Skip to main content
Ecology and Evolution logoLink to Ecology and Evolution
. 2019 Apr 1;9(9):5292–5308. doi: 10.1002/ece3.5119

Conservation genetics of the pond bat (Myotis dasycneme) with special focus on the populations in northwestern Germany and in Jutland, Denmark

Liselotte Wesley Andersen 1,✉, Ronja Dirksen 2, Elena A Nikulina 3, Hans J Baagøe 4, Gunars Petersons 5, Péter Estók 6, Oleg L Orlov 7,8, Maria V Orlova 7,9, Florian Gloza‐Rausch 10, Matthias Göttsche 11, Esben Terp Fjederholt 12, Frauke Krüger 13, Morten Elmeros 1
PMCID: PMC6509384  PMID: 31110680

Abstract

Conservation genetics is important in the management of endangered species, helping to understand their connectivity and long‐term viability, thus identifying populations of importance for conservation. The pond bat (Myotis dasycneme) is a rare species classified as “Near Threatened” with a wide but patchy Palearctic distribution. A total of 277 samples representing populations in Denmark, Germany, Latvia, Hungary, and Russia were used in the genetic analyses; 224 samples representing Denmark, Germany, and Russia were analyzed at 10 microsatellite loci; 241 samples representing all areas were analyzed using mitochondrial D‐loop and cytochrome B sequences. A Bayesian clustering approach revealed two poorly resolved clusters, one representing the Danish and German groups and the other the Russian group. However, significantly different pairwise F ST and D EST estimates were observed between the Danish and German groups and between the Danish and Russian groups suggesting a recent population structure. These conflicting results might be attributed to the effect of migration or low resolution due to the number of microsatellite markers used. After concatenating the two mitochondrial sequences, analysis detected significant genetic differentiation between all populations, probably due to genetic drift combined with a founder event. The phylogenetic tree suggested a closer relationship between the Russian and Northern European populations compared to the Hungarian population, implying that the latter belongs to an older ancestral population. This was supported by the observed haplotype network and higher nucleotide diversity in this population. The genetic structuring observed in the Danish/German pond bat stresses the need for a cross‐border management between the two countries. Further, the pronounced mtDNA structuring, together with the indicated migration between nearby populations suggest philopatric female behavior but male migration, emphasizes the importance of protecting suitable habitat mosaics to maintain a continuum of patches with dense pond bat populations across the species' distribution range.

Keywords: conservation genetics, cross‐border management, migration, Myotis dasycneme, phylogeny, population structure

1. INTRODUCTION

Conservation genetics is an important tool in the management of endangered species, resolving population connectivity and thereby informing us of the long‐term viability of a species, thus identifying populations in special need of conservation (Pérez‐Espona & ConGRESS Consortium, 2017; Stockwell, Hendry, & Kinnison, 2003).

The pond bat, Myotis dasycneme (Boie, 1825), is widely distributed in the temperate lowlands of the Palearctic across northern and central Europe from northern France, Belgium, and the Netherlands toward the east into Asia to the Yenisei region in central Russia (Görföl et al., 2018; Limpens, Lina, & Hutson, 2000; Piraccini, 2016; Strelkov, 1969). Its foraging behavior, feeding on insects associated with water, renders the species dependent on larger, relatively calm bodies of water (Ahlén, Baagøe, & Bach, 2009; Baagøe, 1987; Ciechanowski, Zapart, Kokurewicz, Rusiński, & Lazarus, 2017; Dietz, Helversen, & Nill, 2009; Haarsma & Siepel, 2014; Krüger et al., 2014; Limpens et al., 2000). Consequently, the pond bat has a patchy distribution throughout its range with relatively high densities in regions with suitable habitats, that is, in the Netherlands, northwestern Germany, and in Denmark.

The global status of pond bat is assessed as “Near Threatened” (IUCN, 2018) as its population decline is suspected to approach 30% over the last 15 years (three generations) (Piraccini, 2016). Degradation and loss of aquatic habitats, commuting routes and roosting sites, human disturbance of hibernacula, and water pollution are listed as the main threats for the species (Limpens et al., 2000; Piraccini, 2016).

In Denmark, the pond bat is relatively common in the central and northern parts of Jutland and has a patchy but stable occurrence in the southeastern parts of the country (Baagøe, 2007). Further, there is an increasing number of new records also from other parts of Denmark (H. J. Baagøe, Pers. Comm.). Almost the entire Jutland population (around 8,000 individuals) seems to hibernate in a few old limestone mines, Mønsted and Daugbjerg, from where they disperse to maternity roosts during summer (Baagøe & Degn, 2009). The conservation status of the species is assessed as favorable but the population is vulnerable as it is mainly restricted to a very low number of hibernacula during winter (Baagøe, 2010; www.eionet.eu). In Germany, the pond bat has a fragmented distribution, occurring mainly in the northern and western states (www.bfn.de). Schleswig‐Holstein harbors the biggest known population and a large hibernaculum with more than 1,000 individuals (Jagd & Artenschutz, 2010). The species' conservation status is assessed as moderately unfavorable due to low habitat quality and its restricted population size in some German states (www.eionet.eu; www.eurobats.org). (For species assessment in Latvia, Hungary, and Russia, see Supporting Information Appendix S1).

Studies have investigated the phylogenetic position of the pond bat (Kruskop, Borisenko, Ivanova, Lim, & Eger, 2012; Mayer & von Helversen, 2001; Ruedi & Mayer, 2001), but nongenetic study has addressed the relationship among populations in different parts of its range. Information on population structure/connectivity, as well as genetic diversity, is crucial to understand population processes and fundamental for adaptive processes and species resilience, which is especially important in light of the climate change, impairing pond bat habitat (Meinig, 2010).

Pond bats may migrate more than 300 km between summer and winter habitats (Hutterer, Ivanova, Meyer‐Cords, & Rodrigues, 2005), but bats generally show a high site fidelity to roost sites (Altringham, 2011). Ringing efforts to track migration were conducted in Jutland limestone mines, Denmark, in the 1950s and 1960s (Egsbæk & Jensen, 1963) and in Germany in 2008 (F. Gloza‐Rausch, Pers. Comm.). In the first study, no recapture was recorded in northern Germany, and further, to the authors' knowledge, bats ringed in northern Germany have not been recorded from the four limestone mines in Jutland (H. J. Baagøe, Pers. Comm.). In 2008, a female pond bat ringed as a subadult in Methorst, northern Germany, was resighted hibernating in Mønsted limestone mines spring 2009 in Denmark, a migration distance of 250 km (F. Gloza‐Rausch, Pers. Comm.). In January 2010, this bat hibernated in a bunker in Schafstedt, northern Germany, 250 km south of Mønsted, and the following summer, it bred in its natal roost site in Methorst (Jagd & Artenschutz, 2010). This observation may indicate that there is some dispersal and cohesion among the pond bat populations of Jutland and Schleswig‐Holstein.

The objective of the present study was to investigate the genetic population structure of pond bat mainly in Denmark and Germany (including fewer samples from Latvia, Hungary, and Russia) based on variation in ten microsatellite markers, the control region (CR), and cytochrome B (CytB) of the mitochondrial DNA (mtDNA). The microsatellite markers were used to (a) assess the genetic diversity, (b) estimate population structure, and (c) evaluate immigration/emigration rate and direction (gene flow) within the populations in Denmark and Germany and between them and samples from Russia using assignment test and exploring migration network based on various population structure estimates. Further, as pond bat populations have declined during the last decades (Piraccini, 2016), we tested if this was reflected in the species' genetic makeup. mtDNA markers were used to quantify genetic diversity and population structure among all the sampled populations, but also to try to uncover demographic history, for example, in terms of former population expansions despite small, unequal sample sizes.

2. MATERIALS AND METHODS

2.1. Sampling

In Germany, samples were collected from bats caught using mist nets placed in foraging areas or close to nursery roosts and at major hibernacula in northern Germany (Table 1). In Denmark, samples were collected from bats caught with harp traps during emergence from the large hibernacula in the limestone mines in Mønsted and Daugbjerg. In Hungary, samples were collected near a lake and at three swarming sites situated in the Bükk Mountains in the northern part of the country. In Russia, samples were collected at two major hibernacula in the Smolinskaya and Arakaevskaya caves in the Middle Urals, while the samples from Latvia were fecal samples collected from the ground (Table 1; Figure 1). The samples from Latvia and Hungary were not genotyped at the microsatellite markers due to poor DNA quality (Latvian samples) and low sample size (Hungarian samples). Given the substantial temporal difference between sampling years for the Danish localities suggesting additional impact of genetic drift on the analysis, these samples were kept separate during the initial analysis.

Table 1.

Sampling area and year, colony sites and type, and number of samples and types analyzed for microsatellites, control region (CR), and cytochrome B (CytB) in mtDNA, DNA source for the pond bat

Country Colony site Colony type Microsatellite Control region CytB Sample type Sampling year
Denmark Mønsteda Hibernaculum 51 48 50 Wing 2003
Mønstedb Hibernaculum 19 20 18 Saliva 2011
Daugbjergc Hibernaculum 38 34 34 Wing 2009
Daugbjergd Hibernaculum 12 12 12 Saliva 2011
Germany Wahlstorf Maternity roost 28 29 30 Wing 2009
Methorst Maternity roost 21 21 21 Wing 2009
Groß Nordsee Maternity roost 7 7 Wing 2009
Ratekau Maternity roost 8 8 Wing 2010
Bad Segeberg Hibernaculum 32 38 40 22 Wing 10 Saliva 8 Feces 2011
Latvia Diverse Maternity roost Not used 25 19 Feces 2011
Hungary Diverse Hibernaculum Not used 8 7 Wing 2011
Russia Diverse Hibernaculum 23 24 14 Wing 2010 and 2011
a

MON03.

b

MON11.

c

DAU09.

d

DAU11.

Figure 1.

Figure 1

Map showing the global distribution (gray shaded area) of the pond bat together with sampling localities and the haplotype diversity for the concatenated CytB‐CR region in mtDNA

From some of the pond bats (see Table 1), samples were taken by puncturing the wing membrane of the chiropatagium with a stanza (3 mm diameter; Worthington & Barratt, 1996). These samples were stored in absolute ethanol (99%) at 4°C or a saturated salt/DMSO solution. Saliva samples were taken with Isohelix DNA buccal swabs (Cell Projects, Kent, UK; see Table 1). The swabs were stored in the provided tubes (Isohelix, Cell Projects, Kent, UK) and frozen immediately at −20°C.

2.2. Laboratory procedures

DNA from wing samples was extracted using Qiagen DNeasy® Tissue Kit following the manufacturer's protocol (QIAGEN). DNA from buccal samples was extracted using the Isohelix DNA Isolation Kit following the manufacturer's protocol (Isohelix, Cell Projects Ltd). From fecal samples, DNA was extracted using the Biolab Products Crystal Stool DNA Kit (Biolab Products) adjusting the manufacturer's protocol for a smaller amount of sample. The extraction was conducted in the ancient‐DNA laboratory at the Centre for Baltic and Scandinavian Archaeology (ZBSA), Schleswig‐Holstein State Museums Foundation, Germany.

Ten microsatellite markers developed for Myotis myotis (Castella & Ruedi, 2000) (Supporting Information Appendix S2) were PCR‐multiplexed in two runs using the QIAGEN Multiplex PCR kit in a 12.5 µl reaction volume with an annealing temperature of 57°C and conditions following the manufacturer's protocol (QIAGEN). Mix 1 consisted of A13, E24, F19, G9, G25, and H29 and Mix 2 of D9 and H19. D15 and G30 were run separately. The PCR products were analyzed using an ABI PRISM 3730 DNA sequencer and genotyped in GeneMapper® version 4.2 (Applied Biosystem).

A 521 bp part of the mitochondrial cytochrome b and 247 bp of the D‐loop region of mitochondrial control region were amplified using the following primers: MyoF ATGACCAACATTCGAAAATCTC, MyoR ATGTTAAAGTTAGGAGATCTGC; and MyCR‐F TTAATTACTAATCAGCCCATGCC, MyCR‐R1 GTTGTTGTGTTGTATGTCCTG. Amplification was conducted in a reaction volume of 12.5 µl using Amplicon DNA polymerase master mix (AMPLICON) and 10 µM of each primer, in a standard PCR using one cycle for 5 min at 95°C, 35 cycles at annealing temperatures of 48 and 41°C, respectively, and extension time for 7 min at 72°C. DNA extractions were stored at −20°C. The amplified DNA strands obtained from German, Latvian, Hungarian, and Russian samples were Sanger‐sequenced one way at the Institute of Clinical Molecular Biology, Kiel University, Germany, while the amplified DNA strands from the Danish samples were sequenced forward and reverse at MACROGEN Inc. (Amsterdam, Holland). The sequences were later analyzed using Sequencher 5.3 (Gene Code).

2.3. Data analysis

2.3.1. Genetic variation

Genetic variation, estimated as observed and expected heterozygosity, and tests for goodness of fit to the Hardy–Weinberg equilibrium were performed in FSTAT (Goudet, 1995) and GenAlEx 6.5 (Peakall & Smouse, 2006). The presence of null alleles in the microsatellite loci was checked using MICRO‐CHECKER 2.2.1 (Van Oosterhout, Hutchinson, Wills, & Shipley, 2004) for all except Daugbjerg 2009. Genotypic linkage disequilibrium was tested between all pairs of the 10 loci using GENEPOP version 3.4 with 5,000 iterations (Raymond & Rousset, 1995). Genetic variation in the CytB and D‐loop (CR) sequences and the concatenated CytB‐CR sequences was estimated as haplotype diversity (HD) and nucleotide diversity (π) using DnaSP v5 (Librado & Rozas, 2009).

2.3.2. Population structure

The number of groups represented in the three locations was estimated in STRUCTURE version 2.3.4 (Pritchard, Stephens, & Donnelly, 2000) using data from only seven microsatellite markers due to state (low genetic variation and linkages disequilibrium; see “Results”). This software uses a Bayesian approach by clustering individuals, minimizing Hardy–Weinberg disequilibrium and gametic phase disequilibrium between loci. The analysis was conducted using the admixture model and the model of correlated allele frequencies between clusters. Following the recommendation by Wang (2017), alpha was adjusted to 0.33 according to the number of clusters, K, expected (K = 3 in this instance) to account for the unbalanced sample size. The results of the tests were based on 1,000,000 iterations, a 100,000 burn‐in period. All samples were combined, and STRUCTURE was run with K = 1 to K = 7 and 10 replicates without prior information regarding the sample's origin. The clusters of individuals forming the number of populations with the highest likelihood were assigned to sampling locations. As it might be difficult to infer the number of clusters represented due to an effect of isolation by distance (IBD) and extensive admixture (Falush, Stephens, & Pritchard, 2003; Pritchard et al., 2000), KFinder (Wang, 2019) was applied to infer the number of clusters. KFinder includes three different criterions for assessing the most likely number of populations represented by the sample of individuals. The first two are the classical methods, Pr[X|K] method (Pritchard et al., 2000) and the ΔK method (Evanno, Regnaut, & Goudet, 2005), and the third is the Parsimony Index, which chooses the K that repetitively returns the minimal mean admixture of individuals (Wang, 2019). Wang (2019) shows that this method often performed better in returning the correct population structure compared to the two former methods. Further, CLUMPAK software was applied to visualize the STRUCTURE results over the number of runs (Kopelman, Mayzel, Jakobsson, Rosenberg, & Mayrose, 2015).

Pairwise multilocus F ST (Weir & Cockerham, 1984) and D EST (Jost, 2008) were calculated using the R package diveRsity (Keenan, McGinnity, Cross, Crozier, & Prodöhl, 2013) and statistically evaluated after 1,000 bootstraps. The values obtained were regarded as significant when the confidence interval around the estimate did not contain zero. Both F ST and D EST vary between 0 and 1 (no differentiation–complete differentiation). F ST is dependent on the variability of the used markers, while D EST is independent of this within‐population diversity (Jost, 2008; Verity & Nichols, 2014).

Discriminant analysis of principal components (DAPC; Jombart, Devillard, & Balloux, 2010) was used to further explore the possibility of group structure in the data not recovered by STRUCTURE. This method uses the genetic relationships among individuals to identify groups and is based on allele frequencies of the microsatellite markers, and does not rely on model assumptions. This was conducted using the adegenet package (Jombart, 2008) in R (www.r-project.org; R Development Core Team, 2008).

Population structure based on variation in the mtDNA sequences was examined using the pairwise distance between haplotypes as genetic distance and ΦST statistics. As both CytB and CR are situated in the mitochondria, the two sequences were concatenated for the single individuals to represent a 768‐bp sequence. Mitochondria represents one marker, and it has been shown (Jacobsen et al., 2012) that the longer sequences give higher resolutions. The tests were run for 10,000 permutations over individual haplotypes among potential populations/subpopulations in ARLEQUIN 3.5.1 (Excoffier & Lischer, 2010). The sequential Bonferroni procedure was applied using a significance level of 5% whenever multiple tests were performed (Rice, 1989).

To test if a possible population structure pattern could be explained by pure IBD, genetic distance in terms of ΦST for the concatenated mitochondrial sequences and geographical distance between the areas were computed in IBD (Bohonak, 2002). Genetic distance based on microsatellite markers was not included due to the low number of populations analyzed with them. Geographical distances were measured in kilometers drawing straight lines between the sampling localities using Google™ Earth.

2.3.3. Migration and detection of first‐generation migrants

An assignment test was conducted to allocate individuals to the population from which they most likely originate. This was performed in GENECLASS2 (Piry et al., 2004) that uses the individual's multilocus genotype likelihoods to identify population origin (Paetkau, Slade, Burden, & Estoup, 2004). Further, to detect first‐generation migrants (FGM) in the bat populations, the likelihood computation, L = L_home/L_max_not_home, was used (Paetkau et al., 2004; Piry et al., 2004). For both tests, levels of significance were determined comparing the assigned individuals' genotypes with a simulated set (10,000) obtained using the allele frequencies from the different areas (Paetkau et al., 2004). The exclusion probability (at the 5% level) of a population as the origin and the probability that an individual is a migrant were calculated based on the resampling algorithm of Paetkau et al. (2004). The assignment test was applied including only German and Danish samples to avoid bias due to differences in sampling size (Paetkau et al., 2004).

To analyze migration direction, DivMigrate implemented in the diveRsity R package (Keenan et al., 2013; Sundqvist, Keenan, Zackrisson, Prodöhl, & Kleinhans, 2016) was applied. The method uses the geometric means of allele frequencies and the genetic differentiation between pairs of populations to deduced migration rate and direction. The relative migration network is illustrated as a graph showing the gene flow between the populations. The relative migration network was estimated using the pairwise population differentiation estimates in terms of DEST (Nei, 1973; Nei & Chesser, 1983; Sundqvist et al., 2016). Significant asymmetrical migration was tested based on 1,000 bootstraps in DivMigrate (Keenan et al., 2013; Sundqvist et al., 2016).

2.4. Population demography

2.4.1. Bottleneck

Microsatellite

During a bottleneck, population size declines abruptly, which is expected to affect the number of alleles faster than loss of heterozygosity. This will cause heterozygote excess in the population (Cornuet & Luikart, 1996). The microsatellite dataset from the Danish, German, and Russian pond bat groups was used in the bottleneck test performed in BOTTLENECK 1.2 (Piry, Luikart, & Cornuet, 1999). The nonparametric Wilcoxon's test was used to evaluate if the number of loci with heterozygote excess is larger than expected to occur by chance. The tests were performed assuming the two‐phase mutation model (TPM) (Di Rienzo et al., 1994), with single‐step mutations ranging from 70, 90, 95, and 99% and a 12% variance of multistep mutations as recommended (Piry et al., 1999).

2.4.2. Demographic inferences

mtDNA

Historical population fluctuations were explored using the concatenated CytB‐CR sequences for all samples. This was performed using tests of population growth and mismatch analysis (Schneider & Excoffier, 1999) using Tajima's D test of selective neutrality (Tajima, 1989), Fu's F s (Fu, 1997), and distribution of pairwise differences of nucleotide sequences (mismatch distribution) (Rogers & Harpending, 1992). The detection of excess numbers of singleton mutations relative to expectations under the standard neutral model is indicative of recent population growth. This will be uncovered as significantly negative values of both estimates. The Raggedness Index (Harpending, Sherry, & Rogers, 1993) reflects the mismatch distribution of pairwise nucleotide differences between haplotypes. If the distribution pattern is multimodal or “ragged,” the population is expected to be stable or declining slowly (Rogers & Harpending, 1992; Slatkin & Hudson, 1991). The mismatch distributions were tested by estimating the goodness of fit between observed and expected distributions using the parametric bootstrap (1,000) approach in ARLEQUIN 3.5.1 (Excoffier & Lischer, 2010). The sum of square deviations (SSDs) was the test statistic used between observed and expected distributions, where p‐values were calculated as the proportion of simulations producing a larger SSD than the observed SSD.

2.4.3. Phylogeny

The relationships among the observed mtDNA haplotypes for CytB and CR as well as the concatenated sequence were estimated based on a median‐joining network, which allows intermediate haplotypes in the network (Bandelt, Forster, & Rohl, 1999). The network was generated using DnaSP (Librado & Rozas, 2009) and POPART (Leigh & Bryant, 2015). Further, a phylogenetic consensus tree was inferred using the Bayesian method implemented in MrBayes v3.2.6 (Ronquist et al., 2012) and the HKY model that was found to best fit the concatenated dataset (jModelTest; Posada, 2008) (data not shown). The concatenated sequence of CytB and CR (GenBank accession number KT901455 whole mitogenome) from the greater mouse‐eared bat, Myotis myotis, was included as an outgroup.

MrBayes was run twice using the default settings involving two independent MCMC runs in each and four chains. The default sample frequency of 500 and diagnostic frequency of 5,000 and run length of 1,000,000 were used, discarding 25% of the samples of burn‐ins and run until the standard deviation of split frequencies was below 0.01, which is indicative of convergence according to the authors (Ronquist et al., 2012). The obtained topology and branch lengths of the tree were visualized in FigTree (http://beast.bio.ed.ac.uk/software/FigTree).

3. RESULTS

3.1. Genetic diversity

Species identification of fecal samples was based on alignment of CR and CytB sequences to the known sequences obtained from the tissue samples from live specimens in the study, and all were confirmed to be pond bats (data not shown).

The datasets used to estimate genetic diversity, population structure, and migration based on the 10 microsatellite markers (Supporting Information Appendix S2) and the two mtDNA markers, CR (247 bp) and CytB (521 bp) sequences, and the concatenated sequences (768 bp) for the different localities are given in Table 1.

For the microsatellites, significant departures from Hardy–Weinberg expectations in terms of heterozygote deficiency were observed at locus D9 and D15 in the Danish sample (Supporting Information Appendix S3). The observed microsatellite genetic diversity was at the same level for the Danish (H E = 0.676 ± 0.092), German (H E = 0.673 ± 0.094), and Russian samples (H E = 0.659 ± 0.095). Analysis for genotypic linkage disequilibrium revealed that one pair of loci (G9 and H29) showed linkage (all populations) (data not shown). At the mtDNA level, the highest level of genetic diversity in the CR was observed in the Russian sample (HD = 0.841 ± 0.01, π = 0.0057), while the lowest level for both estimates was observed in the Latvian sample where only one haplotype was found. Unique mt haplotypes were observed in all populations except Latvia; Russia had seven while Denmark and Germany had one and two unique haplotypes, respectively, and Hungary three (Supporting Information Appendix S4). A common haplotype Pb_Gecr3 (Supporting Information Appendix S5a) was found in all sampling areas except Hungary. A slightly different diversity pattern was observed in the CytB sequences, where the Russian sample still contained the highest diversity (HD = 0.868 ± 0.014, π = 0.0029) and five unique haplotypes, but only two haplotypes and low nucleotide diversity (HD = 0.335 ± 0.004, π = 0.0006) were found in the Danish sample despite the large sample size. Pb_Gec1, the most common haplotype, was observed in all areas except Hungary (Supporting Information Appendix S5b).

For the concatenated mtDNA sequence the Russian sample had the highest genetic diversity (HD = 0.962 ± 0.011, π = 0.004), then the German population (HD = 0.752 ± 0.002, π = 0.0023), except for the nucleotide diversity where the Hungarian sample had the second highest (HD = 0.667 ± 0.06, π = 0.0026). The Danish sample had the lowest diversity (HD = 0.507 ± 0.004, π = 0.0007) (Table 2).

Table 2.

Sample size (N), genetic diversity (H O, H E; GenAlEx; Peakall & Smouse, 2006,2012), standard error (SE), and F IS (deviation from Hardy–Weinberg expectations) based on 10 microsatellites (FSTAT; Goudet, 1995)

MON03 MON11 DAU09 DAU11 Denmark Total Germany Latvia Hungary Russia
Microsatellites
N 51 19 38 12 120 81 0 0 23
H O 0.647 0.608 0.647 0.598 0.636 0.651 0 0 0.647
SE 0.095 0.089 0.093 0.108 0.090 0.096 0 0 0.097
H E 0.652 0.659 0.665 0.643 0.676 0.673 0 0 0.659
SE 0.095 0.084 0.090 0.084 0.092 0.094 0 0 0.095
F is 0.018 0.106 0.039 0.114 0.063 0.038 0 0 0.041
CytB‐CR concatenated
N 49 18 32 12 111 96 14 7 13
H 4 2 4 3 4 7 4 3 10
S 3 1 3 2 3 11 3 4 11
Singleton 1 0 0 0 0 0 1 1 4
P shared 2 1 3 2 3 11 2 3 7
HD 0.504 0.425 0.573 0.545 0.507 0.752 0.648 0.667 0.962
SE 0.07 0.100 0.084 0.144 0.004 0.002 0.031 0.06 0.011
Φwa(%)
0.08 0.040 0.1 0.09 0.07 0.28 0.12 0.21 0.46
π (%) 0.07 0.060 0.09 0.08 0.07 0.23 0.1 0.26 0.4
Tajima D −0.35 0.87 −0.26 −0.248 −0.01 −0.465 −0.565 1.076 −0.504
Fu's Fs −0.584 1.039 −0.52 −0.269 −0.038 0.716 −0.99 1.321 −4.98
Spatial expansion
SSD 0.015 0.01 0.019 0.022 0.014 0.035 0.032 0.073 0.007
Ragg. Id. 0.16 0.203 0.167 0.185 0.158 0.081 0.211 0.283 0.043
Demographic expansion
SSD 0.016 0.009 0.018 0.022 0.015 0.027 0.03 0.111 0.007
Ragg. Id. 0.16 0.203 0.167 0.185 0.158 0.081 0.211 0.283 0.043

H = genetic diversity as the number of mtDNA haplotypes; HD = haplotype diversity; N = sample size; π = nucleotide diversity (Nei, 1987); S = number of segregating sites; Singleton = mutation observed in only one sequence; P shared = mutation observed in at least two sequences (DnaSP; Librado & Rozas, 2009). Tests for selective neutrality, Tajima's D (Tajima, 1989) and Fu's Fs (Fu, 1997) (in ARLEQUIN; Excoffier & Lischer, 2010), for the five different pond bat regions were performed. The Danish samples were divided according to locality and year where MON03 = Mønsted 2003, MON11 = Mønsted 2011, DAU09 = Daugbjerg 2009, and DAU11 = Daugbjerg 2011. Population expansion indices estimated for the concatenated sequences in terms of SSD (sum of squares deviations) between observed and expected mismatch and Ragg. Id. (Raggedness Index) of the mismatch distribution (ARLEQUIN; Excoffier & Lischer, 2010). Bold = significant at the 5% level. For F s, p = 0.018.

3.2. Population structure

3.2.1. Microsatellites

Locus G9 was omitted due to the observed significant genotypic linkage to H29, and G25 and H19 were omitted due to occurrence of observed rare alleles and low variability. It has been shown by Linck and Battey (2019) that occurrences of rare alleles introduce noise when estimating population structure, blurring the population inference. Consequently, STRUCTURE analysis together with all the data analysis based on microsatellite markers were performed based on the remaining seven loci and the aggregated Danish samples. The three different approaches implemented in KFinder (Wang, 2019) to identify the individuals' ancestry from the STRUCTURE (Pritchard et al., 2000) results, all returned two populations (best K = 2) as the most probable structure (Table 3; Figure 2). The structure found was not clear, but inspecting the output files suggested that Denmark and Germany belonged to one population and Russia to another population (data not shown).

Table 3.

Estimation of the most likely number of populations present in the sample of pond bats based on the Bayesian method implemented in STRUCTURE

K STRUCTURE STRUCTURE HARVESTER KFinder
Mean Pr[X|K] ΔK Parsimony Index Best K
1 −6,044.16 — 0.5
2 −6,027.46 12.8699 0.6822 2
3 −6,057.61 3.0464 0.4771
4 −6,113.61 9.3609 0.4262
5 −6,454.46 0.4418 0.3529
6 −6,771.41 2.1273 0.0967
7 −6,862.61 — 0.2878

Three different approaches were applied to interpret the best number of clusters (best K) obtained from STRUCTURE: the mean likelihood Pr[X|K] that maximize K (Pritchard et al., 2000), ΔK (the largest rate of change of the log probability given the data) (Evanno et al., 2005; STRUCTURE HARVESTER (Earl & VonHoldt, 2012)), and the Parsimony Index (KFinder, Wang, 2019), identifying the K, which repeatedly returns the minimal mean admixture of the sample. K = number of assumed clusters. The analysis was run for K = 1 to K = 7 and 10 replications. All estimated in KFinder (Wang, 2019).

Figure 2.

Figure 2

Graphical output from STRUCTURE (Pritchard et al., 2000) after evaluation of the number of clusters present in the samples using KFinder (Wang, 2019) and processed in CLUMPAK (Kopelman et al., 2015) illustrating the population structure (STRUCTURE; Pritchard et al., 2000) based on seven microsatellite markers for the three pond bat localities, Denmark, Germany, and Russia without using prior knowledge of locality. Each vertical line represents an individual, and the color composition displays the probability of belonging to a clusters

Population structure based on pairwise F ST and D EST estimates revealed significant genetic differentiation between the Danish and German pond bats (Table 4a). A temporal effect was observed in the Danish sample, which was most pronounced for the F ST method (Table 4b) but not observed in the STRUCTURE analysis. Using DAPC (Figure 3), three groups were identified. The first and second DF (discriminant factor) discriminated between Russian and Danish–German areas, while only the first DF discriminated between the Danish and German pond bats (and to a lesser degree and with some overlap).

Table 4.

Genetic divergence estimated between the populations based on seven microsatellite markers and concatenated mtDNA sequences and the different combinations of geographical regions of the pond bat

(a) Microsatellites, DK samples pooled
Denmark Germany Russia
Denmark 0.018 0.057
Germany 0.004 0.033
Russia 0.011 0.005
(b) Microsatellites, DK samples divided according to year and location
MON03 MON11 DAU09 DAU11 Germany Russia
MON03 0.008 0.038 0.011 0.023 0.07
MON11 0.014 0.055 −0.016 0.021 0.063
DAU09 0.012 0.025 0.046 0.035 0.085
DAU11 0.014 −0.006 0.025 0.024 0.046
Germany 0.004 0.015 0.009 0.016 0.033
Russia 0.013 0.025 0.012 0.024 0.005
(c) CytB‐CR concatenated, DK samples divided according to year and location
MON03 MON11 DAU09
MON11 −0.007
DAU09 −0.043 0.011
DAU11 −0.022 0.005 −0.05
(d) CytB‐CR concatenated
Denmark Germany Latvia Hungary
Germany 0.137
Latvia 0.147 0.121
Hungary 0.914 0.796 0.855
Russia 0.544 0.35 0.319 0.72
(e) CytB‐CR concatenated keeping Methorst separate
Denmark Germany Methorst Latvia Hungary
Germany 0.184
Methorst 0.412 0.26
Latvia 0.147 0.151 0.368
Hungary 0.914 0.797 0.862 0.855
Russia 0.544 0.361 0.413 0.319 0.72

(a) Pairwise multilocus FST below diagonal, D EST above diagonal based on seven microsatellites between pond bats from Denmark (diveRsity; Keenan et al., 2013), Germany, and Russia. (b) Multilocus FST below and D EST above diagonal dividing DK samples according to year and location. (c) Pairwise ΦST results (pairwise distance) based on CytB‐CR concatenated sequences keeping DK sample divided into year and location. (d) Pairwise ΦST results (pairwise distance) based on CytB‐CR concatenated sequences from the five geographically different regions. (e) Pairwise ΦST results based on CytB‐CR concatenated sequences when separating the German pond bats into two different areas (ARLEQUIN; Excoffier & Lischer, 2010). Bold values for FST and D EST estimates are significant after 1,000 bootstraps (bias‐corrected (Keenan et al., 2013); bold italic values are marginally significant (lower 95% BC_bound approaching 0) after 1,000 bootstraps. Bold values for ΦST are significant after sequential Bonferroni correction (Rice, 1989).

Figure 3.

Figure 3

Discriminant analysis of principal components (DAPC; Jombart et al., 2010) based on seven microsatellite markers identifying three genetic clusters of pond bats from Germany (cluster 1), Denmark (cluster 2), and Russia (cluster 3)

3.2.2. mtDNA

The population structure analysis in terms of pairwise ΦST estimates based on the concatenated CytB‐CR sequences did not detect a temporal effect in the Danish samples (Table 4c). Pooling the Danish samples accordingly suggested all analyzed populations were significantly genetically different (Table 4d). This pattern was repeated based on the CytB sequences alone, while the CR region did not separate Denmark and Latvia (Supporting Information Appendix S6a, b). One of the German nursery roosts contained a significantly different haplotype composition compared to the rest of the areas, and to other German pond bats. This different haplotype composition could be attributed to the control region sequences in this sample where haplotype Pb_Gecr5 (Supporting Information Appendix S5a) was more frequently observed.

The results of IBD were nonsignificant despite the method applied, ΦST or ΦST/(1 − ΦST) (data not shown).

3.3. Migration and detection of first‐generation migrants

3.3.1. Microsatellites

The result of the assignment test (Table 5, merging the Danish samples) (Paetkau et al., 2004), showed that ~35% of the pond bat sampled in Germany had the highest probability of belonging to the German population, while ~18% had the highest probability of belonging to the Danish population. For ~39% of the pond bats sampled in Germany, the probability of belonging was inconclusive meaning that the probability was >0.05 and <0.6. Of the pond bats sampled in Germany, ~5% were identified as statistically not belonging to the German population, ~5% could be rejected as coming from the Danish population, and ~6% did not belong to either the German or the Danish population. For Denmark, ~59% of the sampled pond bats had the highest probability of belonging to the Danish population, ~6% to the German population, and ~29% were inconclusive. Among the Danish pond bats, ~17% could be rejected at the 5% level as belonging to the German population, none were rejected as belonging to the Danish population, and ~6% was rejected as belonging from either the Danish or the German population.

Table 5.

Results of assignment test and detection of first‐generation migrants based on seven microsatellite markers (GENECLASS2; Piry et al., 2004)

Denmark Germany Not GE or DK Inconclusive
Denmark
Highest probability of belonging 59.17% 5.83% NA 29.17%
Significantly rejected at the 5% level 0 17.50% 5.83% NA
Detection of first‐generation migrants from GE 4/120 NA NA NA
Germany
Highest probability of belonging 18.50% 35.80% NA 39.51%
Significantly rejected at the 5% level 4.93% 4.93% 6.17% NA
Detection of first‐generation migrants from DK NA 7/81 NA NA

Highest probability of belonging is defined by p ≥ 0.6. First‐generation migrants at p ≤ 0.05.

Seven out of the 81 sampled pond bats in the German population were identified to be putative FGM from Denmark, which was more than expected by chance (type 1 error, 5% of 81). Among the Danish samples, four out of 120 sampled pond bats were possible FGM from Germany, but this might be due to chance alone (type 1 error, 5% of 120).

Assessment of the migration direction including the Russian sample using DivMigrate Network (Figure 4) suggested a relative migration network illustrating bidirectional gene flow between Denmark and Germany with a lower gene flow to Russia despite the estimate used. No significant direction of the relative migration was observed between Denmark and Germany.

Figure 4.

Figure 4

Directional relative migration network illustrating the gene flow connecting the groups of pond bats from Germany (1), Denmark (2), and Russia (3) based on D EST estimates. Line thickness and shade between the populations grow with the relative strengths of the gene flow (DivMigrate; Keenan et al., 2013, Sundqvist et al., 2016)

3.4. Population demography

3.4.1. Microsatellite

No bottleneck effects were observed in the Danish and German pond bat populations (Table 6) despite the different percentage of single‐step and multistep mutations applied (data only shown for the pooled DK sample). In the Russian sample, a significant heterozygote excess was observed in some of the tests which might imply a bottleneck effect.

Table 6.

Bottleneck tests in terms of heterozygote excess evaluated using Wilcoxon's nonparametric signed‐rank test and the mutational model, TPM, with a range of single‐step and multistep mutations (BOTTLENECK; Piry et al., 1999)

TPM p‐value
Denmark 70 0.2891
Germany 0.1484
Russia 0.0039
Denmark 90 0.6563
Germany 0.1484
Russia 0.0078
Denmark 95 0.7656
Germany 0.1484
Russia 0.0195
Denmark 99 0.9453
Germany 0.1875
Russia 0.0547

p‐values significant at the α < 0.05 level are highlighted in bold.

3.4.2. mtDNA

The demographic population history of the investigated areas provided signs of population expansion (Table 2). A significant negative F s estimate (Fu, 1997) in the Russian sample indicated a sign of population expansion, which was reflected in the Raggedness Index. This did not reject the null hypothesis of exponential growth (p > 0.05). The opposite was observed in the Danish and German samples where the SSD and Raggedness Index or Raggedness Index was significant suggesting a stable or declining population.

3.5. Phylogeny

The total number of observed concatenated haplotypes was 23 (CR 16 haplotypes, CytB 14 haplotypes; Supporting Information Appendix S5a,b). The relationship among the haplotypes reflected in the median‐joining network (Figure 5) revealed a close relationship between the Danish, German, and Latvian pond bats, while the Russian and Hungarian were more distantly related from all populations. The most common haplotype, Hap_3, was observed in all but the Hungarian sample. Denmark, Germany, and Latvia shared several haplotypes, and many of the other haplotypes represented in these samples were separated by just one mutation creating a starlike network characteristic for expanding populations that have been through a bottleneck or been founded recently.

Figure 5.

Figure 5

Median‐joining haplotype network of the concatenated CytB‐CR mtDNA sequences between pond bats from Denmark, Germany, Latvia, Hungary, and Russia indicating the phylogenetic relationships estimated using DnaSP (Librado & Rozas, 2009) and POPART (Leigh & Bryant, 2015). The size of the circles indicates the relative frequency of the haplotypes. The number of crossbars on the line connecting haplotypes indicates the number of mutation separating the haplotypes

The genetic relationship among the concatenated haplotypes analyzed using the Bayesian approach implemented in MrBayes 3.2.6 (Ronquist et al., 2012) (Figure 6) supported the distant relationship of the Hungarian and Russian pond bats compared to the Danish, German, and Latvian bats. The phylogeny showed four major clades: The first (5) separated Myotis myotis from the pond bat. The second (4) separated the Hungarian haplotypes, while the third (3) separated the Russian haplotypes from the other areas. Furthermore, a rather close relationship between the Danish and German pond bats was observed and the two populations shared some of the concatenated haplotypes.

Figure 6.

Figure 6

Phylogenetic consensus tree estimated in MrBayes 3.2.6 (Ronquist et al., 2012) indicating the genetic relationship between the haplotypes using the CytB and CR concatenated sequences from Myotis myotis as outgroup. Red = Russian haplotypes; black = haplotypes found in Denmark and Germany; blue = German haplotypes; light blue = Danish haplotypes; aqua azure = Latvian haplotypes; green = Hungarian haplotypes

4. DISCUSSION

This study provides new insights into the conservation genetics of the pond bat with emphasis on the genetic relationship between populations in northernmost Germany and in Jutland, Denmark.

Despite the lack of samples from some important pond bat populations in certain regions within the distribution range (i.e., the Netherlands, Belgium, and northernmost France), the present study offers a first indication of the genetic constitution of the species. A very close recent genetic relationship was revealed between the Danish and German populations by the microsatellite analysis. The multilocus pairwise F ST and D EST estimates were small but significant, and the Bayesian‐based cluster analysis did not identify Denmark and Germany as different clusters. This is probably a combined effect of the low number of microsatellite markers used but also due to migration connecting the two nearby populations. The concatenated mtDNA sequences suggested a clear genetic differentiation between all analyzed populations probably caused by genetic drift combined with founder effects as pond bats colonized Europe from different refugia after the last glacial period.

4.1. Genetic diversity

The level of genetic diversity observed at microsatellite loci in the Danish, German, and Russian pond bat populations was similar to or slightly lower than that found in the greater mouse‐eared bat (Myotis myotis) in the contact zone between European and Anatolian populations (average H E = 0.74 and 0.61, respectively; Furman, Ҫelik, & Ҫoraman, 2018). The greater mouse‐eared bat is generally more sedentary and has typically shorter migration and dispersal distances compared to the pond bat (Corbet, 1978; Horáček, 1985). Ruedi and Castella (2003) studied 24 greater mouse‐eared bat colonies in southern Europe (3,000 km transect) using variation in CR sequences in the mitochondria. They observed 43 haplotypes in total (HD = 0.49, π ~ 0.03% − 2.08%, and 2–6 haplotypes in the different colonies), which was higher than the 23 different concatenated haplotypes (CytB‐CR) for pond bat in the present study. These diversity estimates were based on the control region exclusively; nevertheless, compared to the level for concatenated CytB‐CR sequences in the European pond bat groups, π observed in the latter was lower for all the analyzed groups while HD was in between (separated estimates for CR and CytB; Supporting Information Appendix S4). The rather high nucleotide diversity found in the Hungarian and Russian samples despite the low sampling size is probably due to sampling strategy, as pond bats were sampled over a wide range, representing several roosts within the countries. In contrast, the Latvian fecal samples were collected in the same roost and it is uncertain how many different individuals were sampled.

The low nucleotide diversity observed in the Danish group might reflect a recent colonization event compared to the other groups, as low genetic variation is expected in newly founded populations due to drift and reoccurring bottleneck/founding effects with limited gene flow during expansion of the species (Ramachandran et al., 2005). The limestone mines created by humans have provided suitable hibernation sites that would not have been available naturally in Denmark. The decreased genetic diversity with increasing distance from supposed Pleistocene refugia is not observed in the noctule bat, which probably can be attributed to the longer and regular migration distances of this species (Hutterer et al., 2005; Petit, Excoffier, & Mayer, 1999).

Pond bat bone remains have been recovered in Late Pleistocene caves in northern Italy outside the current range (Salari & Kotsakis, 2011), in Poland (summarized by Ciechanowski, Sachanowicz, & Kokurewicz, 2007), and near the easternmost recent range in the northwestern Altai in Central Asia (Rossina, 2006) (Figure 1). This suggests that the pond bat distribution probably was structured into several distinct populations during the last glacial period, as described for many other animal species (Taberlet, Fumagalli, Wust‐Saucy, & Cosson, 1998). Our genetic analyses corroborate these assumptions and the high nucleotide diversity indicates that the Hungarian population, despite the low sampling size, might be the most ancestral among the analyzed populations. To elaborate further on structuring and potential refugia for pond bats during the glacial periods, a more systematic widespread sampling covering the whole species' distribution is needed, including samples from the large westernmost pond bat population in the Netherlands and Belgium.

4.2. Population structure

The observed temporal effect in the Danish samples can most probably be ascribed to genetic drift caused by small sample sizes combined with the multigeneration time span separating the sampling episodes (estimated generation time = 5 years (Piraccini, 2016)). Despite this, the samples were aggregated analyzing the population structure to avoid noise related to the resulting unequal and small sample sizes from the temporal division. The Bayesian‐based population structure analysis in STRUCTURE detected two clusters, one including individuals from Denmark and Germany and another including Russian samples. However, it was difficult to identify those clusters from the graphical output. It is known that STRUCTURE has problems inferring the number of clusters when F ST < 0.02 (Chen, Durand, Forbes, & Franòois, 2007; Latch, Dharmarajan, Glaubitz, & Rhodes, 2006) which is close to the levels of genetic differentiation observed between the areas. Pairwise F ST as well as D EST analysis did detect significant, however small, genetic differences between Denmark and Germany and Denmark and Russia, but not between Germany and Russia. However, the structuring pattern observed by the DAPC analysis segregated all three populations, suggesting a higher resolution using this method. The contradicting microsatellite results, found applying different methods, may indicate that the number of markers and sample sizes should be higher to resolve the structure properly.

The low, significant genetic differentiation reflected by the microsatellite markers between Danish and German pond bats compared to the Danish and Russian pond bat is probably caused by a higher male‐mediated gene flow due to geographical proximity.

Including Latvia and Hungary in the pairwise ΦST population structure analysis obtained from the concatenated mtDNA sequences revealed a pronounced structure supporting previous assumptions of female philopatric behavior in pond bat (Limpens et al., 2000). The observed differences in population structuring reflected by the two different marker types in the Danish and German pond bats are expected in a female philopatric species with intermediate dispersal behavior due to the different heritage pattern—the nuclear markers displaying the biparental contribution while the mitochondrial only signifies the female contribution. Furthermore, the more pronounced mtDNA differentiation can probably also be attributed to the maternal inheritance reducing effective populations size to one‐fourth that of nuclear genes, thus leading to the faster accumulation of allele frequency changes (DeSalle, Templeton, Mori, Pletscher, & Johnston, 1987). Last, the mtDNA data reflect the evolutionary history of the pond bat, that is, showing a stronger phylogeographical signal due to their relatively slower overall mutation rates (Hickerson et al., 2010).

The population structure pattern observed in the pond bat is concordant with population structure studies on Bechstein's bat (Myotis bechsteinii) and the noctule bat: the former showing strictly female philopatric behavior (Kerth, Mayer, & Petit, 2002) with male dispersal, the latter displaying less strictly female philopatry but seasonal long‐distance migration (Petit et al., 1999; Petit & Mayer, 1999,2000). In Bechstein's bat, F STmic was not significant among the ten colonies analyzed while the ΦSTmt was highly significant (Kerth et al., 2002). In noctule bat, Petit et al. (Petit & Mayer, 1999,2000; 1999) observed a weak but significant F STmic, while ΦSTmt was higher and more pronounced between colonies compared to groups of colonies in Eastern and Central Europe (Petit et al., 1999; Petit & Mayer, 1999,2000).

The observed genetic population structure could be a reflection of “isolation by distance” (IBD), but no significant correlation was discovered, illustrating closer genetic relationship and shorter geographical distance between the populations. This may suggest that the genetic pattern indicates the existence of geographical barriers and/or historical colonization events.

4.3. Migration and detection of first‐generation migrants

The assignment test and detection of FGM between Danish and German populations illustrated a close genetic relationship between the two populations. The high percentage of inconclusive assignments to the populations can probably be attributed to the low number of markers used. However, some individuals sampled in the German roosts might be FGM from Denmark suggesting migration between the two areas, but a source–sink relationship was not detected. These results concur with the observations of the ringed German pond bat female that visited a hibernaculum in Denmark (Jagd & Artenschutz, 2010). Thus, dispersal between populations occupying hibernacula ca 300 kilometers apart do occur, supporting Ahlén et al.'s (2009) suggestion of pond bat behavior.

4.4. Population demography

Pond bat populations are assumed to be declining generally due to degradation and loss of feeding habitats and roosting sites (Piraccini, 2016). This might cause a significant reduction in population size and thus also in genetic diversity. However, this was not detected in the present study, which might be explained by the fact that the test used can only detect severe and recent bottlenecks (ca. 0.2–4.0 NE generations; Luikart, 1998). In the Russian samples, the bottleneck test revealed a significant heterozygote excess, indicating a recent population bottleneck effect. This might reflect a response caused by reductions in population size as hypothesized, although the results should be interpreted with caution due to the low number of marker used and the low sample size. Chikhi, Sousa, Luisi, Goossens, and Beaumont (2010) showed that genetic differentiation/gene flow, genetic diversity, and the sampling scheme can generate false bottleneck signals.

Historically, the last glacial period ending ~11,600 years ago and the following recolonization influenced species distribution and genetic differentiation across Europe leaving genetic footprints in present species (Hewitt, 1999,2001). Ibanez, García‐Mudarra, Ruedi, Stadelmann, and Juste (2006) discovered deeply differentiated cryptic lineages by comparing mitochondrial sequences (cytochrome b and ND1) of Iberian and other European bat species, suggesting the Iberian Peninsula to be an important Ice Age refuge. For the greater mouse‐eared bat, Ruedi et al. (2008) showed that Italy was a major retreat area during glacial periods using variation in the control region of mtDNA. In the present study, different historical population demography signals were observed for the analyzed pond bat populations. The Russian sample showed a clear population expansion signal with a significant negative F S and nonsignificant Raggedness Index. This supports the former suggested explanation that the bottleneck signal was false. In the Danish and German samples, SSDs were significant suggesting that the populations were either stable or declining (Rogers & Harpending, 1992). This population expansion pattern might reflect the historical colonization wave. In the most recent founded population, this signal will be replaced by a signal of stability or decline due to an increasing founder effect as observed in the Danish and German populations. This was supported by the observed pattern of genetic diversity—the older populations have higher genetic diversity (Handley, Manica, Goudet, & Balloux, 2007). Further, the phylogenetic inferences reflected by the median‐joining haplotype network showed a “starlike” haplotype network for the Danish and German samples, which is indicative for populations that have expanded from a bottleneck and small number of founders recently (Slatkin & Hudson, 1991).

The Bayesian phylogenetic consensus tree suggested a closer relationship between the Russian and Northern European pond bat populations compared to the Hungarian population. This might be indicative of Hungarian bats belonging to an older ancestral pond bat population; however, more samples should be included to verify this hypothesis.

4.5. Conservation implications

4.5.1. Denmark and Germany

A significant genetic difference was observed between the two nearby populations in Denmark and Germany using both marker sets. However, the microsatellite analysis also reflected relatively high gene flow between Denmark and Germany. Further, assignment tests revealed the possibility that individuals caught in Germany could originate from the Danish population, as supported by the catching of a female pond bat in Germany that originally was ringed in Denmark. These results emphasize the need for cross‐border management of the species between these two countries to ensure future conservation.

4.5.2. European level

From the mitochondrial analysis, our study documents clear genetic structuring of all the sampled pond bat populations, with unique haplotypes in most populations despite low sample sizes in some. Anthropogenic activities often cause species to decline, with habitat degradation and loss being the most important drivers at a large geographical scale (Frankham, Briscoe, & Ballou, 2010). For pond bats, the loss of roost sites and degradation of aquatic hunting habitats due to destruction and pollution are severe threats (Limpens et al., 2000). Changing climate puts further pressure on these populations as drier summers with less rainfall can alter the preferred hunting habitats and the occurrence of swarming insect populations (Meinig, 2010). Pond bats are rare and patchily distributed (Dietz et al., 2009; Krüger et al., 2014; Limpens et al., 2000), and the observations suggest a genetic structuring based on philopatric behavior with possible migration between nearby populations occurs. These results support the need to preserve and protect suitable habitat mosaics including underground sites to maintain a continuum of patches with dense pond bat populations to conserve genetic diversity in this species. This would further increase the probability of migration between populations across the whole of the species' distribution range. It is important to protect both hibernacula and the maternity roosts and the ecological functionality of the surrounding landscape. Matings during the swarming period in late summer at the large hibernacular sites may play a decisive role in ensuring gene flow between regional colonies in pond bats. Especially given the detected genetic relationship imply that females are philopatric to their maternity roosts (Bogdanowicz, Piksa, & Tereba, 2012; Furmankiewicz & Altringham, 2007; Kerth, Kiefer, Trappmann, & Weishaar, 2003; Kerth et al., 2002; Rivers, Butlin, & Altringham, 2005; Veith, Beer, Kiefer, Johannesen, & Seitz, 2004).

Further analyses of samples collected throughout the whole distribution range of pond bats (i.e., including samples from, e.g., Poland, Ukraine, Belgium, northern France, and the Netherlands) are needed to provide more information about the genetic structuring and colonization processes following the latest glacier period. Higher resolution genetic analysis, for example, involving RAD sequencing (Baird et al., 2008; Hohenlohe et al., 2010; Peterson, Weber, Kay, Fisher, & Hoekstra, 2012) would allow a better understanding of the migratory behavior and fine‐scale population structure of this species across regional and neighboring populations.

ETHICAL STATEMENT

The Danish wing samples were collected in accordance with the Danish Animal Welfare Act. The German wing samples were collected by Dr Florian Gloza‐Rausch, scientific director of Noctalis, Bad Segeberg, Germany, under the permission and ethical approval provided by the State Agency for Agriculture, Environment and Rural Areas, Schleswig‐Holstein. The Hungarian wing samples were collected by Péter Estók under permission no. 14/2138‐7/2011.

CONFLICT OF INTEREST

The authors declare no conflict of interests.

AUTHORS' CONTRIBUTIONS

LWA, RD, HJB, FGR, FK, and ME conceived the study. RD, HJB, GP, PE, OLO, MO, MG, FK, and ME did the fieldwork. LWA, RD, EN, and MO did laboratory analysis. LWA and RD conducted the data analysis with contribution from EN. FGR secured funding. All authors helped drafting the manuscript and gave approval before publication.

Supporting information

 

ACKNOWLEDGMENTS

The work was part of the diploma thesis written by Ronja Dirksen, Zoologisches Institut, Christian‐Albrechts‐Universität, Kiel, Germany. The study was funded by the German Ministry of Energy Transition, Agriculture, the Environment and Rural Areas, Schleswig‐Holstein; the Danish Nature Agency, Funen (FYN); and the Schleswig‐Holsteinische Landesforsten (AöR) and Stiftung Naturschutz, Schleswig‐Holstein, and was a part of the INTERREG4A BioGrenzKorr project. Special thanks to Professor Günther B. Hartl, Department of Population Genetics, Christian‐Albrechts University of Kiel, for invaluable support during the study; and to Antje Seebens (Noctalis), Dr. Robert Sommer (University of Kiel), Steen Fjederholt (Danish Nature Agency, Midtjylland), and Hans Jørgen Degn (Degn's Naturconsult) for helping out and collecting samples. Thanks to the three anonymous reviewers and Professor David Richardson, University of East Anglia, Norwich, UK, for valuable, critical recommendations improving the manuscript and language. The research was also supported by the Tomsk State University Competitiveness Improvement Program.

Andersen LW, Dirksen R, Nikulina EA, et al. Conservation genetics of the pond bat (Myotis dasycneme) with special focus on the populations in northwestern Germany and in Jutland, Denmark. Ecol Evol. 2019;9:5292–5308. 10.1002/ece3.5119

DATA ACCESSIBILITY

All sequences are deposited in GenBank with accession numbers (CR) MK598578–MK598593 and (CytB) MK603162–MK603174. Hap_1–Hap_23 are concatenated from CR and CytB with the following combination of accession numbers from Hap_1: MK598578, MK603170; MK598581, AF376846.1; MK598580, MK603170; MK598580, MK603173; MK598582, MK603170; MK598584, MK603163; MK598585, MK603162; MK598586, MK603162; MK598580, MK603171; MK598583, MK603170; MK598579, MK603170; MK598589, MK603170; MK598590, MK603165; MK598591, MK603174; MK598592, MK603164; MK598580, MK603168; MK598591, MK603164; MK598591, MK603168; MK598588, MK603170; MK598593, MK603166; MK598580, MK603167; MK598580, MK603172; Hap_23: MK598580, MK603169. The microsatellite genotypes data are deposited at Dryad Digital Repository https://doi.org/10.5061/dryad.cq11s60.

REFERENCES

  1. Ahlén, I. , Baagøe, H. J. , & Bach, L. (2009). Behavior of Scandinavian bats during migration and foraging at sea. Journal of Mammalogy, 90, 1318–1323. 10.1644/09-MAMM-S-223R.1 [DOI] [Google Scholar]
  2. Altringham, J. D. (2011). Bats from evolution and conservation. Oxford, UK: Oxford University Press. [Google Scholar]
  3. Baagøe, H. J. (1987). The Scandinavian bat fauna ‐ adaptive wing morphology and free flight in the Field In Fenton M. B., Racey P. A., & Rayner J. M. V. (Eds.), Recent advances in the study of bats (pp. 57–74). Cambridge, UK: Cambridge University Press. [Google Scholar]
  4. Baagøe, H. J. (2007). Damflagermus Myotis dasycneme (Boie, 1825) In Baagøe H. J., & Jensen T. S. (Eds.), Dansk Pattedyratlas (pp. 50–55). København, Denmark: Gyldendal. [Google Scholar]
  5. Baagøe, H. J. (2010). Damflagermus Myotis dasycneme In Elmeros M., Hansen T. S., Baagøe H. J., & Teilmann J. (Eds.), Den danske rødliste. Pattedyr. http://www.dmu.dk/dyrplanter/redlistframe/. [Google Scholar]
  6. Baagøe, H. J. , & Degn, H. J. (2009). Flagermusene i Mønsted og Daugbjerg Kalkgruber i udflyvningsperioden 2009. Skov ‐og Naturstyrelsen, Midtjylland: Miljøministeriet, Skov‐ og Naturstyrelsen, 2009. 38 s.
  7. Baird, N. A. , Etter, P. D. , Atwood, T. S. , Currey, M. C. , Shiver, A. L. , Lewis, Z. A. , … Johnson, E. A. (2008). Rapid SNP discovery and genetic mapping using sequenced RAD markers. PLoS ONE, 3, e3376 10.1371/journal.pone.0003376 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Bandelt, H. J. , Forster, P. , & Rohl, A. (1999). Median‐joining networks for inferring intraspecific phylogenies. Molecular Biology and Evolution, 16, 37–48. 10.1093/oxfordjournals.molbev.a026036 [DOI] [PubMed] [Google Scholar]
  9. Bogdanowicz, W. , Piksa, K. , & Tereba, A. (2012). Genetic structure in three species of whiskered bats (genus Myotis) during swarming. Journal of Mammalogy, 93, 799–807. [Google Scholar]
  10. Bohonak, A. J. (2002). IBD (Isolation By Distance): A program for analyses of isolation by distance. Journal of Heredity, 93, 153–154. 10.1093/jhered/93.2.153 [DOI] [PubMed] [Google Scholar]
  11. Castella, V. , & Ruedi, M. (2000). Characterization of highly variable microsatellite loci in the bat Myotis myotis (Chiroptera: Vespertilionidae). Molecular Ecology, 9, 1000–1002. 10.1046/j.1365-294x.2000.00939-6.x [DOI] [PubMed] [Google Scholar]
  12. Chen, C. , Durand, E. , Forbes, F. , & Franòois, O. (2007). Bayesian clustering algorithms ascertaining spatial population structure: A new computer program and a comparison study. Molecular Ecology Notes, 7, 747–756. 10.1111/j.1471-8286.2007.01769.x [DOI] [Google Scholar]
  13. Chikhi, L. , Sousa, V. C. , Luisi, P. , Goossens, B. , & Beaumont, M. A. (2010). The confounding effects of population structure, genetic diversity and the sampling scheme on the detection and quantification of population size changes. Genetics, 186, 983–995. 10.1534/genetics.110.118661 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Ciechanowski, M. , Sachanowicz, K. , & Kokurewicz, T. (2007). Rare or underestimated? The distribution and abundance of the pond bat (Myotis dasycneme) in Poland. Lutra, 50, 107–134. [Google Scholar]
  15. Ciechanowski, M. , Zapart, A. , Kokurewicz, T. , Rusiński, M. , & Lazarus, M. (2017). Habitat selection of the pond bat (Myotis dasycneme) during pregnancy and lactation in northern Poland. Journal of Mammalogy, 98, 232–245. 10.1093/jmammal/gyw108 [DOI] [Google Scholar]
  16. Corbet, G. B. (1978). The mammals of the Palaearctic Region: A taxonomic review. British Museum (Natural History) (London and Ithaca N.Y.).
  17. Cornuet, J. M. , & Luikart, G. (1996). Description and power analysis of two tests for detecting recent population bottlenecks from allele frequency data. Genetics, 144, 2001–2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. DeSalle, R. , Templeton, A. R. , Mori, I. , Pletscher, S. , & Johnston, J. S. (1987). Temporal and spatial heterogeneity of mtDNA polymorphisms in natural populations of Drosophila mercatorum. Genetics, 116, 215–223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Di Rienzo, A. , Peterson, A. C. , Garza, J. C. , Valdes, A. M. , Slatkin, M. , & Freimer, N. B. (1994). Mutational processes of simple sequence repeat loci in human populations. Proceedings of the National Academy of Sciences, 91, 3166–3170. 10.1073/pnas.91.8.3166 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Dietz, C. , Helversen, O. , & Nill, D. (2009). Bats of Britain Europe and Northeastern Africa. London, UK: A&C Black. [Google Scholar]
  21. Earl, D. A. , & VonHoldt, B. M. (2012). STRUCTURE HARVESTER: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conservation Genetic Resources, 4, 359–361. 10.1007/s12686-011-9548-7 [DOI] [Google Scholar]
  22. Egsbæk, W. , & Jensen, B. (1963). Results of bat banding in Denmark. Videnskabelige Meddelelser Fra Dansk Naturhistorisk Forening, 125, 269–296. [Google Scholar]
  23. Evanno, G. , Regnaut, S. , & Goudet, J. (2005). Detecting the number of clusters of individuals using the software structure: A simulation study. Molecular Ecology, 14, 2611–2620. 10.1111/j.1365-294X.2005.02553.x [DOI] [PubMed] [Google Scholar]
  24. Excoffier, L. , & Lischer, H. E. L. (2010). Arlequin suite ver. 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Molecular Ecology Resources, 10, 564–567. 10.1111/j.1755-0998.2010.02847.x [DOI] [PubMed] [Google Scholar]
  25. Falush, D. , Stephens, M. , & Pritchard, J. (2003). Inference of population structure using multilocus genotype data: Linked loci and correlated allele frequencies. Genetics, 164, 1567–1587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Frankham, R. , Briscoe, D. A. , & Ballou, J. D. (2010). Introduction to Conservation Genetics, 2nd ed Cambridge, UK: Cambridge University Press. [Google Scholar]
  27. Fu, Y. X. (1997). Statistical neutrality of mutations against population growth, hitchhiking and background selection. Genetics, 147, 915–925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Furman, A. , Ҫelik, Y. E. , & Ҫoraman, E. (2018). Myotis myotis (Chiroptera: Vespertilionidae) diverges into two distinct, Anatolian and European, populations. Zoological Journal of the Linnean Society, 183(1), 226–235. [Google Scholar]
  29. Furmankiewicz, J. , & Altringham, J. (2007). Genetic structure in a swarming brown long‐eared bat (Plecotus auritus) population: Evidence for mating at swarming sites. Conservation Genetics, 8, 913–923. 10.1007/s10592-006-9246-2 [DOI] [Google Scholar]
  30. Görföl, T. , Dombei, I. , Barti, L. , Bücs, S. , Jére, C. , Pocora, … I.(2018). A review of the occurrence data of the pond bat (Myotis dasycneme) in its southern distribution range. North‐Western Journal of Zoology, 14, 135–141. [Google Scholar]
  31. Goudet, J. (1995). FSTAT 2.9.3.1: A computer program to calculate F statistics. Journal of Heredity, 86, 485–486. [Google Scholar]
  32. Haarsma, A.‐J. , & Siepel, H. (2014). Group size and dispersal ploys: An analysis of commuting behaviour of the pond bat (Myotis dasycneme). Canadian Journal of Zoology, 92, 57–65. 10.1139/cjz2013-0052 [DOI] [Google Scholar]
  33. Handley, L. J. L. , Manica, A. , Goudet, J. , & Balloux, F. (2007). Going the distance: Human population genetics in a clinal world. Trends in Genetics, 23, 432–439. 10.1016/j.tig.2007.07.002 [DOI] [PubMed] [Google Scholar]
  34. Harpending, H. C. , Sherry, S. T. , & Rogers, A. R. (1993). Genetic structure of ancient human populations. Current Anthropology, 34, 483–496. [Google Scholar]
  35. Hewitt, G. M. (1999). Post‐glacial re‐colonization of European biota. Biological Journal of Linnean Society, 68, 87–112. 10.1111/j.1095-8312.1999.tb01160.x [DOI] [Google Scholar]
  36. Hewitt, G. M. (2001). Speciation, hybrid zones and phylogeography ‐ or seeing genes in space and time. Molecular Ecology, 10, 537–549. 10.1046/j.1365-294x.2001.01202.x [DOI] [PubMed] [Google Scholar]
  37. Hickerson, M. J. , Carstens, B. C. , Cavender‐Bares, J. , Crandall, K. A. , Graham, C. H. , Johnson, J. B. , … Yoder, A. D. (2010). Phylogeography's past, present, and future: 10 years after Avise, 2000. Molecular Phylogenetics and Evolution, 54, 291–301. 10.1016/j.ympev.2009.09.016 [DOI] [PubMed] [Google Scholar]
  38. Hohenlohe, P. A. , Bassham, S. , Etter, P. D. , Stiffler, N. , Johnson, E. A. , & Cresko, W. A. (2010). Population genomics of parallel adaptation in threespine stickleback using sequenced RAD Tags. PLoS Genetics, 6, e1000862 10.1371/journal.pgen.1000862 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Horáček, I. (1985). Population ecology of Myotis myotis in Central Bohemia (Mammalia: Chiroptera). Acta Universitas Carolinae Biologica, 8, 161–267. [Google Scholar]
  40. Hutterer, R. , Ivanova, T. , Meyer‐Cords, L. , & Rodrigues, C. (2005). Bat migrations in Europe: A review of banding data and literature (pp. 28, 1–162). Bonn, Germany: Federal Agency for Nature Conservation. [Google Scholar]
  41. Ibáñez, C. , García‐Mudarra, J. L. , Ruedi, M. , Stadelmann, B. , & Juste, J. (2006). The Iberian contribution to cryptic diversity in European bats. Acta Chiropterologica, 8, 277–297. 10.3161/1733-5329(2006)8[277:TICTCD]2.0.CO;2 [DOI] [Google Scholar]
  42. IUCN . (2018). The IUCN Red List of Threatened Species. Version 2018–2. http://www.iucnredlist.org.
  43. Jacobsen, M. W. , Hansen, M. M. , Orlando, L. , Bekkevold, D. , Bernatchez, L. , Willerslev, E. , & Gilbert, M. T. P. (2012). Mitogenome sequencing reveals shallow evolutionary histories and recent divergence time between morphologically and ecologically distinct European whitefish (Coregonus spp.). Molecular Ecology, 21, 2727–2742. [DOI] [PubMed] [Google Scholar]
  44. Jagd & Artenschutz . (2010). Jagd und Artenschutz Jahresbericht 2010. Kiel, Germany: Ministerium für Landwirtschaft, Umwelt und ländliche Räume des Landes Schleswig‐Holstein. [Google Scholar]
  45. Jombart, T. (2008). adegenet: An R package for the multivariate analysis of genetic markers. Bioinformatics, 24, 1403–1405. [DOI] [PubMed] [Google Scholar]
  46. Jombart, T. , Devillard, S. , & Balloux, F. (2010). Discriminant analysis of principal components: A new method for the analysis of genetically structured populations. BMC Genetics, 11, 5292–15. 10.1186/1471-2156-11-94 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Jost, L. (2008). GST and its relatives do not measure differentiation. Molecular Ecology, 17, 4015–4026. [DOI] [PubMed] [Google Scholar]
  48. Keenan, K. , McGinnity, P. , Cross, T. F. , Crozier, W. W. , & Prodöhl, P. A. (2013). diveRsity: An R package for the estimation and exploration of population genetics parameters and their associated errors. Methods in Ecology and Evolution, 4, 782–788. [Google Scholar]
  49. Kerth, G. , Kiefer, A. , Trappmann, C. , & Weishaar, M. (2003). High gene diversity at swarming sites suggest hot spots for gene flow in the endangered Bechstein's bat. Conservation Biology, 4, 491–499. [Google Scholar]
  50. Kerth, G. , Mayer, F. , & Petit, E. (2002). Extreme sex‐biased dispersal in the communally breeding, nonmigratory Bechstein's bat (Myotis bechsteinii). Molecular Ecology, 11, 1491–1498. 10.1046/j.1365-294X.2002.01528.x [DOI] [PubMed] [Google Scholar]
  51. Kopelman, N. M. , Mayzel, J. , Jakobsson, M. , Rosenberg, N. A. , & Mayrose, I. (2015). Clumpak: A program or identifying clustering modes and packaging population structure inferences across K. Molecular Ecology Resources, 15, 1179–1191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Krüger, F. , Clare, E. L. , Greif, S. , Siemers, B. M. , Symondson, W. O. C. , & Sommer, R. S. (2014). An Integrative approach to detect subtle trophic niche differentiation in the sympatric trawling bat species Myotis dasycneme and Myotis daubentonii . Molecular Ecology, 23, 3657–3671. [DOI] [PubMed] [Google Scholar]
  53. Kruskop, S. V. , Borisenko, A. V. , Ivanova, N. V. , Lim, B. K. , & Eger, J. L. (2012). Genetic diversity of northeastern Palaearctic bats as revealed by DNA barcodes. Acta Chiropterologica, 14, 5292–14. 10.3161/150811012X654222 [DOI] [Google Scholar]
  54. Latch, E. K. , Dharmarajan, G. , Glaubitz, J. C. , & Rhodes, O. E. Jr. (2006). Relative performance of Bayesian clustering software for inferring population substructure and individual assignment at low levels of population differentiation. Conservation Genetics, 7, 295–302. 10.1007/s10592-005-9098-1 [DOI] [Google Scholar]
  55. Leigh, J. W. , & Bryant, D. (2015). POPART: Full‐feature software for haplotype network construction. Methods in Ecology and Evolution, 6, 1110–1116. [Google Scholar]
  56. Librado, P. , & Rozas, J. (2009). DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics, 25, 1451–1452. 10.1093/bioinformatics/btp187 [DOI] [PubMed] [Google Scholar]
  57. Limpens, H. J. G. A. , Lina, P. H. C. , & Hutson, A. M. (2000).Action plan for the conservation of the pond bat in Europe (Myotis dasycneme). Nature and Environment no. 108. Council of Europe.
  58. Linck, E. , & Battey, C. J. (2019). Minor allele frequency thresholds strongly affect population structure inference with genomic datasets. Molecular Ecology Resources. 10.1111/1755-0998.12995 [DOI] [PubMed] [Google Scholar]
  59. Luikart, G. (1998). Distortion of allele frequency distributions provides a test for recent population bottlenecks. Journal of Heredity, 89, 238–247. 10.1093/jhered/89.3.238 [DOI] [PubMed] [Google Scholar]
  60. Mayer, F. , & vonHelversen, O. (2001). Cryptic diversity in European bats. Proceedings of the Royal Society of London B: Biological Sciences, 268, 1825–1832. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Meinig, H. (2010). Die Klimaveränderung – Auswirkungen auf Vögel und Säugetiere in Mitteleuropa. Nyctalus, 15, 128–153. [Google Scholar]
  62. Nei, M. (1973). Analysis of gene diversity in subdivided populations. Proceedings of the National Academy of Sciences, 70, 3321–3323. 10.1073/pnas.70.12.3321 [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Nei, M. (1987). Molecular evolutionary genetics. New York, NY: Columbia University Press. [Google Scholar]
  64. Nei, M. , & Chesser, R. (1983). Estimation of fixation indices and gene diversities. Annals of Human Genetics, 47, 253–259. 10.1111/j.1469-1809.1983.tb00993.x [DOI] [PubMed] [Google Scholar]
  65. Paetkau, D. , Slade, R. , Burden, M. , & Estoup, A. (2004). Genetic assignment methods for the direct, real‐time estimation of migration rate: A simulation‐based exploration of accuracy and power. Molecular Ecology, 13, 55–65. 10.1046/j.1365-294X.2004.02008.x [DOI] [PubMed] [Google Scholar]
  66. Peakall, R. , & Smouse, P. E. (2006). GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes, 6, 288–295. 10.1111/j.1471-8286.2005.01155.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Peakall, R. , & Smouse, P. E. (2012). GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research‐an update. Bioinformatics, 28, 2537–2539. 10.1093/bioinformatics/bts460 [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Pérez‐Espona, S. , & ConGRESS Consortium . (2017). Conservation genetics in the European Union ‐ Biases, gaps and future directions. Biological Conservation, 209, 130–136. 10.1016/j.biocon.2017.01.020 [DOI] [Google Scholar]
  69. Peterson, B. K. , Weber, J. N. , Kay, E. H. , Fisher, H. S. , & Hoekstra, H. E. (2012). Double Digest RADseq: An inexpensive method for de novo SNP discovery and genotyping in model and nonmodel species. PLoS ONE, 7, e37135 10.1371/journal.pone.0037135 [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Petit, E. , Excoffier, L. , & Mayer, F. (1999). No evidence of bottleneck in the postglacial recolonization of Europe by the noctule bat (Nyctalus noctula). Evolution, 53, 1247–1258. [DOI] [PubMed] [Google Scholar]
  71. Petit, E. , & Mayer, F. (1999). Male dispersal in the noctule bat (Nyctalus noctula): Where are the limits? Proceedings Royal Society London B, 266, 1717–1722. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Petit, E. , & Mayer, F. (2000). A population genetic analysis of migration: The case of the noctule bat (Nyctalus noctula). Molecular Ecology, 9, 683–690. 10.1046/j.1365-294x.2000.00896.x [DOI] [PubMed] [Google Scholar]
  73. Piraccini, R. (2016). Myotis dasycneme. The IUCN Red List of Threatened Species, e.T14127A22055164. doi: 10.2305/IUCN.UK.2016-2.RLTS.T14127A22055164.en [DOI]
  74. Piry, S. , Alapetite, A. , Cornuet, J. M. , Paetkau, D. , Baudouin, L. , & Estoup, A. (2004). GENECLASS2: A software for genetic assignment and first‐generation migrant detection. Journal of Heredity, 95, 536–539. 10.1093/jhered/esh074 [DOI] [PubMed] [Google Scholar]
  75. Piry, S. , Luikart, G. , & Cornuet, J. M. (1999). BOTTLENECK – a computer program for detecting recent reductions in the effective population size using allele frequency data. Journal of Heredity, 90, 502–503. [Google Scholar]
  76. Posada, D. (2008). jModelTest: Phylogenetic model averaging. Molecular Biology and Evolution, 25, 1253–1256. 10.1093/molbev/msn083 [DOI] [PubMed] [Google Scholar]
  77. Pritchard, J. K. , Stephens, M. , & Donnelly, P. (2000). Inference of population structure using multilocus genotype data. Genetics, 155, 945–959. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. R Core Team (2008). R: A language and environment for statistical computing. Vienna, Austria: R Foundation for Statistical Computing. [Google Scholar]
  79. Ramachandran, S. , Deshpande, O. , Roseman, C. C. , Rosenberg, N. A. , Feldman, M. W. , & Cavalli‐Sforza, L. L. (2005). Support from the relationship of genetic and geographic distance in human populations for a serial founder effect originating in Africa. Proceedings of the National Academy of Sciences USA, 102, 15942–15947. 10.1073/pnas.0507611102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  80. Raymond, M. , & Rousset, F. (1995). GENEPOP ver. 3.2: A population genetics software for exact tests and ecumenicism. Journal of Heredity, 86, 248–249. [Google Scholar]
  81. Rice, W. R. (1989). Analyzing tables of statistical tests. Evolution, 43, 223–225. 10.1111/j.1558-5646.1989.tb04220.x [DOI] [PubMed] [Google Scholar]
  82. Rivers, N. M. , Butlin, R. K. , & Altringham, J. D. (2005). Genetic population structure of Natterer's Bats explained by mating at swarming sites and philopatry. Molecular Ecology, 14, 4299–4312. 10.1111/j.1365-294X.2005.02748.x [DOI] [PubMed] [Google Scholar]
  83. Rogers, A. , & Harpending, H. (1992). Population growth makes waves in the distribution of pairwise genetic differences. Molecular Biology and Evolution, 9, 552–569. [DOI] [PubMed] [Google Scholar]
  84. Ronquist, F. , Teslenko, M. , van der Mark, P. , Ayres, D. L. , Darling, A. , Höhna, S. , … Huelsenbeck, J. P. (2012). MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology, 61, 539–542. 10.1093/sysbio/sys029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  85. Rossina, V. V. (2006). Bats as an Indicator of human activity in the Paleolithic, using the example of Denisova Cave, Northwestern Altai. Paleontological Journal, 40, 494–500. 10.1134/S0031030106100091 [DOI] [Google Scholar]
  86. Ruedi, M. , & Castella, V. (2003). Genetic consequences of the ice ages on nurseries of the bat Myotis myotis: A mitochondrial and nuclear survey. Molecular Ecology, 12, 1527–1540. 10.1046/j.1365-294X.2003.01828.x [DOI] [PubMed] [Google Scholar]
  87. Ruedi, M. , & Mayer, F. (2001). Molecular systematics of bats of the genus Myotis (Vespertilionidae) suggests deterministic ecomorphological convergences. Molecular Phylogenetics and Evolution, 21, 436–448. 10.1006/mpev.2001.1017 [DOI] [PubMed] [Google Scholar]
  88. Ruedi, M. , Walter, S. , Fischer, M. , Scaravelli, D. , Excoffier, L. , & Heckel, G. (2008). Italy as a major Ice Age refuge area for the bat Myotis myotis (Chiroptera: Vespertilionidae) in Europe. Molecular Ecology, 17, 1801–1814. [DOI] [PubMed] [Google Scholar]
  89. Salari, L. , & Kotsakis, T. (2011). Late Pleistocene and Holocene bats of Latium (Central Italy). Il Quaternario, 24, 121–129. [Google Scholar]
  90. Schneider, S. , & Excoffier, L. (1999). Estimation of demographic parameters from the distribution of pairwise differences when the mutation rates vary among sites: Application to human mitochondrial DNA. Genetics, 152, 1079–1089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  91. Slatkin, M. , & Hudson, R. R. (1991). Pairwise comparisons of mitochondrial DNA sequences in stable and exponentially growing populations. Genetics, 129, 555–562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  92. Stockwell, C. A. , Hendry, A. P. , & Kinnison, M. T. (2003). Contemporary evolution meets conservation biology. TRENDS in Ecology and Evolution, 18, 94–101. 10.1016/S0169-5347(02)00044-7 [DOI] [Google Scholar]
  93. Strelkov, P. P. (1969). Migratory and stationary bats (Chiroptera) of the European part of the Soviet Union. Acta Zoologica Cracoviensia, 14, 393–436. [Google Scholar]
  94. Sundqvist, L. , Keenan, K. , Zackrisson, M. , Prodöhl, P. , & Kleinhans, D. (2016). Directional genetic differentiation and relative migration. Ecology and Evolution, 6, 3461–3475. 10.1002/ece3.2096 [DOI] [PMC free article] [PubMed] [Google Scholar]
  95. Taberlet, P. , Fumagalli, L. , Wust‐Saucy, A. G. , & Cosson, J. F. (1998). Comparative phylogeography and post glacial colonization. Molecular Ecology, 7, 453–464. [DOI] [PubMed] [Google Scholar]
  96. Tajima, F. (1989). Statistical methods to test for nucleotide mutation hypothesis by DNA polymorphism. Genetics, 123, 585–595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  97. Van Oosterhout, C. , Hutchinson, W. F. , Wills, D. P. M. , & Shipley, P. (2004). Micro‐Checker: Software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes, 4, 535–538. 10.1111/j.1471-8286.2004.00684.x [DOI] [Google Scholar]
  98. Veith, M. , Beer, N. , Kiefer, A. , Johannesen, J. , & Seitz, A. (2004). The role of swarming sites for maintaining gene flow in the brown long‐eared bat (Plecotus auritus). Heredity, 93, 342–349. 10.1038/sj.hdy.6800509 [DOI] [PubMed] [Google Scholar]
  99. Verity, R. , & Nichols, R. A. (2014). What is genetic differentiation, and how should we measure it—GST, D, neither or both? Molecular Ecology, 23, 4216–4225. [DOI] [PubMed] [Google Scholar]
  100. Wang, J. (2017). The computer program STRUCTURE for assigning individuals to populations: Easy to use but easier to misuse. Molecular Ecology Resources, 17, 981–990. [DOI] [PubMed] [Google Scholar]
  101. Wang, J. (2019). A parsimony estimator of the number of populations from a STRUCTURE‐like analysis. Molecular Ecology Resources. 10.1111/1755-0998.13000 [DOI] [PubMed] [Google Scholar]
  102. Weir, B. S. , & Cockerham, C. C. (1984). Estimating F‐statistics for the analysis of population structure. Evolution, 38, 1358–1370. [DOI] [PubMed] [Google Scholar]
  103. Worthington, W. J. , & Barratt, E. (1996). A non‐lethal method of tissue sampling for genetic studies of chiropterans. Bat Research News, 37, 5292–3. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

 

Data Availability Statement

All sequences are deposited in GenBank with accession numbers (CR) MK598578–MK598593 and (CytB) MK603162–MK603174. Hap_1–Hap_23 are concatenated from CR and CytB with the following combination of accession numbers from Hap_1: MK598578, MK603170; MK598581, AF376846.1; MK598580, MK603170; MK598580, MK603173; MK598582, MK603170; MK598584, MK603163; MK598585, MK603162; MK598586, MK603162; MK598580, MK603171; MK598583, MK603170; MK598579, MK603170; MK598589, MK603170; MK598590, MK603165; MK598591, MK603174; MK598592, MK603164; MK598580, MK603168; MK598591, MK603164; MK598591, MK603168; MK598588, MK603170; MK598593, MK603166; MK598580, MK603167; MK598580, MK603172; Hap_23: MK598580, MK603169. The microsatellite genotypes data are deposited at Dryad Digital Repository https://doi.org/10.5061/dryad.cq11s60.


Articles from Ecology and Evolution are provided here courtesy of Wiley

RESOURCES