MiR-21 functions as a key regulator of IR-induced fibrotic EMT in lung epithelial cells via the miR-21/PTEN/Akt axis.
Abstract
Radiation-induced pulmonary fibrosis (RIPF) results from thoracic radiotherapy and severely limits the use of radiotherapy. Recent studies suggest that epithelium-to-mesenchymal transition (EMT) contributes to pulmonary fibrosis. Although miRNA dysregulation participates in a variety of pathophysiologic processes, their roles in fibrotic lung diseases and EMT are unclear. In this study, we aimed to identify key miRNAs involved in this process using a mouse model of RIPF previously established by irradiation with a single dose (20 Gy) of 60Co γ-rays. At 2-weeks post-irradiation, a set of significantly upregulated miRNAs was identified in lung tissue by miRNA array analysis. This included miR-21, which has been reported to contribute to the pulmonary fibrotic response induced by stereotactic body radiotherapy. Here, we showed that miR-21 expression increased in parallel with EMT progression in the lungs of irradiated mice. Ectopic miR-21 expression promoted EMT progression in lung epithelial cells. Furthermore, downregulation of miR-21 expression by transfection of its inhibitor inhibited ionizing radiation (IR)-induced EMT. Knockdown of PTEN, which is the functional target of miR-21, reversed the attenuation of IR-induced EMT mediated by miR-21 downregulation. Radiation treatment decreased PTEN expression and increased Akt phosphorylation; these effects were abolished by the miR-21 inhibitor. MiR-21 overexpression in lung epithelial cell also downregulated PTEN expression and upregulated Akt phosphorylation. In conclusion, we have demonstrated that miR-21 functions as a key regulator of IR-induced EMT in lung epithelial cells via the PTEN/Akt pathway. Targeting miR-21 is implicated as a novel therapeutic strategy for the prevention of RIPF.
Introduction
Thoracic radiotherapy is commonly used for the treatment of lung cancer, esophageal cancer, and various lymphomas in the clinic.1 However, chest radiotherapy can result in normal tissue complications, including radiation pneumonitis and radiation-induced pulmonary fibrosis (RIPF). The main features of RIPF are alveolar epithelial cell injury and accumulation of fibroblasts and myofibroblasts, and deposition of collagen and extracellular matrix (ECM) proteins. The resulting scar formation leads to impaired lung function.2
Fibroblasts play a central role in the pathogenesis of RIPF by mediating ECM deposition, structural remodeling, and disruption of the blood–blood barrier in pulmonary tissue.3 Their origin has become a hot topic of research. Fibroblasts are believed to derive mainly from the proliferation of resident fibrosis, although more recently evidence suggests that lung tissue damage is accompanied by changes in the microenvironment of the lung epithelial cells. These changes trigger the transformation of epithelial cells into fibroblasts and myofibroblasts in the form of mesenchymal cells,4 a process known as epithelial-to-mesenchymal transition (EMT).5,6 EMT is a highly regulated process by which differentiated epithelial cells lose their polarity and expression of epithelial markers, such as E-cadherin. Furthermore, this process results in reduced adhesion between cells and other epithelial cells, and the acquisition of the characteristics of migration and differentiation as well as the expression of markers typical of other interstitial cells, such as N-cadherin and vimentin.7–10 Studies support the role of EMT in pulmonary fibrosis.11–14 However, the role and mechanism of ionizing radiation (IR)-induced EMT in RIPF remain to be elucidated.
MicroRNAs (miRNAs) are small non-coding RNAs (17–24 nucleotides) that mediate post-transcriptional silencing of genes by binding to the 3′-UTR region of mRNA.15–19 MiRNAs have been found to regulate a variety of cellular processes, including cell proliferation, differentiation, migration, and disease occurrence and development.20 A growing body of evidence suggests that miRNAs participate in the process of pulmonary fibrosis.21 In addition, miRNAs are important regulators of EMT.22
MiR-21 plays crucial roles in biological functions such as development and inflammation as well as disorders including cancer and cardiovascular diseases.23 MiR-21 expression is significantly increased in a number of solid tumors, including lung, breast, colon, gastric and pancreatic cancer,24–29 and is therefore classified as an oncomiR. Additional roles of miR-21 in cardiac, pulmonary and renal fibrosis have also been documented.30–32 MiR-21 expression has been shown to be highly upregulated in the lungs in a bleomycin-induced pulmonary fibrosis mouse model and in the lungs of patients with idiopathic pulmonary fibrosis.31 More recently, Kwon et al. reported that induction of miR-21 by stereotactic body radiotherapy (SBRT) contributed to the pulmonary fibrotic response and also that specific inhibition of miR-21 significantly reduced collagen synthesis in lung fibroblasts,33 although the mechanism is unclear.
In this study, we aimed to identify key miRNAs involved in this process using a previously established mouse model of RIPF.34 Following irradiation of mice with a single dose (20 Gy) of 60Co γ-rays for 2 weeks, a key time point for RIPF, we performed miRNA array analysis of the total RNAs isolated from the lungs. Our results indicated that miR-21 functions as a key regulator of IR-induced EMT in lung epithelial cells via the PTEN/Akt pathway.
Materials and methods
Mice and mice treatment
Healthy male C57BL/6 wild-type mice (aged 6–8 weeks, 20–24 g) were purchased from Vital River Laboratory Animal Co. (Beijing, China) and housed under environmentally controlled conditions (22 °C, 12 h light/dark cycle) with free access to standard laboratory chow and water ad libitum. The mice were randomly divided into non-irradiation control group and irradiation group (n = 3).
For thoracic irradiation, doses and uniformity of distribution were determined before initiating the study as described previously.34 Mice were anesthetized using an intraperitoneal injection of 1% pentobarbital sodium (50 mg per kg body weight), and they then received a single dose of thoracic irradiation (20 Gy) with a 60Co γ-ray source at a dose rate of 200 cGy min–1. Organs above and below the thorax were shielded with 10 cm-thick lead bricks. The animals were sacrificed by dislocating cervical vertebrae at 2 weeks post irradiation. All described experiments strictly adhered to the Laboratory Animals Guideline of welfare and ethics (GB/T 35892-2018) and all animal experiments were approved by Animal Care and Use Committee of Beijing Institute of Radiation Medicine.
MiRNA array analysis
Total RNAs were isolated from mouse lungs harvested at days 0 and 14 after irradiation (n = 3 per group) using the smiRNAeasy Mini Kit (QIAGEN, Germany). The miRNA analysis was performed by CapitalBio Technology Co. (Beijing, China).
Cell culture and reagents
The cell lines used in this study (human alveolar type II epithelial carcinoma cell line A549 and human bronchial epithelial cell line BEAS-2B) were maintained in our laboratory. A549 and HEK293T cells were cultured in high glucose Dulbecco's modified Eagle's medium (DMEM; HyClone, USA) supplemented with 10% prime fetal bovine serum (FBS; ExCell Bio, Cat. No. FSP500, China); BEAS-2B cells were cultured in LHC-8 medium (Gibco, USA). All cells were cultured at 37 °C under 5% CO2 in a humidified incubator. Cells were subjected to 60Co γ-ray irradiation at a dose rate of 80.74 cGy min–1 at room temperature.
Primers, siRNAs, miRNA mimics and miRNA inhibitors
Primers used in this study were synthesized by AuGCT DNA-SYN Biotechnology Company (Beijing, China). SiRNA duplexes, miRNA mimics and miRNA inhibitors were purchased from Shanghai GenePharma Company (Shanghai, China). Details of the sequences of primers are shown in Table 1. The sequences of siPTEN, miRNA mimic NC, miRNA inhibitor NC, miR-21-5p mimic and miR-21-5p inhibitor are shown in Table 2.
Table 1. Primer sequence of miR-21, U6, PTEN and β-actin.
| Type | Sequence |
| Hsa-miR-21-F: | GCCCGCTAGCTTATCAGACTGATG |
| Hsa-miR-21-R: | GTGCAGGGTCCGAGGT |
| PTEN-F: | AGAACTTATCAAACCCTT |
| PTEN-R: | GTCCTTACTTCCCCAT |
| Hsa-U6-F: | ATTGGAACGATACAGAGAAGATT |
| Hsa-U6-R: | GGAACGCTTCACGAATTTG |
| β-actin-F: | GAATCAATGCAAGTTCGGTTCC |
| β-actin-R: | TCATCTCCGCTATTAGCTCCG |
Table 2. Sequence of siPTEN, miRNA mimics NC, miRNA inhibitor NC, miR-21-5p mimics and miR-21-5p inhibitor.
| Type | Sequence |
| miRNA mimics NC: | Sense: UUCUCCGAACGUGUCACGUTT |
| Antisense: ACGUGACACGUUCGGAGAATT | |
| miRNA inhibitor NC: | CAGUACUUUUGUGUAGUACAA |
| miR-21-5p mimics: | Sense: UAGCUUAUCAGACUGAUGUUGA |
| Antisense: AACAUCAGUCUGAUAAGCUAUU | |
| miR-21-5p inhibitor: | UCAACAUCAGUCUGAUAAGCUA |
| siPTEN: | Sense: GUAUGACAACAGCCUCAAGTT |
| Antisense: CUUGAGGCUGUUGUCAUACTT |
Transfection
Synthetic RNA molecules, including the miR-21 mimic, miR-21-MUT mimic, miR-21 inhibitor, siRNA PTEN and corresponding scrambled control RNAs were purchased from GenePharma Company (Shanghai, China). Cells were seeded in six-well plates or 60 cm dishes, and transfected the following day (60%–70% confluence) using Lipofectamine2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. Transfections were carried out with 20 pmol RNA or 2.5 μg plasmids per 105 cells. Cells were harvested 48 h after transfection for real-time PCR or western blot analysis.
RNA isolation and miRNA quantification by RT-qPCR
Total RNA was extracted from cells or tissues using TRIzol Reagent (Sigma, USA) according to the manufacturer's instructions. cDNA was synthesized using 1 μg RNA as a template with the miRcute Plus miRNA First-Strand cDNA Synthesis Kit (TIANGEN BIOTECH, Beijing, China). RT-qPCR was then carried out using the miRcute Plus miRNA qPCR Detection Kit (SYBR Green) (Tiangen Biotech, Beijing, China) according to the manufacturer's instructions for mature miRNAs and mRNA on a Bio-Rad Real-Time PCR System (CA, USA). U6 was used to normalize expression in the RT-qPCR analysis and the fold changes in miRNA and mRNA expression were calculated using the 2–ΔΔCt method.
Immunoblotting and antibodies
Tissues and cells were lysed in a protein extraction reagent (Thermo, MA, USA) prior to protein extraction. The expression levels of target proteins were determined by routine western blot analysis. The primary detection antibodies were as follows: anti-E-cadherin (Abcam, USA; ab76055, 1 : 1000); anti-N-cadherin (Abcam, USA; ab18203, 1 : 1000); anti-vimentin (Abcam, USA; ab8978, 1 : 1000); anti-twist (Abcam, USA; ab175430, 1 : 1000); anti-GAPDH (Santa Cruz, USA; sc-25778, 1 : 1000); anti-PTEN (Abcam, USA; ab32199, 1 : 1000); anti-Akt (Abcam, USA; ab179463, 1 : 1000) and anti-phosphor-Akt (Abcam, USA; ab81283, 1 : 1000). The secondary detection antibody (HRP-Goat Anti-Mouse, SAEP001, Elabscience, Wuhan, China) was conjugated to horseradish peroxidase. The protein expression was detected with an enhanced chemiluminescent reagent (Thermo, MA, USA). The auto-radiographic intensity of each band was scanned and quantified by densitometric analysis using Image J software.
Immunofluorescence microscopy
A549 and BEAS-2B cells were cultured on coverslips in six-well plates (2.5 × 105 cells per well). At 24 h or 48 h post-transfection, cells were fixed in 4% formaldehyde for 15 min at room temperature, permeabilized in 0.3% Triton X-100-PBS buffer and then blocked in 3% bovine serum albumin for 1 h at room temperature. Subsequently, cells were stained using standard procedures. Specifically, cells were incubated with the following antibodies: anti-E cadherin (Abcam, USA; 1 : 200); anti-N cadherin (Abcam, USA; 1 : 200); or anti-vimentin (Abcam, USA; 1 : 200) overnight at 4 °C in a humidifier. After washing twice in PBS, cells were incubated with an anti-rabbit IgG-Alexa Fluor568 or an anti-mouse IgG-Alexa Fluor488 (Invitrogen, 1 : 500) secondary antibody for 2 h at room temperature. DNA was stained with 4,6-diamidino-2-phenylindole (DAPI) at a concentration of 2 μg ml–1 for 10 min in the dark. Images were obtained using a Nikon Ti-A1 capture system (magnification, 40×). The pixel density of the positively stained area was determined using Image J (; https://imagej.nih.gov/ij/) software.
Dual luciferase reporter assay
Luciferase activity assay was performed as previously described.35 3′ untranslated region (3′-UTR) sequences of PTEN were cloned into Dual Fluorescent Reporter Vector psiCHECK2 (Promega, Madison, USA). The wild-type (WT) PTEN 3′-UTR sequence was designated PTEN-3′-UTR-WT, and the mutated PTEN 3′-UTR sequence without the miR-21 binding site was designated PTEN-3′-UTR-MT (as shown in Table 3). Luciferase reporter gene vectors containing these sequences were generated and HEK293T cells were transfected. Luciferase reporter gene detection reagent (Promega Company, San Luis Obispo, USA) was used to determine the luciferase activity.
Table 3. The seed sequence of miR-21 matched the 3′-UTR of PTEN gene.
| Type | Sequence |
| PTEN-3′-UTR-WT | F: 5′-ACTTGTGGCAACAGATAAGTTTGCAGTTGGCTAAGAGAGGTT-3′ |
| R: 5′-AACCTCTCTTAGCCAACTGCAAACTTATCTGTTGCCACAAGT-3′ | |
| PTEN-3′-UTR-MT | F: 5′-ACTTGTGGCAACAGCTGAATCTGCAGTTGGCTAAGAGAGGTT-3′ |
| R: 5′-AACCTCTCTTAGCCAACTGCAGATTCAGCTGTTGCCACAAGT-3′ |
Statistical analysis
The graphical data were presented as mean ± standard error of the mean (SEM) of experiments performed in triplicate or more. Statistical significance among the three groups and between groups was determined using one-way or two-way analysis of variance (ANOVA) followed by Bonferroni post-hoc tests and Student's t-tests, respectively. P < 0.05 was considered to indicate statistical significance.
Results
Irradiation induces molecular changes associated with EMT
Nagarajan et al. previously reported that radiation induces EMT in normal alveolar type II epithelial cells;36 this observation was supported by our findings. A549 cells and BEAS-2B cells were irradiated with a single dose of 6 Gy of 60Co γ-rays for various times ranging from 1 h to 48 h. Evaluation of cell morphology at 48 h post-irradiation showed that irradiated cells lost their cuboidal appearance and exhibited an elongated mesenchymal-like morphology (Fig. S1D†). A similar phenomenon was observed in BEAS-2B cells (data not shown). To evaluate the contribution of EMT to this morphologic change, we determined the expression of EMT-associated proteins by western blot analysis. At the protein level, expression of the epithelial marker, E-cadherin was reduced and expression of the mesenchymal marker, N-cadherin was enhanced in A549 and BEAS-2B at 12 h, 24 h and 48 h after 6 Gy irradiation compared with the levels detected in non-irradiated control cells (Fig. S1A and B†). We previously reported that a single dose (20 Gy) of 60Co γ-ray irradiation to a mouse thorax caused pulmonary fibrosis. Two weeks after administration of a single dose (20 Gy) of 60Co γ-ray irradiation to the thorax of a mouse, we found that E-cadherin expression was significantly reduced, whereas N-cadherin expression was significantly increased (Fig. S1C†). These data indicated that radiation induces pulmonary epithelial cells to undergo EMT in intro and in vivo.
Irradiation induces expression of miR-21
Recently, miRNAs that are upregulated in various fibrotic diseases of the skin, kidney, liver and lung were shown to contribute to fibrotic responses.10,15,16 To investigate the miRNAs involved in IR-induced RIPF, we identified differentially expressed miRNAs in irradiated lungs. We performed a miRNA array analysis of total RNAs isolated from the lungs of mice irradiated with a single dose (20 Gy) of 60Co γ-rays. At 2 weeks post-irradiation, we found significantly altered expression of a number of miRNAs in radiation-exposed lungs (Fig. 1A). Of these miRNAs, miR-21 demonstrated a 1.4-fold increase in expression. Recently, miR-21 has been shown to contribute to the pulmonary fibrotic response.33 Therefore, we investigated the association of miR-21 with IR-induced EMT. To validate the miRNA array data, we performed real-time PCR and showed that miR-21 was upregulated by 1.5-fold in mouse lungs 2 weeks after a single dose (20 Gy) of 60Co γ-ray irradiation (Fig. 1B). Then, we analyzed the expression of miR-21 in A549 and BEAS-2B cells irradiated with 6 Gy γ-rays. Cells were harvested at 1 h, 3 h, 6 h, 12 h, 24 h, and 48 h after irradiation to extract total RNA. Compared with the non-irradiated control groups, RT-qPCR analysis showed that miR-21 expression was upregulated after irradiation of both cells types in a time-dependent manner. Following irradiation of A549 cells and BEAS-2B cells, miR-21 expression increased (both 4-fold increase compared with the levels detected in the control group) at 12 h and 24 h, respectively, after irradiation, and expression peaked at 48 h after radiation exposure (Fig. 1C and D, respectively).
Fig. 1. Irradiation induces expression of miR-21. (A) MiRNA microarray screening for differentially expressed miRNAs. Ten male C57BL/6 mice (aged 6–8 weeks) were randomly divided into a control group and an irradiation group (n = 5 mice per group). The mice in the irradiated group were anesthetized and received a single full-thickness irradiation with 20 Gy 60Co γ-rays. Fourteen days after irradiation, the mice were sacrificed and the right lung was removed for miRNA microarray analysis. The miRNA expression profile was sorted using a hierarchical clustering method (Cluster 3.0 and Java Tree View). The right histogram shows the miR-21 probe signal. (B) The expression of miR-21 in mouse lungs was verified by RT-qPCR. (C, D) RT-qPCR analysis of expression levels of miR-21 in samples collected at different time-points after 6 Gy irradiation (0, 1 h, 3 h, 6 h, 12 h, 24 h, 48 h) of A549 cells and BEAS-2B cells, respectively. Note: t-test, data represent the mean ± SEM (n = 3), * P < 0.05 compared with the control group.
Ectopic expression of miR-21 promotes EMT
The role of IR-induced EMT in the development of RIPF has been supported by a number of recent reports.34,37–39 Since induction of miR-21 by SBRT contributes to pulmonary fibrosis,33 we investigated the potential of miR-21 induction to influence EMT. MiR-21 mimics were transfected into A549 cells resulting in a 2.34-fold increase in expression (Fig. 2A). We found that miR-21 overexpression changed the morphology of lung epithelial cells, characterized by a neat arrangement of irregular polygonal cells, to that of stromal cells, exhibiting a long spindle shape and arranged in the uniform pattern typical of mesenchymal cells (Fig. S2†). Western blot analysis showed that compared with the control group, E-cadherin expression was downregulated in A549 cells overexpressing miR-21, while N-cadherin, vimentin, and twist expression was upregulated (Fig. 2B). Moreover, miR-21 overexpression caused an increase in A549 cell migration (Fig. S3†). MiR-21 mimics were transfected in BEAS-2B cells with a transfection efficiency of 3.68-fold (Fig. 2C). Western blot analysis showed that compared with the control group, E-cadherin expression was downregulated in BEAS-2B cells overexpressing miR-21, while N-cadherin, vimentin, and twist expression was upregulated (Fig. 2D). This pattern of protein expression was confirmed by immunofluorescence analysis of EMT-related factors after transfection of A549 cells with miR-21 mimics (Fig. 2E). These results indicated that induction of miR-21 promoted EMT.
Fig. 2. Ectopic expression of miR-21 promotes EMT. Cells (1.0 × 106) were seeded in 60 mm dishes for the transfection with miR-21 mimic (20 pmol per 105 cells). Cells were harvested 48 h post-transfection for real-time PCR or western blot analysis. (A, C) RT-qPCR analysis of miR-21 mimic transfection efficiency in A549 cells and in BEAS-2B cells. (B, D) Western blot analysis of protein expression of EMT-related factors after transfection of A549 cells and BEAS-2B cells with the miR-21 mimic. Histogram shows western blot gray scale results. (E) Immunofluorescence analysis of protein expression of EMT-related factors after transfection of A549 cells with the miR-21 mimic for 48 h. Note: t-Test, data represent the mean ± SEM (n = 3), *P < 0.05 compared with the control group.
Downregulation of miR-21 prevented IR-induced EMT
Since miR-21 overexpression was shown to promote EMT, we explored the potential of downregulation of miR-21 to prevent IR-induced EMT. Transfection of A549 cells with miR-21 inhibitors resulted in a 90% reduction in miR-21 expression (Fig. 3A). At 48 h post-irradiation (6 Gy), A549 cells underwent EMT, characterized by decreased E-cadherin expression accompanied by elevated expression of N-cadherin and twist. When A549 cells were transfected with miR-21 inhibitors for 48 h, IR-induced EMT was inhibited at 48 h post-irradiation (6 Gy), suggesting that miR-21 knockdown inhibited IR-induced EMT (Fig. 3B). Similar results were obtained in parallel studies with BEAS-2B cells, with miR-21 knockdown shown to inhibit IR-induced EMT (Fig. 3C and D). This pattern of protein expression was confirmed by immunofluorescence analysis of EMT-related factors after transfection of A549 cells with the miR-21 mimic (Fig. 3E). Taken together, these results clearly demonstrated that miR-21 regulates IR-induced EMT.
Fig. 3. Downregulation of miR-21 prevented IR-induced EMT. Cells (1.0 × 106) were seeded in 60 mm dishes for the transfection with the miR-21 inhibitor (20 pmol per 105 cells). Cells were harvested 48 h post-transfection for real-time PCR or western blot analysis. (A, C) RT-qPCR analysis of miR-21 inhibitor transfection efficiency in A549 cells and in BEAS-2B cells. (B, D) Western blot analysis of protein expression of EMT-related factors after transfection of A549 cells and BEAS-2B cells with the miR-21 inhibitor. Histogram shows western blot gray scale results. (E) Immunofluorescence analysis of protein expression of EMT-related factors after transfection of A549 cells with the miR-21 inhibitor for 48 h. Note: t-Test, data represent the mean ± SEM (n = 3), significance was assumed for P < 0.05 (*), P < 0.01 (**).
PTEN is a functional target of miR-21
Analysis miRNA target genes using online software indicated that PTEN was the most likely potential target of miR-21 in irradiated cells. RT-qPCR analysis showed that PTEN expression was initially downregulated, while miR-21 expression was upregulated in the lung tissue of mice in the irradiated group compared with that in the control group (Fig. 4A). MiR-21 expression was also upregulated and PTEN expression downregulated in irradiated A549 cells (Fig. 4C) and BEAS-2B cells (Fig. 4B). Statistical correlation analysis showed a strong negative correlation between IR-induced miR-21 upregulation and PTEN downregulation in mouse lung, A549 and BEAS-2B cells, with a correlation coefficient of –0.898 (Fig. 4D).
Fig. 4. PTEN is the functional target of miR-21. (A) Expression of miR-21 and PTEN in mouse lung tissue post-irradiation (20 Gy), and PTEN expression levels after miR-21 overexpression or depletion. (B, C) RT-qPCR analysis of expression levels of miR-21 and PTEN in A549 cells (C) and in BEAS-2B cells (B) at different time-points post-irradiation (6 Gy). (D) Pearson's correlation scatter plot of the levels of PTEN and miR-21. (E, F) Overexpression of miR-21 downregulates PTEN expression at the mRNA (RT-qPCR) and protein (western blot) levels. (G, H) Inhibition of miR-21 upregulates PTEN expression at the mRNA (RT-qPCR) and protein (western blot) levels. (I) MiR-21 combined with the PTEN 3′-UTR. (J) Dual luciferase reporter gene activity assay of HEK293T cells co-transfected with PTEN 3′-UTR WT/MT and miR-21 inhibitors or mimics. MiR-21 inhibited the luciferase activity of the WT plasmid but had no influence on that of the MT plasmid. Note: t-Test, data represent the mean ± SEM (n = 3), * P < 0.05 compared with the negative control group.
In addition, we verified the effects of miR-21 overexpression or inhibition on PTEN expression. RT-qPCR analysis revealed that miR-21 overexpression downregulated PTEN expression at the mRNA level (Fig. 4E), while miR-21 knockdown upregulated PTEN expression (Fig. 4G). The results of western blot analysis were consistent with the RT-qPCR results (Fig. 4F and H). These results indicated that miR-21 negatively regulates PTEN. To confirm PTEN as a functional target of miR-21, we performed dual luciferase reporter gene activity assays of HEK293T cells co-transfected with PTEN 3′-UTR WT/MT and miR-21 inhibitors or mimics (Table 3). MiR-21 inhibited the luciferase activity of the WT plasmid but had no influence on that of the MT plasmid. MiR-21inhibited the luciferase activity of the WT plasmid but had no influence on that of the MT plasmid (Fig. 4J), indicating that miR-21 combines with the PTEN 3′-UTR (Fig. 4I).
Roles of PTEN in IR-induced EMT mediated by miR-21 upregulation
We then tested the ability of miR-21 to regulate IR-induced EMT via PTEN. PTEN suppression decreased E-cadherin expression and increased the expression of N-cadherin, vimentin and twist in A549 cells (Fig. 5A) and BEAS-2B cells (Fig. 5B). Immunofluorescence analysis of protein expression of EMT-related factors was performed after transfection of A549 cells with siPTEN (Fig. 5C). Determination of the pixel density of the positively stained area using Image J (Fig. 5D) further validated the western blot data, thus confirming that PTEN suppression promotes EMT.
Fig. 5. SiPTEN promotes EMT. (A, B) Western blot analysis of the protein expression of EMT-related factors after transfection of A549 cells and BEAS-2B cells with siPTEN. Histogram showing western blot gray scale results. (C) Immunofluorescence analysis of protein expression of EMT-related factors after transfection of A549 cells with siPTEN. (D) The pixel density of fluorescent positive area determined by ImageJ. Note: t-Test, data represent the mean ± SEM (n = 3), * P < 0.05, ** P < 0.01 compared with the negative control group.
We then performed a rescue study to confirm miR-21 regulates IR-induced EMT via PTEN. Radiation-induced EMT and downregulated PTEN. Western blot and immunofluorescence analyses confirmed that miR-21 downregulation attenuated IR-induced EMT and upregulated PTEN (Fig. 6A–C). When PTEN was suppressed in A549 and BEAS-2B cells following miR-21 knockdown, the attenuation of miR-21-mediated IR-induced-EMT was reversed (Fig. 6A–C). Thus, these findings further confirm that miR-21 promotes IR-induced EMT by suppressing PTEN.
Fig. 6. SiPTEN reverses the inhibition of IR-induced EMT induced by miR-21-knockdown. (A, B) Western blot analysis of the protein expression of EMT-related factors transfection of A549 cells and BEAS-2B cells with siPTEN and the miR-21 inhibitor 48 h post-irradiation (6 Gy). Histogram showing western blot gray scale results. (C) Immunofluorescence analysis of protein expression of EMT-related factors after transfection of A549 cells with siPTEN and the miR-21 inhibitor 48 h post-irradiation (6 Gy). Note: t-Test, data represent the mean ± SEM (n = 3), significance was assumed for P < 0.05 (*), P < 0.01 (**).
MiR-21-induced EMT post-irradiation via the PTEN/Akt pathway
The PTEN/Akt signaling pathway is known to be involved in EMT.40,41 Therefore, we investigated the involvement of the PTEN/Akt pathway in the process by which EMT is induced by IR and miR-21. Transfection with miR-21 mimics markedly induced the expression of phosphorylated Akt (p-Akt), decreased PTEN expression and promoted EMT (Fig. 7A). Moreover, miR-21 knockdown prevented the IR-induced downregulation of PTEN expression, thereby inhibiting phosphorylation of Akt and inhibiting EMT (Fig. 7B). In the lung tissue of irradiated mice, PTEN expression was decreased and p-Akt expression was increased (Fig. 7C). We then investigated the involvement of PTEN in the mechanism by which miR-21 promotes IR-induced EMT via the PTEN/Akt signaling pathway. The results showed that PTEN knockdown increased p-Akt levels in A549 (Fig. 7D) and BEAS-2B (Fig. 7E) cells. These observations indicated that PTEN negatively regulates Akt phosphorylation. Following simultaneous knockdown of PTEN and miR-21, the reduction of p-Akt was reversed, thereby reversing the attenuation of miR-21-induced EMT (Fig. 7F). These observations suggested that the EMT induced by IR and miR-21 in pulmonary epithelial cells is mediated via the PTEN/Akt pathway.
Fig. 7. MiR-21 mediates IR-induced EMT via the PTEN/Akt signaling pathway. (A, B) Western blot analysis of the protein expression of PTEN, Akt and p-Akt after transfection of A549 cells with the miR-21 mimic and miR-21 inhibitor. (C) PTEN, Akt and p-Akt expression in mouse lung tissue. (D, E) PTEN, Akt and p-Akt expression in A549 cells and BEAS-2B cells. (F) Western blot analysis of the protein expression of PTEN, Akt and p-Akt after transfection of A549 cells with both siPTEN and miR-21 inhibitor 48 h post-irradiation (6 Gy).
Discussion
RIPF is a severe and life-threatening side-effect of radiotherapy in cancer patients.1,2 Thus, early diagnosis and prevention of RIPF is important for initiating anti-fibrosis therapy and effectively relieving the symptoms of RIPF. MicroRNAs, especially circulating miRNAs, have been extensively studied to identify biomarkers and potential therapeutic targets for certain types of diseases.42 Therefore, it is important to identify any miRNAs that are potentially involved in RIPF and can be readily detected in patients. Kwon et al. reported that induction of serum miR-21 by SBRT contributed to the pulmonary fibrotic response and inhibition of miR-21 by its specific inhibitor significantly reduced collagen synthesis in lung fibroblasts;33 however, the underlying mechanism has not yet been defined. In the present study, we showed that upregulation of miR-21 promotes EMT, while downregulation of miR-21 prevented IR-induced-fibrotic EMT in lung epithelial cells. These findings suggest that induction of miR-21 by radiotherapy promotes IR-induced fibrotic EMT, which contributes, at least partially, to the pulmonary fibrotic response.
In the pathogenesis of RIPF, fibroblasts play a central role through ECM deposition and structural remodeling.3 Fibroblasts are believed to have at least three different cellular origins, deriving from proliferation of resident lung fibroblasts, recruitment of circulating progenitor fibrocytes from bone marrow and differentiation of epithelial cells into fibroblasts through EMT.43–46 Tanjore et al.5 and Ohbayashi et al.47 demonstrated the contribution of EMT to fibroblasts, in which one-third of lung fibroblasts were derived from the epithelium during bleomycin-induced pulmonary fibrosis. In our study, 6 Gy 60Co γ-ray irradiation induced fibrotic EMT characterized by reduced expression of the epithelial marker, E-cadherin and enhanced expression of the mesenchymal marker, N-cadherin, vimentin.
MiR-21 is becoming an attractive target for genetic and pharmacological modulation in various disease conditions.23 Several lines of evidence support important roles for miR-21 signaling in fibrotic responses in many organs.30–32 Accumulating evidence suggests a key role for miR-21 in the EMT involved in the invasion and migration of cancers and fibrotic diseases.48–54 Wang et al. showed that miR-21 overexpression enhanced TGF-β1-induced EMT, whereas EMT and fibrosis were inhibited by an miR-21 inhibitor.52 Brønnum et al. reported that miR-21 promoted fibrogenic EMT in epicardial mesothelial cells and contributed to heterogeneous fibroblast.54 Yamada et al. reported that inhibition of miR-21 prevented TGF-β-induced EMT in lung epithelial cells.53 However, the role of miR-21 in the EMT in RIPF has not yet been defined. To address this issue, we performed miRNA array assays on RNA isolated from the lungs of mice irradiated with a single dose (20 Gy) of 60Co γ-ray for 2 weeks, a protocol we have previously established for a mouse model of RIPF. The expression of miR-21 was found to be upregulated in irradiated lung tissue. Furthermore, increased expression of miR-21 was confirmed in A549 and BEAS-2B cells following irradiation with 6 Gy 60Co γ-rays. We found that downregulation of miR-21 prevented IR-induced fibrotic EMT in lung epithelial cells, suggesting that miR-21 is required for IR-induced fibrotic EMT in lung epithelial cells. MiR-21 has a significant impact on the EMT phenotype because overexpression of miR-21 in lung epithelial cells significantly promotes fibrotic EMT. Thus, our data suggest that miR-21 regulates IR-induced EMT.
Many signaling pathways are involved in IR-induced fibrotic EMT.14,40,41,55–64 Marcondes demonstrated that the PI3K/Akt and Wnt/β-catenin signaling pathways as well as ERK1/2 downstream of EPHA4 receptor activation, play important roles in IR-induced EMT.58 Kang et al. reported that rhamnetin and cirsiliol induce inhibition of IR-induced EMT by miR-34a-mediated suppression of Notch-1 expression in non-small cell lung cancer cell lines.60 Cho et al. reported that IR induces cancer cell EMT by activating the EGFR-p38/ERK-CREB-1/STAT3 pathway.62 Su et al. reported that a sublethal dose of radiation enhanced EMT of human cervical cancer cells via the K-Ras/c-Raf/p38 signaling pathway.63 The PTEN/Akt signaling pathway has been reported to be involved in the EMT process,40,41 with PTEN negatively regulating Akt activation.65 We observed that IR treatment resulted in miR-21 upregulation and PTEN downregulation, confirming that PTEN is a direct target of miR-21 post-irradiation. Our results demonstrated that p-Akt was markedly induced by miR-21 mimics, while not Akt. Anti-miR-21 significantly inhibited the IR-mediated decrease in PTEN levels and increase in Akt phosphorylation. Moreover, simultaneous knockdown of PTEN and miR-21 reversed the reduction of phosphorylated Akt, thereby blocking the inhibition of IR-induced EMT mediated by anti-miR-21. Combining previous reports and with the results, we suggest that PTEN/Akt signaling pathway mediates IR-induced-fibrotic EMT in lung epithelial cells by upregulating miR-21.
Conclusion
Our study demonstrates a role for the miR-21 in IR-induced EMT progression. These data indicate that IR-induced miR-21 regulates IR-induced fibrotic EMT progression via the miR-21/PTEN/Akt axis. This evidence implicates miR-21 as a target for the prevention of IR-induced EMT progression in lung epithelial cells and treatment of pulmonary complications after chest radiotherapy, specifically RIPF.
Conflicts of interest
The authors declare no conflict of interest.
Supplementary Material
Acknowledgments
This work was supported by the grants from the National Natural Science Foundation of China (Grant No. 81773359, 31470827, 31270894) to Yongqing Gu, the National Natural Science Foundation, China (Grant No. 81472910) to Maoxiang Zhu and the National Key Basic Research Program (973 Program) of MOST, China (Grant No. 2015CB910601).
Footnotes
†Electronic supplementary information (ESI) available. See DOI: 10.1039/c9tx00019d
References
- Niezink G. H., de Jong R. A., Muijs C. T., Langendijk J. A., Widder J. Oncologist. 2017;22:1257–1264. doi: 10.1634/theoncologist.2016-0324. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ding N. H., Li J. J., Sun L. Q. Curr. Drug Targets. 2013;14:1347–1356. doi: 10.2174/13894501113149990198. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bagnato G., Harari S. Eur. Respir. Rev. 2015;24:102–114. doi: 10.1183/09059180.00003214. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Selman M., King T. E., Pardo A. Ann. Intern. Med. 2001;134:136–151. doi: 10.7326/0003-4819-134-2-200101160-00015. [DOI] [PubMed] [Google Scholar]
- Tanjore H., Xu X. C., Polosukhin V. V., Degryse A. L., Li B., Han W., Sherrill T. P., Plieth D., Neilson E. G., Blackwell T. S., Lawson W. E. Am. J. Respir. Crit. Care Med. 2009;180:657–665. doi: 10.1164/rccm.200903-0322OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Boveda-Ruiz D., D'Alessandro-Gabazza C. N., Toda M., Takagi T., Naito M., Matsushima Y., Matsumoto T., Kobayashi T., Gil-Bernabe P., Chelakkot-Govindalayathil A. L., Miyake Y., Yasukawa A., Morser J., Taguchi O., Gabazza E. C. Immunobiology. 2013;218:245–254. doi: 10.1016/j.imbio.2012.05.020. [DOI] [PubMed] [Google Scholar]
- Brabletz T., Kalluri R., Nieto M. A., Weinberg R. A. Nat. Rev. Cancer. 2018;18:128–134. doi: 10.1038/nrc.2017.118. [DOI] [PubMed] [Google Scholar]
- Chen T., You Y., Jiang H., Wang Z. Z. J. Cell. Physiol. 2017;232:3261–3272. doi: 10.1002/jcp.25797. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen X. L., Lei L., Hong L. L., Ling L. L. Histol. Histopathol. 2018;33:655–663. doi: 10.14670/HH-11-957. [DOI] [PubMed] [Google Scholar]
- Tripathi K., Garg M. J. Cell. Commun. Signal. 2018;12:513–527. doi: 10.1007/s12079-017-0441-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Iwano M., Plieth D., Danoff T. M., Xue C., Okada H., Neilson E. G. J. Clin. Invest. 2002;110:341–350. doi: 10.1172/JCI15518. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Park K. S., Wells J. M., Zorn A. M., Wert S. E., Laubach V. E., Fernandez L. G., Whitsett J. A. Am. J. Respir. Cell Mol. Biol. 2006;34:151–157. doi: 10.1165/rcmb.2005-0332OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Araya J., Cambier S., Markovics J. A., Wolters P., Jablons D., Hill A., Finkbeiner W., Jones K., Broaddus V. C., Sheppard D., Barzcak A., Xiao Y., Erle D. J., Nishimura S. L. J. Clin. Invest. 2007;117:3551–3562. doi: 10.1172/JCI32526. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Balli D., Ustiyan V., Zhang Y., Wang I. C., Masino A. J., Ren X., Whitsett J. A., Kalinichenko V. V., Kalin T. V. EMBO J. 2013;32:231–244. doi: 10.1038/emboj.2012.336. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee R. C., Feinbaum R. L., Ambros V. Cell. 1993;75:843–854. doi: 10.1016/0092-8674(93)90529-y. [DOI] [PubMed] [Google Scholar]
- Lewis B. P., Shih I. H., Jones-Rhoades M. W., Bartel D. P., Burge C. B. Cell. 2003;115:787–798. doi: 10.1016/s0092-8674(03)01018-3. [DOI] [PubMed] [Google Scholar]
- Robins H., Li Y., Padgett R. W. Proc. Natl. Acad. Sci. U. S. A. 2005;102:4006–4009. doi: 10.1073/pnas.0500775102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bartel D. P. Cell. 2009;136:215–233. doi: 10.1016/j.cell.2009.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bartel D. P. Cell. 2004;116:281–297. doi: 10.1016/s0092-8674(04)00045-5. [DOI] [PubMed] [Google Scholar]
- Huang R. X., Zhou P. K. Environ. Pollut. 2019;247:64–71. doi: 10.1016/j.envpol.2019.01.014. [DOI] [PubMed] [Google Scholar]
- Miao C., Xiong Y., Zhang G., Chang J. Exp. Lung Res. 2018:1–13. doi: 10.1080/01902148.2018.1455927. [DOI] [PubMed] [Google Scholar]
- Zhao X., Lu Y., Nie Y., Fan D. Curr. Cancer Drug Targets. 2013;13:935–944. doi: 10.2174/15680096113136660099. [DOI] [PubMed] [Google Scholar]
- Kumarswamy R., Volkmann I., Thum T. RNA Biol. 2011;8:706–713. doi: 10.4161/rna.8.5.16154. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Esquela-Kerscher A., Slack F. J. Nat. Rev. Cancer. 2006;6:259–269. doi: 10.1038/nrc1840. [DOI] [PubMed] [Google Scholar]
- Gao Y., Cai Q., Huang Y., Li S., Yang H., Sun L., Chen K., Wang Y. Oncotarget. 2016;7:34498–34506. doi: 10.18632/oncotarget.9142. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hu G. Y., Tao F., Wang W., Ji K. W. World J. Surg. Oncol. 2016;14:82. doi: 10.1186/s12957-016-0842-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jiang S., Wang R., Yan H., Jin L., Dou X., Chen D. Mol. Med. Rep. 2016;13:4101–4107. doi: 10.3892/mmr.2016.5010. [DOI] [PubMed] [Google Scholar]
- Yan J., Liu T., Zhou X., Dang Y., Yin C., Zhang G. Am. J. Transl. Res. 2016;8:2354–2364. [PMC free article] [PubMed] [Google Scholar]
- Tao Y. J., Li Y. J., Zheng W., Zhao J. J., Guo M. M., Zhou Y., Qin N. L., Zheng J., Xu L. Cancer Cell Int. 2015;15:77. doi: 10.1186/s12935-015-0228-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Thum T., Gross C., Fiedler J., Fischer T., Kissler S., Bussen M., Galuppo P., Just S., Rottbauer W., Frantz S., Castoldi M., Soutschek J., Koteliansky V., Rosenwald A., Basson M. A., Licht J. D., Pena J. T., Rouhanifard S. H., Muckenthaler M. U., Tuschl T., Martin G. R., Bauersachs J., Engelhardt S. Nature. 2008;456:980–984. doi: 10.1038/nature07511. [DOI] [PubMed] [Google Scholar]
- Liu G., Friggeri A., Yang Y., Milosevic J., Ding Q., Thannickal V. J., Kaminski N., Abraham E. J. Exp. Med. 2010;207:1589–1597. doi: 10.1084/jem.20100035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Loboda A., Sobczak M., Jozkowicz A., Dulak J. Mediators Inflammation. 2016;2016:8319283. doi: 10.1155/2016/8319283. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kwon O. S., Kim K. T., Lee E., Kim M., Choi S. H., Li H., Fornace A. J., Cho J. H., Lee Y. S., Lee J. S., Lee Y. J., Cha H. J. PLoS One. 2016;11:e0154942. doi: 10.1371/journal.pone.0154942. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xiong S., Pan X., Xu L., Yang Z., Guo R., Gu Y., Li R., Wang Q., Xiao F., Du L., Zhou P., Zhu M. Int. J. Radiat. Oncol., Biol., Phys. 2015;93:425–435. doi: 10.1016/j.ijrobp.2015.05.043. [DOI] [PubMed] [Google Scholar]
- Bailey S. T., Westerling T., Brown M. Cancer Res. 2015;75:436–445. doi: 10.1158/0008-5472.CAN-14-1041. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nagarajan D., Melo T., Deng Z., Almeida C., Zhao W. Free Radicals Biol. Med. 2012;52:983–992. doi: 10.1016/j.freeradbiomed.2011.11.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kim J. S., Son Y., Jung M. G., Jeong Y. J., Kim S. H., Lee S. J., Lee Y. J., Lee H. J. Mol. Med. Rep. 2016;13:4666–4670. doi: 10.3892/mmr.2016.5121. [DOI] [PubMed] [Google Scholar]
- Tsoyi K., Chu S. G., Patino-Jaramillo N. G., Wilder J., Villalba J., Doyle-Eisele M., McDonald J., Liu X., El-Chemaly S., Perrella M. A., Rosas I. O. Am. J. Respir. Cell Mol. Biol. 2018;58:208–215. doi: 10.1165/rcmb.2017-0088OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lu J., Zhong Y., Lin Z., Lin X., Chen Z., Wu X., Wang N., Zhang H., Huang S., Zhu Y., Wang Y., Lin S. Biomed. Pharmacother. 2017;95:1219–1224. doi: 10.1016/j.biopha.2017.09.037. [DOI] [PubMed] [Google Scholar]
- Song L. B., Li J., Liao W. T., Feng Y., Yu C. P., Hu L. J., Kong Q. L., Xu L. H., Zhang X., Liu W. L., Li M. Z., Zhang L., Kang T. B., Fu L. W., Huang W. L., Xia Y. F., Tsao S. W., Li M., Band V., Band H., Shi Q. H., Zeng Y. X., Zeng M. S. J. Clin. Invest. 2009;119:3626–3636. doi: 10.1172/JCI39374. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang H., Quah S. Y., Dong J. M., Manser E., Tang J. P., Zeng Q. Cancer Res. 2007;67:2922–2926. doi: 10.1158/0008-5472.CAN-06-3598. [DOI] [PubMed] [Google Scholar]
- Mitchell P. S., Parkin R. K., Kroh E. M., Fritz B. R., Wyman S. K., Pogosova-Agadjanyan E. L., Peterson A., Noteboom J., O'Briant K. C., Allen A., Lin D. W., Urban N., Drescher C. W., Knudsen B. S., Stirewalt D. L., Gentleman R., Vessella R. L., Nelson P. S., Martin D. B., Tewari M. Proc. Natl. Acad. Sci. U. S. A. 2008;105:10513–10518. doi: 10.1073/pnas.0804549105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Quan T. E., Cowper S. E., Bucala R. Curr. Rheumatol. Rep. 2006;8:145–150. doi: 10.1007/s11926-006-0055-x. [DOI] [PubMed] [Google Scholar]
- Andersson-Sjöland A., de Alba C. G., Nihlberg K., Becerril C., Ramírez R., Pardo A., Westergren-Thorsson G., Selman M. Int. J. Biochem. Cell Biol. 2008;40:2129–2140. doi: 10.1016/j.biocel.2008.02.012. [DOI] [PubMed] [Google Scholar]
- Andersson-Sjöland A., Nihlberg K., Eriksson L., Bjermer L., Westergren-Thorsson G. Respir. Res. 2011;12:76. doi: 10.1186/1465-9921-12-76. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wynn T. A. J. Exp. Med. 2011;208:1339–1350. doi: 10.1084/jem.20110551. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ohbayashi M., Kubota S., Kawase A., Kohyama N., Kobayashi Y., Yamamoto T. J. Toxicol. Sci. 2014;39:319–330. doi: 10.2131/jts.39.319. [DOI] [PubMed] [Google Scholar]
- Cao J., Liu J., Xu R., Zhu X., Liu L., Zhao X. Mol. Med. Rep. 2016;13:75–82. doi: 10.3892/mmr.2015.4568. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li C., Song L., Zhang Z., Bai X. X., Cui M. F., Ma L. J. Oncotarget. 2016;7:66989–67003. doi: 10.18632/oncotarget.11888. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- Zhang Y., Pan T., Zhong X., Cheng C. Tumor Biol. 2014;35:7063–7072. doi: 10.1007/s13277-014-1968-z. [DOI] [PubMed] [Google Scholar]
- Liu Z., Wang J., Guo C., Fan X. Biomed. Pharmacother. 2015;69:24–28. doi: 10.1016/j.biopha.2014.10.028. [DOI] [PubMed] [Google Scholar]
- Wang J. Y., Gao Y. B., Zhang N., Zou D. W., Wang P., Zhu Z. Y., Li J. Y., Zhou S. N., Wang S. C., Wang Y. Y., Yang J. K. Mol. Cell. Endocrinol. 2014;392:163–172. doi: 10.1016/j.mce.2014.05.018. [DOI] [PubMed] [Google Scholar]
- Yamada M., Kubo H., Ota C., Takahashi T., Tando Y., Suzuki T., Fujino N., Makiguchi T., Takagi K., Suzuki T., Ichinose M. Respir. Res. 2013;14:95. doi: 10.1186/1465-9921-14-95. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brønnum H., Andersen D. C., Schneider M., Sandberg M. B., Eskildsen T., Nielsen S. B., Kalluri R., Sheikh S. P. PLoS One. 2013;8:e56280. doi: 10.1371/journal.pone.0056280. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee S. Y., Jeong E. K., Ju M. K., Jeon H. M., Kim M. Y., Kim C. H., Park H. G., Han S. I., Kang H. S. Mol. Cancer. 2017;16:10. doi: 10.1186/s12943-016-0577-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kambach D. M., Sodi V. L., Lelkes P. I., Azizkhan-Clifford J., Reginato M. J. Oncogene. 2014;33:589–598. doi: 10.1038/onc.2012.629. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jobling M. F., Mott J. D., Finnegan M. T., Jurukovski V., Erickson A. C., Walian P. J., Taylor S. E., Ledbetter S., Lawrence C. M., Rifkin D. B., Barcellos-Hoff M. H. Radiat. Res. 2006;166:839–848. doi: 10.1667/RR0695.1. [DOI] [PubMed] [Google Scholar]
- de Marcondes P. G., Morgado-Díaz J. A. J. Cell. Biochem. 2017;118:442–445. doi: 10.1002/jcb.25738. [DOI] [PubMed] [Google Scholar]
- Dong Z., Zhou L., Han N., Zhang M., Lyu X. Strahlenther. Onkol. 2015;191:672–680. doi: 10.1007/s00066-015-0858-7. [DOI] [PubMed] [Google Scholar]
- Kang J., Kim E., Kim W., Seong K. M., Youn H., Kim J. W., Kim J., Youn B. J. Biol. Chem. 2013;288:27343–27357. doi: 10.1074/jbc.M113.490482. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang S., Lee Y., Kim J., Hyun J., Lee K., Kim Y., Jung Y. PLoS One. 2013;8:e74141. doi: 10.1371/journal.pone.0074141. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cho J. H., Hong W. G., Jung Y. J., Lee J., Lee E., Hwang S. G., Um H. D., Park J. K. Tumor Biol. 2016;37:7315–7325. doi: 10.1007/s13277-015-4548-y. [DOI] [PubMed] [Google Scholar]
- Su W. H., Chuang P. C., Huang E. Y., Yang K. D. Am. J. Pathol. 2012;180:862–871. doi: 10.1016/j.ajpath.2011.10.018. [DOI] [PubMed] [Google Scholar]
- Nijkamp M. M., Span P. N., Bussink J., Kaanders J. H. Radiother. Oncol. 2013;108:17–23. doi: 10.1016/j.radonc.2013.05.006. [DOI] [PubMed] [Google Scholar]
- Bakin A. V., Tomlinson A. K., Bhowmick N. A., Moses H. L., Arteaga C. L. J. Biol. Chem. 2000;275:36803–36810. doi: 10.1074/jbc.M005912200. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.







