Complete genome characterization and population dynamics of potato virus Y-NTN strain from India

Abstract

Potato virus Y (PVY) is a major threat to potato cultivation worldwide. PVY exists as biologically and genetically distinct strains and causes varying degrees of pathogenicity and a wide range of symptoms in potato. Knowledge of the nature of PVY strains is essential for breeding PVY resistant cultivars that are durable against a wide range of strains. We report the complete genome of a PVY potato isolate (JK12) characterised from the potato production areas of Jammu and Kashmir, India. Nucleotide sequence comparisons and phylogenetic analysis with known PVY strains revealed that the isolate belongs to the NTN strain of PVY. At the whole genome sequence level, the JK12 isolate shared the highest identity (99.42%) with PVY-NTN strains reported from Germany, followed by those from United Kingdom (99.34%) and Japan (99.33%). Recombination detection analysis identified two recombination break points and JK12 appeared to have originated from a recombination event between a PVY-N strain from Belgium as a major parent and a PVY-O strain from China as the minor parent. Our results suggest possible mutation and recombination could be the basis for the evolution and the subsequent establishment of NTN in this region. Furthermore, a global evolutionary lineage analysis of all the known PVY strains showed relatively low nucleotide diversity among the PVY-NTN strains. Neutrality tests showed that all the genotypes of PVY are undergoing purifying selection suggesting population expansion of PVY. This is the first report of complete genomic characterization of an NTN strain of PVY isolated from commercial potato fields in India. The implications of the emergence of this strain in the Indian context are discussed.

Electronic supplementary material

The online version of this article (10.1007/s13337-019-00526-5) contains supplementary material, which is available to authorized users.

Introduction

Potato virus Y (PVY) is a major pathogen of potatoes worldwide, resulting in yield losses of up to 80% [40]. PVY is a type member of the genus Potyvirus in the family Potyviridae [27, 43]. PVY has a wide host range and infects plants belonging to nine different families including the family Solanaceae and the prominent susceptible hosts include pepper, potato, tobacco and tomato [27, 34]. PVY is transmitted through vegetative propagation of infected material and by several species of aphids in a non-persistent manner [10].

The genome of PVY is characterized by a single-stranded, positive-sense RNA of approximately 9.7 kb in length [47]. PVY genome has a single large open reading frame (ORF), which encodes a single polyprotein, flanked by 5′ and 3′ untranslated regions (UTRs). Three viral proteases are involved in cleaving the expressed polyprotein into 10 products [3]. P1 is the first coded protein from the 5′ end and is the most variable protein among all the PVY-coded proteins and it is necessary for RNA binding and genome amplification [45, 48]. Hc-Pro has been shown to have a role in aphid transmission, cell-to-cell movement and systemic movement [20, 36, 42]. P3 and 6K2 proteins are membrane proteins [11]. Cytoplasmic inclusion (CI) protein has a pivotal role in cell-to-cell virus movement [8, 49]. The two domains of first nuclear inclusion (NIa) protein vis-à-vis, the VPg and protease domain, execute cleavage of the precursor polyprotein [34]. The second nuclear inclusion (NIb) protein is RNA dependent RNA polymerase (RdRp). The coat protein (CP) at the 3′ end has a myriad of functions which include virion assembly, cell-to-cell movement and aphid transmission [2, 9, 36].

On a worldwide basis, several distinct PVY strains have been reported which include the common (PVY^c), ordinary (PVY^O) and tobacco venal necrosis (PVY^N) strains based on the biological properties and genomic analysis [40, 44]. New variants such as tuber necrosis strain (PVY^NTN) and PVY^N-W (Wilga) were also identified within the PVY^N and PVY^O, respectively [4, 13, 18]. The N group (including PVY^N, PVY^NTN and PVY^N-Wi strains) is the most common in Europe, whereas the ordinary strain group (PVY^O) still has a predominant place in North America [19, 38]. The exchange of genomic sequences and the pattern of genetic exchange that occurs between different species of viruses reveal how an otherwise unnoticed ecology plays an important role in virus evolution [1, 29, 39]. Analysis of genetic variation and cause of these genomic variations by studying the recombination breakpoints could also reveal the mechanism behind the processes underlying recombination, survival and emergence and proliferation of new strains following recombination [7, 50]. Besides PVY, recombination events were reported in different potyviruses such as Bean common mosaic virus, and Soybean mosaic virus, [17, 35, 44] and it is widely accepted that recombination plays a significant role in the evolution of PVY population [5, 37].

PVY has been a serious threat to potato cultivation in India. However, only limited reports are available with regard to whole genome sequence and diversity studies pertaining to PVY strains in India. The virus causes significant yield losses, sometimes to the extent of 80% in India, and the economic losses vary according to the variety, environment and the virus strain. In general, it has been predicted that average yield reduction is 40–50% making PVY the single most important potato virus. There is limited information available regarding the strain situation of PYV in potato in India. Here we present the first report, based on the complete genomic characterization and inter-strain sequence relationships, of the presence of an NTN strain of PVY isolated from naturally infected Kufri Jyoti, a popular potato cultivar in the Indian state of Jammu and Kashmir (J&K).

Materials and methods

Survey and virus detection

A survey was conducted to determine the extent of PVY infection in the potato fields of Kashmir Valley, India during the period 2016–2017. Thirty potato samples from the cultivar Kufri Jyoti were collected from the six commercial potato fields viz; Shalimar, Lal Mandi (Srinagar), Manzhama (Budgam), Sopore, Yarikha (Baramulla) and Kalnag (Anantnag) and were tested for PVY infection.

RNA extraction, RT-PCR and genome sequencing

Total RNA was extracted from infected leaves of potato cultivar, Kufri Jyoti, using TRIzol™ RNA extraction kit. First strand cDNA was synthesized by Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA) using downstream primer specific for coat protein gene (5′ ATCGTCCGGCTCGAGACTACATCA 3′). The conserved regions in different PVY strains were used to design oligonucleotides for detection of PVY infection. Out of 30 samples tested, 13 that were positive in RT-PCR were further studied for strain identification using strain-specific primers [32]. Out of 13 positive samples, 4 were positive for NTN strain. The JK12 isolate that tested positive using NTN strain-specific primers was further characterized. The complete genome of the isolate JK12 was obtained as five overlapping amplicons using Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific) by following primer walking strategy (Fig. 1, Table 1). PCR products were cloned into the pGEM^®-T Easy Vector (Promega, Madison, WI) following standard molecular cloning procedures [23]. Three positive recombinant clones were sequenced following Sanger sequencing strategy and sequence analysis was performed using BioEdit sequence alignment editor version 7.0 (http://www.mbio.ncsu.edu/BioEdit/bioedit.html/). The identity of each of the sequences was verified by comparing the sequences with those in NCBI’s GenBank using BLASTn (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

Fig. 1.

Schematic representation of PVY RNA genome and arrows show the position of primers used in this study for characterising the genome of Jammu and Kashmir PVY isolate

Table 1.

Primers used for sequencing the PVY isolate

Primer	Sequence	Size (bp)
Primer 1	Forward: 5′ATGGCAACTTACATGTCAACA 3′ Reverse: 5′ATTAGGAACTCAACCAACTCT 3′	2236
Primer 2	Forward: 5′ATGCCATGTGGTTGACTCGT 3′ Reverse: 5′ATTCCATGAAGTGCCCCTCG 3′	1562
Primer 3	Forward: 5′TCCTTAGACGATGTGATCAAG 3′ Reverse: 5′GAGCGATTAAGCTTCATGCTC 3′	2398
Primer 4	Forward: 5′GCTAAATCGCTCATGAGAGGC 3′ Reverse: 5′GATTGTGTCATTTCATTGATG 3′	2400
Primer 5	Forward: 5′TATGAATTCCACCATCAAGCAAATGA 3′ Reverse: 5′ATCGTCCGGCTCGAGACTACATCA 3′	844

Sequence analysis

Sequences derived from the replicate clones were assembled into contigs to generate the complete genome sequence of PVY using BioEdit. The complete genome sequence generated is available in GenBank (accession number KY851109). A phylogenetic dendrogram was reconstructed with Maximum Likelihood method based on the Tamura-Nei model using MEGA6 (www.megasoftware.net/mega.php/) with bootstrap of 1000 replicates. The new sequence was aligned with known PVY-NTN strains as well as with all other known PVY sequences retrieved from the GenBank (http://www.ncbi.nlm.nih.gov/).

Recombination analysis

Potential recombination events in the PVY genomic sequence with other PVY strains was studied using Recombination Detection Program (RDP) [33], GENECONV [42], BOOTSCAN [41], MAXCHI [33], CHIMAERA [37] and SISCAN [16], all implemented in RDP4 [33]. Further, we also used SISCAN version 2 [12]. All the available full-length genome sequences of PVY were retrieved from GenBank. The coding sequences along with the sequence of the JK12 isolate were loaded unaligned in the program, Sequence Demarcation Tool-version 1.2 (SDTv1.2) and pairwise scan with the MUSCLE method was performed. Datasets with the minimum identity of 70% and the maximum of 100% were used for analysis. The alignment of the dataset was done using MUSCLE Sequence Alignment (www.ebi.ac.uk/Tool/msa/muscle/). The analysis in RDP4 was carried out with default settings for the recombination detection with Bonferroni corrected P value cut off of 0.01 in General Recombination Detection Option and without Disentangle overlapping events in Data Processing Options.

The aligned nucleotide sequences were also analyzed in the Recombination Analysis Tool (RAT) [12]. RAT uses a distance-based method of recombination in both nucleic acid and protein multiple alignments. RAT compares the percentage of nucleotide similarities using a sliding window size of 10% of the sequences length and an increment size being half of the window size.

PVY genome data set for population genetics analysis

The complete genome sequences of known PVY strains were collected (Supplementary File 1) and analyzed for studying the viral population genetics parameters. PVY genome sequences which did not fall in either of the following strains NTN, O, N, NO, Wilga and C were considered as ‘others’.

DNA polymorphism, neutrality tests and the estimation of gene flow

To study the nucleotide diversity and DNA polymorphism, DnaSP [30] was used. The analysis included quantifying the levels of DNA polymorphism such as the number of haplotypes and haplotype diversity in order to analyze the distribution pattern of DNA variation, or to compare alternative evolutionary scenarios. To test the theory of neutral evolution, test statistics such as Tajimas’s D [46], Fu & Li’s D and Fu & Li’s F [13, 14] were determined using DnaSP software. Similarly, the analysis of genetic differentiation and gene flow estimates such as Kst, Ks, Snn, Fst among others were performed using DnaSP [41].

Results

Molecular characterization

The complete genome was amplified as five overlapping amplicons using the primer walking strategy, and the amplicons were cloned and sequenced (Accession No. KY851109). The identity of the genome sequence of the isolate JK12 was confirmed using the BLAST search. Nucleotide sequence comparisons with known PVY strains revealed that the isolate belongs to the NTN strain of PVY. At the whole genome sequence level, the JK12 isolate shared the highest identity (99.42%) with a PVY-NTN strain reported from Germany, followed by those from United Kingdom (99.34%) and Japan (99.33%).

Phylogeny of PVY strains

Phylogenetic analysis was carried out comparing the complete nucleotide sequence of JK12 isolate with those of different strains of PVY (Supplementary Table 1). The different clades of the tree represented different strains of PVY and the JK12 isolate clustered with PVY-NTN clade reiterating that the isolate is an NTN strain (Fig. 2). Among the various known NTN strains, the Indian isolate was closely related to the NTN strain reported from Germany (AJ890345) which was further corroborated when the coding region (nt) and amino acid sequences of only the NTN strains were used in the phylogenetic analysis (Fig. 3). Moreover, the phylogenetic tree based on the CP gene also showed that the JK12 isolate clustered within the NTN clade.

Fig. 2.

Phylogenetic tree depicting the relationship of KY851109. Kashmir with other strains at the CP level. The sequences available in GenBank from India (KU509054, AF345650) are also included

Fig. 3.

Phylogenetic analysis of the complete polyprotein sequences of PVY-NTN strains by Maximum Likelihood method. The tree depicts the relationship of the PVY-NTN strain described in this study (KY851109_JK12India) with other NTN strains

Recombination events in the PVY genome

Interestingly, the PVY-NTN strain reported herein appears to be a recombinant. The recombination event that generated the JK12 isolate (KY851109) was supported by all the recombination detection programs which detected two breakpoints with the highest value being of RDP (1.765 × 10⁻¹⁶²) (Supplementary Table 2). It appears that the JK12 isolate might have originated due to recombination involving PVY-N strain (JQ969036) reported from Belgium as a major parent and a PVY-O strain (JQ663997) reported from China as a minor parent. The recombination breakpoint begins at 2216 in alignment (2216 without gaps) with the breakpoint clustering at 99% confidence intervals ranging from 2200 to 2230 in alignment (2200–2230 without gaps). Whereas the recombination breakpoint ends at 5654 in the alignment (5654 without gaps) with breakpoint clustering at 99% confidence intervals ranging from 5587 to 5678 in alignment (5587–5678 without gaps) (Supplementary Fig. 2 and 3) (Fig. 4).

Fig. 4.

Putative recombination events identified by RDP v.4. with the input query of full length genome sequence of PVY (KY851109) strain and full-length sequences of 16 PVY strains. The figure depicts the exchange of genome segments between strains and the recombination break-points

Further, the recombinant nature of the polyprotein of the Indian isolate was verified by RAT analysis. A potential recombination event was detected when the lines representing two sequences intersected in the graph (Supplementary Fig. 6). A potential breakpoint in the sequence was observed in the Indian isolate while using JQ969036 and JQ663997 as two parents, whereas no clear breakpoints were observed for the sequences of C, N and O strains which are considered as non-recombinant strains. The recombinant events observed by using RAT corresponded to those obtained by RDP as well.

Genetic diversity of PVY

Among the various strains of PVY that were analyzed, nucleotide diversity (π) was found to be relatively high among the PVY strains-C (0.10619), whereas nucleotide diversity was low in PVY-NO (0.00283). PVY strains viz., NTN (0.03067), Wilga (0.02862), and O (0.02987) showed a moderate nucleotide diversity however, PVY-N strains showed a slightly higher diversity value of 0.06116 (π). Expectedly, the nucleotide diversity values of ‘others’ category (12 isolates) that included diverse strains of South American isolates, among others, showed a high diversity value of 0.14867 (π) and the highest number of polymorphic sites (4020-S). With respect to the number of polymorphic sites on the genomes of PVY strains, strain ‘O’ (2869) displayed the highest number of polymorphic sites (S) followed by strain ‘C’ (2028), N (1913), and NTN (1641). The least number of polymorphic sites was observed in the ten NO genomic sequences that were analysed (109).

Population dynamics of PVY

Studies on population statistic parameters showed that statistically significant negative values of Tajima’s D exhibited by all the PVY strains suggest that PVY population as a whole and individual strains are characterized with excess of low frequency polymorphisms and the population undergo the phenomenon of purifying selection. It implies that any detrimental mutations in the genomes of PVY are being cleansed and hence the population expansion is observed. Similarly, the values of test statistic Fu & Li’s D further confirmed the generation of excess singletons (corroborating negative Tajima’s D) in the population. Correspondingly, Fu & Li’s F have also shown negative values indicating the principle of operation of purifying selection and population expansion. The implication of these test statistics is that aberrant mutations in the genomes of PVY as whole and individual strains are not tolerated in the population. Negative values signify that PVY population undergoes natural selection or a recent bottleneck which was followed by expansion of the species. Furthermore, these results also suggest that the genomes of PVY more likely underwent an excess of mutations in the recent past than in the more distant past.

Genetic differentiation and gene flow among the various PVY strains

Nucleotide test statistic based on genetic differentiation between strain groups revealed that a relatively greater degree of genetic differentiation was observed between the genotypes NTN versus NO, NTN versus C, NO versus WILGA because the Snn value was found to be 1.000 between these strains. On the other hand, WILGA and C were found to be closely related to ‘Others’ and NTN is related to N because the analysis showed the Snn value of 0.87097 (WILGA vs. Others), 0.80435 (NTN vs. N) and 0.73529 for (C vs. Others). Studies regarding gene flow showed that relatively free gene flow or panmixis is observed between N and others (Fst: 0.07978), NTN and Others (0.17720). On the contrary, NTN versus O (Fst: 0.74988), O versus NO (Fst: 0.75924) and NTN versus NO (Fst: 0.77295) showed relatively higher Fst values indicating that these strains were not open for free gene flow hence genetic exchange between these genotypes were found to be low. Similarly, a moderate gene flow was observed between many genotypes for example, O versus WILGA (Fst: 0.53929); O versus Others (0.41961); N versus C (0.47149); NO versus WILGA (0.41426); NO versus C (0.55616); NO versus Others (0.42661); WILGA versus C (0.43629).

Discussion

PVY continues to be a serious threat to potato cultivation worldwide. Information about the strain composition of PVY populations in various potato-producing states of India is so far limited. In this article, we report the complete genome sequence characterization of a PVY isolate from commercial potato fields in J&K and performed evolutionary lineage analysis of PVY. A common strain of PVY (PVY-O) has been identified based on the sequence analysis of the 5′UTR and P1 gene. Recently, a hybrid strain of PVY-N:O was identified [24]. Besides, PVY-C also referred as the stipple streak strain was documented to be distributed in India. However, there has been no record of occurrence of an NTN strain in India. In the present study, the isolate JK12 (KY851109) was characterized using strain-specific primers and complete genome sequencing approach. Comparative sequence analysis with known PVY strains revealed that the JK12 isolate is an NTN strain. The phylogenetic analysis of JK12 isolate along with other isolates of PVY at coat protein level as well as the polyprotein level showed that the JK12 isolate clustered within the clade consisting of known NTN strains.

During last 2 decades, an increasing body of evidence has accumulated suggesting the emergence of new recombinant strains of PVY [18, 25]. The strain composition of PVY seems to be dynamic and shifting in different parts of the potato producing regions of the world and new strains continue to be discovered and characterized [15]. For example, O and N to be the predominant strains in the US for a long time, while they seemed to have been replaced by NTN and more recently by N-Wilga [21, 25, 31]. Similarly, in Europe, the non-recombinant PVY strains have almost disappeared and replaced by recombinant strains [28]. Moreover, the recombinant PVY-NTN and related strains were found to be predominantly present worldwide and they tend to replace the common strain such as PVY-N and PVY-O (Green 2017). A recent study revealed that the selective pressure in the field conditions favours PVY-EU–NTN isolates and suppresses other less predominant isolates [6]. In this context, the present study is a significant step forward as we provide the first report of occurrence of the NTN strain in India. PVY-NTN has been shown to cause disease symptoms in potato tubers and NTN strains are considered to be emerging from the mild foliar symptom inducing PVY-N and PVY-O strains [18]. The finding of NTN in commercial potato fields in India underscores a potential threat to potato cultivation with the risk of potato tuber necrotic ringspot disease (PTNRD) development. Even though the occurrence of PTNRD in Indian potato cultivars has not been reported, the ability of PVY-NTN to cause characteristic symptoms and hence the economic losses could not be ignored. Biological characterization of the isolates obtained during this study needs to be carried out to verify if PTNRD is caused by the isolates collected during this study.

The PVY-NTN isolate (JK12) was analyzed for the effect of genetic recombination because of the prevalence of comparatively open potato seed production systems in India which facilitates the entry of different strains of PVY leading to a greater chance of recombination. The Indian NTN strain (JK12 isolate) might have possibly originated from a recombination event between JQ969036 (N strain) from Belgium as the major parent and JQ663997 (O strain) from China as the minor parent. The recombination event identified by RDP4 was further confirmed by RAT. Similar findings of recombination in PVY genomes were reported earlier wherein the nucleotide sequence of PVY-O was found to be present in recombinant strains of NTN, N:O, Wi and -O5 [26]. This phenomenon was reported for NTN and other PVY hybrid strains, which have been shown to recombine at non-random breakpoints [29, 49, 50].

A large scale PVY genome sequence project characterized 119 whole genome sequences obtained from the potato producing regions of the US. Further, 166 complete PVY sequences obtained from GenBank were used for phylogenetic and recombination analysis. Three novel PVY recombinants (2 novel PVY-C and one novel PVY-N:O) were reported in this study [22]. This investigation also showed that the common recombinants of PVY have originated multiple times with varying parental lines suggesting the important role of recombination in the emergence of new strains of PVY. Another global analysis of PVY genome sequences [12] showed that the recent phylogeny concurred with the classification of PVY strains based on sequence and taxonomic analysis [16].

In the Indian context, the present study laid the ground work for further investigations to determine the extent of distribution of the PVY-NTN strain in particular and the other PVY-N and PVY-O-derived recombinants in general, and possibly other strains in seed and commercial potato fields. Furthermore, the availability of PCR-based methods should facilitate the typing of various PVY isolates to the strain level. Breeding of potato cultivars resistant to PVY infection should take into consideration the full gamut of PVY strains and their relative incidence. Thus, identification of potato genotypes resistant to PVY-NTN infection and incorporation of those genotypes in the potato breeding programs is imperative in order to obtain potato cultivar with broad spectrum resistance.

Electronic supplementary material

Below is the link to the electronic supplementary material.