Abstract
Background
Tristetraprolin (TTP) is an RNA binding protein that plays a critical role in regulating proinflammatory immune responses by destabilizing target mRNAs via binding to their AU-rich elements (AREs) in the 3′-UTRs of mRNAs. A recent CLIP-seq study revealed that TTP-binding sites are enriched in the intronic regions of RNA. TTP is also a nuclear protein that exhibits putative DNA-binding activity. These features suggested that TTP might regulate gene transcription and/or alternative splicing of pre-mRNAs in the absence of stimulation.
Results
To elucidate the regulatory pattern of TTP, we cloned and overexpressed the human TTP-encoding gene, ZFP36, in HeLa cells in the absence of inflammatory stimuli. The transcriptomes of the control and ZFP36-overexpressing cells were sequenced and subjected to analysis and validation. Upon ZFP36 overexpression, the expression of genes associated with innate immunity, including those in the type I interferon signaling pathway and viral response, were specifically upregulated, implying a transcriptional regulatory mechanism associated with the predicted DNA binding activity of TTP. TTP preferentially regulated the alternative splicing of genes involved in the positive regulation of the I-κB/NF-κB cascade and the TRIF-dependent toll-like receptor, MAPK, TNF, and T cell receptor signaling pathways.
Conclusions
Our findings indicated that TTP may regulate the immune response via the regulation of alternative splicing and potentially transcription, which greatly expands the current understanding of the mechanisms of TTP-mediated gene regulation.
Electronic supplementary material
The online version of this article (10.1186/s12865-019-0292-1) contains supplementary material, which is available to authorized users.
Keywords: ZFP36, Overexpression, RNA-seq, Gene expression, Alternative splicing
Background
RNA binding proteins play key roles in coordinating RNA processing events (e.g., pre-mRNA splicing and polyadenylation, mRNA transport, and translation), creating vast opportunities for posttranscriptional gene regulation (PTGR) [1–3]. Moreover, RNA binding proteins are involved in regulating the establishment of a large array of physiological and pathological states [1, 4–9].
RNA binding proteins are well characterized for their ability to control multiple steps in the PTGR of the immune response [6, 8]. Among these, tristetraprolin (TTP) is one of the most well-studied RNA binding proteins [6, 8, 10]. In the early 1990s, TTP was identified as the prototype of a class of Cys-Cys-Cys-His (CCCH) zinc finger proteins, that was found to be proline-rich, widely distributed, and encoded by the immediate-early response gene, ZFP36 [11, 12]. In addition, the transcription of ZFP36 is rapidly accumulated in response to insulin [11] and growth factors [13]. In the late 1990s, experiments involving TTP-deficient mice indicated that it played a pathogenetic role and was linked to the cytokine, tumor necrosis factor alpha (TNFα) [14]. Moreover, the expression of both TTP and TNFα is induced upon stimulation with lipopolysaccharide (LPS), and TTP was shown to bind to the AU-rich element (ARE) of TNFα mRNA, promoting deadenylation, destabilization, and exerting a feedback inhibition [15, 16]. In subsequent studies, TTP was shown to target a number of other mRNAs associated with inflammation for degradation, most notably, cytokine and chemokine mRNA (e.g., IL-2, IL-3, IL-6, CCL2, CCL3, iNOS, COX2, and IL-10) [17–27]. Recently, CLIP technology has been applied to more accurately map the relationship between TTP-binding and its regulatory function in mouse macrophages following stimulation with LPS [28, 29].
TTP regulation of proinflammatory cytokine mRNA in macrophages is dependent on inflammatory conditions. Upon the induction of inflammation, TTP is phosphorylated by p38MAPK-activated protein kinase (MK2). The phosphorylation of TTP by MK2 results in the sequestration of TTP by 14–3-3 proteins and weakens the interaction of TTP with mRNA and CCR4-NOT, thereby stabilizing the target mRNA [30].
In addition to TTP, there are other RNA binding proteins involved in regulating the PTGR and RNA processing events associated with a proinflammatory immune response [31, 32]. For example, in contrast to TTP, HuR has been found to positively regulate the stability of several inflammatory cytokines, including IL-4, IL-13, IL-17, and TNF-α via binding to AU-rich elements [33]. In addition, RNA helicase DDX39B is a potent activator promoting the inclusion of IL7R exon 6 and consequently, a suppressor of the sIL7R protein isoform, which has been associated with an increased risk of multiple sclerosis [34]. The transcription of CELF2 is induced during T cell signaling, which promotes widespread alternative splicing [35]. In addition, RC3H1 acts in concert with EDC4 and DDX6, whereas ZC3H12A associates with UPF1 to degrade mRNAs at spatiotemporally distinct phases of the inflammatory response [36].
Furthermore, the TTP-encoding gene, ZFP36, is also characterized as a cancer suppressor gene [37]. Most of the characterized suppressor functions of TTP have associated with its known target genes, including inflammatory cytokines (e.g., IL8, IL6, and IL23), as well as additional targets (e.g., vascular endothelial growth factor gene, VEGF) in melanoma cells [38], malignant glioma cells [39], head and neck squamous cell carcinoma [40], and colon cancer cells [41].
Most of what is currently known of TTP-mediated regulation of gene expression has been drawn from its ability to bind to the 3′-UTR as an ARE binding protein, which promotes target mRNA degradation. However, TTP is also located in the nucleus and mediates several DNA-binding activities. Stimulation with serum and other mitogens causes the rapid translocation of TTP into the cytosol, which is accompanied by rapid serine phosphorylation [13, 42, 43]. Furthermore, the global mapping of TTP binding sites in mouse macrophage transcripts has demonstrated its extensive binding to the intronic region of pre-mRNA [28]. However, it remains unclear as to whether nuclear-located TTP regulates any gene transcription or alternative splicing of pre-mRNAs in the absence of stimulation. Thus, the purpose of this study was to address these two related questions in HeLa cells rather than in immune responsive cells, which should eliminate the complications arising from the known function of TTP in regulating the immune response to inflammatory stimuli. To this end, we overexpressed the ZFP36 gene in HeLa cells and analyzed the impact of TTP on the level of gene expression and alternative splicing in the absence of any inflammatory stimuli by sequencing and analyzing the transcriptomes of the overexpressing cells compared to the controls. Our results revealed that TTP could regulate the transcription and alternative splicing of a large number of genes involved in the innate immune and inflammatory response, which expands the current understanding of TTP-mediated immune regulation.
Results
RNA-seq data analysis
To explore the molecular mechanism of TTP-mediated transcriptional regulation, RNA-seq experiments were performed. As shown in Fig. 1a and b, the efficacy of ZFP36 overexpression was assessed by RT-PCR and western blots, approximately 10 times. Four cDNA libraries were constructed and sequenced using the Illumina Xten platform for 2 × 150 paired-end reads per sample.
After removing the adaptor sequences and low quality sequencing reads, we obtained a total of 98 ± 14.8 million high quality reads from each sample (Table 1). When these reads were mapped onto the human GRCH38 genome using Tophat2, 89.22–92.68% were aligned and about 95.46–96.8% were uniquely aligned (Table 1). To compare the gene expression patterns between individuals, we reassessed the gene and transcript quantifications with Cufflinks [44]. The expression values in units of fragments per kilo base of exon model per million fragments mapped (FPKM) was calculated. RNA-seq yielded robust expression results for 28,837 genes (see Additional file 1: Table S1). Effective overexpression of ZFP36 was further confirmed in a parallel RNA-seq analysis (Fig. 1c). FPKM values for all 28,837 genes were used to calculate a correlation matrix based on the Pearson’s correlation coefficient.
Table 1.
Sample | ZFP36_1st | ZFP36_2nd | Ctrl_1st | Ctrl_2nd | |
---|---|---|---|---|---|
Raw reads | 97,277,834 | 122,099,646 | 85,307,388 | 103,111,480 | 101,949,087 + 15,342,348.1003348a |
Clean reads | 94,730,320 | 117,723,315 | 81,786,909 | 98,488,282 | 98,182,206.5 + 14,862,367.5115245 |
paired-end reads | 92,564,654 | 114,105,262 | 78,689,244 | 94,366,960 | 94,931,530 + 14,575,832.6760188 |
Total mapped | 84,903,807 (91.72%b) | 105,756,131 (92.68%) | 70,202,863 (89.22%) | 85,742,261 (90.86%) | 86,651,265.5 + 14,599,380.4773278 |
Total Uniquely mapped | 81,485,850 (95.97%c) | 101,851,278 (96.31%) | 67,016,487 (95.46%) | 82,999,189 (96.8%) | 83,338,201 + 14,290,772.0956458 |
Splice reads | 33,118,198 (40.64%d) | 42,059,737 (41.3%) | 28,029,484 (41.82%) | 34,446,000 (41.5%) |
aThe mean and standard deviation across the 4 samples
bthe percentage of paired-end reads that were mapped to the genome
cthe percentage of unique reads mapping out of the total mapped reads
dthe percentage of uniquely mapped reads that were mapped to splice site
ZFP36 overexpression in HeLa cells preferentially upregulated the expression of a large number of immune response genes
Based on the high quality RNA-seq data obtained from the ZFP36-OE cells and the control, we used criteria of an absolute fold change ≥1.5 or ≤ 2/3, FDR < 0.05 with the edge R package [45] to identify genes that were potentially regulated by TTP at the transcriptional level. We identified 596 and 231 genes that were upregulated and downregulated, respectively. The details of the differentially expressed genes (DEGs) can be found in Additional file 2. A volcano plot was constructed to display the DEGs associated with ZFP36 overexpression (Fig. 1d). A heat map analysis of the DEG expression patterns in the RNA-seq samples displayed high consistency with the TTP-mediated transcription in both data sets (Fig. 2a). These results indicated that TTP extensively regulated gene expression.
Based on the cut-off criteria, the upregulated DEGs were enriched in 66 GO terms, and the downregulated DEGs in 4 GO terms (see Additional files 3 and 4 for details). Strikingly, in the biological process terms of the GO analysis, the upregulated genes in the ZFP36-OE cells were primarily associated with the innate immune response, including the “type I interferon-mediated signaling pathway,” “response to virus,” “defense response to virus,” and “interferon-gamma-mediated signaling pathway.” The TTP up-regulated genes included, IL23A, OASL, TRIM22, IFIT2, HERC5, IFIT3, IFI27, TNF, CSF2, IL6, CCL2, RELB, CXCL2, TRAF1, and DDX58. TTP overexpression also resulted in the upregulation of genes enriched in the “cytokine-mediated signaling pathway” and “positive regulation of the apoptotic process” (Fig. 2b; for details see Additional file 4). In contrast, the downregulated genes were primarily enriched regarding “synaptic transmission.” The enrichment of genes involved in “signal transduction” was also observed (Fig. 2c).
When the corrected p-value for the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways were set at < 0.05; no pathways were enriched (Additional file 1: Figure S1; for details see Additional files 5 and 6). Surprisingly, when the adjusted p-value for the KEGG pathways were set at < 0.05, some genes were dysregulated in the TTP overexpressing samples annotated with KEGG categories and were mainly involved in the NF- κB signaling pathway (e.g., RELB, DDX58, CXCL2, IL1R1, and TRAF1) or chemokine signaling pathways (for details see Additional file 6).
We selected DEGs or non-DEGs involved in the immune response for further reverse transcription and quantitative real-time (qPCR) validation analysis. The qPCR results were highly consistent with the sequencing data (Fig. 2d and Table 2).
Table 2.
Overexpression | ||||
ZFP36-F | CTGTCACCCTCTGCCTTCTC | ZFP36-R | TCCCAGGGACTGTACAGAGG | |
Differentially expressed genes | ||||
IL23A-F | TCGGTGAACAACTGAGGG | IL23A-R | TCAAATCTGGCTGGCTCT | |
OASL-F | AGGCTGATATGGAAAACC | OASL-R | CTGTAGGCAGGCACAATG | |
TRIM22-F | GGAACCTCCGACCTAATC | TRIM22-R | ACAAACCCAGCAAATGAC | |
IFIT2-F | ATACATACCAAACAATGCCTAC | IRIT2-R | GAGCCACAGCGTGTCCTA | |
HERC5-F | GTGGAGAAATTGGGTATG | HERC5-R | TTAGGCTTGACAGGAAAC | |
IFIT3-F | ACACCAAACAATGGCTAC | IRIT3-R | AGGATTCAGTCCCTTCTC | |
TNF-F | CTCACATACTGACCCACG | TNR-R | AAGAGGCTGAGGAACAAG | |
IL6-F | CAGACAGCCACTCACCTC | IL6-R | CTCTTTGCTGCTTTCACA | |
CCL2-F | GAAAACTGAGGCACCAAG | CCL2-R | GGAGCTAGAGGAGGAACG | |
RelB-F | CCACGCCTGGTGTCTCGC | RelB-R | CGCTGCTTGGGCTGCTCC | |
CXCL2-F | CTGCGCTGCCAGTGCTTG | CXCL2-R | GCTTTCTGCCCATTCTTG | |
TRAF1-F | GGACCGTCAGCCTCTTCT | TRAR1-R | GCGCATCATACTCCCCTC | |
DDX58-F | CAGTGTATGAACAGCAGA | DDX58-R | GATGGATAGTGATGGAAT | |
B2M-F | GGTTTCATCCATCCGACATT | B2M-R | ACGGCAGGCATACTCATCTT | |
GDF15-F | CTTGTTAGCCAAAGACTGCC | GDF15-R | AACCTTGAGCCCATTCCACA | |
SLC6A12-F | GTGACACTCCCTTGGCTGGTG | SLC6A12-R | GCCTTCTTCATCCCCTACTT | |
HPV18-E6-F | ATAAGGTGCCTGCGGTGCC | HPV18-E6-R | TGCGTCGTTGGAGTCGTTC | |
HPV18-E7-F | GAGCACGACAGGAACGACT | HPV18-E7-R | GGGCTGGTAAATGTTGATGAT | |
HPV18-L1-F | CAGGTGGTGGCAATAAGCAGGA | HPV18-L1-F | TGGCGGCATGGGAACTTTCAG | |
GAPDH-F | GGTCGGAGTCAACGGATTTG | GAPDH-R | GGAAGATGGTGATGGGATTTC | |
Alternative splicing events | ||||
TRIM38 | AS1-F | TCGCCTCTGCTTATTCTA | AS1/AS2-R | CTTGATGACTCCTTAACATT |
AS2-F | CTTTGAGCAGGAGTTGGGCT | |||
IRF3 | AS1/AS2-F | GAAATCCTCCTGCTGTGCATC | AS1-R | GACGCTGGAGGCCGGACCAT |
AS2-R | TCCATCGTAGGCCGGACCAT | |||
TLR4 | AS1/AS2-F | GGTCAGACGGTGATAGCG | AS1-R | TAGGAACCACCTCCACGCAG |
AS2-R | TGTGGTTTAGGGCCAAGT | |||
LTBR | AS1/AS2-F | ACAAGCAAACGGAAGACC | AS1-R | CTGTGAGCCTCTTTGAGCTC |
AS2-R | GAGCTGCCTCCACCAGAC | |||
NOD1 | AS1 -F | GTTGTATAAACTTCAAGAGA | AS1/AS2-R | AAGGTGCTAAGCGAAGAG |
AS2-F | ATCCAGGATTTTGGTGAC | |||
CASP8 | AS1/AS2-F | CCTGCTGGATATTTTCAT | AS1-R | AACTCCTCCCCTTTGCTG |
AS2-R | CTTCAAGGCTGCTGCTTC | |||
MEF2A | AS1/AS2-F | GTAGCCCTTGGACTAGAAG | AS1-R | CCCAACCATTCTGTCCTATG |
AS2-R | TTCTTAAAGTCTGTCGGTTC | |||
MAP2K7 | AS1/AS2-F | CGGCGGCTCGACGGGGTC | AS1 -R | GGGCAGGAGCAGGGCTTAGAG |
AS2-R | AGCTGCAGGGTGGGCCTGGG | |||
ATF2 | AS1/AS2-F | CTGAAGCTTTCTTGAATTCATTCTC | AS1-R | ATGTGGCCAGATCAGACCCC |
AS2-R | GATCATTTGGCTGTCCATAAAC | |||
FLNA | AS1/AS2-F | CTACTCATTTTGAGGCGCGAGAAGC | AS1-R | GACCAGAAGGACAACTTCAAGCCCG |
AS2-R | GGAACAGCAGCGCAACCTCT | |||
KANK1 | AS1/AS2-F | TTCCATCCTCTTCAGTTG | AS1-R | CTTCGTGTTTAAAGCCCTC |
AS2-R | GGCATTCAACCTCTCAACAA | |||
SLC44A2 | AS1-F | CAGTGCCTCCCTCCAG | AS1/AS2-R | TTGTAAATGGGTCCTTTG |
AS2-F | CGGCCATGGAGGACGAGC | |||
CARHSP1 | AS1-F | ACAGCAAGTTAAAAAACAGTAGC | AS1/AS2-R | GGAAGCCTCCGGCCCTAT |
AS2-F | CATGGCTGACGTGTCTCCCG | |||
CREM | AS1/AS2-F | GGTCGGGCTCGCCGTCTC | AS1 -R | CACCACTTACCCGCCGCAAA |
AS2-R | AAGTTGGCATGTCACCAG | |||
TEAD2 | AS1/AS2-F | CTGGAGGATGGTGAAGTTTTCC | AS1-R | TTCCTCCAAGACGGAACGGG |
AS2-R | GGCAAGCAGGTGGTGGAG | |||
MYCBP2 | AS1/AS2-F | CTGAATGGTGAAATCCAC | AS1 -R | GAAGGAAGAGATGGAAGTGG |
AS2-R | TAAACGGGACAAGCACAAAG |
Since HeLa is a well-characterized HPV+ cervical cancer cell line [46, 47], it could be possible that the activated expression of the immune response genes by ZFP36 overexpression is due to an attempt to reactivate the expression of the HPV genome. To address this possibility, we detected the level of the HPV gene expression (E6, E7, and L1) by qRT-PCR analysis in ZFP36-overexpressed and control cells. None of the HPV genes displayed an increased expression upon ZFP36 overexpression (Fig. 2e). The specific PCR primer pairs that were designed are presented in Table 2 [48]. Moreover, we also mapped the RNA-seq reads in this study onto the HPV genome, which demonstrated that extremely few reads originated from HPV and supported the lack of HPV activation. These results confirmed the lack of HPV activation upon ZFP36 overexpression in HeLa cells.
TTP positively regulates gene expression in HeLa cells without associating with the presence of an AU-rich element
TTP negatively regulates immune response genes by binding to the ARE elements located at the 3′-UTR of the mRNAs of these target genes, which leads to target mRNA degradation [10]. We hypothesized that the upregulated gene expression in HeLa cells should not reflect its binding to AU-rich elements in the 3′-UTRs of immune response genes. Consistent with this hypothesis, we found that apart from IL-23A, the level of all reported TTP target gene expression involving the binding of the mRNA AU-rich elements was not substantially altered (Fig. 3a). To correlate TTP-regulated gene expression with its 3′-UTR binding activity, we analyzed the previously published iCLIP data [28] and obtained mouse macrophage mRNAs containing TTP binding peaks at the 3′-UTR regions. We then calculated the percentage of TTP-regulated genes in HeLa cells whose mouse homologues contain a TTP binding peak in the 3′-UTR of mRNA in mouse macrophages. The statistical analysis showed that TTP-mediated down-regulated genes contained more 3′-UTR binding sites in mice, consistent with the view that TTP may downregulate gene expression in HeLa cells via its canonical 3′-UTR binding activity (Fig. 3b). To further test whether the TTP-regulated genes in HeLa cells are related to the AU-rich elements in the 3′-UTRs, we performed a motif search analysis, which showed that the frequency of AU-rich elements were substantially higher in the TTP-mediated downregulated genes (Fig. 3c). Taken together, these results confirmed that TTP may downregulate the expression of some genes in HeLa cells via its known 3′-UTR binding activity. Moreover, these findings are consistent with our hypothesis that TTP might upregulate gene expression at the transcriptional level, which may be distinct from the TTP-mRNA binding activity.
TTP regulates the alternative splicing of a large number of immune-response genes
One key objective of this study was to gain an insight into the role of TTP in the regulation of alternative splicing. To use transcriptome data to explore the TTP-dependent AS events in HeLa cells, we assessed the data quality using an analysis of alternative splicing. Among the 83.3 M ± 14.2 M uniquely mapped reads from ZFP36-OE and control HeLa cells, 40.64–41.82% were junction reads (Table 1). When compared to the reference genome annotation, we found 68.66% annotated exons (252,220 out of 367,321 annotated exons), 166,260 annotated splice junctions, and 211,482 novel splice junctions by using the Tophat2 pipeline.
To investigate the global changes in the AS profiles in response to ZPF36 overexpression, AS events were analyzed from the RNA-seq dataset using ABLas software [49]. We detected 21,681 known alternative splicing events (ASEs) in the model gene that we termed the reference genome, and 49,136 novel ASEs, excluding intron retention events (Additional file 1: Table S2).
We applied a stringent cut-off p-value of ≤0.05, changed T-value ≥0.2 (See Methods) to identify regulated alternative splicing events (RASEs) with a high confidence, which resulted in 497 RASEs (the complete RASEs can be found in Additional files 7 and 8). TTP-regulated AS events included the Cassette exon (69)/exon skipping (86 ES), alternative 5′ splice site (127 A5SS), and alternative 3′ splice site (137 A5SS) (Fig. 4a). These data suggested that TTP globally regulated alternative splicing events in HeLa cells. To analyze whether the increase in AS events could be attributed to altered transcription [50], we overlapped the genes whose level of expression and alternative splicing were both regulated by TTP, and identified seven such genes: GARNL3, PVRL4, ABCA5, TTC21A, HES4, LRRC37A11P, and SLX1B-SULT1A4 (Fig. 4b). This finding indicated that transcriptional regulation and alternative splicing might be partially coupled.
It was further revealed that the genes regulated by TTP-mediated alternative splicing were highly enriched for “positive regulation of I-kappaB kinase/NF-kappaB,” “TRIF-dependent toll-like receptor signaling pathway,” “MyD88-independent toll-like receptor signaling pathway,” “toll-like receptor 3 signaling pathway,” and “regulation of transcription, DNA-dependent” (GO biological process terms, Fig. 4c). Enriched KEGG pathways (p < 0.05) included those involved in “Renal cell carcinoma,” “Notch signaling pathway,” and “TNF signaling pathway” (Fig. 4c).
To validate the alternative splicing events identified by the RNA-Seq data, 16 potential alternative splicing events were analyzed by q-PCR. PCR primer pairs (Table 2) were designed to amplify the long and short splicing isoforms in the same reaction. Out of 16 tested events, 13 alternative splicing events validated by q-PCR were in agreement with the RNA-Seq results. The 13 validated splicing events were located in the following genes (TRIM38, IRF3, TLR4, LTBR, CASP8, MEF2A, MAP2K7, ATF2, SLC44A2, CARHSP1, CREM, TEAD2, and MYCBP2) (Fig. 5 and Additional file 1: Figure S2).
Discussion
To our best knowledge, this study is the first to profile the entire transcriptome in a nonimmune cell line (HeLa cells) with the overexpression of ZFP36, which allows for the decoding of TTP-mediated regulation of gene expression and alternative splicing in a system unrelated to inflammatory stimulation. Interestingly, upon ZFP36 overexpression, the expression of genes associated with innate immunity, including those in the type I interferon signaling pathway and viral response, were specifically upregulated. In the absence of inflammatory stimuli, the upregulated expression of immune response genes were contradicted to the mRNA destabilization function of TTP via binding to the AU-rich element of the mRNA. Therefore, it is highly likely that TTP was able to promote the expression of immune response genes via a transcriptional regulatory mechanism associated with the predicted DNA binding activity. Furthermore, TTP preferentially regulated the alternative splicing of genes enriched in the positive regulation of the I-κB/NF-κB cascade, TRIF-dependent toll-like receptor signaling pathway, as well as the MAPK, TNF, and T cell receptor signaling pathways. Furthermore, our study indicated that TTP modulated the immune response via regulation of transcription and alternative mRNA splicing, thereby expanding our current understanding of the central role of TTP in regulating the immune response.
TTP is well-known for its capacity to regulate the mRNA stability of pro-inflammatory genes. This regulatory mechanism has been heavily used in the literature to explain its multiple roles in various physiological and pathological immune states [20–27]. However, a recent genome-wide study revealed that a large fraction of TTP binding events are not sufficient to drive mRNA destabilization [28]. Moreover, TTP binding of the intronic regions of pre-mRNAs is significant [28, 29], albeit with little reported function. Moreover, TTP-mediated regulation of a large number of alternative splicing events in HeLa cells is consistent with the reported abundant binding of TTP in the intronic RNA regions of mouse macrophages [28]. Considering the central role of NF-κB in immunity, inflammation, and cancer [51, 52], the enrichment of TTP-regulated alternative splicing genes in the I-κB/NF-κB cascade suggests a novel mechanism of TTP in the regulation of the immune response, and that it should be further explored regarding its mechanism as a tumor suppressor. NF-κB is a member of the transcription factor protein family, which includes five subunits: Rel (cRel), p65 (RelA, NF-κB3), RelB, p50 (NF-κB1), and p52 (NF-κB2). In addition, TTP is known to function as part of a negative feedback loop to limit the inflammatory response, including the negative regulation of NF-κB [53]. In the present study, we found that ZFP36 overexpression was associated with an increase in RELB gene expression, which could represent an additional mechanism whereby the NF-κB signaling pathway is regulated.
TTP enriched-regulation of alternatively spliced genes in the TRIF-dependent toll-like receptor, MAPK, TNF, and T cell receptor signaling pathways indicated that TTP-regulated alternative splicing mediated multiple critical biological functions. The TTP-regulated AS genes in these pathways included myocyte enhancer factor 2A (MEF2A), interferon regulatory factor 3 (IRF3), and Toll-like receptor 4 (TLR4) (Fig. 5). In particular, MEF2 has been well-established to contribute to numerous diseases and cancers. Moreover, it has been reported that MEF2A transcripts may include a β exon that increases the capacity of the encoded protein to activate transcription in both striated muscle and neural tissue [54]. Our identification of MEF2A as a TTP-regulated AS gene suggested that MEF2A-dependent transcription regulation might be involved in the immune response.
TLR4 is a member of the TLR family, which is highly expressed in macrophages, dendritic cells, epithelial cells, and B cells. In addition, the alternative splicing of TLR4 has been reported to regulate TLR4 signaling in both mouse and human immune cells [55–57]. IRF3 plays a key role in regulating the innate response against viral infection and IRF3 splicing variants have been reported to affect that ability of IRF3 to trigger the expression of type I interferons and the interferon-stimulated genes in infected cells [58]. Our findings regarding TTP-mediated alternative splicing of TLR4 and IRF3 suggested a more complex network among these immune-response genes.
Because the HeLa cell line is not a cell line exhibiting a normal immune response, its use may limit the biological applications of the findings obtained in this study. However, despite HeLa cells being a cancer cell line, they express genes with diverse biological functions other than tumorigenesis. For example, we showed that TTP and immune response genes were expressed in HeLa cells (74 pathways related to the immune response), at adequate levels when compared with that observed in macrophages in previous studies (for details see Additional file 9). The regulatory mechanisms presented in HeLa cells are likely presented in other cell types, although different cell types may exhibit their own specificity. For example, we have previously reported that a knockdown of PTBP1, a repressor of neuron differentiation, in HeLa cells globally promotes the expression of neuronal genes and neuron differentiation markers [59]. Thus, the regulatory loop established among the PTBP1-microRNA-transcription factors is common in both HeLa and neuronal cell lines [59]. Further studies are required to elucidate the biological relevance of TTP-regulated transcription and the alternative splicing of immune response genes.
Conclusions
Our study is the first to reveal that TTP extensively regulated the alternative splicing of genes involved in the innate immune response in HeLa cells, which could similarly occur in macrophages and other immune cells. The positive regulation of the gene expression enriched in the type I interferon signaling pathway and viral response has also been demonstrated, which is likely mediated through TTP-mediated binding of DNA targets in the nucleus. Future studies are required to explore the biological function of TTP-mediated alternative splicing, as well as confirm the interaction between TTP and DNA in regulating gene expression. Therefore, these findings revealed an elaborate regulatory TTP-regulatory network connecting transcription, alternative splicing, and mRNA stability, which could play a role in regulating the immune response and tumorigenesis beyond the research in the current study.
Methods
ZFP36 cloning and plasmid construction
Primer pairs used for Hot Fusion were designed by CE Design V1.04 with gene-specific sequences, in conjunction with the portion of the vector pIRES-hrGFP-1a sequences, each with a 17 bp–30 bp overlap.
F-primer: agcccgggcggatccgaattcATGGATCTGACTGCCATCTACG
R-primer: gtcatccttgtagtcctcgagCTCAGAAACAGAGAGGCGATTG
Vector pIRES-hrGFP-1a was digested by EcoRI and XhoI (NEB) at 37 °C for 2 h–3 h. The enzyme-digested vector was also run on a 1.0% agarose gel and purified using a Qiagen column kit. Human RNA was isolated using TRIzol reagent. Purified RNA was reverse transcribed into cDNA using oligo dT primer. Some fragments were synthesized via PCR. A linearized vector digested by EcoRI and XhoI (NEB) and PCR insert (978 bp) were added to PCR microtubes with ClonExpress® II One Step Cloning Kit (Vazyme). Plasmids were introduced into Escherichia coli by chemical transformation. The cells were plated onto LB plates containing ampicillin, and the plates were incubated overnight at 37 °C. Colonies were screened by colony PCR (28 cycles) using universal primers (located on the backbone vector). The PCR inert was verified by Sanger sequencing.
Cell culture and transfection
The human HeLa cell line was purchased from the Institute of Biochemistry and Cell Biology (Chinese Academy of Sciences, Shanghai, China). The cells were seeded into a petri dish (100 mm) at a density of 1 × 105 cells/mL per well, and cultured at 37 °C with 5% CO2 in Dulbecco’s Modified Eagle’s Medium (DMEM) containing 10% fetal bovine serum (FBS) (Hyclone), penicillin (100 U/mL), and streptomycin (100 g/mL). The transfection of HeLa cells with a ZFP36-overexpressing plasmid was performed using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The transfected cells were harvested after 48 h.
Assessment of ZFP36 overexpression
GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was used as a control. cDNA synthesis was performed using standard procedures and real time PCR was performed on the Bio-Rad S1000 with Bestar SYBR Green RT-PCR Master Mix (DBI Bioscience). The concentration of each transcript was then normalized to the level of GAPDH mRNA using the 2- ΔΔCT method [60]. Comparisons were performed with a paired Student’s t-test by using GraphPad Prism software (San Diego, CA).
Western blot analysis
Briefly, to prepare the total cell lysates, normal and ZFP36-overexpressing HeLa cells were lysed in RIPA buffer containing 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1.0% deoxycholate, 1% Triton X-100, 1 mM EDTA, and 0.1% SDS. The samples were centrifuged (12,000×g for 5 min) and the supernatants were further analyzed on a 10% SDS-PAGE gel and subsequently transferred onto a PVDF membrane (Millipore). TTP was detected using a monoclonal Flag antibody (Sigma-Aldrich) diluted in TBST (1:2000) and Action (Abclonal) was used as the loading control (1:2000).
Library preparation and sequencing
Total RNA was extracted using TRIzol (Ambion). The RNA was further purified with two phenol-chloroform treatments and RQ1 DNase (Promega) was administered to remove the DNA. The quality and quantity of the purified RNA was assessed by measuring the absorbance at 260 nm/280 nm (A260/A280) using a Smartspec Plus (BioRad). The integrity of the RNA was further verified by 1.5% agarose gel electrophoresis.
For each sample, 1 μg of the total RNA was used for RNA-seq library preparation via VAHTS Stranded mRNA-seq Library Prep Kit (Vazyme). Polyadenylated mRNA was purified and fragmented, and then converted into double stranded cDNA. After the step of end repair and A tailing, the DNAs were ligated to VAHTS RNA Adapters (Vazyme). The purified ligation products corresponding to 200–500 bps were digested with heat-labile UDG, and the single stranded cDNA was amplified, purified, quantified, and stored at − 80 °C before sequencing.
For high-throughput sequencing, the libraries were prepared following the manufacturer’s instructions and applied to the Illumina HiSeq X Ten system for 150 nt paired-end sequencing.
Real-time qPCR validation of DEGs and AS events
In this study, to elucidate the validity of the RNA-seq data, qPCR was performed for some selected DEGs, and normalized to the reference gene, GAPDH. Information regarding the primers is presented in Table 2. The same RNA samples for RNA-seq were used for qPCR. The PCR conditions consist of denaturing at 95 °C for 10 min, 40 cycles of denaturing at 95 °C for 15 s, followed by annealing and extension at 60 °C for 1 min. PCR amplifications were performed in triplicate for each sample.
Moreover, a qPCR assay was used to analyze the alternative splicing events in HeLa cells. The primers used to detect the pre-mRNA splicing are presented in Table 2. To detect one of the alternative isoforms, one primer was designed in the alternative exon, and an opposing primer was designed in a constitutive exon. To detect the other alternative isoform, a boundary-spanning primer for the sequence encompassing the exon-exon junction with the opposing primer in a constitutive exon was used.
Bioinformatics analysis and statistical analysis
The adaptors and low quality bases were trimmed from raw sequencing reads by using FASTX-Toolkit (Version 0.0.13). The filtered reads were then aligned to the GRCh38 genome by TopHat2 [61], allowing four mismatches. Uniquely aligned reads were selected to calculate the fragments per kilobase per million mapped reads (FPKM) that represents the expression levels of genes [44]. The software edgeR [45] was utilized to screen for DEGs, based on fold change (FC ≥ 1.5) and false discovery rate (FDR < 0.05). To predict the gene function and calculate the functional category distribution frequency, enriched KEGG pathway and Gene Ontology (GO) terms were identified by using KOBAS 2.0 server [62] and in house tool, respectively. Hypergeometric test and Benjamini-Hochberg FDR controlling procedure were used to define the enriched significance of each pathway (corrected p-value < 0.05). The alternative splicing events (ASEs) and regulated alternative splicing events (RASEs) between the samples were defined and quantified using the ABLas pipeline as described previously [49]. After detecting the ASEs in each RNA-seq sample, Fisher’s exact test was used to calculate significant p-values, with the alternative reads and model reads of the samples as input data, respectively. The change ratio of alternatively spliced reads and constitutively spliced reads between the compared samples was defined as the RASE ratio. We set p-value < 0.05 and RASE ratio > 0.2 as the thresholds for RASE detection.
To explore the mRNA binding profile of TTP, we obtained and analyzed mouse macrophage mRNAs containing TTP binding peaks at the 3′-UTR regions from published data (GSE63466).
Additional files
Acknowledgements
We thank International Science Editing (http://www.internationalscienceediting.com) for editing this manuscript. We are very thankful Dr. Yi Zhang’s team members for helpful discussions.
Funding
This work was supported by the National Science Foundations of HUBEI (No. 2018CFB235). The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Availability of data and materials
RNA-seq data in this publication have been deposited in NCBI’s Gene Expression Omnibus and are accessible through GEO series accession number GSE114216.
All additional data analysed during this study are included in this published article [and its additional files].
Abbreviations
- ASEs
Alternative splicing events
- Cassette exon
CassetteExon
- ES
Exon skipping
- FPKM
Fragments per kilo base of exon model per million fragments mapped
- MXE
Mutual exclusive exon skipping
- PTGR
Post-transcriptional gene regulation
- RASEs
Regulated alternative splicing events
- RBPs
RNA-binding proteins
- TTP
Tristetraprolin
Authors’ contributions
YT and XW conceived the project, designed and supervised the Experiments. YT, FY, JD, ZC, and JW performed the experiment. YW, ZZ, WL, and LL analyzed the data. YT, FY and YZ drafted the manuscript. All authors reviewed the draft manuscript and approved the final version of the manuscript.
Ethics approval and consent to participate
Not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Yafang Tu, Email: tuyafang2006@163.com.
Xiongfei Wu, Email: wuxfei@126.com.
Fengyun Yu, Email: fengyunyu@ablife.cc.
Jianzhong Dang, Email: 359515393@qq.com.
Juan Wang, Email: 654368009@qq.com.
Yaxun Wei, Email: yaxunwei@ablife.cc.
Zhitao Cai, Email: 615956443@qq.com.
Zhipeng Zhou, Email: zhipengzhou@ablife.cc.
Wenliang Liao, Email: 258275054@qq.com.
Lian Li, Email: hawk1218@qq.com.
Yi Zhang, Email: yizhang@ablife.cc.
References
- 1.Castello A, Fischer B, Hentze MW, Preiss T. RNA-binding proteins in Mendelian disease. Trends Genet. 2013;29(5):318–327. doi: 10.1016/j.tig.2013.01.004. [DOI] [PubMed] [Google Scholar]
- 2.Fu XD, Ares M., Jr Context-dependent control of alternative splicing by RNA-binding proteins. Nat Rev Genet. 2014;15(10):689–701. doi: 10.1038/nrg3778. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Gerstberger S, Hafner M, Tuschl T. A census of human RNA-binding proteins. Nat Rev Genet. 2014;15(12):829–845. doi: 10.1038/nrg3813. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.van Kouwenhove M, Kedde M, Agami R. MicroRNA regulation by RNA-binding proteins and its implications for cancer. Nat Rev Cancer. 2011;11(9):644–656. doi: 10.1038/nrc3107. [DOI] [PubMed] [Google Scholar]
- 5.Kwon SC, Yi H, Eichelbaum K, Fohr S, Fischer B, You KT, Castello A, Krijgsveld J, Hentze MW, Kim VN. The RNA-binding protein repertoire of embryonic stem cells. Nat Struct Mol Biol. 2013;20(9):1122–1130. doi: 10.1038/nsmb.2638. [DOI] [PubMed] [Google Scholar]
- 6.Fu M, Blackshear PJ. RNA-binding proteins in immune regulation: a focus on CCCH zinc finger proteins. Nat Rev Immunol. 2017;17(2):130–143. doi: 10.1038/nri.2016.129. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Khalaj K, Miller JE, Fenn CR, Ahn S, Luna RL, Symons L, Monsanto SP, Koti M, Tayade C. RNA-binding proteins in female reproductive pathologies. Am J Pathol. 2017;187(6):1200–1210. doi: 10.1016/j.ajpath.2017.01.017. [DOI] [PubMed] [Google Scholar]
- 8.Turner M, Diaz-Munoz MD. RNA-binding proteins control gene expression and cell fate in the immune system. Nat Immunol. 2018;19(2):120–129. doi: 10.1038/s41590-017-0028-4. [DOI] [PubMed] [Google Scholar]
- 9.Ray D, Kazan H, Cook KB, Weirauch MT, Najafabadi HS, Li X, Gueroussov S, Albu M, Zheng H, Yang A, et al. A compendium of RNA-binding motifs for decoding gene regulation. Nature. 2013;499(7457):172–177. doi: 10.1038/nature12311. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Kafasla P, Skliris A, Kontoyiannis DL. Post-transcriptional coordination of immunological responses by RNA-binding proteins. Nat Immunol. 2014;15(6):492–502. doi: 10.1038/ni.2884. [DOI] [PubMed] [Google Scholar]
- 11.Lai WS, Stumpo DJ, Blackshear PJ. Rapid insulin-stimulated accumulation of an mRNA encoding a proline-rich protein. J Biol Chem. 1990;265(27):16556–16563. [PubMed] [Google Scholar]
- 12.Taylor GA, Lai WS, Oakey RJ, Seldin MF, Shows TB, Eddy RL, Jr, Blackshear PJ. The human TTP protein: sequence, alignment with related proteins, and chromosomal localization of the mouse and human genes. Nucleic Acids Res. 1991;19(12):3454. doi: 10.1093/nar/19.12.3454. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.DuBois RN, McLane MW, Ryder K, Lau LF, Nathans D. A growth factor-inducible nuclear protein with a novel cysteine/histidine repetitive sequence. J Biol Chem. 1990;265(31):19185–19191. [PubMed] [Google Scholar]
- 14.Taylor GA, Carballo E, Lee DM, Lai WS, Thompson MJ, Patel DD, Schenkman DI, Gilkeson GS, Broxmeyer HE, Haynes BF, et al. A pathogenetic role for TNF alpha in the syndrome of cachexia, arthritis, and autoimmunity resulting from tristetraprolin (TTP) deficiency. Immunity. 1996;4(5):445–454. doi: 10.1016/s1074-7613(00)80411-2. [DOI] [PubMed] [Google Scholar]
- 15.Carballo E, Lai WS, Blackshear PJ. Feedback inhibition of macrophage tumor necrosis factor-alpha production by tristetraprolin. Science. 1998;281(5379):1001–1005. doi: 10.1126/science.281.5379.1001. [DOI] [PubMed] [Google Scholar]
- 16.Lai WS, Carballo E, Strum JR, Kennington EA, Phillips RS, Blackshear PJ. Evidence that tristetraprolin binds to AU-rich elements and promotes the deadenylation and destabilization of tumor necrosis factor alpha mRNA. Mol Cell Biol. 1999;19(6):4311–4323. doi: 10.1128/mcb.19.6.4311. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Kratochvill F, Machacek C, Vogl C, Ebner F, Sedlyarov V, Gruber AR, Hartweger H, Vielnascher R, Karaghiosoff M, Rulicke T, et al. Tristetraprolin-driven regulatory circuit controls quality and timing of mRNA decay in inflammation. Mol Syst Biol. 2011;7:560. doi: 10.1038/msb.2011.93. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Lai WS, Parker JS, Grissom SF, Stumpo DJ, Blackshear PJ. Novel mRNA targets for tristetraprolin (TTP) identified by global analysis of stabilized transcripts in TTP-deficient fibroblasts. Mol Cell Biol. 2006;26(24):9196–9208. doi: 10.1128/MCB.00945-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Emmons J, Townley-Tilson WH, Deleault KM, Skinner SJ, Gross RH, Whitfield ML, Brooks SA. Identification of TTP mRNA targets in human dendritic cells reveals TTP as a critical regulator of dendritic cell maturation. RNA. 2008;14(5):888–902. doi: 10.1261/rna.748408. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Georg Stoecklin SAT. Genome-wide analysis identifies Interleukin-10 mRNA as target of Tristetraprolin. J Biol Chem. 2008;283(17):11689–11699. doi: 10.1074/jbc.M709657200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Stoecklin G, Ming XF, Looser R, Moroni C. Somatic mRNA turnover mutants implicate tristetraprolin in the interleukin-3 mRNA degradation pathway. Mol Cell Biol. 2000;20(11):3753–3763. doi: 10.1128/mcb.20.11.3753-3763.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Boutaud O, Dixon DA, Oates JA, Sawaoka H. Tristetraprolin binds to the COX-2 mRNA 3′-untranslated region in cancer cells. Adv Exp Med Biol. 2003;525:157–160. doi: 10.1007/978-1-4419-9194-2_32. [DOI] [PubMed] [Google Scholar]
- 23.Brooks SA, Connolly JE, Rigby WF. The role of mRNA turnover in the regulation of tristetraprolin expression: evidence for an extracellular signal-regulated kinase-specific, AU-rich element-dependent, autoregulatory pathway. J Immunol. 2004;172(12):7263–7271. doi: 10.4049/jimmunol.172.12.7263. [DOI] [PubMed] [Google Scholar]
- 24.Phillips K, Kedersha N, Shen L, Blackshear PJ, Anderson P. Arthritis suppressor genes TIA-1 and TTP dampen the expression of tumor necrosis factor alpha, cyclooxygenase 2, and inflammatory arthritis. Proc Natl Acad Sci. 2004;101:2011–2016. doi: 10.1073/pnas.0400148101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Linker K, Pautz A, Fechir M, Hubrich T, Greeve J, Kleinert H. Involvement of KSRP in the post-transcriptional regulation of human iNOS expression-complex interplay of KSRP with TTP and HuR. Nucleic Acids Res. 2005;33(15):4813–4827. doi: 10.1093/nar/gki797. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ogilvie RL, Abelson M, Hau HH, Vlasova I, Blackshear PJ, Bohjanen PR. Tristetraprolin down-regulates IL-2 gene expression through AU-rich element-mediated mRNA decay. J Immunol. 2005;174:953–961. doi: 10.4049/jimmunol.174.2.953. [DOI] [PubMed] [Google Scholar]
- 27.Carballo E, Lai WS, Blackshear PJ. Evidence that tristetraprolin is a physiological regulator of granulocyte-macrophage colony-stimulating factor messenger RNA deadenylation and stability. Blood. 2000;95:1891–1899. [PubMed] [Google Scholar]
- 28.Sedlyarov V, Fallmann J, Ebner F, Huemer J, Sneezum L, Ivin M, Kreiner K, Tanzer A, Vogl C, Hofacker I, et al. Tristetraprolin binding site atlas in the macrophage transcriptome reveals a switch for inflammation resolution. Mol Syst Biol. 2016;12(5):868. doi: 10.15252/msb.20156628. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Tiedje C, Diaz-Munoz MD, Trulley P, Ahlfors H, Laass K, Blackshear PJ, Turner M, Gaestel M. The RNA-binding protein TTP is a global post-transcriptional regulator of feedback control in inflammation. Nucleic Acids Res. 2016;44(15):7418–7440. doi: 10.1093/nar/gkw474. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Clark AR, Dean JL. The control of inflammation via the phosphorylation and dephosphorylation of tristetraprolin: a tale of two phosphatases. Biochem Soc Trans. 2016;44(5):1321–1337. doi: 10.1042/BST20160166. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Bhatt DM, Pandya-Jones A, Tong AJ, Barozzi I, Lissner MM, Natoli G, Black DL, Smale ST. Transcript dynamics of proinflammatory genes revealed by sequence analysis of subcellular RNA fractions. Cell. 2012;150(2):279–290. doi: 10.1016/j.cell.2012.05.043. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Hao S, Baltimore D. RNA splicing regulates the temporal order of TNF-induced gene expression. Proc Natl Acad Sci U S A. 2013;110(29):11934–11939. doi: 10.1073/pnas.1309990110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Chen J, Cascio J, Magee JD, Techasintana P, Gubin MM, Dahm GM, Calaluce R, Yu S, Atasoy U. Posttranscriptional gene regulation of IL-17 by the RNA-binding protein HuR is required for initiation of experimental autoimmune encephalomyelitis. J Immunol. 2013;191(11):5441–5450. doi: 10.4049/jimmunol.1301188. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Galarza-Munoz G, Briggs FBS, Evsyukova I, Schott-Lerner G, Kennedy EM, Nyanhete T, Wang L, Bergamaschi L, Widen SG, Tomaras GD, et al. Human epistatic interaction controls IL7R splicing and increases multiple sclerosis risk. Cell. 2017;169(1):72–84. doi: 10.1016/j.cell.2017.03.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Mallory MJ, Allon SJ, Qiu J, Gazzara MR, Tapescu I, Martinez NM, Fu XD, Lynch KW. Induced transcription and stability of CELF2 mRNA drives widespread alternative splicing during T-cell signaling. Proc Natl Acad Sci U S A. 2015;112(17):E2139–E2148. doi: 10.1073/pnas.1423695112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Mino T, Murakawa Y, Fukao A, Vandenbon A, Wessels HH, Ori D, Uehata T, Tartey S, Akira S, Suzuki Y, et al. Regnase-1 and Roquin regulate a common element in inflammatory mRNAs by spatiotemporally distinct mechanisms. Cell. 2015;161(5):1058–1073. doi: 10.1016/j.cell.2015.04.029. [DOI] [PubMed] [Google Scholar]
- 37.Brennan SEKY, Alkharouf N, Blackshear PJ, Gorospe M, et al. The mRNAdestabilizing protein tristetraprolin is suppressed in many cancers, altering tumorigenic phenotypes and patient prognosis. Cancer Res. 2009;69:5168–5176. doi: 10.1158/0008-5472.CAN-08-4238. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Bourcier C, Griseri P, Grepin R, Bertolotto C, Mazure N, Pages G. Constitutive ERK activity induces downregulation of tristetraprolin, a major protein controlling interleukin8/CXCL8 mRNA stability in melanoma cells. Am J Physiol Cell Physiol. 2011;301(3):C609–C618. doi: 10.1152/ajpcell.00506.2010. [DOI] [PubMed] [Google Scholar]
- 39.Suswam ELY, Zhang X, Gillespie GY, Li X, et al. Tristetraprolin down-regulates interleukin-8 and vascular endothelial growth factor in malignant glioma cells. Cancer Res. 2008;68(3):674–682. doi: 10.1158/0008-5472.CAN-07-2751. [DOI] [PubMed] [Google Scholar]
- 40.Van Tubergen EVBR, Lee J, Wolf G, Carey T, et al. Tristetraprolin regulates interleukin-6, which is correlated with tumor progression in patients with head and neck squamous cell carcinoma. Cancer Res. 2011;117:2677–2689. doi: 10.1002/cncr.25859. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Lee HH, Yang SS, Vo MT, Cho WJ, Lee BJ, Leem SH, Lee SH, Cha HJ, Park JW. Tristetraprolin down-regulates IL-23 expression in colon cancer cells. Mol Cells. 2013;36(6):571–576. doi: 10.1007/s10059-013-0268-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Taylor GA, Thompson MJ, Lai WS, Blackshear PJ. Phosphorylation of tristetraprolin, a potential zinc finger transcription factor, by mitogen stimulation in intact cells and by mitogen-activated protein kinase in vitro. J Biol Chem. 1995;270(22):13341–13347. doi: 10.1074/jbc.270.22.13341. [DOI] [PubMed] [Google Scholar]
- 43.Taylor GA, Thompson MJ, Lai WS, Blackshear PJ. Mitogens stimulate the rapid nuclear to cytosolic translocation of tristetraprolin, a potential zinc-finger transcription factor. Mol Endocrinol. 1996;10(2):140–146. doi: 10.1210/mend.10.2.8825554. [DOI] [PubMed] [Google Scholar]
- 44.Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, Van Baren MJ, Salzberg SL, Wold BJ, Pachter L. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol. 2010;28(5):511–515. doi: 10.1038/nbt.1621. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010;26(1):139–140. doi: 10.1093/bioinformatics/btp616. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Adey A, Burton JN, Kitzman JO, Hiatt JB, Lewis AP, Martin BK, Qiu R, Lee C, Shendure J. The haplotype-resolved genome and epigenome of the aneuploid HeLa cancer cell line. Nature. 2013;500(7461):207–211. doi: 10.1038/nature12064. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Landry JJ, Pyl PT, Rausch T, Zichner T, Tekkedil MM, Stutz AM, Jauch A, Aiyar RS, Pau G, Delhomme N, et al. The genomic and transcriptomic landscape of a HeLa cell line. G3 (Bethesda) 2013;3(8):1213–1224. doi: 10.1534/g3.113.005777. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Li Y, Qi H, Li X, Hou X, Lu X, Xiao X. A novel dithiocarbamate derivative induces cell apoptosis through p53-dependent intrinsic pathway and suppresses the expression of the E6 oncogene of human papillomavirus 18 in HeLa cells. Apoptosis. 2015;20(6):787–795. doi: 10.1007/s10495-015-1114-4. [DOI] [PubMed] [Google Scholar]
- 49.Xia H, Chen D, Wu Q, Wu G, Zhou Y, Zhang Y, Zhang L. CELF1 preferentially binds to exon-intron boundary and regulates alternative splicing in HeLa cells. Biochim Biophys Acta Gene Regul Mech. 2017;1860(9):911–921. doi: 10.1016/j.bbagrm.2017.07.004. [DOI] [PubMed] [Google Scholar]
- 50.Naftelberg S, Schor IE, Ast G, Kornblihtt AR. Regulation of alternative splicing through coupling with transcription and chromatin structure. Annu Rev Biochem. 2015;84:165–198. doi: 10.1146/annurev-biochem-060614-034242. [DOI] [PubMed] [Google Scholar]
- 51.Ben-Neriah Y, Karin M. Inflammation meets cancer, with NF-kappaB as the matchmaker. Nat Immunol. 2011;12(8):715–723. doi: 10.1038/ni.2060. [DOI] [PubMed] [Google Scholar]
- 52.Zhang Q, Lenardo MJ, Baltimore D. 30 years of NF-kappaB: a blossoming of relevance to human pathobiology. Cell. 2017;168(1–2):37–57. doi: 10.1016/j.cell.2016.12.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Afonina IS, Zhong Z, Karin M, Beyaert R. Limiting inflammation-the negative regulation of NF-kappaB and the NLRP3 inflammasome. Nat Immunol. 2017;18(8):861–869. doi: 10.1038/ni.3772. [DOI] [PubMed] [Google Scholar]
- 54.Zhu B, Ramachandran B, Gulick T. Alternative pre-mRNA splicing governs expression of a conserved acidic transactivation domain in myocyte enhancer factor 2 factors of striated muscle and brain. J Biol Chem. 2005;280(31):28749–28760. doi: 10.1074/jbc.M502491200. [DOI] [PubMed] [Google Scholar]
- 55.Iwami KIMT, Masuda A, Kikuchi T, Musikacharoen T, Yoshikai Y, Xue Y, Zhou TW, Zhu T, Ji X, Kwon YS, Zhang C, Yeo G, Black DL, Sun H. Cutting edge: naturally occurring soluble form of mouse toll-like receptor 4 inhibits lipopolysaccharide signaling. J Immunol. 2000;165(12):6682–6686. doi: 10.4049/jimmunol.165.12.6682. [DOI] [PubMed] [Google Scholar]
- 56.Li JP, Chen Y, Ng CH, Fung ML, Xu A, Cheng B, Tsao SW, Leung WK. Differential expression of toll-like receptor 4 in healthy and diseased human gingiva. J Periodontal Res. 2014;49(6):845–854. doi: 10.1111/jre.12173. [DOI] [PubMed] [Google Scholar]
- 57.Jaresova IRD, Spisek R, Janda A, Brazova J, Sediva A. Kinetics of Tolllike receptor-4 splice variants expression in lipopolysaccharide-stimulated antigen presenting cells of healthy donors and patients with cystic fibrosis. Microbes Infect. 2007;9:1359–1367. doi: 10.1016/j.micinf.2007.06.009. [DOI] [PubMed] [Google Scholar]
- 58.Ysebrant de Lendonck L, Martinet V, Goriely S. Interferon regulatory factor 3 in adaptive immune responses. Cell Mol Life Sci. 2014;71(20):3873–3883. doi: 10.1007/s00018-014-1653-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Xue Y, Ouyang K, Huang J, Zhou Y, Ouyang H, Li H, Wang G, Wu Q, Wei C, Bi Y, et al. Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated MicroRNA circuits. Cell. 2013;152(1–2):82–96. doi: 10.1016/j.cell.2012.11.045. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 2001;25(4):402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 61.Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, Salzberg SL. TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 2013;14;R36. [DOI] [PMC free article] [PubMed]
- 62.Xie C, Mao X, Huang J, Ding Y, Wu J, Dong S, Kong L, Gao G, Li CY, Wei L. KOBAS 2.0: a web server for annotation and identification of enriched pathways and diseases. Nucleic Acids Res. 2011;39(Web Server issue):W316–W322. doi: 10.1093/nar/gkr483. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
RNA-seq data in this publication have been deposited in NCBI’s Gene Expression Omnibus and are accessible through GEO series accession number GSE114216.
All additional data analysed during this study are included in this published article [and its additional files].