Skip to main content
Infection and Drug Resistance logoLink to Infection and Drug Resistance
. 2019 May 7;12:1139–1151. doi: 10.2147/IDR.S202048

Low prevalence of resistance genes in sheltered homeless population in Marseille, France, 2014–2018

Tran Duc Anh Ly 1,2, Linda Hadjadj 2,3, Van Thuan Hoang 1,2,4, Meriem Louni 1,2, Thi Loi Dao 1,2,5, Sekene Badiaga 2,6, Herve Tissot-Dupont 2,3, Didier Raoult 2,3, Jean-Marc Rolain 2,3, Philippe Gautret 1,2,
PMCID: PMC6511248  PMID: 31123411

Abstract

Objectives: The present study has explored the prevalence and potential factors contributing to the presence of nasal/pharyngeal resistant genes in homeless people.

Methods: During the winters 2014–2018, we enrolled sheltered homeless adults and controls and collected nasal/pharyngeal samples. Sixteen antibiotic resistance genes (ARGs), including genes encoding for beta-lactamases and colistin-resistance genes, were searched by real-time polymerase chain reaction (qPCR) performed directly on respiratory samples and followed by conventional PCR and sequencing.

Results: Over a 5-year period, using qPCR, we identified in homeless group (n=715) the presence of blaTEM (396/710, 54.7%), blaSHV (27/708, 3.6%), blaOXA-23 (1/708, 0.1%), while other genes including colistin-resistance genes (mcr-1 to mcr-5) were absent. We found a significantly higher proportion of ARG carriage among controls (74.1%) compared to homeless population (57.1%), p=0.038. Tobacco smoking (OR=4.72, p<0.0001) and respiratory clinical signs (OR=4.03, p=0.002) were most prevalent in homeless people, while vaccination against influenza (OR=0.31, p=0.016) was lower compared to controls. Among homeless people, type of housing (shelter A versus B, OR=1.59, p=0.006) and smoking tobacco (smoker versus non-smoker, OR=0.55, p=0.001) were independent factors associated with ARG carriage. By sequencing, we obtained a high diversity of blaTEM and blaSHV in both populations.

Conclusion: The lower risk for ARGs in the homeless population could be explained by limited access to health care and subsequently reduced exposure to antibiotics.

Keywords: antibiotic resistance gene, homeless, real-time polymerase chain reaction (qPCR), potential risk factors

Introduction

Homelessness is an increasingly social and public health concern in both developing and developed countries. Because of poor environmental conditions, poor physical state and substance abuse, this population is associated with the transmission of communicable diseases, including respiratory tract infections and multidrug-resistant tuberculosis.1,2 Antimicrobial resistance, if occurring in the homeless population, can challenge local health care systems because of the lack of surveillance due to the high mobility of this population. Several studies are available regarding the prevalence of antimicrobial resistance in homeless populations. An 8–10% prevalence of methicillin-resistant Staphylococcus aureus was evidenced in nasal sample from homeless people in Kansas City and in Boston, USA with resistance to erythromycin, levofloxacin and clindamycin.3,4 A study conducted in New Orleans, USA evidenced that housing in homeless shelter was an independent risk factor for high level of penicillin-non-susceptible Streptococcus pneumoniae carriage.5

Resistance to antibiotics may be due to the production of specific inactivating enzymes, changes in membrane permeability and efflux of the antibiotic, or to alteration of target sites.6 The production of beta-lactamases (extended-spectrum β-lactamases [ESBLs], especially those belonging to the CTX-M family, carbapenem-hydrolyzing β-lactamases) in Gram-negative bacteria is considered the most important mechanism contributing to antimicrobial resistance to β-lactam antibiotics.7 Due to be plasmid-borne, β-lactamases might spread among aerobic Gram-negative bacilli including Enterobacteriaceae and non-lactose fermenting bacteria (Pseudomonas aeruginosa, Acinetobacter baumannii).7 Carbapenemases belonging to the blaOXA-23, blaOXA-24, blaOXA-48, blaOXA-58 subgroups are those most frequently identified from A. baumannii.8 Multidrug-resistant A. baumannii which has been reported a frequent cause of respiratory infection might be responsible for nosocomial infection outbreaks and lead to increase health care-associated costs and occurrence of hard-to-treat bacterial infections.9,10 Colistin is currently regarded as one of the last-resource antibiotics for a variety of treatment of human infections.11 Nevertheless, the emergence of the plasmid-mediated colistin resistance genes, such as mcr-1 gene, has also been documented in Enterobacteriaceae species and then disseminated worldwide due to the spread of a transposon, which can move in or out of plasmids and the chromosome.11

The burden of antibiotic resistance in Marseille homeless population remains unknown and unexplored. Therefore, in this cross-sectional study, we aimed to assess the prevalence of most common resistance genes carriage (genes encoding for β-lactamases and colistin-resistance genes) in nasal-pharyngeal samples from sheltered homeless people in comparison with “non-homeless” controls. We also investigate the role of potential risk factors for resistance gene carriage. Rather than exploring antibiotic resistance by conventional culture-based methods, a molecular technique was directly applied, as this strategy has proven successful in other populations.12

Materials and methods

Selection of homeless participants

In our one-shot studies, adult homeless people residing in two municipal emergency shelters (shelters A and B) in Marseille, France were recruited on a voluntary basis in winter from 2014 through 2018. The participants were asked to complete questionnaires including information on demographics, personal history, substance use, vaccination status and respiratory clinical presentation at the time of enrolment.

Selection of comparison group

Controls (defined as the non-homeless group) included administrative staffs, physicians, nurses, medical students and Ph.D students from our institute who volunteered for nasal and pharyngeal sample collection and completed a questionnaire addressing demographics, chronic medical conditions, substance abuse, vaccination status, respiratory symptoms and signs at enrolment. This assessment was advertised only in the year 2018 and 5 days after the homeless people recruitment. Controls were selected in order to avoid marked differences in terms of age, gender or origin with the homeless group. The Méditerranée Infection Institute is at the front of the fight against health care-associated infections. The building was conceived with a specifically designed setting aiming at reducing at-risk contacts with patients.13 Staffs in clinical wards are controlled through automated continuous monitoring systems for the traceability of care and good practice reminders have been developed to an anthropological approach. In this context, the control group is unlikely to carry more resistance genes because of working at the institute.14

DNA extraction and pool

A pair of swabs (nasal and pharyngeal) were collected from each participant, transferred to Sigma-Virocult® medium and were subsequently processed for molecular analysis. The automated DNA extraction was performed on 200 µL of each swab using a BioRobot®EZ1 Advanced XL instrument (QIAGEN, Hilden, Germany) and DNeasy® Blood & Tissue according to the manufacturer’s instructions. DNA pooling was performed as previously described.15 The DNA extraction quality of each pool was assessed by RT-PCR targeting internal control TISS phage that was added to each extraction.16

Real-time PCR

All quantitative real-time PCR (qPCR) reactions were performed using a C1000 Touch™ Thermal Cycle (Bio-Rad, USA) with the ready-to-use reaction mix ROX qPCR Master according to the manufacturer’s recommendations. Negative control (single PCR mix and sterile H2O) and positive control template (Plasmid DNA extracted from a colony of Escherichia coli or K. pneumoniae cultured) were included in each qPCR experimental run. Results were considered positive accepted when the cycle threshold value of real-time PCR was ≤35. Individual retesting of each specimen was carried out from positive pools. Eventually, individuals having at least a nasal or a pharyngeal positive sample were considered positive cases.

The qPCR amplification was used to confirm the presence of 1) most common β-lactamase encoding genes including blaTEM, blaSHV, ESBL genes (blaCTX-A and blaCTX-B [blaCTX-M clusters A and B]) and carbapenemase-encoding genes (blaOXA-23, blaOXA-24, blaOXA-48, blaOXA-58, blaNDM, blaVIM, blaKPC), and 2) colistin-resistance genes (mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5) by using primers as described and by using specific primers designed in our laboratory (Table 1).17,18

Table 1.

Sequences of primers and probes used for real-time PCRs and conventional PCRs in this study

Gene Name Primers (5′-3′) and probes Amplicon size (pair of base) Reference
A. Real-time PCRs
blaTEM Forward TTCTGCTATGTGGTGCGGTA 213 (15)
Reward GTCCTCCGATCGTTGTCAGA
Probe 6-FAM-AACTCGGTCGCCGCATACACTATTCTCAGA-TAMRA
blaSHV Forward TCCCATGATGAGCACCTTTAAA 105 (15)
Reward TCCTGCTGGCGATAGTGGAT
Probe 6-FAM-TGCCGGTGACGAACAGCTGGAG-TAMRA
blaCTX-M-A Forward CGGGCRATGGCGCARAC 105 (15)
Reward TGCRCCGGTSGTATTGCC
Probe 6-FAM-CCARCGGGCGCAGYTGGTGAC-TAMRA
blaCTX-M-B Forward ACCGAGCCSACGCTCAA 221 (15)
Reward CCGCTGCCGGTTTTATC
Probe 6-FAM-CCCGCGYGATACCACCACGC-TAMRA
blaKPC Forward GATACCACGTTCCGTCTGGA 180 (16)
Reward GGTCGTGTTTCCCTTTAGCC
Probe 6-FAM-CGCGCGCCGTGACGGAAAGC-TAMRA
blaNDM Forward GCGCAACACAGCCTGACTTT 155 (16)
Reward CAGCCACCAAAAGCGATGTC
Probe 6-FAM-CAACCGCGCCCAACTTTGGC-TAMRA
BlaVIM Forward CACAGYGGCMCTTCTCGCGGAGA 132 (16)
Reward GCGTACGTYGCCACYCCAGCC
Probe 6FAM-AGTCTCCACGCACTTTCATGACGACCGCGTCGGCG-TAMRA
blaOXA-23 Forward TGCTCTAAGCCGCGCAAATA 130 (16)
Reward TGACCTTTTCTCGCCCTTCC
Probe 6-FAM-GCCCTGATCGGATTGGAGAACCA-TAMRA
blaOXA-24 Forward CAAATGAGATTTTCAAATGGGATGG 123 (16)
Reward TCCGTCTTGCAAGCTCTTGAT
Probe 6-FAM-GGTGAGGCAATGGCATTGTCAGCA-TAMRA
blaOXA-48 Forward TCTTAAACGGGCGAACCAAG 125 (16)
Reward GCGTCTGTCCATCCCACTTA
Probe 6-FAM-AGCTTGATCGCCCTCGATTTGG-TAMRA
blaOXA-58 Forward CGCAGAGGGGAGAATCGTCT 102 (16)
Reward TTGCCCATCTGCCTTTTCAA
Probe 6-FAM-GGGGAATGGCTGTAGACCCGC-TAMRA
mcr-1–2 Forward CTGTGCCGTGTATGTTCAGC 151 Available in our laboratory
Reward TTATCCATCACGCCTTTTGAG
Probe (mcr-1–2) FAM-TATGATGTCGATACCGCCAAATACC-TAMRA
Probe (mcr-2) VIC-TGACCGCTTGGGTGTGGGTA-TAMRA
mcr-3 Forward TGAATCACTGGGAGCATTAGGGC 144 Available in our laboratory
Reward TGCTGCAAACACGCCATATCAAC
Probe FAM-TGCACCGGATGATCAGACCCGT-TAMRA
mcr-4 Forward GCCAACCAATGCTCATACCCAAAA 112 Available in our laboratory
Reward CCGCCCCATTCGTGAAAACATAC
Probe FAM-GCCACGGCGGTGTCTCTACCC-TAMRA
mcr-5 Forward TATCCCGCAAGCTACCGACGC 126 Available in our laboratory
Reward ACGGGCAAGCACATGATCGGT
Probe FAM-TGCGACACCACCGATCTGGCCA-TAMRA
B. Conventional PCRs
blaTEM Forward ATGAGTATTCAACATTTCCGTG 861 (15)
Reward TTACCAATGCTTAATCAGTGAG
blaSHV Forward ATTTGTCGCTTCTTTACTCGC 1051 (15)
Reward TTTATGGCGTTACCTTTGACC
blaOXA-23 Forward GATCGGATTGGAGAACCAGA 501 (16)
Reward ATTTCTGACCGCATTTCCAT

Conventional PCR and sequencing

To better characterize these genes, only positive qPCR results were simultaneously tested by standard PCR. The purified PCR products were sequenced using specific primers and the BigDye Terminator® version 1.1 cycle sequencing ready reaction mix (Applied Biosystems, Foster City, CA, USA). All primers used in this study have previously been described (Table 1).17,18 Sequencing was performed on Applied Biosystems 3130 platform (ABI PRISM, PE Applied Biosystems, USA). Obtained sequences were edited and assembled using Chromas Pro 1.77 (Technelysium Pty Ltd, Australia) and were then aligned with reference genes from the ARG-ANNOT by Mega 7.0 software (https://www.megasoftware.net).19 These sequences are available in GenBank at accession numbers from MK099071 to MK099084 (for blaSHV), from MK099085 to MK099091 (for blaTEM) and MK099092 (for blaOXA-23) (Figure 1).

Figure 1.

Figure 1

Phylogenetic tree of the diversity of resistance genes detected in nasal/pharyngeal swabs from Marseille homeless people (▾) and comparison group (▽). (A) blaTEM genotyping; blaTEM-194 gene of K. pneumoniae (JN935136) was used as outgroup. (B) blaSHV genotyping; blaOKP gene of K. pneumoniae (NG049359) was used as outgroup. (C) blaOXA-23 genotyping; blaOXA-48 gene was used as outgroup. Phylogenetic inferences were conducted in MEGA 7 using the maximum likelihood method based on the Tamura-Nei model.

Statistical analysis

Collected data were statistically treated using Microsoft Excel 2016 and STATA (version 11.1). Missing data and unidentified samples were not analyzed. Statistical differences in baseline characteristics were evaluated by Pearson’s chi-square or Fisher’s exact tests as categorical variables. Means of quantitative data were compared using Student’s t-test. A two-tailed p-value <0.05 was considered as statistically significant. We first compared the prevalence of at least one resistance gene between the homeless group and the control group (in the year 2018). In addition, two logistic regression models were applied in order 1) to compare the distribution of potential risk factors among homeless and control groups (in the year 2018); 2) to identify factors associated with resistance gene carriage in the homeless group (in the 2014–2018 period). In the first model, univariate analysis was used to examine unadjusted distributions of multiple factors (demographic, chronic medical condition), respiratory symptoms or physical finding between. A p-value <0.05 was considered statistically significant. Variables with p-values of <0.2 from the univariate analysis were included in the multivariable multinomial regression, which was then created by step-wise regression. Using the same methods, in the second model, the same set of potential risk factors together with special characteristic for homeless (type of housing, duration of homelessness) were considered for association with resistance genes. Variation over time was adequate (assessed statistically as the proportion of variance explained by year and considered adequately fitted if the coefficient of determination [R2 statistic] was >50%) by using Microsoft Excel 2016.

Results

A total of 724 homeless people was included in the study, of whom 715 (98.8%) had a nasal and/or pharyngeal swab. In the comparison group, 54 individuals were recruited and all provided both nasal and pharyngeal swabs. A total of 1,530 respiratory samples was collected. The DNA was grouped into 87 pools (15 pools of 10, 12 pools of 15 and 60 pools of 20).

Participant characteristics

The homeless individuals were predominantly male (98.2%) with a median age of 43 years (ranging 18–84 years). Fifty-five percent of them were recruited from shelter A and 45% from shelter B. Participants originated from 49 countries with a majority of African migrants (70%). About 54% of the migrant population arrived in France more than a year earlier, with a mean (SD) length of stay in France of 10 years. Overall, the average duration of homelessness was about 3 years. A proportion of 9.6% of homeless people reported chronic respiratory disease and 60.3% smoking tobacco. About 40% were suffering from at least one respiratory symptom or sign at the time of sampling, with a 27.4% cough prevalence. Vaccination rate against influenza was less than 15%. Other socio-demographic characteristics, substance abuse, chronic diseases and clinical features of participants are shown in Table 2.

Table 2.

Characteristics of homeless participants: Demographics, chronic medical conditions and respiratory for resistance gene carriage (N=724 individuals)

Characteristics Total
n (%)
At least one resistance gene
n (%)
No resistance gene
n (%)
Univariate analysis OR (95% CI), p-value
Total 408 (57.5) 302 (42.5)
Year of studya
 2014 144 (19.9) 63 (45.7) 75 (54.3) -
 2015 126 (17.4) 90 (72.6) 34 (27.4) -
 2016 157 (21.7) 86 (55.5) 69 (44.5) -
 2017 198 (41.3) 113 (57.9) 82 (42.1) -
 2018 99 (13.7) 56 (57.1) 42 (42.9) -
Shelter
 B 323 (44.6) 164 (51.4) 155 (48.6) REF
 A 401 (55.4) 244 (62.4) 147 (37.6) 1.57 (1.16–2.19), p=0.003
Genre
 Female 13 (1.8) 3 (23.1) 9 (76.9) -
 Male 705 (98.2) 401 (58.0) 290 (42.0) -
 Unknownb 6 (-)
Age at enrolment
Mean age (SD) 42.8±16 years N/A N/A
Age range (years) 18–84 years N/A N/A
 ≤30 186 (26.0) 114 (57) 86 (43) REF
 30-≤50 286 (39.9) 157 (59.5) 124 (44.1) 0.96 (0.66–1.38), p=0.81
 >50 244 (34.1) 133 (59.9) 89 (40.1) 1.12 (0.77–1.66), p=0.55
 Unknownb 8 (-)
Origin
 European 182 (25.3) 85 (48.0) 92 (52.0) REF
 African 502 (69.8) 299 (60.4) 196 (39.6) 1.65 (1.17–2.33), p=0.004
 Asian 35 (4.9) 23 (67.6) 11 (32.4) 2.27 (1.05–4.92), p=0.036
 Unknownb 6 (-)
Mean duration of residence in France for migrant (SD), range (min, max) (years) 9.6±15.8 (0–66) N/A N/A
Mean duration of homelessness (SD) 2.8±5.5 N/A N/A
Range of duration of homelessness (years)
 <1 year 371 (53.2) 216 (59.7) 146 (40.3) REF
 ≥1 year 327 (46.8) 179 (55.2) 145 (44.8) 0.83 (0.61–1.13), p=0.25
 Unknownb 25 (-)
Alcohol
 Frequent 82 (11.5) 39 (49.4) 40 (50.6) 0.69 (0.43–1.1), p=0.12
 Rare or never 633 (88.5) 366 (58.7) 258 (41.3) REF
 Unknownb 9 (-)
Tobacco
 Never 284 (39.7) 188 (67.1) 92 (32.9) REF
 Yes 432 (60.3) 217 (51.3) 206 (48.7) 0.51 (0.38–0.71), p<0.0001
 Unknownb 9 (-)
Cannabis 126 (17.6) 55 (45.1) 67 (54.9) 0.54 (0.37–0.8), p=0.002
Intravenous drug use 3 (0.4) 1 (50) 1 (50) -
Snorted drug use 22 (3.1) 10 (47.6) 11 (52.4) -
Drug substitutes 9 (1.3) 3 (33.3) 6 (66.7) -
Chronic diseases
 Chronic respiratory diseasesc 69 (9.6) 32 (47.8) 35 (52.2) 0.65 (0.4–1.09), p=0.1
 Diabetes mellitus 47 (6.5) 27 (57.4) 20 (42.6) 1.01 (0.56–1.54), p=0.97
 Cancer 6 (1.0) 4 (66.7) 2 (33.3) -
 Hepatitis 16 (2.8) 6 (37.5) 10 (62.5) -
BMI
 Mean BMI (kg/m2) 24.2±4.1 N/A N/A
 Range of BMI (kg/m2) 14.7–40.1 N/A N/A
 Normal weight 393 (57.8) 223 (57.9) 162 (42.1) REF
 Underweight 31 (4.6) 17 (54.8) 14 (42.2) 0.88 (0.42–1.81), p=0.74
 Overweight 194 (28.6) 103 (53.1) 91 (46.9) 0.82 (0.58–1.16), p=0.27
 Obesity 61 (9.0) 37 (61.7) 23 (38.3) 1.17 (0.67–2.04), p=0.58
 Unknownb 45 (-)
 Seasonal vaccination against influenzad 103 (14.6) 52 (51.5) 49 (48.5) 0.76 (0.5–0.156), p=0.197
Clinical findings
At least one respiratory symptom or signe 266 (39.5) 149 (57.5) 110 (42.5) 0.96 (0.7–1.32), p=0.81
 Cough 182 (27.4) 101 (56.7) 77 (43.3) 0.91 (0.64–1.29), p=0.58
 Expectoration 83 (12.7) 42 (51.2) 40(48.8) 0.71 (0.45–1.13), p=0.145
 Rhinorrhea 49 (10.9) 28 (58.3) 20 (41.7) 1.1 (0.6–1.99), p=0.8
Fever 14 (2.5) 7 (50) 7 (50)

aThe variable was not included in the analysis, given that no intervention could be done based on this criterion

bUnknown: missing data or unidentified samples

cChronic respiratory diseases were defined as suffering from one of the following conditions: asthma, chronic obstructive pulmonary disease, occupational lung diseases and pulmonary hypertension

dProportion of seasonal vaccination against influenza for individuals ≥65 years of age: 24 of 73 participants (32.9%)

eAt least one respiratory symptom and sign was defined as suffering from one of the following coughs, expectoration, rhinorrhea, dyspnea, sore throat, sibilants, rhonchi, crackles

Abbreviations: BMI, body mass index; NA, not applicable; REF, reference category.

Controls were significantly more likely to be vaccinated against influenza compared to homeless people enrolled in 2018. Homeless people were significantly more likely to report chronic diseases and tobacco smoking and to present with respiratory symptoms at sampling time, compared to controls (Table 3). The differences in the distribution of several factors between the two groups remained significant in multivariate multinomial regression, such as tobacco smoking, respiratory clinical signs and vaccination against influenza (Table 4).

Table 3.

Comparison of homeless people and controls (year 2018)

Characteristics Homeless group
n (%)
Control group
n (%)
Univariate analysis
OR (95% CI)
p-value
Total 99 54
Genre
 Male 99 (100) 54 (100) N/A 1.00
 Female 0 0
 Mean age (SD) 39.4±17.5 34.4±10.2 N/A 0.06
Age range
 ≤30 years of age 47 (47.5) 27 (50.0) REF
 30-≤50 years of age 24 (24.2) 20 (37.0) 0.67 (0.32–1.47) 0.34
 >50 years of age 28 (28.3) 7 (13.0) 2.30 (0.88–5.96) 0.09
Origin 0.08
 Europe 22 (22.2) 19 (35.2) REF
 Africa 74 (72.6) 28 (27.5) 2.28 (1.08–4.85) 0.032
 Asia 3 (30.0) 7 (70.0) 0.27 (0.08–1.63) 0.19
Mean duration of residence in France (SD) for migrants (min, max) 8.2±16.1
(1 week-63 years)
3.8±3.9
(5 months-17 years)
N/A 0.117
Addiction
 Tobacco 58 (59.2) 13 (24.1) 4.60 (2.20–9.60) <0.0001
 Alcohol 13 (13.3) 6 (11.1) 1.22 (0.43–3.43) 0.7
 Antibiotic use in past 2 weeks 5 (5.2) 5 (9.3) 1.90 (0.68–4.51) 0.27
 Chronic respiratory diseases 10 (10.1) 0 (0) N/A <0.0001
 Seasonal vaccination against influenza 13 (13.4) 17 (31.5) 0.33 (0.15–0.76) 0.008
 Vaccination against pneumococcus 3 (3.2) 4 (7.4) 1.39 (0.34–4.00) 0.7
Clinical findings
 At least one respiratory symptom and sign 41 (41.8) 8 (14.8) 4.67 (2.00–10.96) 0.001
 Fever (temperature measured) 0 (0) 0(0) N/A N/A

Abbreviations: NA, not applicable; Ref, reference category.

Table 4.

Multivariate analysis of distribution of demographics, chronic medical conditions, clinical finding between the two groups (homeless people versus controls)

Characteristicsa Multivariate analysis
OR (95% CI), p-value
Origin -
Tobacco consumption 4.72 (2.12–10.53), p<0.0001
Seasonal vaccination against influenza 0.31 (0.12–0.81), p=0.016
At least one respiratory symptom and sign 4.03 (1.64–9.90), p=0.002

aOnly variables with p-values of <0.2 in the univariate analysis

Screening of β-lactamase encoding genes (Table 5 and Figure 1)

Table 5.

Prevalence of antibiotic resistance genes in nasal/pharyngeal samples in homeless population in the period 2014–2018 (N=715 individuals)

Overall gene frequency N (%)
At least one resistance gene 408 (57.5)
Extended-spectrum beta-lactamases 407/710 (57.3)
blaTEM 396/710 (54.7)
blaSHV 27/708 (3.8)
blaCTX-M-A 0
blaCTX-M-B 0
Carbapenemase encoding-genes 1/708 (0.14)
blaOXA-23 1/708 (0.14)
blaOXA-24 0
blaOXA-48 0
blaOXA-58 0
blaKPC 0
blaVIM 0
blaNDM 0
Colistin genes
mcr-1 0
mcr-2 0
mcr-3 0
mcr-4 0
mcr-5 0

blaTEM

Among the pools tested by qPCR screening, 82.8% (72/87) were positive for blaTEM. By individual retesting of each specimen for positive pools, we found a prevalence of 54.7% (396/710) in the homeless group over a 5-year period. Interestingly, in the control group, the prevalence was of 72.2% in 2018 (39/54), which was significantly higher than in the homeless group recruited in 2018 (52%, 51 of 98, p<0.001). Of note, using sequencing reaction targeting blaTEM in the 72 pools testing positive for blaTEM, we succeeded in amplifying 69 sequences and obtained 5 sequence types from the homeless group and 2 from the comparison group, showing 99–100% nucleotide identity to blaTEM type/reference genes in ARG-ANNOT site (Figure 1A).

blaSHV

About 18.4% (16/87) of the pools were positive for blaSHV-qPCR. In the homeless group, blaSHV prevalence was 3.8% (27/708). There was no significant difference of prevalence between the two groups in 2018 (7/98 in homeless people versus 4/54 in controls, p=0.92).

For the genotypic identification of blaSHV, we succeeded in amplifying 25 sequences (of 27, 92.6%) for homeless population and 4 (of 4, 100%) for the comparison group. The sequence results show the diversity of blaSHV in the homeless group (comprising 11 sequence types) and in the control group (comprising 3 sequence types) (Figure 1B).

blaCTX-M-A and blaCTX-M-B

None of the DNA pools tested positive for blaCTX-M-A and blaCTX-M-B.

Carbapenemase-encoding genes

Only 1 homeless (0.14%) was positive for blaOXA-23 by both qPCR and sequencing in nasal swab sampled in 2014 (Figure 1C). None of the DNA pools tested positive for blaOXA-58, blaOXA-48, blaOXA-24, blaNDM, blaVIM.

Screening of colistin-resistance genes

None of the DNA pools tested positive for mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 genes.

Overall, by qPCR, 57.5% (408/710) samples were positive for at least one resistance gene (blaSHV or/and blaTEM or/and blaOXA-23) in the homeless group; the proportion of blaSHV (or blaTEM) genes did not significantly vary over time (Figure 2). A higher prevalence of at least one resistance gene was observed in the comparison group (40 of 54, 74.1%) compared to the homeless group (56 of 98, 57.1%, p=0.038) (Figure 3).

Figure 2.

Figure 2

Prevalence of blaTEM and blaSHV according to the year of study (homeless group).

Figure 3.

Figure 3

Percentage of individuals harboring antibiotic resistance genes (Comparison between two groups; homeless group: N=98 individuals; controls: N=54 individuals).

Factor associated with resistance genes prevalence in the homeless population: multivariate model

Resistance genes prevalence was significantly higher in participants housed in shelter A (compared to shelter B) and in those born in African or Asian countries compared to European countries. Individuals smoking tobacco and cannabis were less likely to present resistance genes than others. In multivariate analysis, only being housed in shelter A (OR=1.59 [1.14–2.2], p=0.006) and smoking tobacco (OR=0.55 [0.39–0.78], p=0.001) remained associated with resistance gene carriage (Table 6).

Table 6.

Multivariate analysis of demographics, chronic medical conditions, clinical findings for resistance gene carriage in homeless group in the period 2014–2018 (N=715 individuals)

Characteristicsa Multivariate analysis
OR (95% CI), p-value
Shelter (A vs B) 1.59 (1.14–2.2), p=0.006
Origin -
Substance use
Alcohol (frequently vs sometimes or never) -
Tobacco (yes vs no) 0.55 (0.39–0.78), p=0.001
Cannabis (yes vs no) -
Chronic respiratory diseases -
Seasonal vaccination against influenza -
Expectoration -

aOnly variables with p-values of <0.2 in the univariate analysis

Discussion

A report from the Public Assistance – Hospitals of Marseille estimated that there are approximately 1,500 homeless individuals, including 800 sleeping on city streets, park benches, and subway trains and approximately 600 residing temporarily at the 2 main municipal shelters, with a high turnover.20 This is the first retrospective study aiming to assess directly resistance gene carriage rates in nasal/pharyngeal samples among sheltered homeless and their potential risk factors. As mentioned in several studies, tobacco smoking and suffering of respiratory symptoms at inclusion were strongly associated with homelessness status.2123 By contrast, the prevalence of seasonal vaccination against influenza was lower in the homeless group compared to controls; in fact, the seasonal vaccination coverage in homeless people ≥65 years was only 32.9% compared to 48.5–50.8% in the overall general French population ≥65 years in the same period.24

Homeless people from shelter A were more likely to carry resistance genes compared to those from shelter B. A sub-population of homeless people with a high level of precariousness is housed in a special sector of shelter A, which may partially explain our results. Unfortunately, the fact of being housed in the special unit was not documented on a regular basis in our surveys. We also found a negative association between tobacco smoking and resistance gene carriage. Tobacco has been shown to have impact on the nasopharyngeal flora of smokers,25 which may possibly account for the lower prevalence of resistance gene in homeless smokers, although further studies are needed before conclusions can be drawn.

Overall, a lower proportion of β-lactamase encoding gene carriage was observed among the homeless individuals compared to controls. A possible explanation is the limited access to health care and subsequently reduced exposure to antibiotics in homeless people, since, in France, antibiotics are not available for sale without prescription. Further longitudinal studies are needed to better assess the antibiotic use in this population and to challenge this hypothesis.

To date, more than 400 members of blaTEM and blaSHV have been described.26 It is proven that blaTEM-1 is one of the major plasmids associated with H. influenzae which is a major causative bacterium of community-acquired respiratory tract infections.27 In a previous work, a high prevalence of Haemophilus influenzae (59%) was shown in this population during the period 2015–2017.28 In this study, similarly high genetic diversity among blaTEM-encoding strains was observed; each blaTEM has one (blaTEM-2, blaTEM-29, blaTEM-55, blaTEM-59, blaTEM-96, blaTEM-171) amino acid substitution when compared to blaTEM-1.26 For blaSHV-1, a non-ESBL variant was first identified as plasmid-encoded in E. coli from Switzerland and subsequently described worldwide in isolates in different epidemiological settings, both in humans and animals.29,30 The genetic diversity of blaSHV-encoding gene in our study did not correlate with the origin of migrants (data not shown).

We reported a very low prevalence of carbapenemase-encoding genes (only blaOXA-23 with 1 of 708 individuals, 0.14%). In surveys conducted among healthy French pilgrims before departure to the Hajj pilgrimage, the prevalence of carbapenemase-encoding was also low (1% blaOXA-48) when detected by the same molecular method.18

Since the first description of mobilized colistin gene mcr-1 in a plasmid carried by E. coli isolated in China in April 2011,31 the dissemination of the transposon has been reported in numerous countries across five continents.32 Few data are available on the prevalence of mcr-genes other than mcr-1 in the human sample. In France, to our knowledge, mcr-genes others than mcr-1 have rarely been reported,3337 and no data is available concerning the presence of mcr-2 to mcr-5 in human samples.

Our study was based on non-culture techniques for screening antimicrobial resistance. Because many resistance genes are located on plasmids, resistance screening by direct qPCR provides a quick and simple method of screening products from genetic manipulations and a rapid estimation of antimicrobial resistance. Furthermore, pooling DNA reduces the cost of real-time PCR and yields a high specificity and a high sensitivity.16

Our work has several limitations. Homeless population was not randomly selected so that those harboring respiratory symptoms (cough, expectoration, rhinorrhoea) might have been more prone to enroll in the survey given that a medical examination was offered. The information about antibiotic use in the past, covered only a short 2-week period, which does not allow evaluating a possible lower exposure to antibiotics in the homeless group compared to controls. The detection of resistance gene directly from specimens did not allow to identify the bacteria that housed the antibiotic resistance genes.

Conclusions

Notwithstanding these limitations, the current study evidenced an unexpected low rate of resistance gene carriage among homeless people that could be explained by limited access to health care and subsequently reduced exposure to antibiotics.

Acknowledgments

This study was supported by the Institut Hospitalo-Universitaire (IHU) Méditerranée Infection, the National Research Agency under the program « Investissements d’avenir », reference ANR-10-IAHU-03, the Région Provence Alpes Côte d’Azur and European funding FEDER PRIMI. We thank Seydina M Diene and Ngaiganam Edgarthe for their technical assistance.

Ethics approval and informed consent

This protocol was reviewed and approved by the Marseille Institutional Review Board/Ethics Committee (Homeless population: 2010-A01406-33; Comparison group: 07-008-IFR 48). Informed consent was dated and signed by all individuals and the study was conducted in accordance with the Declaration of Helsinki.

Author contributions

All authors contributed to data analysis, drafting or revising the article, gave final approval of the version to be published, and agree to be accountable for all aspects of the work.

Disclosure

The authors report no conflicts of interest in this work.

References

  • 1.Wrezel O. Respiratory infections in the homeless. UWO Med J. 2009;2(78):5. [Google Scholar]
  • 2.Faustini A, Hall AJ, Perucci CA. Factors for multidrug resistant tuberculosis in Europe: a systematic review. Thorax. 2006;61(2):158–163. doi: 10.1136/thx.2005.045963 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ottomeyer M, Graham CD, Legg AD, et al. Prevalence of nasal colonization by methicillin-resistant Staphylococcus aureus in persons using a homeless shelter in Kansas City. Front Public Health. 2016;(4):234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Leibler JH, León C, Cardoso LJP, et al. Prevalence and risk factors for MRSA nasal colonization among persons experiencing homelessness in Boston, MA. J Med Microbiol. 2017;66:1183–1188. doi: 10.1099/jmm.0.000552 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Ruhe JJ, Myers L, Mushatt D, Hasbun R. High‐level penicillin‐non-susceptible Streptococcus pneumoniae bacteremia: identification of a low‐risk subgroup. Clin Infect Dis. 2004;38:508–514. doi: 10.1086/381197 [DOI] [PubMed] [Google Scholar]
  • 6.Munita JM, Arias CA. Mechanisms of antibiotic resistance. Microbiol Spectr. 2016;4:2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.van Hoek AH, Mevius D, Guerra B, Mullany P, Roberts AP, Aarts HJM. Acquired antibiotic resistance genes: an overview. Front Microbiol. 2011;2:203. doi: 10.3389/fmicb.2011.00215 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Antunes NT, Lamoureaux TL, Toth M, et al. Class D β-lactamases: are they all carbapenemases? Antimicrob Agents Chemother. 2014;58(4):2119–2125. doi: 10.1128/AAC.02045-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Kuo SC, Lee YT, Yang SP, et al.Eradication of multidrug-resistant Acinetobacter baumannii from the respiratory tract with inhaled colistin methanesulfonate: a matched case-control study. Clin Microbiol Infect. 2012;(18):870–876. doi: 10.1111/j.1469-0691.2011.03682.x [DOI] [PubMed] [Google Scholar]
  • 10.Hartzell JD, Kim AS, Kortepeter MG, et al. Acinetobacter pneumonia: a review. Med Gen Med. 2007;9:4. [PMC free article] [PubMed] [Google Scholar]
  • 11.Hadjadj L, Riziki T, Zhu Y, Li J, Diene S, Rolain J-M. Study of mcr-1 Gene-mediated colistin resistance in Enterobacteriaceae isolated from humans and animals in different countries. Genes. 2017;8:394. doi: 10.3390/genes8120394 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Leangapichart T, Tissot-Dupont H, Raoult D, et al. Risk factors for acquisition of CTX-M genes in pilgrims during Hajj 2013 and 2014. J Antimicrob Chemother. 2017;72(9):2627–2635. doi: 10.1093/jac/dkx066 [DOI] [PubMed] [Google Scholar]
  • 13.Bataille J, Brouqui P. Building an intelligent hospital to fight contagion. Clin Infect Dis. 2017;65(Suppl1):S4–S11. doi: 10.1093/cid/cix474 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Brouqui P, Boudjema S, Soto Aladro A, et al. New approaches to prevent healthcare-associated infection. Clin Infect Dis. 2017;65(Suppl1):S50–S54. doi: 10.1093/cid/cix474 [DOI] [PubMed] [Google Scholar]
  • 15.Edouard S, Prudent E, Gautret P, Memish ZA, Raoult D, Patel R. Cost-effective pooling of DNA from nasopharyngeal swab samples for large-scale detection of bacteria by real-time PCR. J Clin Microbiol. 2015;53:1002–1004. doi: 10.1128/JCM.03609-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Sow D, Parola P, Sylla K, et al. Performance of real-time polymerase chain reaction assays for the detection of 20 gastrointestinal parasites in clinical samples from Senegal. Am J Trop Med Hyg. 2017;97:173–182. doi: 10.4269/ajtmh.16-0781 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Leangapichart T, Dia NM, Olaitan AO, Gautret P, Brouqui P, Rolain J-M. Acquisition of extended-spectrum β-lactamases by Escherichia coli and Klebsiella pneumoniae in gut microbiota of Pilgrims during the Hajj Pilgrimage of 2013. Antimicrob Agents Chemother. 2016;60:3222–3226. doi: 10.1128/AAC.02396-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Leangapichart T, Gautret P, Griffiths K, et al. Acquisition of a high diversity of bacteria during the Hajj Pilgrimage, including Acinetobacter baumannii with blaOXA-72 and Escherichia coli with blaNDM-5 Carbapenemase Genes. Antimicrob Agents Chemother. 2016;60(10):5942–5948. doi: 10.1128/AAC.00669-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Gupta SK, Padmanabhan BR, Diene SM, et al. ARG-ANNOT, a new bioinformatic tool to discover antibiotic resistance genes in bacterial genomes. Antimicrob Agents Chemother. 2014;58:212–220. doi: 10.1128/AAC.02045-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Assistance Publique Hôpitaux de Marseille. Investigation of endemic and emerging diseases in populations of homeless households in Marseille. Available from: https://clinicaltrials.gov/ct2/show/results/NCT02819128. Accessed January 1, 2019.
  • 21.Collins SE, Orfaly VE, Wu T, et al. Content analysis of homeless smokers’ perspectives on established and alternative smoking interventions. Int J Drug Policy. 2018;51:10–17. doi: 10.1016/j.drugpo.2017.09.007 [DOI] [PubMed] [Google Scholar]
  • 22.van Laere I, de Wit M, Klazinga N. Shelter-based convalescence for homeless adults in Amsterdam: a descriptive study. BMC Health Serv Res. 2009;18:208. doi: 10.1186/1472-6963-9-208 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.De Maio G, Van Den Bergh R, Garelli S, et al. Reaching out to the forgotten: providing access to medical care for the homeless in Italy. Int Health. 2014;6:93–98. doi: 10.1093/inthealth/ihu002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.OCDE Données. Taux de vaccination contre la grippe. Available from: https://data.oecd.org/fr/healthcare/taux-de-vaccination-contre-la-grippe.htm. Accessed March05, 2019.
  • 25.Brook I, Gober AE. Recovery of potential pathogens and interfering bacteria in the nasopharynx of smokers and non-smokers. Chest. 2005;127:2072–2075. doi: 10.1378/chest.127.2.630 [DOI] [PubMed] [Google Scholar]
  • 26.The lactamase engineering database. Available from: http://www.laced.uni-stuttgart.de/. Accessed March05, 2019.
  • 27.Tristram S, Jacobs MR, Appelbaum PC. Antimicrobial resistance in Haemophilus influenzae. Clin Microbiol Rev. 2007;20:368–389. doi: 10.1128/CMR.00040-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Ly TDA, Edouard S, Badiaga S, et al. Epidemiology of respiratory pathogen carriage in the homeless population within two shelters in Marseille, France, 2015–2017: cross sectional 1-day surveys. Clin Microbiol Infect. 2019;25(2):e1–249.e6. doi: 10.1016/j.cmi.2018.04.032 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Liakopoulos A, Mevius D, Ceccarelli D. A review of SHV extended-spectrum β-lactamases: neglected yet ubiquitous. Front Microbiol. 2016;7:1374. doi: 10.3389/fmicb.2016.01374 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Heritage J, M’Zali FH, Gascoyne-Binzi D, Hawkey PM. Evolution and spread of SHV extended-spectrum β-lactamases in Gram-negative bacteria. J Antimicrob Chemother. 1999;44:309–318. doi: 10.1093/jac/44.3.309 [DOI] [PubMed] [Google Scholar]
  • 31.Liu YY, Wang Y, Walsh TR, et al. Emergence of plasmid-mediated colistin resistance mechanism mcr-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect Dis. 2016;16:161–168. doi: 10.1016/S1473-3099(16)30197-9 [DOI] [PubMed] [Google Scholar]
  • 32.Wang R, van Dorp L, Shaw LP, et al. The global distribution and spread of the mobilized colistin resistance gene mcr-1. Nat Commun. 2018;9(1):1179. doi: 10.1038/s41467-018-03205-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Rolain J-M, Kempf M, Leangapichart T, et al. Plasmid-mediated mcr-1 gene in colistin-resistant clinical isolates of Klebsiella pneumoniae in France and Laos. Antimicrob Agents Chemother. 2016;60:6994–6995. doi: 10.1128/AAC.00960-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Poirel L, Jayol A, Nordmann P. Polymyxins: antibacterial activity, susceptibility testing, and resistance mechanisms encoded by plasmids or chromosomes. Clin Microbiol Rev. 2017;30:557–596. doi: 10.1128/CMR.00064-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Beyrouthy R, Robin F, Lessene A, et al. MCR-1 and OXA-48 in vivo acquisition in KPC-producing Escherichia coli after colistin treatment. Antimicrob Agents Chemother. 2017;61(8):e02540–16. doi: 10.1128/AAC.02540-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Baron S, Bardet L, Dubourg G, et al. MCR-1 plasmid-mediated colistin resistance gene detection in an Enterobacter cloacae clinical isolate in France. J Glob Antimicrob Resist. 2017;10:35–36. doi: 10.1016/j.jgar.2017.05.004 [DOI] [PubMed] [Google Scholar]
  • 37.Birgy A, Madhi F, Hogan J, et al. CTX-M-55, MCR-1 and FosA-producing multidrug-resistant Escherichia coli infection in a child in France. Antimicrob Agents Chemother. 2018;62(4):e00127–18. doi: 10.1128/AAC.00127-18 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Infection and Drug Resistance are provided here courtesy of Dove Press

RESOURCES