Skip to main content
NCBI home page
Journal of Insect Science logoLink to Journal of Insect Science
. 2019 May 22;19(3):12. doi: 10.1093/jisesa/iez047

Prevalence and Diversity of Endosymbionts in Cassava Whiteflies (Hemiptera: Aleyrodidae) From Colombia

Juan Sebastián Gómez-Díaz 1,✉, James Montoya-Lerma 1, Vanessa Muñoz-Valencia 1
PMCID: PMC6529905  PMID: 31115477

Abstract

Whiteflies cause huge economic losses for cassava (Manihot esculenta Crantz) cultivation. Damage can be caused directly when the insects feed on the phloem and/or indirectly by the transmission of viruses. It has been found that whiteflies maintain a close relationship with some endosymbiotic bacteria and that this interaction produces different effects on host biology and can also facilitate viral transmission. This study aimed to characterize the diversity of secondary endosymbionts (SE) present in whiteflies associated with cassava. Whitefly adults and nymphs were collected from cassava crops at nine locations in Southwestern Colombia. Molecular identification of insects and endosymbionts was carried out using specific mtCOI, wsp, 23s rRNA, and 16s rRNA primers. Phylogenetic trees were constructed from these sequences, both for whitefly species and the endosymbionts found. In addition, morphological identification of whitefly species was made using last instar nymphs. Molecular and morphological evaluation revealed that the most abundant whitefly species was Trialeurodes variabilis (Quaintance) followed by Aleurotrachelus socialis Bondar and Bemisia tuberculata Bondar. One hundred percent of the individuals contained the primary endosymbiont Portiera. The SE Rickettsia, Hamiltonella, Wolbachia, and Fritschea were not detected in the samples tested. Prevalence of Cardinium and Arsenophonus were variable at each locality, Cardinium being most prevalent in A. socialis adults. This study is the first report on the presence of Cardinium and Arsenophonus in A. socialis and T. variabilis. It is also the first report of endosymbiotic diversity in whiteflies associated with cassava in Colombia.

Keywords: diversity, whitefly, cytochrome oxidase I, phylogenetics, secondary endosymbionts

After rice and corn, cassava (Manihot esculenta) is the most important source of calories for humans in the tropics and is essential for food security in many countries in the Americas and Africa (FAO 2015). Worldwide, one of the biggest problems for its production is the presence of whiteflies (Hemiptera: Aleyrodidae), a complex of species that causes direct damage by feeding on the phloem and, indirectly, through the transmission of more than 100 different virus species (Legg and Fauquet 2004, Carabalí et al. 2008, Navas-Castillo et al. 2011).

Of the 1,556 species of whitefly described (Forero 2008), only 15 are associated with cassava cultivation (Vásquez-Ordóñez et al. 2015), and only Bemisia and Trialeurodes genera are vectors of disease-causing viruses (Bellotti and Arias 2001, Navas-Castillo et al. 2011). In Africa, e.g., Bemisia tabaci (Gennadius) transmits the viruses causing cassava brown streak disease (CBSD) and cassava mosaic disease (CMD), the latter also transmitted by this species in Southern Asia. Both CBSD and CMD annually cause losses of millions of dollars of cassava crops in both Africa and Indian subcontinent (Legg and Fauquet 2004, Ghosh et al. 2015, Karthikeyan et al. 2016).

In Latin America, cassava is mainly colonized by whitefly species that cause losses as a consequence of direct feeding on the phloem (Carabalí et al. 2005). Specifically, two species of whitefly, Aleurotrachelus socialis (Bondar) and Trialeurodes variabilis (Quaintance), can cause losses of up to 79% in crop yield depending on the period of infestation and the variety cultivated in the north of South America (Bellotti and Arias 2001, Carabalí et al. 2010, Vásquez-Ordóñez et al. 2015). However, there are no reports of virus transmission in cassava by B. tabaci. This is possibly due to the limited capacity of B. tabaci MEAM1 to colonize cassava crops in the Americas (Carabalí et al. 2008).

As in other insects, whiteflies harbor intracellular bacteria known as endosymbionts (Baumann 2005, Baumann et al. 2006) that provide their host with essential nutrients that they lack or have little access to (Feldhaar et al. 2007, Santos-Garcia et al. 2012). In some cases, they also participate in the detoxification of secondary metabolites present in their diet (Feldhaar 2011) or are associated with increased resistance to pathogens (Su et al. 2013b) and predators (Oliver et al. 2003), contributing to the evolutionary and ecological success of the host (Moya et al. 2008, Feldhaar 2011). Endosymbionts are classified into two categories, mainly according to degree of host association. Primary endosymbionts (PE) are usually mutualistic and host-specific, and their transmission is strictly vertical. They exhibit long-term co-evolution with their host and are, therefore, fundamental for survival and/or reproduction (Wernegreen 2002, Su et al. 2013a). Examples of this are Buchnera in aphids, Blochmannia in Camponotus ants, Carsonella ruddii in psyllids, and Portiera aleyrodidarum in whiteflies (Wernegreen 2002, Kikuchi 2009, Su et al. 2013a). In the latter case, Portiera participates in the synthesis of essential aminoacids for its host since the phloem that these insects feed on contains low quantities of these aminoacids (Baumann 2005, Santos-Garcia et al. 2012, Upadhyay et al. 2015).

Conversely, secondary endosymbionts (SE) found in a wide variety of hosts can be parasites or mutualists, and their transmission can occur both vertically and horizontally (Gottlieb et al. 2008, Clark et al. 2010, Su et al. 2013a). Also, compared to PEs, SEs are not restricted to bacteriocytes as they do not have an obligate symbiotic relationship with their host and can inhabit a wide variety of tissues including bacteriocytes, salivary glands, Malpighi tubules, and reproductive organs. Additionally, they can be eliminated from their host without affecting the viability of their populations (Ruan et al. 2006, Ahmed et al. 2010, Clark et al. 2010, Xue et al. 2012, Su et al. 2014). However, in some hemipterans where SE complement the functions of PE, the relationship between host and SE has become closer, turning into a co-obligated association (McCutcheon et al. 2009, Manzano-Marín and Latorre 2014).

SE such as Hamiltonella, Wolbachia, Cardinium (Chiel et al. 2007), Rickettsia, Arsenophonus (Thao and Baumann 2004), and Fritschea (Everett et al. 2005) have been detected in whiteflies. Ghanim and Kontsedalov (2009) and Kontsedalov et al. (2008) proposed that some of these endosymbionts may be related to the insecticide resistance exhibited by certain species of whiteflies. Likewise, an association between the presence of SE in these insects and the efficiency of viral transmission has been detected (Morin et al. 2000). Gottlieb et al. (2010) reported the presence of Hamiltonella in B. tabaci MEAM1 which could facilitate transmission of the tomato yellow leaf curl virus; while Rana et al. (2012) detected Arsenophonus in B. tabaci Asia II which may be involved in the transmission of the cotton leaf curl virus. Similarly, it has been observed that the interaction between SE and its host not only enhances its ability to transmit viruses, but also provides several advantages at the fitness level. For example, a significant increase in both the number of eggs and nymph survival, shorter development time and larger body size (Su et al. 2013a), an increase in fertility, tolerance to insecticides and a greater number of female offspring (Brumin et al. 2011). Additionally, SE such as Wolbachia in B. tabaci MED (Xue et al. 2012) can also have important effects on processes such as resistance to parasitoids.

Currently, most of the studies that report endosymbiotic diversity in whiteflies have been carried out in Africa, Asia, and Europe (Ahmed et al. 2010, Gueguen et al. 2010, Thierry et al. 2011, Bing et al. 2013, Škaljac et al. 2013, Tajebe et al. 2014, Ghosh et al. 2015) and mainly focus on B. tabaci, leaving aside other species of this complex. However, in Latin America, specifically in Brazil, Marubayashi et al. (2014) identified the diversity of endosymbionts in different aleurodid species associated with crops such as tomato, cassava, eggplant, and others, reporting the presence of Arsenophonus in Trialeurodes vaporariorum (Westwood); Wolbachia, Arsenophonus, Cardinium, and Fritschea in Bemisia tuberculata (Bondar) and Wolbachia, Cardinium, and Fritschea in Tetraleurodes acacia (Quaintance). In Colombia, despite the importance of endosymbionts, there are no studies, to date, that report on the diversity of SE present in whiteflies. Identification of these endosymbionts is important given the ability of some SE to modify, and even increase, the fitness of their hosts. Their role in facilitating viral transmission by the insect could be influencing the recorded losses in cassava crops. Therefore, this study aimed to identify the SE in whitefly species associated with cassava crops from different localities in southwestern Colombia.

Materials and Methods

Whitefly Collection and DNA Extraction

Whitefly adults were collected from cassava crops at nine locations in the Departments of Cauca, Valle del Cauca, and Quindío in Colombia between August and November 2015 (Fig. 1; Supp Table 1 [online only]). Adults were captured using oral aspirators and preserved in 90% ethanol at −20°C previous to molecular analysis. In addition, the last instar nymphs were collected to corroborate the species present at each locality through morphological identification. Total DNA was extracted following the method proposed by Frohlich et al. (1999), individually macerating 24 to 30 adult females for each location.

Fig. 1.

Fig. 1.

Open in a new tab

Reference map of the nine localities sampled. The circular diagrams represent the percentage of prevalence of the whitefly species detected and the colors represent each species: black: T. variabilis; gray: B. tuberculata; white: A. socialis. SQI: Santander de Quilichao I; SQII: Santander de Quilichao II.

Whitefly Identification and SE Screening

For the molecular identification of the Aleyrodidae species, PCRs were performed using specific primers for A. socialis (Lundgren et al. 2014) and universal mitochondrial cytochrome oxidase I (mtCOI) (Folmer et al. 1994) (Table 1). For the detection of SE, specific primers available in the literature were used for Portiera, Rickettsia, Arsenophonus, Hamiltonella, Wolbachia, Fritschea, and Cardinium (Table 1).

Table 1.

List of the specific primers used for the identification of whitefly species and their SE

Species Gene Primer name 5′-3′ Tm (°C) Fragment size (bp) Reference
Aleurotrachelus socialis mtCOI Als-F GGGCACTGGTTGAACAGTTT 55 117 Lundgren et al. 2014
Als-R GCACCTAAAATGGAAGACGC
mtCOI LCO1490 GGTCAACAAATCATAAAGATATTGG 51 700 Folmer et al. 1994
HC021298 TAAACTTCAGGGTGACCAAAAAATCA
Portiera 16S rDNA Port-F GGAAACGTACGCTAATAC 58 900 Thierry et al. 2011
Port-R TGACGACAGCCATGCAGCAC
Arsenophonus 16S rDNA ARS-F GGGTTGTAAAGTACTTTCAGTCGT 60 600 Duron et al. 2008
ARS-R2 GTAGCCCTRCTCGTAAGGGCC
Wolbachia wsp 81-F TGGTCCAATAAGTGATGAAGAAAC 58 600 Zhou et al. 1998
417-R AAAAATTAAACGCTACTCCA
Rickettsia 16S rDNA Rb-F GCTCAGAACGAACGCTATC 58 960 Gottlieb et al. 2006
Rb-R GAAGGAAAGCATCTCTGC
Hamiltonella 16S rDNA HB-F TGAGTAAAGTCTGGGAATCTGG 58 750 Zchori-Fein and Brown 2002
HB-R AGTTCAAGACCGCAACCTC
Fritschea 23s rDNA FRIT-F GAGTTTGATCATGGCTCAGATTG 60 630 Gueguen et al. 2010
FRIT-R GCTCGCGTACCACTTTAAATGGCG
Cardinium 16S rDNA CLO-f1 GGAACCTTACCTGGGCTAGAATGTATT 54 466 Duron et al. 2008
CLO-r1 GCCACTGTCTTCAAGCTCTACCAAC
Open in a new tab

PCR reactions were carried out using 2 μl of template DNA, 2 mM dNTPs, 50 mM MgCl 2, 10 μM of each primer, 1 U of Taq BIOLASE DNA polymerase (Bioline, United Kingdom), 10× buffer solution (NH4). Cycling conditions used for mtCOI (Folmer et al. 1994) were those proposed by Ovalle et al. (2014). For the amplification of the endosymbionts, the thermal profile comprised an initial phase at 95°C for 2 min, followed by 35 cycles at 95°C for 30 s, Tm for 45 s (Table 1) and 72°C for 1 min, with a final extension at 72°C for 5 min. All PCRs were carried out in a Veriti thermocycler (ThermoFisher, United States) and negative and positive controls were included. Due to the small sizes of the fragments, the PCR products from A. socialis were visualized on 2% agarose gels while the other products were visualized in gels of 1% agarose with ethidium bromide. For each locality, between 5 and 10 positive amplicons (five amplicons for SE, and 10 for mtCOI gene) were randomly selected and sent to the Macrogen Corporation, United States for sequencing. Sequences were identified by comparison with those deposited in GenBank using BLASTn (NCBI, available online) and were deposited in the NCBI GenBank (GenBank accession numbers: MG812215-MG812280 and MG840316-MG840339).

With minor modifications, for each locality, five to eight nymphs from the last nymph instar were mounted on slides following, the method described by Hodges and Evans (2005). The nymphs were rinsed in 10% potassium hydroxide (KOH) over a period of 24 h (whitish nymphs) to 48 h (dark nymphs), and acid fuchsin was then added to facilitate visualization. Aleyrodidae whitefly species were morphologically determined using keys and descriptions by Caballero (1994), Dooley (2006), Hodges and Evans (2005), Martin (2005), and Ovalle et al. (2014) (Supp Table 2 [online only]).

Phylogenetic Analysis

The sequences from both mtCOI and the 16s rDNA gene (Supp Table 3 [online only]) were aligned with sequences available in GenBank using ClustalW (Hall 1999). Subsequently, jModelTest 2.1.6 (Darriba et al. 2012) was used to determine the nucleotide substitution model with best fit according to the AIC criterion. Phylogenetic trees were constructed using 1) the Bayesian inference method in Mr Bayes (Ronquist and Huelsenbeck 2003) with 30,000,000 generations and 2) the maximum likelihood (ML) method in PAUP 4.0 (Swofford 2002) with 1,000 bootstraps. The GTR + I + G nucleotide substitution model was used for mtCOI and Portiera, the TPM2 + G model for Arsenophonus, and the TPM1 + G model for Cardinium. All phylogenetic analyses were performed on the CIPRES platform (Miller et al. 2015).

Results

Whitefly Identification

A total of 264 whitefly adults were analyzed using primers for mtCOI (Table 1). One hundred sixty-three were found to be T. variabilis (62%), 96 A. socialis (36%), and 5 B. tuberculata (2%). Trialeurodes variabilis was dominant in the localities of Armenia (100%), Sevilla (100%), CORPOICA (100%), and Caldono (79%) while A. socialis predominated in the localities of La Tebaida, Santander de Quilichao I and II (SQ I and SQ II) and CIAT with percentages ranging from 53% (CIAT) to 83% (La Tebaida). Bemisia tuberculata was detected with percentages lower than 10% in the localities of Cali and SQ I and II. Likewise, a tendency in relation to the dominance of whiteflies in the different localities was observed whereby an increased presence of A. socialis was associated with a decrease in T. variabilis (Fig. 1).

The morphological analysis of the last instar nymphs confirmed the presence of the three species of whitefly associated with cassava crops. All nymphs identified from the Sevilla, CORPOICA, and Armenia locations were T. variabilis while both A. socialis and T. variabilis nymphs were found from the La Tebaida, CIAT, Cali, and SQ I locations. While B. tuberculata was only detected in SQ II (Fig. 2; Supp Table 2 [online only]). The above is congruent with what was found at the molecular level.

Fig. 2.

Fig. 2.

Open in a new tab

Last instar whitefly nymphs collected from Colombian cassava crops. Dorsal view. Dorsal view: (A) Aleurotrachelus socialis; (B) Trialeurodes variabilis; (C) Bemisia tuberculata.

Endosymbiont Screening

Portiera (PE) was detected in 100% of the individuals analyzed and this result served as quality control for the extracted DNA (Fig. 3). Only SE Cardinium and Arsenophonus were detected in the analyzed samples. Cardinium was observed in most of the localities (except Armenia and CORPOICA) and was the most prevalent SE in A. socialis with infection percentages ranging from 19 to 88% depending on the locality. In T. variabilis, this SE had low to intermediate prevalence percentages compared to A. socialis, ranging from 0 to 33% for each locality. Cardinium was also found in B. tuberculata from Cali and SQII (Fig. 3).

Fig. 3.

Fig. 3.

Open in a new tab

State of individual infection in adults of the three species of whitefly collected in this study. The panels represent the whitefly species detected in each locality. The columns correspond to the endosymbionts evaluated: P, Portiera; H, Hamiltonella; R, Rickettsia; A, Arsenophonus; W, Wolbachia; C, Cardinium. The rows represent the individuals evaluated for each species at each location. The gray boxes indicate positive infection by the corresponding endosymbiont. The location and the number of individuals analyzed (n) are found at the top of each panel.

On the other hand, in all adults tested, SE Arsenophonus was only found in A. socialis from La Tebaida. Likewise, this SE was detected in the only B. tuberculata adult found in Cali. Double infection by Cardinium and Arsenophonus was observed in A. socialis and T. variabilis adults from Tebaida and in B. tuberculata from Cali (Fig. 3).

Phylogenetic Analysis

In the phylogeny constructed from the mtCOI sequences, two large clades belonging to the two subfamilies of whiteflies, Aleurodicinae and Aleyrodinae, were formed. Within the Aleyrodinae clade, the sequences obtained for T. variabilis, B. tuberculata, and A. socialis were separated into three different groups designated A, B, and C, respectively (Fig. 4). Subgroups were formed within the T. variabilis (A) group, reflecting the existence of high mitochondrial diversity and possible genetic groups in the cassava crops of the sampled localities.

Fig. 4.

Fig. 4.

Open in a new tab

Bayesian inference tree constructed from mtCOI sequences of different whitefly species (650 bp). The nodes in parentheses show the Bayesian posterior probability values (>0.6) and the bootstrap values (>70), respectively. The sequences from this study are highlighted in bold print. GenBank accession numbers appear in square brackets. Sequences with the same symbols come from the same locality.

In the phylogenetic reconstruction of the 16s rDNA gene of PE Portiera, two clades were also formed corresponding to the two whitefly subfamilies. Similar to the phylogeny constructed with mtCOI, the sequences obtained from B. tuberculata, T. variabilis and A. socialis were separated into three different groups: A, B, and C, respectively (Fig. 5).

Fig. 5.

Fig. 5.

Open in a new tab

Bayesian inference tree constructed from sequences of the 16S rDNA gene for PE Portiera (780 bp). The nodes in parentheses show the Bayesian posterior probability values (>0.6) and the bootstrap values (>70), respectively. The sequences of this study are highlighted in bold print. GenBank accession numbers appear in square brackets.

In the phylogenetic reconstruction based on the 16s rDNA gene for SE Arsenophonus, the sequences from this study were grouped into two different clades (Fig. 6). In Clade A were grouped Arsenophonus sequences from A. socialis and T. variabilis collected at the same locality (La Tebaida); whereas in Clade B, two Arsenophonus sequences from B. tuberculata were grouped together. Similarly, for the phylogenetic reconstruction carried out with the 16s rDNA gene sequences for SE Cardinium, the sequences from this study were grouped into two clades (Fig. 7). The A. socialis and T. variabilis sequences are found in Clade A and those from B. tuberculata, as well as one from T. variabilis from Santander de Quilichao II, were grouped in Clade B. These results may be demonstrating the presence of different strains for both Arsenophonus and Cardinium associated with their host.

Fig. 6.

Fig. 6.

Open in a new tab

Bayesian inference tree constructed from 16S rDNA gene sequences for SE Arsenophonus from different arthropod species (650 bp). The nodes in parentheses show the Bayesian posterior probability values (>0.6) and the bootstrap values (>70), respectively. The sequences from this study are in bold print. The accession numbers for each sequence in GenBank appear in square brackets. Sequences with the same symbols come from the same locality.

Fig. 7.

Fig. 7.

Open in a new tab

Bayesian inference tree constructed from 16S rDNA gene sequences for SE Cardinium from different arthropod species (350 bp). The nodes in parentheses show the Bayesian posterior probability values (> 0.6) and the bootstrap values (> 70), respectively. The sequences from this study are in bold print. GenBank accession numbers appear in square brackets. Sequences with the same symbols come from the same locality.

Discussion

Both morphological and molecular results for the identification of whitefly species were congruent, confirming the presence of T. variabilis, A. socialis, and B. tuberculata in Colombian cassava crops. According to Gold et al. (1990), Carabalí et al. (2008, 2010), Vásquez-Ordóñez et al. (2015), cassava crops in Colombia are mostly colonized by these three species of whitefly, being A. socialis the predominant species with percentages of prevalence reported ranging from 66 to 88%. However, T. variabilis was the dominant species in our study. A possible explanation could be the behavior of A. socialis population which increases its size during the rainy season (Bellotti 2008). Nevertheless, in this study sampling was carried out between August and November 2015, a period coinciding with the El Niño phenomenon (IDEAM 2016) characterized by high temperatures and severe droughts. Another factor that could explain these differences is the altitude at which the crops were sampled. Aleurotrachelus socialis is generally restricted to altitudes below 1,200 meters above sea level (m.a.s.l) while T. variabilis increases at altitudes above 1,000 m.a.s.l. (Bellotti 2008), and six of the nine sampled localities are found above this elevation (Supp Table 1 [online only]).

On the other hand, that the PE Portiera was found in 100% of the individuals analyzed is consistent with that reported in studies of endosymbiotic diversity in whiteflies (Bing et al. 2013, Tajebe et al. 2014, Ghosh et al. 2015), and it is expected because this PE is responsible for synthesizing essential amino acids that complement the diet of aleurodids (Santos-Garcia et al. 2012, Rao et al. 2015, Upadhyay et al. 2015). In the case of SE, our study constitutes the first report of the presence of Arsenophonus in A. socialis and T. variabilis. Typically, this symbiont is prevalent in T. vaporariorum (Škaljac et al. 2013, Kapantaidaki et al. 2015). However, in South America, Arsenophonus has been reported in populations of T. vaporariorum, B. tabaci MED, and B. tuberculata whiteflies from Brazil (Marubayashi et al. 2014, de Moraes et al. 2017). In this study, Arsenophonus was only found to be very prevalent in the locality of La Tebaida, however its role or functionality still unknown. It is possible that the presence of this SE in La Tebaida population is related to host fitness, as occurs with other endosymbionts (Brumin et al. 2011, Xue et al. 2012, Ghosh et al. 2018), or it may be a transient infection propitiated by momentary abiotic factors. More in-depth studies are required in both cases.

Nonetheless, Cardinium was detected in most of the localities sampled, prevalence varying according to the locality (8–80%). For South America, particularly in Brazil, Marubayashi et al. (2014) and de Moraes et al. (2017, 2018) reported the presence of this endosymbiont in populations of B. tabaci (MEAM 1, MED, and NW), B. tuberculata and Tetraleurodes acaciae. However, it is not known whether this bacterium plays any role in the fitness of these populations or if it manipulates host reproduction through cytoplasmic incompatibility or feminization of males, as has been found in some species of parasitoid wasps of the genus Encarsia (Zchori-Fein et al. 2001, Hunter et al. 2003, Engelstädter and Hurst 2009). This is a possibility because Cardinium strains from B. tabaci and Encarsia are highly related: these two insect species exhibit a host (whitefly) parasitoid relationship, making it possible for them to share and transmit bacterial symbionts to each other (Santos-Garcia et al. 2014). It is noteworthy that only in the localities of La Tebaida and Cali was there evidence of double infection of Cardinium and Arsenophonus with high prevalence (>75%). This may be suggesting a possible complementary role for these two endosymbionts within their host and/or low competition for space and resources by both endosymbionts (Vautrin and Vavre 2009, Skaljac et al. 2010). The latter could be related to the location of these symbionts within their host since Arsenophonus is generally located inside the bacteriocytes while Cardinium can be found outside of them (Škaljac et al. 2013, Marubayashi et al. 2014), possibly reducing competition for space.

On the other hand, the low diversity of SE detected in this study could be explained by biological or technical processes. First, it is possible that the PE supplies all host metabolic functions (Sloan and Moran 2013, Santos-Garcia et al. 2015) in which case the maintenance of other guests could generate a load on the host, negatively affecting fitness in terms of survival and viability (Gottlieb et al. 2008, Vautrin and Vavre 2009). Secondly, it is likely that the prevalence of endosymbionts inside the insects may be higher than that detected due to the use of inadequate primers, or to low sensibility of the PCR compared to metagenomics methods (Ghosh et al. 2015), which would permit broad-spectrum detection of the endosymbiotic bacteria present in these insects (Bansal et al. 2014, Gauthier et al. 2015, Coon et al. 2016).

The phylogenetic reconstruction obtained from the mtDNA sequences, in which the division between the Aleurodicinae and Aleyrodinae whitefly subfamilies can be observed, confirm that all sequences from this study were grouped within the Aleyrodinae clade (Fig. 4, clades A, B, and C). It should be noted that sequences from T. variabilis showed several subgroups within clade A (Fig. 4), suggesting a high degree of diversity in mitochondrial DNA within this species of whitefly. However, these differences are not linked to geographical separation, individuals from different subgroups being observed within the same locality.

With respect to the phylogenetic reconstructions for both PE and SE, the formation of two main clades was observed. In the phylogeny of PE Portiera (Fig. 5), the sequences of three whitefly species were grouped within the Aleyrodinae clade, separated into three distinct groups, suggesting the presence of several Portiera strains related to each species of whitefly. This is consistent with reports by Sloan and Moran (2013) and Santos-Garcia et al. (2015) who suggest that the PE strains of Bemisia and Trialeurodes have recently diverged (90 MA), demonstrating a strong association and a long co-evolutionary process between Portiera and the different whitefly species.

For the phylogeny of SE Arsenophonus, the sequences of this study were grouped into two clades (Fig. 6), which may be evidence of the existence of two genetic groups of Arsenophonus in aleurodids associated with cassava, whereby T. variabilis and A. socialis share the same strain for this SE but B. tuberculata is infected by a different strain. As in our study, Thao and Baumann (2004) also found two different groups of Arsenophonus from sequences of 16-23S rDNA. One group corresponding to Arsenophonus sequences from different species of whitefly, and the other to sequences of this endosymbiont from Bemisia.

Likewise, the sequences from our study obtained for SE Cardinium also were grouped into two well-defined clades. Where sequences from different whitefly species that shared the same locality were found within the same clade. This suggests a possible association of strains of this endosymbiont with the locality in which its host is found rather than with the species of whitefly. Furthermore, the presence of the same strain of both SE Cardinium and Arsenophonus in two different whitefly species suggests the occurrence of horizontal transmission of these endosymbionts. Similarly, de Moraes et al. (2018) found genetically close strains of Hamiltonella and Ricketsia in B. tabaci MED and MEAM 1. Evidencing that it is probable that horizontal transmission is being mediated by the insect host plant since, in this case, these species are in sympatry in the cassava crops studied. The crop may serve as a reservoir and facilitate transmission of the endosymbiont. For example, Caspi-Fluger et al. (2012) and Li et al. (2017) conducted experiments using cotton plants to mediate transmission from insects infected with Rickettsia and Wolbachia, respectively. These authors observed the occurrence of SE transfer from infected insects to the phloem of the plant, where SE could be maintained and subsequently infect SE-free insects that would feed on these plants.

Finally, this is the first study in Colombia demonstrating the endosymbiotic diversity of cassava whiteflies. An association was found between SE and the different species of whitefly analyzed with a higher prevalence of Cardinium in A. socialis than in T. variabilis. Whereas, B. tuberculata was found associated with different strains of Cardinium and Arsenophonus. Likewise, the presence of both SEs was recorded for the first time in A. socialis and T. variabilis. And, it is also worth mentioning the high degree of mitochondrial diversity detected in T. variabilis and a possible increase of this whitefly species in cassava crops in contrast to that reported in previous studies, possibly due to the altitudinal differences of the localities sampled and climatic factors.

Supplementary Material

iez047_suppl_Supporting-Information
Click here for additional data file. (21.2KB, docx)

Acknowledgments

Our sincere thanks to H. Burnham at Universidad del Valle for help with the English translation and to M. Dittmann for editing the final English version. We also thank H. Gomez, B. Ospina, J. O. Ortiz, M. I. Gomez at CIAT and all the farmers for permission to collect whiteflies; and finally, thanks to Dr. J. Tavera, Dr. A. Zuluaga and Dr. G. Barreto for explanations and suggestions. Thanks to COLCIENCIAS, National Program of Basic Sciences (https://colciencias.gov.co), Code 110656933843, and the Universidad del Valle, Vicerrectoria de Investigaciones CI 710667 for funding the study. All the authors declare having no conflict of interest at the time of publishing.

References Cited

  1. Ahmed M. Z., Ren S. X., Xue X., Li X. X., Jin G. H., and Qiu B. L.. 2010. Prevalence of endosymbionts in Bemisia tabaci populations and their in vivo sensitivity to antibiotics. Curr. Microbiol. 61: 322–328. [DOI] [PubMed] [Google Scholar]
  2. Bansal R., Mian M. A., and Michel A. P.. 2014. Microbiome diversity of Aphis glycines with extensive superinfection in native and invasive populations. Environ. Microbiol. Rep. 6: 57–69. [DOI] [PubMed] [Google Scholar]
  3. Baumann P. 2005. Biology bacteriocyte-associated endosymbionts of plant sap-sucking insects. Annu. Rev. Microbiol. 59: 155–189. [DOI] [PubMed] [Google Scholar]
  4. Baumann P., Moran N. A., and Baumann L.. 2006. Bacteriocyte-associated endosymbionts of insects, pp. 403–438. InDworkin M., Falkow S., Rosenberg E., Schleifer K.-H., and Stackebrandt E. (eds.), Prokaryotes vol. 1 Symbiotic Assoc. Biotechnol. Appl. Microbiol. Springer New York, New York, NY. [Google Scholar]
  5. Bellotti A. C. 2008. Cassava pests and their management, pp. 764–794. InCapinera J. L. (ed.), Encyclopedia of Entomology. Springer Netherlands, Dordrecht, the Netherlands. [Google Scholar]
  6. Bellotti A. C., and Arias B.. 2001. Host plant resistance to whiteflies with emphasis on cassava as a case study. Crop Prot. 20: 813–823. [Google Scholar]
  7. Bing X. L., Ruan Y. M., Rao Q., Wang X. W., and Liu S. S.. 2013. Diversity of secondary endosymbionts among different putative species of the whitefly Bemisia tabaci. Insect Sci. 20: 194–206. [DOI] [PubMed] [Google Scholar]
  8. Brumin M., Kontsedalov S., and Ghanim M.. 2011. Rickettsia influences thermotolerance in the whitefly Bemisia tabaci B biotype. Insect Sci. 18: 57–66. [Google Scholar]
  9. Caballero R. 1994. Clave de campo para inmaduros de moscas blancas de Centroamérica (Homoptera: Aleyrodidae). Esc. Agrícola Panam. Zamorano, Honduras. 35: 47–50. [Google Scholar]
  10. Carabalí A., Bellotti A. C., Montoya-Lerma J., and Cuellar M. E.. 2005. Adaptation of Bemisia tabaci biotype B (Gennadius) to cassava, Manihot esculenta (Crantz). Crop Prot. 24: 643–649. [Google Scholar]
  11. Carabalí A., Montoya-Lerma J., and Bellotti A. C.. 2008. Desarrollo y reproducción de Bemisia tabaci “B” (Hemiptera: Aleyrodidae) sobre genotipos de yuca (Manihot esculenta). Rev. Colomb. Entomol. 34: 28–32. [Google Scholar]
  12. Carabalí A., Bellotti A. C., Montoya-Lerma J., and Fregene M.. 2010. Resistance to the whitefly, Aleurotrachelus socialis, in wild populations of cassava, Manihot tristis. J. Insect Sci. 10: 170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Caspi-Fluger A., Inbar M., Mozes-Daube N., Katzir N., Portnoy V., Belausov E., Hunter M. S., and Zchori-Fein E.. 2012. Horizontal transmission of the insect symbiont Rickettsia is plant-mediated. Proc. Biol. Sci. 279: 1791–1796. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Chiel E., Gottlieb Y., Zchori-Fein E., Mozes-Daube N., Katzir N., Inbar M., and Ghanim M.. 2007. Biotype-dependent secondary symbiont communities in sympatric populations of Bemisia tabaci. Bull. Entomol. Res. 97: 407–413. [DOI] [PubMed] [Google Scholar]
  15. Clark E. L., Karley A. J., and Hubbard S. F.. 2010. Insect endosymbionts: manipulators of insect herbivore trophic interactions? Protoplasma. 244: 25–51. [DOI] [PubMed] [Google Scholar]
  16. Coon K. L., Brown M. R., and Strand M. R.. 2016. Mosquitoes host communities of bacteria that are essential for development but vary greatly between local habitats. Mol. Ecol. 25: 5806–5826. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Darriba D., Taboada G. L., Doallo R., and Posada D.. 2012. jModelTest 2: more models, new heuristics and parallel computing. Nat. Methods 9: 772. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Dooley J. 2006. Whitefly pupa of the world compendium and key to the genera of the aleurodicinae & the aleyrodinae USDA, APHIS, PPQ, South San Francisco, CA: http://keys.lucidcentral.org/keys/v3/whitefly/Default.htm. [Google Scholar]
  19. Duron O., Bouchon D., Boutin S., Bellamy L., Zhou L., Engelstädter J., and Hurst G. D.. 2008. The diversity of reproductive parasites among arthropods: Wolbachia do not walk alone. BMC Biol. 6: 27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Engelstädter J., and Hurst G. D. D.. 2009. The ecology and evolution of microbes that manipulate host reproduction. Annu. Rev. Ecol. Evol. Syst. 40: 127–149. [Google Scholar]
  21. Everett K. D., Thao M., Horn M., Dyszynski G. E., and Baumann P.. 2005. Novel chlamydiae in whiteflies and scale insects: endosymbionts ‘Candidatus Fritschea bemisiae’ strain Falk and ‘Candidatus Fritschea eriococci’ strain Elm. Int. J. Syst. Evol. Microbiol. 55: 1581–1587. [DOI] [PubMed] [Google Scholar]
  22. FAO 2015. http://www.fao.org/agriculture/crops/thematic-sitemap/theme/pests/cassava-diseases/importance-cassava/en/ Food and agriculture organization of the United Nations.
  23. Feldhaar H. 2011. Bacterial symbionts as mediators of ecologically important traits of insect hosts. Ecol. Entomol. 36: 533–543. [Google Scholar]
  24. Feldhaar H., Straka J., Krischke M., Berthold K., Stoll S., Mueller M. J., and Gross R.. 2007. Nutritional upgrading for omnivorous carpenter ants by the endosymbiont Blochmannia. BMC Biol. 5: 48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Folmer O., Black M., Hoeh W., Lutz R., and Vrijenhoek R.. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. March Biol. Biotechnol. 3: 294–299. [PubMed] [Google Scholar]
  26. Forero D. 2008. The systematics of the Hemiptera. Rev. Colomb. Entomol. 34: 1–21. [Google Scholar]
  27. Frohlich D. R., Torres-Jerez I. I, Bedford I. D., Markham P. G., and Brown J. K.. 1999. A phylogeographical analysis of the Bemisia tabaci species complex based on mitochondrial DNA markers. Mol. Ecol. 8: 1683–1691. [DOI] [PubMed] [Google Scholar]
  28. Gauthier J. P., Outreman Y., Mieuzet L., and Simon J. C.. 2015. Bacterial communities associated with host-adapted populations of pea aphids revealed by deep sequencing of 16S ribosomal DNA. PLoS One 10: e0120664. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Ghanim M., and Kontsedalov S.. 2009. Susceptibility to insecticides in the Q biotype of Bemisia tabaci is correlated with bacterial symbiont densities. Pest Manag. Sci. 65: 939–942. [DOI] [PubMed] [Google Scholar]
  30. Ghosh S., Bouvaine S., and Maruthi M. N.. 2015. Prevalence and genetic diversity of endosymbiotic bacteria infecting cassava whiteflies in Africa. BMC Microbiol. 15: 93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Ghosh S., Bouvaine S., Richardson S. C. W., Ghanim M., and Maruthi M. N.. 2018. Fitness costs associated with infections of secondary endosymbionts in the cassava whitefly species Bemisia tabaci. J. Pest Sci. (2004). 91: 17–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Gold C. S., Altieri M. A., and Bellotti A. C.. 1990. Direct and residual effects of short duration intercrops on the cassava whiteflies Aleurotrachelus socialis and Trialeurodes variabilis (Homoptera: Aleyrodidae) in Colombia. Agric. Ecosyst. Environ. 32: 57–67. [Google Scholar]
  33. Gottlieb Y., Ghanim M., Chiel E., Gerling D., Portnoy V., Steinberg S., Tzuri G., Horowitz A. R., Belausov E., Mozes-Daube N., et al. 2006. Identification and localization of a Rickettsia sp. in Bemisia tabaci (Homoptera: Aleyrodidae). Appl. Environ. Microbiol. 72: 3646–3652. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Gottlieb Y., Ghanim M., Gueguen G., Kontsedalov S., Vavre F., Fleury F., and Zchori-Fein E.. 2008. Inherited intracellular ecosystem: symbiotic bacteria share bacteriocytes in whiteflies. FASEB J. 22: 2591–2599. [DOI] [PubMed] [Google Scholar]
  35. Gottlieb Y., Zchori-Fein E., Mozes-Daube N., Kontsedalov S., Skaljac M., Brumin M., Sobol I., Czosnek H., Vavre F., Fleury F., et al. 2010. The transmission efficiency of tomato yellow leaf curl virus by the whitefly Bemisia tabaci is correlated with the presence of a specific symbiotic bacterium species. J. Virol. 84: 9310–9317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Gueguen G., Vavre F., Gnankine O., Peterschmitt M., Charif D., Chiel E., Gottlieb Y., Ghanim M., Zchori-Fein E., and Fleury F.. 2010. Endosymbiont metacommunities, mtDNA diversity and the evolution of the Bemisia tabaci (Hemiptera: Aleyrodidae) species complex. Mol. Ecol. 19: 4365–4376. [DOI] [PubMed] [Google Scholar]
  37. Hall A. T. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for windows 95/98/NT. Nucl. Acids. Symp. Ser. 41: 95–98. [Google Scholar]
  38. Hodges G., and Evans G.. 2005. An identification guide to the whiteflies (Hemiptera: Aleyrodidae) of the Southeastern United States. Florida Entomol. 88: 518–534. [Google Scholar]
  39. Hunter M. S., Perlman S. J., and Kelly S. E.. 2003. A bacterial symbiont in the Bacteroidetes induces cytoplasmic incompatibility in the parasitoid wasp Encarsia pergandiella. Proc. Biol. Sci. 270: 2185–2190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. IDEAM 2016. http://www.ideam.gov.co/documents/21021/441801/El+Niño+-+Temperatura+-+Típico.pdf/b8f3e4c0-10e0-4d4d-b58b-6c62c724b522 Alteraciones más probables de la temperatura del aire, durante la ocurrencia de un fenómeno el niño típico.
  41. Kapantaidaki D. E., Ovčarenko I., Fytrou N., Knott K. E., Bourtzis K., and Tsagkarakou A.. 2015. Low levels of mitochondrial DNA and symbiont diversity in the worldwide agricultural pest, the greenhouse whitefly Trialeurodes vaporariorum (Hemiptera: Aleyrodidae). J. Hered. 106: 80–92. [DOI] [PubMed] [Google Scholar]
  42. Karthikeyan C., Patil B. L., Borah B. K., Resmi T. R., Turco S., Pooggin M. M., Hohn T., and Veluthambi K.. 2016. Emergence of a Latent Indian cassava mosaic virus from cassava which recovered from infection by a non-persistent Sri Lankan cassava mosaic virus. Viruses. 8: 264. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Kikuchi Y. 2009. Endosymbiotic bacteria in insects: their diversity and culturability. Microbes Environ. 24: 195–204. [DOI] [PubMed] [Google Scholar]
  44. Kontsedalov S., Zchori-Fein E., Chiel E., Gottlieb Y., Inbar M., and Ghanim M.. 2008. The presence of Rickettsia is associated with increased susceptibility of Bemisia tabaci (Homoptera: Aleyrodidae) to insecticides. Pest Manag. Sci. 64: 789–792. [DOI] [PubMed] [Google Scholar]
  45. Legg J. P., and Fauquet C. M.. 2004. Cassava mosaic geminiviruses in Africa. Plant Mol. Biol. 56: 585–599. [DOI] [PubMed] [Google Scholar]
  46. Li S. J., Ahmed M. Z., Lv N., Shi P. Q., Wang X. M., Huang J. L., and Qiu B. L.. 2017. Plantmediated horizontal transmission of Wolbachia between whiteflies. ISME J. 11: 1019–1028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Lundgren J. G., López-Lavalle L. A. B., Parsa S., and Wyckhuys K. A. G.. 2014. Molecular determination of the predator community of a cassava whitefly in Colombia: pest-specific primer development and field validation. J. Pest Sci. 87: 125–131. [Google Scholar]
  48. Manzano-Marín A., and Latorre A.. 2014. Settling down: the genome of Serratia symbiotica from the aphid Cinara tujafilina zooms in on the process of accommodation to a cooperative intracellular life. Genome Biol. Evol. 6: 1683–1698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Martin J. H. 2005. Whiteflies of Belize (Hemiptera: Aleyrodidae): part 2 - a review of the subfamily Aleyrodinae Westwood. Zootaxa. 1098: 1–116. [Google Scholar]
  50. Marubayashi J. M., Kliot A., Yuki V. A., Rezende J. A., Krause-Sakate R., Pavan M. A., and Ghanim M.. 2014. Diversity and localization of bacterial endosymbionts from whitefly species collected in Brazil. PLoS One 9: e108363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. McCutcheon J. P., McDonald B. R., and Moran N. A.. 2009. Convergent evolution of metabolic roles in bacterial co-symbionts of insects. Proc. Natl. Acad. Sci. USA 106: 15394–15399. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Miller M. A., Schwartz T., Pickett B. E., He S., Klem E. B., Scheuermann R. H., Passarotti M., Kaufman S., and O’Leary M. A.. 2015. A RESTful API for access to phylogenetic tools via the CIPRES science gateway. Evol. Bioinform. Online. 11: 43–48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. de Moraes L. A., Marubayashi J. M., Yuki V. A., Ghanim M., Bello V. H., De Marchi B. R., da Fonseca Barbosa L., Boykin L. M., Krause-Sakate R., and Pavan M. A.. 2017. New invasion of Bemisia tabaci Mediterranean species in Brazil associated to ornamental plants. Phytoparasitica 45: 517–525. [Google Scholar]
  54. de Moraes L. A., Muller C., Bueno R. C. O. F., Santos A., Bello V. H., De Marchi B. R., Watanabe L. F. M., Marubayashi J. M., Santos B. R., Yuki V. A., et al. 2018. Distribution and phylogenetics of whiteflies and their endosymbiont relationships after the Mediterranean species invasion in Brazil. Sci. Rep. 8: 14589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Morin S., Ghanim M., Sobol I., and Czosnek H.. 2000. The GroEL protein of the whitefly Bemisia tabaci interacts with the coat protein of transmissible and nontransmissible begomoviruses in the yeast two-hybrid system. Virology. 276: 404–416. [DOI] [PubMed] [Google Scholar]
  56. Moya A., Peretó J., Gil R., and Latorre A.. 2008. Learning how to live together: genomic insights into prokaryote-animal symbioses. Nat. Rev. Genet. 9: 218–229. [DOI] [PubMed] [Google Scholar]
  57. Navas-Castillo J., Fiallo-Olivé E., and Sánchez-Campos S.. 2011. Emerging virus diseases transmitted by whiteflies. Annu. Rev. Phytopathol. 49: 219–248. [DOI] [PubMed] [Google Scholar]
  58. Oliver K. M., Russell J. A., Moran N. A., and Hunter M. S.. 2003. Facultative bacterial symbionts in aphids confer resistance to parasitic wasps. Proc. Natl. Acad. Sci. USA 100: 1803–1807. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Ovalle T. M., Parsa S., Hernández M. P., and Becerra Lopez-Lavalle L. A.. 2014. Reliable molecular identification of nine tropical whitefly species. Ecol. Evol. 4: 3778–3787. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Rana V. S., Singh S. T., Priya N. G., Kumar J., and Rajagopal R.. 2012. Arsenophonus GroEL interacts with CLCuV and is localized in midgut and salivary gland of whitefly B. tabaci. PLoS One 7: e42168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Rao Q., Rollat-Farnier P. A., Zhu D. T., Santos-Garcia D., Silva F. J., Moya A., Latorre A., Klein C. C., Vavre F., Sagot M. F., et al. 2015. Genome reduction and potential metabolic complementation of the dual endosymbionts in the whitefly Bemisia tabaci. BMC Genomics 16: 226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Ronquist F., and Huelsenbeck J. P.. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 19: 1572–1574. [DOI] [PubMed] [Google Scholar]
  63. Ruan Y. M., Xu J., and Liu S. S.. 2006. Effects of antibiotics on fitness of the B biotype and a non-B biotype of the whitefly Bemisia tabaci. Entomol. Exp. Appl. 121: 159–166. [Google Scholar]
  64. Santos-Garcia D., Farnier P. A., Beitia F., Zchori-Fein E., Vavre F., Mouton L., Moya A., Latorre A., and Silva F. J.. 2012. Complete genome sequence of “Candidatus Portiera aleyrodidarum” BT-QVLC, an obligate symbiont that supplies amino acids and carotenoids to Bemisia tabaci. J. Bacteriol. 194: 6654–6655. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Santos-Garcia D., Latorre A., Moya A., Gibbs G., Hartung V., Dettner K., Kuechler S. M., and Silva F. J.. 2014. Small but powerful, the primary endosymbiont of moss bugs, Candidatus Evansia muelleri, holds a reduced genome with large biosynthetic capabilities. Genome Biol. Evol. 6: 1875–1893. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Santos-Garcia D., Vargas-Chavez C., Moya A., Latorre A., and Silva F. J.. 2015. Genome evolution in the primary endosymbiont of whiteflies sheds light on their divergence. Genome Biol. Evol. 7: 873–888. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Skaljac M., Zanic K., Ban S. G., Kontsedalov S., and Ghanim M.. 2010. Co-infection and localization of secondary symbionts in two whitefly species. BMC Microbiol. 10: 142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Škaljac M., Žanić K., Hrnčić S., Radonjić S., Perović T., and Ghanim M.. 2013. Diversity and localization of bacterial symbionts in three whitefly species (Hemiptera: Aleyrodidae) from the east coast of the Adriatic Sea. Bull. Entomol. Res. 103: 48–59. [DOI] [PubMed] [Google Scholar]
  69. Sloan D. B., and Moran N. A.. 2013. The evolution of genomic instability in the obligate endosymbionts of whiteflies. Genome Biol. Evol. 5: 783–793. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Su Q., Oliver K. M., Pan H., Jiao X., Liu B., Xie W., Wang S., Wu Q., Xu B., White J. A., et al. 2013a. Facultative symbiont Hamiltonella confers benefits to Bemisia tabaci (Hemiptera: Aleyrodidae), an invasive agricultural pest worldwide. Environ. Entomol. 42: 1265–1271. [DOI] [PubMed] [Google Scholar]
  71. Su Q., Zhou X., and Zhang Y.. 2013b. Symbiont-mediated functions in insect hosts. Commun. Integr. Biol. 6: e23804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Su Q., Xie W., Wang S., Wu Q., Liu B., Fang Y., Xu B., and Zhang Y.. 2014. The endosymbiont Hamiltonella increases the growth rate of its host Bemisia tabaci during periods of nutritional stress. PLoS One 9: e89002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Swofford D. L. 2002. Phylogenetic analysis using parsimony (*and other methods), version 4. ed. Sinauer Associates, Sunderland, MA. [Google Scholar]
  74. Tajebe L. S., Guastella D., Cavalieri V., Kelly S. E., Hunter M. S., Lund O. S., Legg J. P., and Rapisarda C.. 2014. Diversity of symbiotic bacteria associated with Bemisia tabaci (Homoptera: Aleyrodidae) in cassava mosaic disease pandemic areas of Tanzania. Ann. Appl. Biol. 166: 297–310. [Google Scholar]
  75. Thao M. L. L., and Baumann P.. 2004. Evidence for multiple acquisition of Arsenophonus by whitefly species (Sternorrhyncha: Aleyrodidae). Curr. Microbiol. 48: 140–144. [DOI] [PubMed] [Google Scholar]
  76. Thierry M., Becker N., Hajri A., Reynaud B., Lett J. M., and Delatte H.. 2011. Symbiont diversity and non-random hybridization among indigenous (Ms) and invasive (B) biotypes of Bemisia tabaci. Mol. Ecol. 20: 2172–2187. [DOI] [PubMed] [Google Scholar]
  77. Upadhyay S. K., Sharma S., Singh H., Dixit S., Kumar J., Verma P. C., and Chandrashekar K.. 2015. Whitefly genome expression reveals host-symbiont interaction in amino acid biosynthesis. PLoS One 10: e0126751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Vásquez-Ordóñez A. A., Hazzi N. А., Escobar-Prieto D., Paz-Jojoa D., and Parsa S.. 2015. A geographic distribution database of the Neotropical cassava whitefly complex (Hemiptera, Aleyrodidae) and their associated parasitoids and hyperparasitoids (Hymenoptera). Zookeys. 545: 75–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Vautrin E., and Vavre F.. 2009. Interactions between vertically transmitted symbionts: cooperation or conflict? Trends Microbiol. 17: 95–99. [DOI] [PubMed] [Google Scholar]
  80. Wernegreen J. J. 2002. Genome evolution in bacterial endosymbionts of insects. Nat. Rev. Genet. 3: 850–861. [DOI] [PubMed] [Google Scholar]
  81. Xue X., Li S. J., Ahmed M. Z., De Barro P. J., Ren S. X., and Qiu B. L.. 2012. Inactivation of Wolbachia reveals its biological roles in whitefly host. PLoS One 7: e48148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  82. Zchori-Fein E., and Brown J. K.. 2002. Diversity of prokaryotes associated with Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae). Ann. Entomol. Soc. Am. 95: 711–718. [Google Scholar]
  83. Zchori-Fein E., Gottlieb Y., Kelly S. E., Brown J. K., Wilson J. M., Karr T. L., and Hunter M. S.. 2001. A newly discovered bacterium associated with parthenogenesis and a change in host selection behavior in parasitoid wasps. Proc. Natl. Acad. Sci. USA 98: 12555–12560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  84. Zhou W., Rousset F., and O’Neil S.. 1998. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. Proc. Biol. Sci. 265: 509–515. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

iez047_suppl_Supporting-Information
Click here for additional data file. (21.2KB, docx)

Articles from Journal of Insect Science are provided here courtesy of University of Wisconsin Libraries

RESOURCES