown in 7H9.

Hypoxia time course

An Oxygen Sensor Spot (PreSens, Regensburg, Germany) was adhered within a 1‐l disposable spinner flask with two side arms (Corning, Corning, NY). A velcro belt with a screw‐on port for the fiber optic cable was wrapped around the flask. A gas line input was fastened on one arm of the flask, and a Luer‐Lock/filter sampling port was connected to the other arm. Air and N2 gas lines were run into the Biological Safety Laboratory and connected to gas‐specific mass flow controllers (Alicat, Tucson, AZ), whose outputs were connected downstream through a Y‐connector that led into an incubator. Three separate flasks, all prepared as described above, were placed onto a stir plate inside an incubator at 37°C. The mixed gas line was split via additional Y‐connectors, streamed through 0.2‐μm filters, and attached to the gas line inputs of each flask. Media was incubated overnight and checked for contamination before inoculated with MTB.

The mass flow controllers and oxygen sensor were linked to a computer and remotely controlled and monitored in real time. After inoculation of 700 ml 7H9 media with MTB H37Rv at starting OD600 of 0.01, we programmed the mass flow controllers to achieve a changing gas mixture gradient, which allowed us creating a steady 2‐day depletion, followed by 2 days of sustained hypoxia, and reaeration by flowing pure air into the headspace of the vessels and increasing the speed of the stir bars in each vessel. Samples were collected by attaching a Luer‐Lock syringe to the sampling port. Samples were centrifuged at high speed for 5 min, supernatant was discarded, and cell pellet was immediately flash frozen in liquid nitrogen.

RNA isolation

Cell pellets in TRIzol were transferred to a tube containing Lysing Matrix B (MP Biomedicals) and vigorously shaken at max speed for 30 s in a FastPrep 120 Homogenizer (QBiogene) three times. This mixture was centrifuged at max speed for 1 min, and the supernatant was transferred to a fresh tube. RNA from extracellular MTB samples, BMDM infection, hypoxia time course, and madR overexpression was isolated using the Direct‐zol RNA MicroPrep Kit (Zymol Research) according to manufacturer's instruction with on‐column DNase treatment.

RNA from mice infection was isolated by the following method:

  • 200 μl chloroform was added to 1 ml of TRIzol.

  • Samples were inverted and incubated for 2–3 min, and the upper aqueous phase was collected.

  • A second chloroform extraction was done, followed by addition of 1 μl glycogen and 500 μl isopropanol.

  • Samples were incubated with isopropanol for 10 m at room temperature and centrifuged, and supernatant was discarded.

  • Pellet was washed with 1 ml 70% ethanol twice.

  • All ethanol was removed, the pellet dried (15 m), and resuspended in 12 μl RNase‐free water.

For all RNA samples, total RNA yield was quantified by NanoDrop (Thermo Scientific) and quality was analyzed in a 2100 Bioanalyzer system (Agilent Technologies). Following DNase treatment, total RNA samples were depleted of ribosomal RNA using the Ribo‐Zero Gold rRNA Removal Kit “epidemiology” (Illumina).

Probe design

Non‐overlapping head‐to‐tail 120‐nucleotide probes were designed using the Array software (Agilent Technologies). A total of 35,624 probes were designed to cover 3,924 M. tuberculosis H37Rv ORFs (Agilent probe library M_tub_h37rv_ASM19595v2_32_1, ELID number 3037441). Using Megablast, it was verified that all genes of MTB were matched by at least one probe and that only a negligible fraction of the probes could be mapped on the mouse and human cDNA sequences from Ensembl.

Preparation of libraries for transcriptional sequencing

RNA libraries for Path‐seq were prepared using the SureSelectXT strand‐specific RNA target enrichment for Illumina multiplexed sequencing. RNA libraries for RNA‐seq were prepared using the SureSelectXT strand‐specific RNA kit, but were not hybridized to probes and indexed separately.

Briefly, the protocol followed was as follows:

  • RNA from rRNA‐depleted samples was enzymatically fragmented, and double‐stranded cDNA was produced with adapters ligated to both ends.

  • The library was then amplified using provided primers which hybridize to the previously inserted adapters, therefore allowing a linear amplification to all transcripts present in the sample. In the case of non‐enriched RNA‐seq samples, sample indexes were also inserted during this PCR.

  • For Path‐seq libraries, double‐stranded cDNA ligated to adapters was also amplified and then incubated at 65°C for 24 h with the set of biotinylated oligonucleotides specifically designed to capture MTB transcripts, as described above.

  • The hybridized sequences were captured with magnetic streptavidin beads (M‐270, Invitrogen).

  • They were next linearly amplified using provided primers and indexed during PCR.

Before sequencing, libraries were assessed for quality and fragment size by Bioanalyzer and with a Qubit Fluorometer (Invitrogen) to determine cDNA concentration. Resulting libraries were sequenced on the Illumina NextSeq Instrument using mid output 150 v2 reagents. Paired‐end 75 bp reads were processed following Illumina default quality filtering steps.

Transcription abundance from sequencing data

Raw FASTQ read data were processed using the R package DuffyNGS as described previously (Vignali et al, 2011). Briefly, raw reads pass through a 3‐stage alignment pipeline: (i) a prealignment stage to filter out unwanted transcripts, such as rRNA, mitochondrial RNA, albumin, and globin; (ii) a main genomic alignment stage against the genome(s) of interest; and (iii) a splice junction alignment stage against an index of standard and alternative exon splice junctions. Reads from samples of mixed host–pathogen RNA and extracellular MTB controls were aligned to a combined M. tuberculosis H37Rv (ASM19595v2) and Mus Musculus (GRCm38.p6) genome. Reads from samples of MSM RNA were aligned to M. smegmatis mc2155 genome (ASM1500v1). All alignments were performed with Bowtie 2 (Langmead & Salzberg, 2012), using the command line option “very‐sensitive”. BAM files from stages 2 and 3 are combined into read depth wiggle tracks that record both uniquely mapped and multiply mapped reads to each of the forward and reverse strands of the genome(s) at single‐nucleotide resolution. Multiply mapped reads are prorated over all highest‐quality aligned locations. Gene transcript abundance is then measured by summing total reads landing inside annotated gene boundaries, expressed as both RPKM and raw read counts. Two stringencies of gene abundance are provided using all aligned reads and by just counting uniquely aligned reads.

Differential expression

For both infection models (in vitro and in vivo), we used DESeq2 (Love et al, 2014) to identify gene expression changes between intracellular and extracellular MTB at each sampled time point. We used rounded raw read counts estimated by DuffyNGS (as described above) as input for DESeq2. Genes with absolute log2 fold change bigger than one and multiple hypothesis‐adjusted P‐value below 0.01 and 0.05, for the in vitro and in vivo data, respectively, were considered differentially expressed. For the in vivo samples, only genes with non‐zero counts in any of the replicates were considered in DESeq2.

For Msmeg0916 overexpression, we used a panel of 5 DE tools to identify gene expression changes between induced (+ATc) and uninduced (−ATc). The tools included (i) RoundRobin (in‐house); (ii) RankProduct (Breitling et al, 2004); (iii) significance analysis of microarrays (SAM) (Tusher et al, 2001); (iv) EdgeR (Robinson & Smyth, 2008); and (v) DESeq2 (Love et al, 2014). Each DE tool was called with appropriate default parameters and operated on the same set of transcription results, using RPKM abundance units for RoundRobin, RankProduct, and SAM and raw read count abundance units for DESeq2 and EdgeR. All 5 DE results were then synthesized, by combining gene DE rank positions across all 5 DE tools. Specifically, a gene's rank position in all 5 results was averaged, using a generalized mean to the 1/2 power, to yield the gene's final net rank position. Each DE tool's explicit measurements of differential expression (fold change) and significance (P‐value) were similarly combined via appropriate averaging (arithmetic and geometric mean, respectively). Genes with averaged absolute log2 fold change bigger than one and multiple hypothesis‐adjusted P‐value below 0.01 were considered differentially expressed.

MTB signed transcriptional network

We compiled a signed (stating the positive or negative nature of each TF–gene interaction) wiring diagram of MTB transcriptional regulatory network. The compiled MTB network included 4,635 TF–gene interactions (2,296 and 2,339 instances of activation and repression, respectively) with both physical (detected with ChIP‐seq experiments) and functional evidence (detected with transcriptional profiling). The compiled network contained 2,001 genes and 136 TFs with at least one target. The initial ChIP‐seq derived MTB network consisted of 6,581 interactions occurring in the −150 bp to +70 bp region of genes’ promoter reported by Minch et al (Data ref: Minch et al 2015). We expanded that MTB ChIP‐seq network by taking into account operon organizations. For a given TF–gene interaction, if the target gene is part of an operon, we included all other members of the operon as potential targets of the corresponding TF. The expanded MTB ChIP‐seq network contained 12,188 interactions. Finally, we filtered out interactions that did not change at least 20% in the relevant TF‐overexpressing strain (compared to the WT strain). Up‐regulation of the target gene in the TF‐overexpressing strain was interpreted as positive interaction (the opposite for down‐regulation).

Identification of transcription factors with differential activity in intracellular MTB (using NetSurgeon)

We identified potential TFs with increased or decreased regulatory activity in intracellular MTB (respect to extracellular controls) at each sampled time point using the method recently developed by Michael et al (2016) called the NetSurgeon algorithm. Briefly, NetSurgeon identifies TFs whose differential regulatory activity is likely responsible for the observed transcriptional changes between two states of interest. In our case, we wanted to identify TFs that drive differential expression between intracellular MTB and their controls. Changes in TF activities are estimated based on the expression of their target genes (derived from DESeq2 output). TF regulons are extracted from a signed transcriptional regulatory network specified by the user. The signed MTB transcriptional network model used in this study is described above (and available at: http://networks.systemsbiology.net/mtb). NetSurgeon's scoring is based on the hypergeometric test distribution (Michael et al, 2016). Three important NetSurgeon's considerations are as follows: (i) Increase and decrease in TF activity are independently scored; (ii) only target genes differentially expressed (according to user's defined P‐values, q‐values, and fold change cutoffs) in the proper direction impact TF scores. This means that in case of increased activity, only genes significantly down‐regulated and up‐regulated will contribute to the score of their repressors and activators, respectively; and (iii) TF scores are defined not only by the number of target genes that are differentially expressed in the correct direction, but also by their adjusted P‐values (associated with the differential expression analysis performed with DESeq2). The weight of each gene in the scores of its transcriptional regulators is proportional to the –log2 of its adjusted P‐value. Thus, NetSurgeon's score is not homogeneous distributed among TFs’ targets but it is affected by the differential expression significance of each gene. To reduce false positives (i.e., misleading presence of TFs with small number of known targets at the top of our TF scores ranking) due to overlap between regulons, only TFs with at least five targets were considered in this analysis. Furthermore, we considered TFs in the top 15 of NetSurgeon's score ranking as the ones with differential activity. This threshold was selected based on the NetSurgeon's results when we compared susceptible and antibiotic resistance Escherichia coli transcriptomes. Among the top 15 TFs, we were able to recall TFs known to be involved in multidrug resistance (such as MarA and homolog Rob, Ruiz & Levy, 2010). TFs with < 5 targets with differential expression or with contradicting trends (similar number of activated and repressed targets moving in the same direction) were excluded from the NetSurgeon's top 15 ranking. For the in vivo and 8 h in vitro data, the next two TFs outside the top 15 ranking were included to compensate for multiple TFs that were filtered out.

ChIP‐seq

The madR overexpression strain was induced for the approximate duration of one cell doubling (4 h for MSM) using an ATc concentration of 100 ng/ml culture. DNA–protein interactions were characterized as described previously (Data ref: Minch et al, 2015). Libraries were prepared using ThruPLEX DNA‐seq Kit (Takara) using standard protocol. Samples were sequenced on the Illumina 550 NextSeq instrument, generating unpaired 20–30 million 75‐bp reads per sample. Raw FASTQ read data were processed using the R package DuffyNGS as described previously (Vignali et al, 2011). For consensus motif determination, we searched for conserved DNA sequences within ± 50 nucleotides of high‐quality (score > 0.7) ChIP‐seq peak centers using MEME (Bailey & Elkan, 1994).

Measuring viability of madR overexpression strains

Wild‐type and madR overexpression strain cultures were grown into mid‐log phase. For assessing growth on agar plates, OD of the broth culture was adjusted up to 0.5, and serial dilutions were spotted in 7H10 containing 0.5% (v/v) glycerol and 10% (v/v) OADC plates, with or without 100 ng/ml ATc. In the case of the overexpression strain, 50 ng/ml hygromycin was added to the solid medium.

Extraction and analysis of total lipids and mycolic acids

Lipids were extracted from BCG and MSM cells in three fractions as describes by Dobson et al (1985), with a few modifications. Briefly, outside apolar lipids from dried pellets were extracted with two consecutive extractions with 4 ml of petroleum ether (60–80°C) and dried. Then, inside apolar and polar lipids were extracted following Dobson protocol.

Outside, inside apolar, and polar lipid extracts, along with delipidated pellets from MSM and BCG, were subjected to alkaline hydrolysis using tetrabutylammonium hydroxide (TBAH) as previously described (Kremer et al, 2002). Aliquots (15,000 cpm) from each outside, inside apolar, and polar lipid extracts were analyzed by thin layer chromatography (TLC) utilizing Silica Gel 60 F254 plates (Merck) developed once in the solvent system CHCl3/CH3OH/H2O (60:16:2, v/v/v). However, FAME and MAME aliquots (15,000 cpm) were resolved through TLC using petroleum ether/acetone (95:5, v/v) or by two‐dimensional silver ion argentation thin layer chromatography (2D‐TLC; Kremer et al, 2002). Autoradiograms were produced after exposing Carestream® Kodak® BioMax® MR film for 3 days. To determine the intensity of TLC spots, densitometric analysis using Adobe Photoshop CC 2015 was performed.

Data availability

The datasets and computer code produced in this study are available in the following databases:

Author contributions

EJRP, RB, ACR, AA, AB, and NSB designed research; EJRP, RB, ACR, AK, MP, DM, AAA, and CC performed research; EJRP and MLA‐O performed computational analyses; EJRP, RB, ACR, MLA‐O, AB, and NSB analyzed and interpreted data; and EJRP, RB, MLA‐O, AB, and NSB wrote the paper.

Conflict of interest

The authors declare that they have no conflict of interest.

Supporting information

Appendix

Dataset EV1

Dataset EV2

Dataset EV3

Review Process File

Acknowledgements

We thank members of the Baliga, Bhatt, and Aderem laboratories for critical discussions; Albel Singh for help with graphics; and David Sherman and laboratory for providing the overexpression vectors and plasmids. Funding was provided by the National Science Foundation (1518261); Biotechnology and Biological Sciences Research Council (BB/N01314X/1); National Institute of Allergy and Infectious Diseases of the National Institutes of Health (R01AI128215, U19AI10676, U19AI135976); and MIBTP PhD Studentship to CC.

Mol Syst Biol. (2019) 15: e8584

Contributor Information

Apoorva Bhatt, Email: a.bhatt@bham.ac.uk.

Nitin S Baliga, Email: nitin.baliga@systemsbiology.org.

References

  1. Alberts B, Bray C, Lewis J, Raff M, Roberts K, Watson JD (1994) Molecular biology of the cell. New York: Garland Publishing; [Google Scholar]
  2. Amorim‐Vaz S, Tran Vdu T, Pradervand S, Pagni M, Coste AT, Sanglard D (2015) RNA enrichment method for quantitative transcriptional analysis of pathogens in vivo applied to the fungus Candida albicans . MBio 6: e00942‐15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Avraham R, Haseley N, Brown D, Penaranda C, Jijon HB, Trombetta JJ, Satija R, Shalek AK, Xavier RJ, Regev A, Hung DT (2015) Pathogen cell‐to‐cell variability drives heterogeneity in host immune responses. Cell 162: 1309–1321 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Avraham R, Haseley N, Fan A, Bloom‐Ackermann Z, Livny J, Hung DT (2016) A highly multiplexed and sensitive RNA‐seq protocol for simultaneous analysis of host and pathogen transcriptomes. Nat Protoc 11: 1477–1491 [DOI] [PubMed] [Google Scholar]
  5. Bailey TL, Elkan C (1994) Fitting a mixture model by expectation maximization to discover motifs in biopolymers. Proc Int Conf Intell Syst Mol Biol 2: 28–36 [PubMed] [Google Scholar]
  6. Balazsi G, Heath AP, Shi L, Gennaro ML (2008) The temporal response of the Mycobacterium tuberculosis gene regulatory network during growth arrest. Mol Syst Biol 4: 225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Balhana RJ, Singla A, Sikder MH, Withers M, Kendall SL (2015) Global analyses of TetR family transcriptional regulators in mycobacteria indicates conservation across species and diversity in regulated functions. BMC Genom 16: 479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Barczak AK, Avraham R, Singh S, Luo SS, Zhang WR, Bray MA, Hinman AE, Thompson M, Nietupski RM, Golas A, Montgomery P, Fitzgerald M, Smith RS, White DW, Tischler AD, Carpenter AE, Hung DT (2017) Systematic, multiparametric analysis of Mycobacterium tuberculosis intracellular infection offers insight into coordinated virulence. PLoS Pathog 13: e1006363 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Barkan D, Hedhli D, Yan HG, Huygen K, Glickman MS (2012) Mycobacterium tuberculosis lacking all mycolic acid cyclopropanation is viable but highly attenuated and hyperinflammatory in mice. Infect Immun 80: 1958–1968 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Barry CE III, Lee RE, Mdluli K, Sampson AE, Schroeder BG, Slayden RA, Yuan Y (1998) Mycolic acids: structure, biosynthesis and physiological functions. Prog Lipid Res 37: 143–179 [DOI] [PubMed] [Google Scholar]
  11. Bernut A, Viljoen A, Dupont C, Sapriel G, Blaise M, Bouchier C, Brosch R, de Chastellier C, Herrmann JL, Kremer L (2016) Insights into the smooth‐to‐rough transitioning in Mycobacterium bolletii unravels a functional Tyr residue conserved in all mycobacterial MmpL family members. Mol Microbiol 99: 866–883 [DOI] [PubMed] [Google Scholar]
  12. Biswas RK, Dutta D, Tripathi A, Feng Y, Banerjee M, Singh BN (2013) Identification and characterization of Rv0494: a fatty acid‐responsive protein of the GntR/FadR family from Mycobacterium tuberculosis. Microbiology 159: 913–923 [DOI] [PubMed] [Google Scholar]
  13. Breitling R, Armengaud P, Amtmann A, Herzyk P (2004) Rank products: a simple, yet powerful, new method to detect differentially regulated genes in replicated microarray experiments. FEBS Lett 573: 83–92 [DOI] [PubMed] [Google Scholar]
  14. Brynildsen MP, Liao JC (2009) An integrated network approach identifies the isobutanol response network of Escherichia coli . Mol Syst Biol 5: 277 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Cahan P, Li H, Morris SA, Lummertz da Rocha E, Daley GQ, Collins JJ (2014) CellNet: network biology applied to stem cell engineering. Cell 158: 903–915 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Charrad M, Ghazzali N, Boiteau V, Niknafs A (2014) NbClust: an R package for determining the relevant number of clusters in a data set. J Stat Softw 61: 1–36 [Google Scholar]
  17. Dobson G, Minnikin DE, Minnikin SM, Parlett JH, Goodfellow M, Ridell M, Magnusson M (1985) Systematic analysis of complex mycobacterial lipids In Chemical Methods in Bacterial Systematics, Goodfellow M, Minnikin DE. (eds), pp 237–265. London: Academic Press; [Google Scholar]
  18. Fischer K, Chatterjee D, Torrelles J, Brennan PJ, Kaufmann SH, Schaible UE (2001) Mycobacterial lysocardiolipin is exported from phagosomes upon cleavage of cardiolipin by a macrophage‐derived lysosomal phospholipase A2. J Immunol 167: 2187–2192 [DOI] [PubMed] [Google Scholar]
  19. Fleischmann RD, Alland D, Eisen JA, Carpenter L, White O, Peterson J, DeBoy R, Dodson R, Gwinn M, Haft D, Hickey E, Kolonay JF, Nelson WC, Umayam LA , Ermolaeva M, Salzberg SL, Delcher A, Utterback T, Weidman J , Khouri H et al (2002) Whole‐genome comparison of Mycobacterium tuberculosis clinical and laboratory strains. J Bacteriol 184: 5479–5490 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Flynn JL, Chan J, Lin PL (2011) Macrophages and control of granulomatous inflammation in tuberculosis. Mucosal Immunol 4: 271–278 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Galagan JE, Minch K, Peterson M, Lyubetskaya A, Azizi E, Sweet L, Gomes A, Rustad T, Dolganov G, Glotova I, Abeel T, Mahwinney C, Kennedy AD, Allard R, Brabant W, Krueger A, Jaini S, Honda B, Yu WH, Hickey MJ et al (2013) The Mycobacterium tuberculosis regulatory network and hypoxia. Nature 499: 178–183 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Galan JE, Wolf‐Watz H (2006) Protein delivery into eukaryotic cells by type III secretion machines. Nature 444: 567–573 [DOI] [PubMed] [Google Scholar]
  23. Glickman MS, Cox JS, Jacobs WR Jr (2000) A novel mycolic acid cyclopropane synthetase is required for cording, persistence, and virulence of Mycobacterium tuberculosis. Mol Cell 5: 717–727 [DOI] [PubMed] [Google Scholar]
  24. Graham JE, Clark‐Curtiss JE (1999) Identification of Mycobacterium tuberculosis RNAs synthesized in response to phagocytosis by human macrophages by selective capture of transcribed sequences (SCOTS). Proc Natl Acad Sci USA 96: 11554–11559 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Homolka S, Niemann S, Russell DG, Rohde KH (2010) Functional genetic diversity among Mycobacterium tuberculosis complex clinical isolates: delineation of conserved core and lineage‐specific transcriptomes during intracellular survival. PLoS Pathog 6: e1000988 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Huang da W, Sherman BT, Lempicki RA (2009a) Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res 37: 1–13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Huang da W, Sherman BT, Lempicki RA (2009b) Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 4: 44–57 [DOI] [PubMed] [Google Scholar]
  28. Huang L, Nazarova EV, Tan S, Liu Y, Russell DG (2018) Growth of Mycobacterium tuberculosis in vivo segregates with host macrophage metabolism and ontogeny. J Exp Med 215: 1135–1152 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Humphrys MS, Creasy T, Sun Y, Shetty AC, Chibucos MC, Drabek EF, Fraser CM, Farooq U, Sengamalay N, Ott S, Shou H, Bavoil PM, Mahurkar A, Myers GS (2013) Simultaneous transcriptional profiling of bacteria and their host cells. PLoS One 8: e80597 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Jaini S, Lyubetskaya A, Gomes A, Peterson M, Park ST, Raman S, Schoolnik G, Galagan J (2014) Transcription factor binding site mapping using ChIP‐Seq. Microbiol Spectr 2: doi: 10.1128/microbiolspec.MGM2-0035-2013 [DOI] [PubMed] [Google Scholar]
  31. Jamet S, Quentin Y, Coudray C, Texier P, Laval F, Daffe M, Fichant G, Cam K (2015) Evolution of mycolic acid biosynthesis genes and their regulation during starvation in mycobacterium tuberculosis. J Bacteriol 197: 3797–3811 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Kapopoulou A, Lew JM, Cole ST (2011) The MycoBrowser portal: a comprehensive and manually annotated resource for mycobacterial genomes. Tuberculosis 91: 8–13 [DOI] [PubMed] [Google Scholar]
  33. Kendall SL, Movahedzadeh F, Rison SC, Wernisch L, Parish T, Duncan K, Betts JC, Stoker NG (2004) The Mycobacterium tuberculosis dosRS two‐component system is induced by multiple stresses. Tuberculosis 84: 247–255 [DOI] [PubMed] [Google Scholar]
  34. Kendall SL, Burgess P, Balhana R, Withers M, Ten Bokum A, Lott JS, Gao C, Uhia‐Castro I, Stoker NG (2010) Cholesterol utilization in mycobacteria is controlled by two TetR‐type transcriptional regulators: kstR and kstR2. Microbiology 156: 1362–1371 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Kremer L, Douglas JD, Baulard AR, Morehouse C, Guy MR, Alland D, Dover LG, Lakey JH, Jacobs WR Jr, Brennan PJ, Minnikin DE, Besra GS (2000) Thiolactomycin and related analogues as novel anti‐mycobacterial agents targeting KasA and KasB condensing enzymes in Mycobacterium tuberculosis. J Biol Chem 275: 16857–16864 [DOI] [PubMed] [Google Scholar]
  36. Kremer L, Dover LG, Carrere S, Nampoothiri KM, Lesjean S, Brown AK, Brennan PJ, Minnikin DE, Locht C, Besra GS (2002) Mycolic acid biosynthesis and enzymic characterization of the beta‐ketoacyl‐ACP synthase A‐condensing enzyme from Mycobacterium tuberculosis. Biochem J 364: 423–430 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Kumar A, Deshane JS, Crossman DK, Bolisetty S, Yan BS, Kramnik I, Agarwal A, Steyn AJ (2008) Heme oxygenase‐1‐derived carbon monoxide induces the Mycobacterium tuberculosis dormancy regulon. J Biol Chem 283: 18032–18039 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Langmead B, Salzberg SL (2012) Fast gapped‐read alignment with Bowtie 2. Nat Methods 9: 357–359 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Love MI, Huber W, Anders S (2014) Moderated estimation of fold change and dispersion for RNA‐seq data with DESeq2. Genome Biol 15: 550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. van der Maaten L, Hinton G (2008) Visualizing data using t‐SNE. J Mach Learn Res 9: 2579–2605 [Google Scholar]
  41. Maciag A, Dainese E, Rodriguez GM, Milano A, Provvedi R, Pasca MR, Smith I, Palu G, Riccardi G, Manganelli R (2007) Global analysis of the Mycobacterium tuberculosis Zur (FurB) regulon. J Bacteriol 189: 730–740 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Marrakchi H, Laneelle MA, Daffe M (2014) Mycolic acids: structures, biosynthesis, and beyond. Chem Biol 21: 67–85 [DOI] [PubMed] [Google Scholar]
  43. Mavromatis CH, Bokil NJ, Totsika M, Kakkanat A, Schaale K, Cannistraci CV, Ryu T, Beatson SA, Ulett GC, Schembri MA, Sweet MJ, Ravasi T (2015) The co‐transcriptome of uropathogenic Escherichia coli‐infected mouse macrophages reveals new insights into host‐pathogen interactions. Cell Microbiol 17: 730–746 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. McGillivray A, Golden NA, Kaushal D (2015) The Mycobacterium tuberculosis Clp gene regulator is required for in vitro reactivation from hypoxia‐induced dormancy. J Biol Chem 290: 2351–2367 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Medzhitov R (2007) TLR‐mediated innate immune recognition. Semin Immunol 19: 1–2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Michael DG, Maier EJ, Brown H, Gish SR, Fiore C, Brown RH, Brent MR (2016) Model‐based transcriptome engineering promotes a fermentative transcriptional state in yeast. Proc Natl Acad Sci USA 113: E7428–E7437 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Minch K, Rustad T, Sherman D (2014) NCBI BioProject PRJNA255984 (https://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA255984) [DATASET]
  48. Minch KJ, Rustad TR, Peterson EJ, Winkler J, Reiss DJ, Ma S, Hickey M, Brabant W, Morrison B, Turkarslan S, Mawhinney C, Galagan JE, Price ND, Baliga NS, Sherman DR (2015) The DNA‐binding network of Mycobacterium tuberculosis. Nat Commun 6: 5829 [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Mondino S, Gago G, Gramajo H (2013) Transcriptional regulation of fatty acid biosynthesis in mycobacteria. Mol Microbiol 89: 372–387 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Moreira‐Teixeira L, Mayer‐Barber K, Sher A, O'Garra A (2018) Type I interferons in tuberculosis: Foe and occasionally friend. J Exp Med 215: 1273–1285 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Morrow BJ, Graham JE, Curtiss R III (1999) Genomic subtractive hybridization and selective capture of transcribed sequences identify a novel Salmonella typhimurium fimbrial operon and putative transcriptional regulator that are absent from the Salmonella typhi genome. Infect Immun 67: 5106–5116 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Munoz‐Elias EJ, Upton AM, Cherian J, McKinney JD (2006) Role of the methylcitrate cycle in Mycobacterium tuberculosis metabolism, intracellular growth, and virulence. Mol Microbiol 60: 1109–1122 [DOI] [PubMed] [Google Scholar]
  53. Nataraj V, Varela C, Javid A, Singh A, Besra GS, Bhatt A (2015) Mycolic acids: deciphering and targeting the Achilles’ heel of the tubercle bacillus. Mol Microbiol 98: 7–16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Neuwald AF, Aravind L, Spouge JL, Koonin EV (1999) AAA+: a class of chaperone‐like ATPases associated with the assembly, operation, and disassembly of protein complexes. Genome Res 9: 27–43 [PubMed] [Google Scholar]
  55. Neyrolles O, Wolschendorf F, Mitra A, Niederweis M (2015) Mycobacteria, metals, and the macrophage. Immunol Rev 264: 249–263 [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Ong JGA, Joshi S, Ravi H, Pabon‐Pena C, Novak B, Visitacion M, Hamady M, Useche F, Arezi B, Buehler B, Lin E, Hunt S, Roberts D, Happe S, Leproust E (2011) Overview of agilent technologies sureselect target enrichment system. J Biomol Tech 22: S30–S31 [Google Scholar]
  57. Pandey AK, Sassetti CM (2008) Mycobacterial persistence requires the utilization of host cholesterol. Proc Natl Acad Sci USA 105: 4376–4380 [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Park HD, Guinn KM, Harrell MI, Liao R, Voskuil MI, Tompa M, Schoolnik GK, Sherman DR (2003) Rv3133c/dosR is a transcription factor that mediates the hypoxic response of Mycobacterium tuberculosis. Mol Microbiol 48: 833–843 [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Peterson EJ, Reiss DJ, Turkarslan S, Minch KJ, Rustad T, Plaisier CL, Longabaugh WJ, Sherman DR, Baliga NS (2015) A high‐resolution network model for global gene regulation in Mycobacterium tuberculosis. Nucleic Acids Res 42: 11291–11303 [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Raju RM, Jedrychowski MP, Wei JR, Pinkham JT, Park AS, O'Brien K, Rehren G, Schnappinger D, Gygi SP, Rubin EJ (2014) Post‐translational regulation via Clp protease is critical for survival of Mycobacterium tuberculosis. PLoS Pathog 10: e1003994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Rao V, Fujiwara N, Porcelli SA, Glickman MS (2005) Mycobacterium tuberculosis controls host innate immune activation through cyclopropane modification of a glycolipid effector molecule. J Exp Med 201: 535–543 [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Rao V, Gao F, Chen B, Jacobs WR Jr, Glickman MS (2006) Trans‐cyclopropanation of mycolic acids on trehalose dimycolate suppresses Mycobacterium tuberculosis ‐induced inflammation and virulence. J Clin Invest 116: 1660–1667 [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Reiss DJ, Baliga NS, Bonneau R (2006) Integrated biclustering of heterogeneous genome‐wide datasets for the inference of global regulatory networks. BMC Bioinformatics 7: 280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Rienksma RA, Suarez‐Diez M, Mollenkopf HJ, Dolganov GM, Dorhoi A, Schoolnik GK, Martins Dos Santos VA, Kaufmann SH, Schaap PJ, Gengenbacher M (2015) Comprehensive insights into transcriptional adaptation of intracellular mycobacteria by microbe‐enriched dual RNA sequencing. BMC Genom 16: 34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Roberts DM, Liao RP, Wisedchaisri G, Hol WG, Sherman DR (2004) Two sensor kinases contribute to the hypoxic response of Mycobacterium tuberculosis. J Biol Chem 279: 23082–23087 [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Robinson MD, Smyth GK (2008) Small‐sample estimation of negative binomial dispersion, with applications to SAGE data. Biostatistics 9: 321–332 [DOI] [PubMed] [Google Scholar]
  67. Rohde KH, Abramovitch RB, Russell DG (2007) Gene Expression Omnibus GSE8827 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE8827) [DATASET]
  68. Rohde KH, Abramovitch RB, Russell DG (2007) Mycobacterium tuberculosis invasion of macrophages: linking bacterial gene expression to environmental cues. Cell Host Microbe 2: 352–364 [DOI] [PubMed] [Google Scholar]
  69. Rohde KH, Veiga DF, Caldwell S, Balazsi G, Russell DG (2012) Linking the transcriptional profiles and the physiological states of Mycobacterium tuberculosis during an extended intracellular infection. PLoS Pathog 8: e1002769 [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Ruiz C, Levy SB (2010) Many chromosomal genes modulate MarA‐mediated multidrug resistance in Escherichia coli. Antimicrob Agents Chemother 54: 2125–2134 [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Rustad T, Minch K, Sherman D (2014) Gene Expression Omnibus GSE59086 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi) [DATASET]
  72. Rustad TR, Minch KJ, Ma S, Winkler JK, Hobbs S, Hickey M, Brabant W, Turkarslan S, Price ND, Baliga NS, Sherman DR (2014) Mapping and manipulating the Mycobacterium tuberculosis transcriptome using a transcription factor overexpression‐derived regulatory network. Genome Biol 15: 502 [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Salzman V, Mondino S, Sala C, Cole ST, Gago G, Gramajo H (2010) Transcriptional regulation of lipid homeostasis in mycobacteria. Mol Microbiol 78: 64–77 [DOI] [PubMed] [Google Scholar]
  74. Schnappinger D, Ehrt S, Voskuil MI, Liu Y, Mangan JA, Monahan IM, Dolganov G, Efron B, Butcher P, Nathan C, Schoolnik G (2003) J Exp Med (http://jem.rupress.org/content/198/5/693/tab-figures-data) [DATASET] [DOI] [PMC free article] [PubMed]
  75. Schnappinger D, Ehrt S, Voskuil MI, Liu Y, Mangan JA, Monahan IM, Dolganov G, Efron B, Butcher PD, Nathan C, Schoolnik GK (2003) Transcriptional adaptation of mycobacterium tuberculosis within macrophages: insights into the phagosomal environment. J Exp Med 198: 693–704 [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Singh A, Varela C, Bhatt K, Veerapen N, Lee OY, Wu HH, Besra GS, Minnikin DE, Fujiwara N, Teramoto K, Bhatt A (2016) Identification of a desaturase involved in mycolic acid biosynthesis in mycobacterium smegmatis. PLoS One 11: e0164253 [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Talaat AM, Lyons R, Howard ST, Johnston SA (2004) The temporal expression profile of Mycobacterium tuberculosis infection in mice. Proc Natl Acad Sci USA 101: 4602–4607 [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Tiwari BM, Kannan N, Vemu L, Raghunand TR (2012) The Mycobacterium tuberculosis PE proteins Rv0285 and Rv1386 modulate innate immunity and mediate bacillary survival in macrophages. PLoS One 7: e51686 [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Tsai YT, Salzman V, Cabruja M, Gago G, Gramajo H (2017) Role of long‐chain acyl‐CoAs in the regulation of mycolic acid biosynthesis in mycobacteria. Open Biol 7: 170087 [DOI] [PMC free article] [PubMed] [Google Scholar]
  80. Turkarslan SPE, Rustad TR, Minch KJ, Reiss DJ, Morrison R, Ma S, Price ND, Sherman DR, Baliga NS (2015) A comprehensive map of genome‐wide gene regulation in Mycobacterium tuberculosis. Sci Data 2: 150010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  81. Tusher VG, Tibshirani R, Chu G (2001) Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci USA 98: 5116–5121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  82. Vignali M, Armour CD, Chen J, Morrison R, Castle JC, Biery MC, Bouzek H, Moon W, Babak T, Fried M, Raymond CK, Duffy PE (2011) NSR‐seq transcriptional profiling enables identification of a gene signature of Plasmodium falciparum parasites infecting children. J Clin Invest 121: 1119–1129 [DOI] [PMC free article] [PubMed] [Google Scholar]
  83. Vilcheze C, Morbidoni HR, Weisbrod TR, Iwamoto H, Kuo M, Sacchettini JC, Jacobs WR Jr (2000) Inactivation of the inhA‐encoded fatty acid synthase II (FASII) enoyl‐acyl carrier protein reductase induces accumulation of the FASI end products and cell lysis of Mycobacterium smegmatis. J Bacteriol 182: 4059–4067 [DOI] [PMC free article] [PubMed] [Google Scholar]
  84. Westermann AJ, Gorski SA, Vogel J (2012) Dual RNA‐seq of pathogen and host. Nat Rev Microbiol 10: 618–630 [DOI] [PubMed] [Google Scholar]
  85. Westermann AJ, Forstner KU, Amman F, Barquist L, Chao Y, Schulte LN, Muller L, Reinhardt R, Stadler PF, Vogel J (2016) Dual RNA‐seq unveils noncoding RNA functions in host‐pathogen interactions. Nature 529: 496–501 [DOI] [PubMed] [Google Scholar]
  86. Zhang YM, Zhu K, Frank MW, Rock CO (2007) A Pseudomonas aeruginosa transcription factor that senses fatty acid structure. Mol Microbiol 66: 622–632 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Appendix

Dataset EV1

Dataset EV2

Dataset EV3

Review Process File

Data Availability Statement

The datasets and computer code produced in this study are available in the following databases:


Articles from Molecular Systems Biology are provided here courtesy of Nature Publishing Group

RESOURCES