Characterization and structure determination of prolyl‐tRNA synthetase from Pseudomonas aeruginosa and development as a screening platform

Abstract

Pseudomonas aeruginosa is an opportunistic multi‐drug resistant pathogen implicated as a causative agent in nosocomial and community acquired bacterial infections. The gene encoding prolyl‐tRNA synthetase (ProRS) from P. aeruginosa was overexpressed in Escherichia coli and the resulting protein was characterized. ProRS was kinetically evaluated and the K _M values for interactions with ATP, proline, and tRNA were 154, 122, and 5.5 μM, respectively. The turn‐over numbers, k _cat ^obs, for interactions with these substrates were calculated to be 5.5, 6.3, and 0.2 s⁻¹, respectively. The crystal structure of the α₂ form of P. aeruginosa ProRS was solved to 2.60 Å resolution. The amino acid sequence and X‐ray crystal structure of P. aeruginosa ProRS was analyzed and compared with homologs in which the crystal structures have been solved. The amino acids that interact with ATP and proline are well conserved in the active site region and overlay of the crystal structure with ProRS homologs conforms to a similar overall three‐dimensional structure. ProRS was developed into a screening platform using scintillation proximity assay (SPA) technology and used to screen 890 chemical compounds, resulting in the identification of two inhibitory compounds, BT06A02 and BT07H05. This work confirms the utility of a screening system based on the functionality of ProRS from P. aeruginosa.

Short abstract

PDB Code(s): 5UCM

Introduction

The recent trend of overuse and misuse of antibiotics to treat bacterial infections has in part stimulated the increase in the level of antibiotic resistance in pathogenic bacteria. In addition, recent reports indicate that the level of antibiotic resistant pathogens found in the environment and in animals is also increasing.1 In some bacteria, such as Pseudomonas aeruginosa, resistance has increased to the point that some strains are resistant to all antibiotic treatments. These multidrug‐resistant (MDR) bacteria have become such a major threat during the treatment of infections that they are now classified as the so‐called “superbugs.”2 MDR strains have been associated with increased length of hospital stays and a large increase in cost of care.3 The Infectious Disease Society of America (IDSA) has summarized the current and future public health burden resulting from drug‐resistant bacteria. According to these reports, the current annual cost to the US health care system for antibiotic resistant infections is as much as $34 billion and growing.4 The expansion of the MDR group of pathogenic bacterial strains has increased the incentive to identify new classes of antibiotics that inhibit bacterial growth by targeting different molecular targets and utilizing new mechanisms of action.

Prolyl‐tRNA synthetase (ProRS), encoded by the gene proS, is a member of a family of enzymes known as aminoacyl‐tRNA synthetases (aaRS), which functions to attach a specific amino acid to its cognate tRNA during protein biosynthesis.5 ProRS is a Class II aminoacyl‐tRNA synthetase, characterized by an active site that consists of three structural motifs (Motifs I, II and III), and is contained within Subclass IIa, which also includes SerRS, ThrRS, GlyRS, and HisRS.6 The Class IIa aaRS are α₂ homodimers with cross‐subunit tRNA binding and contain a C‐terminal anti‐codon binding domain (except SerRS).7

There are two distinct types of ProRS enzymes. One type is contained in the cytoplasm of eukaryotic organisms and in archaebacterial and is considered the “eukaryote‐like” ProRS and it is composed of three distinct domains: the N‐terminal catalytic domain, a central anticodon‐binding domain, and a C‐terminal zinc‐binding domain.8 The second type is contained in eubacteria and in mitochondria and is considered the “prokaryote‐like” ProRS. This form of ProRS is composed of an N‐terminal catalytic domain, a central insertion domain (INS), and a C‐terminal anticodon‐binding domain.9 However, sorting of ProRS into one group or the other does not necessarily conform to canonical divisions along taxonomic lines.10 For instance, Thermus thermophilus is taxonomically classed as a bacterium; however, it contains a “eukaryote‐like” ProRS.8

Bacterial ProRS contain pre‐ and post‐editing mechanisms that ensure the proper acylation of tRNA^Pro. The editing occurs either at the pre‐transfer state in which the mis‐activated amino acid (adenylate) is hydrolyzed before attachment to the 3′‐end of tRNA^Pro, or at the post‐transfer state in which the non‐cognate amino acid of the mischarged tRNA^Pro is hydrolyzed.11 These mechanisms are necessary to correct any mistakes that may occur during the aminoacylation process due to the similarity in side chains of other amino acids with that of the cognate amino acid, proline.

A recombinant form of ProRS from P. aeruginosa was purified and the kinetic parameters (K _M, V _max, and k ^cat) governing interactions with its three substrates (ATP, proline, tRNA^Pro) were determined. The crystal structure of the α₂ form of ProRS was solved to 2.60 Å resolution. Additionally, ProRS was developed into a screening platform using scintillation proximity assay (SPA) technology12 and used to screen 890 synthetic compounds for inhibition of activity.

Results

Protein expression and characterization

Prolyl‐tRNA synthetase from P. aeruginosa was cloned and overexpressed in E. coli and purified to greater than 95% homogeneity as visualized by SDS‐PAGE (Supporting Information Fig. S1). Expression of ProRS initially resulted in substantial amounts of insoluble protein. This was overcome by optimizing expression at various temperatures and various concentrations of IPTG. The optimized growth temperature and the IPTG concentration was experimentally determined to be 30°C and 25 μM, respectively.

In the aminoacylation assay, ProRS was observed to be active in attaching proline to the cognate tRNA (Fig. 1). This reaction occurs via two distinct enzymatic steps in which the amino acid substrate is not released from the enzyme and an ATP is hydrolyzed and released as AMP and PP_i:

$$\mathrm{ATP}+\text{Proline}+\text{ProRS}\to \text{Prolyl}-\mathrm{AMP}-\text{ProRs}+{\mathrm{PP}}_{\mathrm{i}}$$ (1)

$$\text{Prolyl}-\mathrm{AMP}-\text{ProRS}+{\text{tRNA}}^{\mathrm{Pro}}\to \text{Prolyl}-{\text{tRNA}}^{\mathrm{Pro}}+\text{ProRS}+\mathrm{AMP}$$ (2)

Figure 1.

Determination of the activity of P. aeruginosa ProRS. Pseudomonas aeruginosa ProRS was titrated into the aminoacylation assay as described in “Materials and Methods” at concentrations between 0.0125 and 0.4 μM and the activity was monitored using SPA technology.

During the initial step (1) the enzyme catalyzes the formation of an aminoacyl adenylate (prolyl‐AMP) by the condensation of the amino acid and ATP followed by the release of an inorganic pyrophosphate (PP_i). This reaction is reversible in the absence of cognate tRNA and has historically been used to monitor the interaction of the enzyme with the amino acid and ATP using the ATP:PP_i exchange assay. Using this assay, the kinetic parameters governing the interaction of P. aeruginosa ProRS with proline and ATP were determined as described under the “Methods and Material” section. To determine the kinetic parameters with respect to ATP, the concentration of proline was held constant while the concentration of ATP was varied between 50 and 400 μM. Alternatively, to determine the same kinetic parameters with respect to proline, the concentration of ATP was held constant while the concentration of the amino acid was varied between 50 and 400 μM. The initial velocities at each substrate concentration were determined and fit to the Michaelis–Menten steady‐state model using XLfit (IDBS) [Fig. 2(A, B)]. From these data, the kinetic parameters K _M and V _max were obtained and used to determine the observed turnover number (k _cat ^obs). The kinetic parameters, K _M, k _cat ^obs, and k _cat ^obs /K _M, for interaction of P. aeruginosa ProRS with ATP were determined to be 154 μM, 5.5 s⁻¹, and 0.04 s⁻¹ μM⁻¹, respectively (Table 1). These parameters for the interaction with proline were 122 μM, 6.3 s⁻¹, and 0.05 s⁻¹ μM⁻¹, also respectively. The same kinetic values, K _M and k _cat, observed for E. coli ProRS with proline were 290 μM and 14 s⁻¹.13 These values for ProRS from numerous other organisms were similar.

Figure 2.

Assays to determine the kinetic parameters governing interactions of ProRS with ATP, proline, and tRNA^Pro. Initial velocities for the interaction of ProRS with ATP (A) and proline (B) were determined using the ATP:PP_i exchange reaction. The concentration of ProRS in the reactions was 0.2 μM. Initial velocities were determined at each concentration of ATP or proline and the data were fit to a Michaelis–Menten steady‐state model using XLfit 5.3 (IDBS) to determine K _M and V _max. (C) Initial velocity for the interaction of ProRS with tRNA was determined using the aminoacylation reaction. The concentration of ProRS in the aminoacylation reactions was 0.05 μM. Initial velocities were determined for each concentration of tRNA (0.75 to 3.0 μM) and the data were fit to a Michaelis–Menten steady‐state model using XLfit 5.3 (IDBS) to determine K _M and V _max.

Table 1.

The Kinetic Parameter Governing the Interaction of ProRS with its Substrates

ATP			Proline			tRNA
K M (μM)	k cat obs (s−1)	k cat obs/K M (s−1 μM)	K M (μM)	k cat obs (s−1)	k cat obs/K M (s−1 μM)	K M (μM)	k cat obs (s−1)	k cat obs/K M (s−1 μM)
154	5.5	0.04	122	6.3	0.05	5.5	0.2	0.035

In the second enzymatic step (2), the kinetic interactions of P. aeruginosa ProRS with tRNA^Pro was determined using the aminoacylation reaction. The initial rate for aminoacylation of tRNA^Pro was determined at several different concentrations of tRNA^Pro (0.75, 1.25, 1.75, 2.0, 2.5, and 3.0 μM) while holding ATP and proline constant at saturating concentrations [Fig. 2(C)]. The initial velocities were modeled by fitting them to the Michaelis–Menten steady‐state model. The K_M and k_cat ^obs values for the interaction of P. aeruginosa ProRS with the tRNA^Pro were determined to be 5.5 μM and 0.2 s⁻¹, which gave a k_cat ^obs/K_M value of 0.035 s⁻¹ μM⁻¹ (Table 1).

Structure and sequence analysis of P. aeruginosa ProRS

Pseudomonas aeruginosa ProRS incubated with l‐proline, MgCl₂, and AMPPNP crystallized into space group P2₁2₁2₁ and crystals diffracted to 2.60 Å resolution with a single homodimer in the asymmetric unit (Fig. 3). This structure has been deposited in the RCSB Protein Data Bank (PDB ID: 5UCM). Even though P. aeruginosa ProRS was crystalized in the presence of both the amino acid and the ATP analog, neither substrate was visible in the electron density. Each monomer is similar to the other with a RMSD of 0.473 Å between 563 atom pairs. Data collection and refinement statistics are given in Table 2. The structure of P. aeruginosa ProRS contains an N‐terminal aminoacylation domain, a central INS domain, and a C‐terminal anticodon binding domain. The bacterial‐like ProRS crystal structure has only been solved from two other bacteria, Enterococcus faecalis, a low G/C Gram‐positive firmicute, and Rhodopseudomonas palustris, a Gram‐negative α‐proteobacteria.9 The two ProRS structures either contain a cis‐editing domain, or that domain is absent, respectively. The structure of P. aeruginosa ProRS is very similar to the structures of ProRS from both E. faecalis, and R. palustris with RMSDs of 0.888 Å between 298 atom pairs and 0.889 Å between 341 atom pairs, respectively (Fig. 4). As both, P. aeruginosa ProRS and E. faecalis ProRS contain the INS domain, they are more similar to each other than with the R. palustris ProRS. Comparison of ProRS from P. aeruginosa with the E. faecalis homolog shows that the aminoacylation domain and anticodon binding domain overlay quite well; however, there is a difference in the positioning of the INS domain relative to the catalytic domain. In P. aeruginosa ProRS, the INS domain appears to be shifted further away from the aminoacylation domain than observed with the E. faecalis homolog.

Figure 3.

The crystal structure of the α₂ form of P. aeruginosa ProRS. The 3‐dimensional structure of P. aeruginosa ProRS was solved to 2.60 Å resolution. The insertion (INS) domain (containing the editing function), the anti‐codon binding (ACB) domain, and the three structural motifs forming the active site of the catalytic domain are indicated.

Table 2.

Data Collection and Refinement Statistics for the Crystal Structure of P. aeruginosa ProRS

Data collection
PDB code	5UCM
Resolution (Å)	2.60 (2.67–2.60)
Space group	P212121
Unit cell dimensions
a, b, c (Å)	85.83 101.54 187.24
α, β, γ, (°)	90.00, 90.00, 90.00
No. of unique reflections	222,455
R ,merge	13.0 (58.54)
Redundancy	4.5 (4.4)
Completeness (%)	97.5 (99.1)
l/σ	9.75 (2.67)
CC1/2	98.9 (68.9)
Refinement
Resolution (Å)	2.60 (2.67–2.60)
No. of protein atoms	8641
No. of Mg atoms	2
No. of water molecules	488
R working (R free)	16.9 (23.2)
R.M.S. deviations
Bond lengths (Å)	0.007
Bond angles (°)	0.884
Ave. B factors (Å2)
Protein	35.79
Mg	48.6
Water	31.80
Ramachandran plot
Favored region (%)	97.15
Allowed regions (%)	2.85
Outlier regions (%)	0.00

Figure 4.

Structural comparison of P. aeruginosa ProRS with homologs. The structure of the monomeric form of P. aeruginosa ProRS (silver) is overlaid with the three‐dimensional structure of ProRS from E. faecalis (magenta) and R. palustris (cyan). Only ProRS from P. aeruginosa and E. faecalis contain an INS domain.

The amino acid sequence of ProRS from E. faecalis and R. palustris are similar, containing 44.3%/32.3% similar/conserved amino acid residues and the crystal structures of both have been solved bound to substrates. The amino acid sequence of P. aeruginosa ProRS is similar to that of both of these enzymes and overall contains 64.5%/47.1% and 50.1%/38.4% similar/conserved amino acids relative to E. faecalis and R. palustris ProRS, respectively. The lower percent sequence conservation seen between P. aeruginosa and R. palustris ProRS is a result of the lack of an editing domain in R. palustris ProRS.

Pseudomonas aeruginosa ProRS is an enzyme of ~63.1 kDa with multiple flexible domains. Sequence and structure analysis enables active site structure comparison with that of the homologs from E. faecalis, and R. palustris in which the structures have been solved bound to ATP and prolyl‐analogs (Fig. 5). In interactions of ProRS with ATP, the adenine ring is stacked between Phe¹⁵⁵ (E. faecalis numbering) and Arg⁴⁴⁷. These residues are strictly conserved when the sequences of P. aeruginosa and E. coli ProRS are compared with that of E. faecalis and R. palustris (Fig. 6). The ribose of ATP is stabilized by interactions with the side chain of Glu⁴⁰⁷ which is conserved in all four forms of ProRS. The principal divalent cation is co‐ordinated by the α‐ and β‐phosphates of ATP and His⁴¹⁰ and Glu⁴⁰⁷. These residues are conserved in ProRS from E. faecalis, P. aeruginosa and E. coli; however, the residue corresponding to His⁴¹⁰ is a glutamine in R. palustris ProRS. There are two additional divalent cations that bridge the β‐ and γ‐phosphates that are coordinated by Glu⁴⁰⁷ or by water molecules positioned by Glu¹⁴², Glu²⁰⁹, and Asp²¹⁹, all strictly conserved. The conserved Arg¹⁵¹ and Arg⁴⁴⁷ interact with and stabilize the γ‐phosphate of ATP. The carboxylate of the functionally conserved Glu²¹⁸ points directly into the active site and stabilized the positions of the basic residues interacting with the ATP pyrophosphate. This residue is conserved in all sequences analyzed.

Figure 5.

The active site region of ProRS. The positioning of ATP and the proline analog are from the structure of E. faecalis ProRS. The numbering is based on the amino acid sequence of P. aeruginosa ProRS. The active site structure of P. aeruginosa ProRS is shown in silver, and the structure of E. faecalis ProRS is shown in magenta.

Figure 6.

Alignment of the amino acid sequence of P. aeruginosa ProRS with homologs. The protein sequences of Ef, E. faecalis; Ec, E. coli; Pa, P. aeruginosa; Rp, R. palustris were downloaded from the National Center for Biotechnology Information (NCBI). Accession numbers for ProRS protein sequences of E. faecalis, E. coli, P. aeruginosa, and R. palustris are KAJ60230, BAA77870, NP_249647, and WP_027277454, respectively. Sequence alignments were performed using Vector NTI Advance™ 11.5.4 (Invitrogen). Identical residues are indicated by white letters on black background, while similar sequences are black letters on gray background. The three structural motifs I, II, III are indicated. Amino acids that interact with ATP (●) and proline (▲) are indicated above the aligned residues. The invariant residue, Lys²⁷⁹ (■), essential for hydrolysis of mis‐acylated tRNA^Pro is shown.

The hydrophobic portion of the amino acid contained within the prolyl moiety of the adenylate fits within a pocket formed by the 157‐MKDxYSF‐163 motif and the main chain of the 439‐GCYG‐442 motif (E. faecalis numbering). The amino acids making up these motifs are again conserved in the ProRS alignments. The imino group of proline is hydrogen bonded to Thr¹⁰⁹ and Glu¹¹¹ while the carbonyl‐oxygen interacts with Arg¹⁴⁰ (Fig. 5), all strictly conserved amino acid residues. The conservation of amino acids and structure comparison in the ATP/proline binding region indicates that the active site of P. aeruginosa ProRS is similar when compared with that of the homologs from E. coli, E. faecalis, and R. palustris. This suggests that a compound that interferes with activity by binding in or near these strategic regions may have broad spectrum inhibitory activity.

ProRS from E. faecalis contains a distinct cis‐editing domain contained in Residues 237–390; this domain is missing from the R. palustris homolog (Fig. 4). P. aeruginosa ProRS also contains this editing domain. This domain contains the invariant amino acid residue Lys²⁷⁹ which has been shown to be essential for hydrolysis of mis‐acylated tRNA^Pro and it is strictly conserved in the aligned sequences.

The crystal structure of Thermus thermophilus (Tth) ProRS has also been solved but was not included in the preceding discussion since it is eukaryote/archaeon‐like8 and has little sequence conservation to prokaryotic forms of ProRS. However, when the anticodon binding domain of Tth ProRS was aligned with that of P. aeruginosa ProRS (amino acids 281–377, and 465–565, respectively), there was significant sequence conservation, 47.5%/36.4% similar/conserved, and the structures had a high degree of similarity with an RMDS of 0.978 Å between 81atom pairs [Fig. 7(A)]. The anticodon forming G35 and G36 are supported by a hydrophobic group of amino acids, Leu⁴⁷⁹, Pro⁵¹⁵, and Phe⁵¹⁹ (P. aeruginosa numbering), with Pro⁵¹⁵ and Phe⁵¹⁹ strictly conserved and Leu⁴⁷⁹ replaced by the similar Ile in Tth ProRS6 [Fig. 7(B)]. These two anticodon nucleotides also form hydrogen bonds to Arg⁵³⁰ and Val⁵³². The Arg residue is conserved in Tth ProRS, however the Val is replaced by a hydrophilic Glu. The nucleotide at the wobble position, C34, forms a hydrogen bond with Glu⁴⁸² which is replaced with the similar Asp in ProRS from Tth. These residues, shown to be important for anticodon recognition in Tth, are similar or conserved in the P. aeruginosa ProRS indicating that recognition of the cognate tRNA^Pro may be similar in both forms of ProRS.

Figure 7.

Comparison of the structure of the anticodon binding region of ProRS from P. aeruginosa and Thermus thermophilus. (A) Alignment of the structure of the anticodon binding domain of Tth ProRS with that of P. aeruginosa ProRS (Amino acids 281–377 and 465–565, respectively). (B) Overlay of the amino acid residues that interact with the anti‐codon nucleotides (P. aeruginosa ProRS numbering). The anticodon binding region of P. aeruginosa ProRS is shown in silver and that of Tth ProRS is shown in gold.

Development and use of ProRS as a screening platform for identification of inhibitors of function

Using SPA technology, the activity of ProRS in the aminoacylation assay was screened against a synthetic chemical compound library containing 890 distinct compounds of low molecular weight, drug‐like molecules with scaffolds found in antiseptic agents with anti‐bacterial, anti‐fungoid, and anti‐microbial activities from TimTec LLC. The concentration of ProRS for use in SPAs was 0.35 μM, which was in the linear range of the titration curve and allowed maximum sensitivity to enzymatic inhibition (Fig. 1). Next, tRNA was titrated into the assay to determine the concentration of tRNA^Pro to be used in the screening assay and to determine that the amount of tRNA^Pro used would be within the linear region of the reaction‐detection time (Supporting Information Fig. S2). From the titration reactions, 2 μM tRNA^Pro was selected for use in the screening assays. Since chemical compounds were dissolved in 100% DMSO, resulting in final DMSO concentrations in screening assays of 4%, the ability of P. aeruginosa ProRS to function in the presence of increasing amounts of DMSO was determined. There was a gradual decrease of activity observed in aminoacylation assays containing up to 10% DMSO; however, at 4% DMSO, the decrease was insignificant [Fig. 8(A)]. The other components of the assay were also optimized for maximum activity (Supporting Information Fig. S3).

Figure 8.

Effect of DMSO and halofuginone, a eukaryotic ProRS inhibitor, on the activity of P. aeruginosa ProRS. (A) DMSO (0–10%) was added into the aminoacylation assay described in the “Chemical Compound Screening” section of “Materials and Methods”. The concentration of P. aeruginosa ProRS was the same as contained in the screening assay (0.35 μM). (B) Halofuginone was serially diluted (200–0.2 μM) into the aminoacylation assay as described in the “Chemical Compound Screening” section of “Materials and Methods”. The concentration of P. aeruginosa ProRS was the same as contained in the screening assay (0.35 μM). The IC₅₀ was determined to be 1.25 μM. The “% positive” indicates the percent of activity observed relative to activity in assays where only DMSO was added to the assay in the absence of halofuginone.

In the optimized assay, in which all non‐enzymatic components are at saturating concentrations and the enzyme concentration is in the linear range of the titration curve, in the presence of a chemical compound any inhibition of the function of ProRS in the aminoacylation of tRNA^Pro can be monitored. Halofuginone, a drug used in veterinary medicine, is being developed to treat autoimmune diseases and targets the eukaryotic form of ProRS.14 To test for the ability of halofuginone to inhibit P. aeruginosa ProRS and for its potential use as an inhibitory positive control agent it was added to aminoacylation assays in concentrations varying from 200 to 0.2 μM. Halofuginone was observed to inhibit the activity of P. aeruginosa ProRS with an IC₅₀ of 1.25 μM [Fig. 8(B)]. This compares to an IC₅₀ of approximately 0.8 μM against the human form of ProRS at the same proline concentration.14

Initial screening assays contained chemical compounds at a concentration of 132 μM and were carried out as single point assays. Compounds observed to inhibit enzymatic activity by at least 50% were re‐assayed in triplicate using filter binding assays, as described.15 These assays resulted in two confirmed hit compounds, BT06A02 and BT07H05 (Supporting Information Fig. S4).

Discussion

As resistance in pathogenic bacteria continues to increase, the impetus for the identification of compounds that have the potential for development as new antibacterial agents with different modes of action than currently marketed antibiotics also increases. The aminoacyl tRNA synthetases (aaRS) are ideal targets for development of new antibacterial agents for a number of reasons.16 This class of enzymes plays a crucial role in protein biosynthesis and are vital for cell viability and growth. The primary structure of the aaRS proteins is similar enough from bacterial sources to indicate that a compound effective in inhibiting the function of a specific bacterial aaRS may have broad‐spectrum antibacterial activity. This with the fact that bacterial aaRSs are sufficiently divergent from their eukaryotic homologs makes them suitable targets for antibiotic development.

Pseudomonas aeruginosa is a multi‐drug‐resistant pathogen that continues to plague the health care industry. In the present work, the gene encoding ProRS from P. aeruginosa has been cloned and the resulting protein was enzymatically characterized. Next, the crystal structure of P. aeruginosa ProRS was solved to 2.60 Å resolution and compared with other bacterial homologs. Finally, the aminoacylation activity of ProRS has been optimized and developed into a platform using scintillation proximity assay technology to screen for inhibitors of activity. The screening assays were robust and resulted in Z’ and Z factors of approximately 0.41 and 0.40, respectively, across all plates. The signal to background ratio of the DMSO positive controls to the negative controls was approximately 6.7:1. From 890 compounds, two compounds were identified that inhibited the activity of P. aeruginosa ProRS. Chemical compound libraries are screened against the activity of numerous aaRS enzymes from P. aeruginosa and Streptococcus pneumoniae in our laboratory. The two compounds, BT06A02 and BT07H05, identified in the ProRS screen were also identified as hit compounds in screens of five other aaRS enzymes from P. aeruginosa. The common substrate for all aaRS enzymes is ATP, which leads to speculation that these compounds compete with ATP for enzyme binding. Alternatively, a compound that inhibits a number of biochemical activities may be classified as a “promiscuous” compound.15 The lack of specificity of these compounds limits their value as an antimicrobial agent and they will not be considered further. The screening of this chemical compound library does, however, serve as proof‐of‐principal that ProRS has utility as a screening platform for discovery of compounds that have the potential for development as new antibacterial agents.

Materials and Methods

Materials

All chemicals were obtained from Fisher Scientific (Pittsburg, PA). DNA oligonucleotides were from Integrated DNA Technologies (Coralville, IA). DNA sequencing was performed by Functional Bioscience (Madison, WI). Radioactive isotopes, SPA beads and 96‐well screening plates were from PerkinElmer (Waltham, MA). The synthetic compound library was from TimTec LLC (Newark, DE). Compounds stocks were dissolved in dimethyl sulfoxide (DMSO) to a concentration of 10 mM, stored at −20°C and thawed immediately before analysis. The compounds have an average purity of 95%, and the minimum purity is at least 90%.

Cloning and purification of P. aeruginosa ProRS

The gene encoding P. aeruginosa ProRS was amplified by PCR (MJ Mini Thermo Cycler, Bio‐Rad, Hercules, CA) using P. aeruginosa PAO1 (ATCC 47085) genomic DNA as a template. A forward primer (5′‐ATATGCTAGCCGTACCAGTCACTATCTGCTTCCC‐3′), designed to create a NheI restriction site at the 5′ end of the gene and a reverse primer (5′‐CAT TGGATCCTCAGCGGCTGAGTTTTTCG‐3′) designed to add a BamHI restriction site at the 3′ end of the gene were used in PCR. The PCR product was inserted into pET‐28b(+) (Novagen) digested with NheI/BamHI restriction enzymes. This recombinant plasmid was transformed into E. coli Rosetta 2 (DE3) Singles Competent Cells (EMD Millipore, Danvers, MA).

The transformed E. coli Rosetta cell cultures were grown in LB Broth containing 25 μg/mL of kanamycin and 50 μg/mL of chloramphenicol at a temperature of 30°C to an optical density (A ₆₀₀) of 0.6–0.8. The overexpression of P. aeruginosa ProRS was induced by the addition of isopropyl β‐d‐1‐thiogalactopyranoside (IPTG) to a concentration of 25 μM. Growth was continued for 4 h post‐induction, and the bacteria were harvested by centrifugation (10,000 g, 4°C, 45 min). Fraction I lysates were prepared as previously described.17 The initial step in purification of P. aeruginosa ProRS was by precipitation of the protein in a solution containing 40% ammonium sulfate saturation. Next, P. aeruginosa ProRS was purified to greater than 95% homogeneity as previously described18 using nickel–nitrilotriacetic acid (NTA) affinity chromatography (Perfect Pro, 5 Prime) followed by dialysis (two times) against a buffer containing 20 mM Hepes‐KOH (pH 7.0), 40 mM KCl, 1 mM MgCl₂, 0.1 mM EDTA, 10% glycerol. Purified proteins were fast frozen in liquid nitrogen and stored at −80°C.

Gel electrophoresis and protein analysis

Visualization of proteins was by sodium dodecyl sulfate‐polyacrylamide gel electrophoresis (SDS‐PAGE) using 4–12% polyacrylamide precast gradient gels (Novex NuPAGE; Invitrogen, Grand Island, NY) with 3‐(N‐morpholino)propanesulfonic acid (MOPS) as the running buffer (Invitrogen). The protein standard was EZ‐Run Rec Protein Ladder (Fisher Scientific). Coomassie Protein Assay Reagent (Thermo Scientific, Waltham, MA) was used to determine protein concentrations with bovine serum albumin as a standard.

ATP:PP_i exchange reactions

ATP:PP_i exchange reactions (100 μL) were carried out at 37°C for 20 min in 50 mM Tris–HCl (pH 7.5), 10 mM KF, 8 mM MgOAc, 1 mM dithiothreitol (DTT), 2 mM [³²P]PP_i (50 cpm/pmol), and 0.2 μM of P. aeruginosa ProRS as previously described.18 When the concentration of proline (Pro) was varied (50, 75, 100, 150, 200, 300, and 400 μM), the concentration of ATP was held constant at 2 mM and when the concentration of ATP was varied (50, 100, 200, 300, and 400 μM), the concentration of Pro was held constant at 2 mM. The reactions were stopped at 1, 2, 3, 4, and 5 min time points. The K _M, V _max, and the k _cat ^obs for the interactions of P. aeruginosa ProRS with ATP and proline were determined by plotting the initial velocities for exchange of PP_i at each concentration of the varied substrate, and fitting these data to the Michaelis–Menten steady‐state model using XLfit (IDBS).

Timed tRNA aminoacylation assay

Initial velocities in timed aminoacylation reactions were measured using scintillation proximity assay (SPA) technology19 in 96‐well plates (Costar). Briefly, reactions (50 μL) contained a protein/buffer mix (35 μL) designed to yield final concentrations of: 50 mM Tris–HCl (pH 7.5), 0.5 mM spermine, 7.5 mM MgOAc, 2.5 mM ATP, 1 mM DTT, 75 μM [³H]Pro (50 cpm/pmol), and 0.05 μM P. aeruginosa ProRS. Reactions were started by the addition of tRNA^Pro (15 μL) at concentrations varying between 0.75 and 3.0 μM. Assays were stopped at 1 min intervals and ranged between 1 and 5 min. Reactions were stopped by the addition of 5 μL of 0.5 M EDTA. 400 μg of yttrium silicate (Ysi) poly‐l‐lysine coated SPA beads (Perkin‐Elmer) in 150 μL of 300 mM citrate buffer (pH 2.0) were added and allowed to incubate at room temperature for 1 h. The plates were analyzed using a 1450 Microbeta (Jet) liquid scintillation/luminescent counter (Wallac). Initial velocities for aminoacylation were calculated for all tRNA concentrations and the kinetic parameters (K _M and V _max ) were determined by plotting the velocities against substrate concentration and fit to the Michaelis–Menten steady‐state model using XLfit (IDBS).

Crystallography and structure determination

Pseudomonas aeruginosa ProRS for crystallography was cloned, expressed, and purified as described20 and concentrated to 9.5 mg/mL and incubated with 1 mM l‐proline, 1 mM MgCl₂, and 1 mM AMPPNP for 10 min at 289 K. Crystals were then grown at 289 K by sitting drop vapor diffusion with 0.4 μL of protein/ligand complex mixed with 0.4 μL of a MCSG1(b11): 20% (w/v) PEG‐8000, 0.2 M MgCl₂, 0.1 M Tris–HCl (pH 8.5). Crystals were looped and soaked in reservoir solution supplemented with 20% ethylene glycol, 1 mM l‐proline, 1 mM MgCl₂, and AMPPNP and flash frozen in liquid nitrogen. Data were collected at 100 K on a Raynoix MX‐300 mm CCD detector at a wavelength of 0.97872 Å on beamline 21‐ID‐F at the Advanced Photon Source (APS, Argonne, IL). Indexing and integration were carried out using XDS21 and the scaling of the intensity data was accomplished with XSCALE.21 The structure was solved using molecular replacement with MR‐Rosetta22 with 2J3L as a starting model. Iterative rounds of manual model building and automated refinement were carried out using Coot23 and Phenix.24 The structure was quality checked with Molprobity.25

Chemical compound screening

To screen for inhibitors of ProRS, tRNA aminoacylation was monitored using SPA technology as described above. The screening reactions were in 96‐well microtiter plates (Costar). Test compounds (2 μL of compound, 3.3 mM) dissolved in 100% DMSO were equilibrated by addition of 33 μL of the protein/buffer mix as described above in the timed aminoacylation assay with the exception that the concentration of P. aeruginosa ProRS was 0.35 μM. This resulted in a compound concentration in the final assay of 132 μM. This mixture was allowed to incubate at ambient temperature for 15 min and reactions were then initiated by addition of 15 μL E. coli tRNA yielding 2 μM tRNA^Pro, followed by incubation for 1 h at 37°C. Reactions were stopped by the addition of 5 μL of 0.5 M EDTA and reactions were analyzed as described above. In assays to determine the effect of halofuginone, an inhibitor of eukaryotic ProRS enzymes, on the activity of P. aeruginosa ProRS, halofuginone was serially diluted into the assays from 200 to 0.2 μM. These data were fit to a Sigmoidal Dose–Response Model using XLfit to determine the concentration that inhibited 50% of activity (IC₅₀). The halofuginone was also dissolved in DMSO.

Declaration of Conflicting Interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Supporting information

Supplemental Figure S1 Purification of P. aeruginosa ProRS.

Supplemental Figure S2. Titration of tRNA^Pro into the aminoacylation assay to determine the concentration to be used in the screening assay.

Supplemental Figure S3. Titration of non‐enzymatic components of the aminoacylation assay to determine the concentration to be used in the screening assay.

Supplemental Figure S4. Compounds identified as inhibitors of ProRS.