Skip to main content
Molecular Plant Pathology logoLink to Molecular Plant Pathology
. 2012 Dec 28;14(4):323–341. doi: 10.1111/mpp.12011

Fusarium culmorum: causal agent of foot and root rot and head blight on wheat

Barbara Scherm 1, Virgilio Balmas 1, Francesca Spanu 1, Giovanna Pani 1,2, Giovanna Delogu 2, Matias Pasquali 3, Quirico Migheli 1,
PMCID: PMC6638779  PMID: 23279114

Summary

Fusarium culmorum is a ubiquitous soil‐borne fungus able to cause foot and root rot and Fusarium head blight on different small‐grain cereals, in particular wheat and barley. It causes significant yield and quality losses and results in contamination of the grain with mycotoxins. This review summarizes recent research activities related to F. culmorum, including studies into its population diversity, mycotoxin biosynthesis, mechanisms of pathogenesis and resistance, the development of diagnostic tools and preliminary genome sequence surveys. We also propose potential research areas that may expand our basic understanding of the wheat–F. culmorum interaction and assist in the management of the disease caused by this pathogen.

Taxonomy

Fusarium culmorum (W.G. Smith) Sacc. Kingdom Fungi; Phylum Ascomycota; Subphylum Pezizomycotina; Class Sordariomycetes; Subclass Hypocreomycetidae; Order Hypocreales; Family Nectriaceae; Genus Fusarium.

Disease symptoms

Foot and root rot (also known as Fusarium crown rot): seedling blight with death of the plant before or after emergence; brown discoloration on roots and coleoptiles of the infected seedlings; brown discoloration on subcrown internodes and on the first two/three internodes of the main stem; tiller abortion; formation of whiteheads with shrivelled white grains; Fusarium head blight: prematurely bleached spikelets or blighting of the entire head, which remains empty or contains shrunken dark kernels.

Identification and detection

Morphological identification is based on the shape of the macroconidia formed on sporodochia on carnation leaf agar. The conidiophores are branched monophialides, short and wide. The macroconidia are relatively short and stout with an apical cell blunt or slightly papillate; the basal cell is foot‐shaped or just notched. Macroconidia are thick‐walled and curved, usually 3–5 septate, and mostly measuring 30–50 × 5.0–7.5 μm. Microconidia are absent. Oval to globose chlamydospores are formed, intercalary in the hyphae, solitary, in chains or in clumps; they are also formed from macroconidia. The colony grows very rapidly (1.6–2.2 cm/day) on potato dextrose agar (PDA) at the optimum temperature of 25 °C. The mycelium on PDA is floccose, whitish, light yellow or red. The pigment on the reverse plate on PDA varies from greyish‐rose, carmine red or burgundy. A wide array of polymerase chain reaction (PCR) and real‐time PCR tools, as well as complementary methods, which are summarised in the first two tables, have been developed for the detection and/or quantification of F. culmorum in culture and in naturally infected plant tissue.

Host range

Fusarium culmorum has a wide range of host plants, mainly cereals, such as wheat, barley, oats, rye, corn, sorghum and various grasses. In addition, it has been isolated from sugar beet, flax, carnation, bean, pea, asparagus, red clover, hop, leeks, Norway spruce, strawberry and potato tuber. Fusarium culmorum has also been associated with dermatitis on marram grass planters in the Netherlands, although its role as a causal agent of skin lesions appears questionable. It is also isolated as a symbiont able to confer resistance to abiotic stress, and has been proposed as a potential biocontrol agent to control the aquatic weed Hydrilla spp.

Useful websites

http://isolate.fusariumdb.org/; http://sppadbase.ipp.cnr.it/; http://www.broad.mit.edu/annotation/genome/fusarium_group/MultiHome.html; http://www.fgsc.net/Fusarium/fushome.htm; http://plantpath.psu.edu/facilities/fusarium‐research‐center; http://www.phi‐base.org/; http://www.uniprot.org/; http://www.cabi.org/; http://www.indexfungorum.org/

Introduction

Fusarium culmorum (W.G. Smith) Sacc. is a ubiquitous soil‐borne fungus with a highly competitive saprophytic capability. As a facultative parasite, it is able to cause foot and root rot (FRR) and Fusarium head blight (FHB) on different small‐grain cereals, in particular wheat and barley. Fusarium culmorum is also known as a post‐harvest pathogen, especially on freshly harvested grain that has not been dried or stored properly (Aldred and Magan, 2004; Eifler et al., 2011; Lowe et al., 2012; Magan et al., 2003, 2010). Together with F. graminearum Schwabe (teleomorph Gibberella zeae) and F. pseudograminearum O'Donnell and Aoki (teleomorph Gibberella coronicola), F. culmorum has been reported as one of the main pathogens of wheat worldwide (Burgess et al., 2001; Goswami and Kistler, 2004; Hogg et al., 2010; Kosiak et al., 2003; Miedaner et al., 2008; Treikale et al., 2010; Wagacha and Muthomi, 2007; Wang et al., 2006).

Yield and quality losses are particularly important when F. culmorum induces FHB, which develops from infection at anthesis and spreads until grain harvest, causing grain contamination with mycotoxins, such as type B trichothecenes, zearalenone and fusarins (Hope et al., 2005; Jennings et al., 2004; Kammoun et al., 2010; Lacey et al., 1999; Placinta et al., 1999; Rohweder et al., 2011; Visconti and Pascale, 2010). The sesquiterpene epoxide trichothecenes are considered to be the most bioactive compounds produced by F. culmorum. These mycotoxins are able to inhibit eukaryotic protein synthesis (Wei and McLaughlin, 1974) and cause toxicoses in humans or animals consuming contaminated food or feed (Sudakin, 2003). They have also been reported to induce apoptosis (Desmond et al., 2008; Yang et al., 2000) and play an important role as virulence factors (Bai et al., 2002; Desjardins et al., 1996, 2000; Harris et al., 1999; Jansen et al., 2005; Maier et al., 2006; McCormick, 2003; Proctor et al., 1995, 2002; Scherm et al., 2011; Ward et al., 2008; Zhang et al., 2010).

The purpose of this profile is to provide an overview of the recent research activities related to F. culmorum, including those on population diversity, mycotoxin biosynthesis, mechanisms of pathogenesis and resistance, the development of diagnostic tools and preliminary genome sequence surveys (see Tables 1 and 2, respectively, for a list of PCR‐based and non PCR‐based approaches to discriminate and detect F. culmorum). We also propose potential research areas that may expand our basic understanding of the wheat–F. culmorum interaction and ultimately assist in the management of the different facies of the disease caused by this pathogen.

Table 1.

Summary of published primers used for species and chemotype determination in Fusarium culmorum

Identification of Primers and probes (5′ → 3′) Target DNA PCR technique Reference
Species (F. culmorum and F. graminearum) FcF CAAAAGCTTCCCGAGTGTGTC
FcR GGCGAAGGTTCAAGGATGAC
Unknown Conventional PCR Baturo‐Ciesniewska and Suchorzynska (2011); Doohan et al. (1998)
Species (not able to distinguish from F. cerealis) FculC561fwd CACCGTCATTGGTATGTTGTCACT
FculC614rev CGGGAGCGTCTGATAGTCG
ef1‐α Real‐time PCR Nicolaisen et al. (2009)
Species (together with F cerealis and F. graminearum) FIP‐hyd5 GCACAGCACTGGGAAGTGCGAGAAGCGACAGGCCTACA
BIP‐hyd5 TGGGTGTTGCTGACCTCGACGGGGCTGTTCATGTTAGCT
B3‐hyd4 GACAGCGCTGAAGTTGTC
LoopB‐hyd5 CCGTAAGTACTCGAGTCTG
LoopF‐hyd5 GTAGAGGCCACTGCAAGG
F3‐hyd5 CTTGGAGCCGTTGTCTCTG
Hyd 5 LAMP PCR Denschlag et al. (2012)
Species (together with F. crockwellense) CRO‐C fwd CTCAGTGTCCACCGCGTTGCGTAGTGT
CRO‐C rev AAGCAGGAAACAGAAACCCTTTCC
RAPD fragment Conventional PCR Yoder and Christianson (1998)
Species (together with F. graminearum) CUL‐A fwd TTTCAGCGGGCAACTTTGGGTAGA
CUL‐A rev AAGCTGAAATACGCGGTTGATAGG
RAPD fragment Conventional PCR Yoder and Christianson (1998)
Species C51END fwd AACTGAATTGATCGCAAGC
C51END rev CCCTTCTTACGCCAATCTC
Unknown Real‐time PCR Covarelli et al. (2012)
Species OPT18F470 GATGCCAGACCAAGACGAAG
OPT18R470 GATGCCAGACGCACTAAGAT
SCAR Conventional PCR
Real‐time PCR*
Baturo‐Ciesniewska and Suchorzynska (2011); Brandfass and Karlovsky 2006; Schilling et al. (1996)
Species Fc92s1 forward TTCACTAGATCGTCCGGCAG
Fc92s1 reverse GAGCCCTCCAAGCGAGAAG
Unknown Real‐time PCR Leisova et al. (2006)
Species Fc01F ATGGTGAACTCGTCGTGGC
Fc01R CCCTTCTTACGCCAATCTCG
RAPD fragment Conventional PCR Baturo‐Ciesniewska and Suchorzynska (2011); Nicholson et al. (1998)
Species Fcg17F TCGATATACCGTGCGATTTCC
Fcg17R TACAGACACCGTCAGGGGG
RAPD fragment Conventional PCR Baturo‐Ciesniewska and Suchorzynska (2011); Nicholson et al. (1998)
Species 175F TTTTAGTGGAACTTCTGAGTAT
430R AGTGCAGCAGGACTGCAGC
ITS region Fluorescent‐labelled PCR‐based assay Mishra et al. (2003)
Species culmorum MGB‐R GAACGCTGCCCTCAAGCTT
culmorum MGB‐F TCACCCAAGACGGGAATGA
Probe CACTTGGATATATTTCC
Genomic DNA Real‐time PCR (TaqMan) Waalwijk et al. (2004)
Type B trichothecene producers Fcu‐F GACTATCATTATGCTTGCGAGAG
Fgc‐R CTCTCATATACCCTCCG
IGS region Conventional PCR Baturo‐Ciesniewska and Suchorzynska (2011); Jurado et al. (2005)
15‐ADON subchemotype Tri3F971 CATCATACTCGCTCTGCTG
Tri3R1679 TT(AG)TAGTTTGCATCATT(AG)TAG
TRI3 Conventional PCR Pasquali et al. (2011); Quarta et al. (2006)
3‐ADON subchemotype Tri3F1325 GCATTGGCTAACACATGA
Tri3R1679 TT(AG)TAGTTTGCATCATT(AG)TAG
TRI3 Conventional PCR Pasquali et al. (2011); Quarta et al. (2006)
Nivalenol subchemotype Tri7F340 ATCGTGTACAAGGTTTACG
Tri7R965 TTCAAGTAACGTTCGACAAT
TRI7 Conventional PCR Pasquali et al. (2011); Quarta et al. (2005)
High‐deoxynivalenol‐producing strains N1‐2 CTTGTTAAGCTAAGCGTTTT
N1‐2R AACCCCTTTCCTATGTGTTA
TRI6/TRI5 intergenic region Conventional PCR Bakan et al. (2002)
Low‐deoxynivalenol‐producing strains 4056 ATCCCTCAAAAACTGCCGCT
3551 ACTTTCCCACCGAGTATTTC
TRI6/TRI5 intergenic region Conventional PCR Bakan et al. (2002)
Species (together with F. graminearum and F. pseudograminearum) Gzeae87T forward CGCATCGAGAATTTGCA
Gzeae87T reverse TGGCGAGGCTGAGCAAAG
Gzeae87T probe 6FAM‐TGCTTACAACAAGGCTGCCCACCA‐TAMRA
TRI5 Real‐time PCR (TaqMan) Strausbaugh et al. (2005)
Deoxynivalenol‐producing isolates (F. graminearum and F. culmorum) 22F AATATGGAAAACGGAGTTCATCTACA
122R ATTGCCGGTGCCTGAAAGT
TRI6‐TRI5 intergenic region Real‐time PCR (SYBR Green I) Terzi et al. (2007)
PKS13‐containing strains (F. culmorum and F. graminearum) ZEA‐F CTGAGAAATATCGCTACACTACCGAC
ZEA‐R CCCACTCAGGTTGATTTTCGTC
PKS13 Conventional PCR/Real‐time PCR (SYBR Green I) Atoui et al. (2012)
Deoxynivalenol‐producing strain Tri7F TGCGTGGCAATATCTTCTTCTA
Tri7DON GTGCTAATATTGTGCTAATATTGTGC
TRI7 Conventional PCR Baturo‐Ciesniewska and Suchorzynska (2011); Chandler et al. (2003)
Deoxynivalenol‐producing strain Tri13F CATCATGAGACTTGTKCRAGTTTGGGC
Tri13DONR GCTAGATCGATTGTTGCATTGAG
TRI13 Conventional PCR Baturo‐Ciesniewska and Suchorzynska (2011); Chandler et al. (2003)
Nivalenol‐producing strain Tri7F TGCGTGGCAATATCTTCTTCTA
Tri7NIV TGTGGAAGCCGCAGA
TRI7 Conventional PCR Baturo‐Ciesniewska and Suchorzynska (2011); Chandler et al. (2003)
Nivalenol‐producing strain Tri13NIVF CCAAATCCGAAAACCGCA
Tri13R TTGAAAGCTCCAATGTCGTG
TRI13 Conventional PCR Baturo‐Ciesniewska and Suchorzynska (2011); Chandler et al. (2003)
3‐ADON‐producing strain Tri303F GATGGCCGCAAGTGGA
Tri303R GCCGGACTGCCCTATTG
TRI3 Conventional PCR Baturo‐Ciesniewska and Suchorzynska (2011); Jennings et al. (2004)
Trichothecene producer Tox5‐1 GCTGCTCATCACTTTGCTCAG
Tox5‐2 CTGATCTGGTCACGCTCATC
TRI5 Conventional PCR Baturo‐Ciesniewska and Suchorzynska (2011); Niessen and Vogel (1998)
Nivalenol‐producing strain 12NF TCTCCTCGTTGTATCTGG
12CON CATGAGCATGGTGATGTC
TRI12 Conventional PCR Pasquali et al. (2011); Ward et al. (2002)
Deoxynivalenol‐producing strain 12‐3F CTTTGGCAAGCCCGTGCA
12CON CATGAGCATGGTGATGTC
TRI12 Conventional PCR Pasquali et al. (2011); Ward et al. (2002)
Nivalenol‐producing strain Tri13P1 CTCSACCGCATCGAAGASTCTC
Tri13P2 GAASGTCGCARGACCTTGTTTC
TRI13 Conventional PCR Pasquali et al. (2011); Wang et al. (2008)
3‐ADON‐producing strains 3ADONf AACATGATCGGTGAGGTATCGA
3ADONr CCATGGCGCTGGGAGTT
TRI12 Real‐time PCR Nielsen et al. (2012)
Nivalenol‐producing strain NIVf GCCCATATTCGCGACAATGT
NIVr GGCGAACTGATGAGTAACAAAACC
TRI12 Real‐time PCR Nielsen et al. (2012)
3‐ADON‐producing strains (F. culmorum and F. graminearum) 3ADON fwd CATGCGGGACTTTGATCGAT
3ADON rev TTTGTCCGCTTTCTTTCTATCATAAA
3ADON probe FAM‐CTCACCGATCATGTTC‐MGB
TRI12 Taqman real‐time PCR Kulik (2011)
Nivalenol‐producing strain (F. culmorum and F. graminearum) NIV fwd TCGCCAGTCTCTGCATGAAG
NIV rev CCTTATCCGCTTTCTTTCTATCATAAA
NIV probe FAM‐CTGATCATGTCCCGCATC‐MGB
TRI12 Taqman real‐time PCR Kulik (2011)
Zearalenone producer PKS4‐PS.1 GTGGGCTTCGCTAGACCGTGAGTT
PKS4‐PS.2 ATGCCCTGATGAAGAGTTTGA
PKS4 Real‐time PCR Baturo‐Ciesniewska and Suchorzynska (2011); Lysøe et al. (2006)
Zearalenone producer F1 CGTCTTCGAGAAGATGACAT
R1 TGTTCTGCAAGCACTCCGA
PKS4 PCR Baturo‐Ciesniewska and Suchorzynska (2011); Meng et al. (2010)

ADON, acetylated deoxynivalenol; PCR, polymerase chain reaction; RAPD, random amplification of polymorphic DNA; SCAR, sequence characterized amplified region.

Table 2.

Non‐polymerase chain reaction (PCR)‐based approaches to discriminate and detect Fusarium culmorum

Technology employed Reference
Surface plasmon resonance (SPR) sensor based on DNA hybridization Zezza et al. (2006)
Luminex assay to discriminate Fusarium species and chemotypes Ward et al. (2008)
DNA microarray for detection and identification of 14 Fusarium species Kristensen et al. (2007)
Spore shape discrimination analysed by computerized algorithms Dubos et al. (2012)
Metabolomic analysis and monitoring of the metabolic activity Lowe et al. (2010)
Electronic nose for discriminating species infecting grains Eifler et al. (2011)
Quick matrix‐assisted laser desorption/ionization (MALDI) linear time‐of‐flight mass spectrometry analysis of fungal spores Kemptner et al. (2009)

Disease Symptoms

Fusarium culmorum causes two distinct diseases on wheat: FRR and FHB, also known as ear blight or scab. FRR symptoms vary depending on the time of infection: if the fungus attacks at the early stage, just after sowing, pre‐ and post‐emergence seedling death occurs, with brown discoloration on the coleoptiles, roots and the pseudostem; if the infection starts later in the season, brown lesions appear on the first two or three internodes of the main stem and tiller abortion occurs (Fig. 1B). In the presence of high humidity, a reddish‐pink discoloration is often evident on the nodes caused by the presence of sporulating mycelium (Fig. 1C). The presence of whiteheads with shrivelled grain—or no grain at all—is easily observed when the wheat is still immature (Fig. 1D,E). Infected plants are more prone to lodging. FHB symptoms include partial head blighting, with the appearance of one or more prematurely bleached spikelets, or blighting of the entire head, which is easily observed when wheat has not yet reached the ripening stage (Fig. 2A,B). Initially, infected spikelets show light‐brown, water‐soaked spots on the glumes, which then become dark brown. Infected spikelets remain empty or contain shrunken grey/brown kernels. Browning on the rachilla and the rachis can be observed and, under favourable conditions, the fungus may infect the stem below the head, inducing a brown/purplish discoloration (Fig. 2C). Pink to orange sporodochia may be evident at the base of the spikelets or between the glumes and lemmas, if the environmental conditions are particularly humid (Fig. 2D,F).

Figure 1.

figure

Foot and root rot (FRR) symptoms: (A) macroconidia; (B) browning on the stem base; (C) reddish‐pink discoloration on the basal nodes; (D,E) presence of whiteheads.

Figure 2.

figure

Fusarium head blight (FHB) symptoms: (A,B) head blight symptoms; (C) brown/purplish discoloration below head; (D–F) orange sporodochia on spikelets.

Epidemiology

Fusarium culmorum has been traditionally reported as the incitant of FHB in northern, central and western Europe (Muthomi et al., 2000;de Nijs et al., 1997; Parry et al., 1995). However, recently, in northern Europe, a change is being observed in the frequency of isolation, and F. culmorum is seldom reported compared with F. graminearum. This progressive switch may be explained by the widespread use of feed maize as a rotation crop with wheat in northern Europe, with consequent F. graminearum inoculum build‐up in the soil. It is noteworthy that F. culmorum is occasionally isolated from maize crops and maize kernels, but never as the main pathogen (Logrieco et al., 2002; Scauflaire et al., 2011; Van Asselt et al., 2012). Other reasons for the transition from F. culmorum to F. graminearum may be related to the gradual adaptation of F. graminearum to colder climates as a result of genome plasticity (Lysøe et al., 2011; Raffaele and Kamoun, 2012) or to the rise in average temperatures caused by climate change (Jennings et al., 2004; Waalwijk et al., 2003; West et al., 2012; Xu et al., 2005). However, in Luxembourg, following the year 2011 with hardly any precipitation in May, 90% of the blighted spikes were infected by F. culmorum, whereas only 10% were infected by F. graminearum, suggesting a role of climatic conditions in driving the prevalence of each species, reversing drastically the previous species distribution (Giraud et al., 2010).

Contrary to early reports from colder areas in central and northern Europe, F. culmorum is now frequently reported as the main agent of FHB in the Mediterranean region, and particularly in years characterized by wet conditions during the phenological phases of flowering and kernel filling (Corazza et al., 2002; Fakhfakh et al., 2011; Kammoun et al., 2010; Pancaldi et al., 2010). The greater incidence of FHB caused by F. culmorum in these areas is correlated with its presence as the main cause of FRR, a disease that is particularly severe on durum wheat in southern Italy and North Africa.

Key factors in the development of FRR are the previous crop, residue management, nitrogen fertilization, plant density and the environmental conditions. Conidial germination and germ tube extension on sterile and unsterile wheat straw leaf sheaths were significantly higher relative to other crop residue colonizers, such as Gliocladium, Trichoderma and Penicillium spp., when tested at different water potential × temperature (Magan, 1988). Therefore, wheat monoculture and/or rotation with another cereal crop (such as barley, triticale, rye, spelt, oat or corn) boosts the inoculum and, consequently, the chances of increasing FRR severity: although cereals are not equally sensitive to F. culmorum, all may contribute to maintain inoculum survival in the soil. High nitrogen fertilization rates and high sowing density are believed to increase the incidence of FRR: increased leaf index and transpiration rates and the reduction of plant water potential induce water stress and, consequently, a higher sensitivity to the pathogen (Davis et al., 2009; Papendick and Cook, 1974).

FRR by F. culmorum is severe when wheat is grown in warm areas, where the host plant is more subject to water stress (Bateman, 1993; Cariddi and Catalano, 1990; Chekali et al., 2010; Colhoun et al., 1968; Inglis and Cook, 1986; Papendick and Cook, 1974; Parry, 1990; Prew et al., 1995). Drought conditions increase the susceptibility of the plant rather than the virulence of the fungus. However, FHB occurs preferentially when the pathogen is present at the soil level, and the weather is moist and warm, with frequent rains between flowering and kernel filling stages (Bateman, 2005). Rain is an essential determinant of FHB infection, as demonstrated experimentally on wheat crops receiving overhead irrigation (Strausbaugh and Maloy, 1986). The macroconidia that are found in soil on crop residues reach the ear by rain splash, wind or insects, attaining distances of up to 60 cm vertically and 1 m horizontally (Jenkinson and Parry, 1994; Parry et al., 1995; Rossi et al., 2002). Compared with F. graminearum, F. culmorum does not produce ascospores, being unable to differentiate sexual perithecia. From an epidemiological standpoint, this is paramount, given the crucial role of wind‐borne ascospores in the spread of FHB caused by the former species (Markell and Francl, 2003).

Once the inoculum reaches the ear, humidity and temperature in the crop microclimate play a critical role: it takes at least 24 h of moisture with temperatures above 15 °C, with an optimum of 25 °C, to allow infection (Doohan et al., 2003; Parry et al., 1995). Nonetheless, among the species causing FHB, F. culmorum has the smallest need for the presence of high relative humidity to infect wheat (Klix et al., 2008; Rossi et al., 2001).

Population Diversity and Mycotoxin Production

The perfect stage (teleomorph) of F. culmorum is not known, even though transcribed mating type genes have been identified in this species. Only one MAT idiomorph (MAT1‐1 or MAT1‐2) has been reported so far, postulating heterothallism (Kerényi et al., 2004; Mishra et al., 2003; Obanor et al., 2010; Tòth et al., 2004). It is noteworthy that, among a vast majority of isolates from Turkey carrying either the MAT‐1 or MAT‐2 sequence, Çepni et al. (2012) were recently able to identify two F. culmorum isolates that carried both sequences.

The genetic variability of F. culmorum in different geographical areas suggests that genetic exchange occurs or has occurred in the past, as the population structure is not clonal (Miedaner et al., 2001; Mishra et al., 2003; Tòth et al., 2004).

Population studies carried out within restricted geographical areas, or even at the single field level, have reported a wide genetic variability, whereas relatively modest differences have been detected among populations obtained from different climatic regions (Gargouri et al., 2003; Nicholson et al., 1993). A high level of diversity has also been found recently in F. culmorum isolates from Turkey by intergenic spacer‐restriction fragment length polymorphism (IGS‐RFLP) analysis, further confirming the wide genetic variability associated with FRR disease (Çepni et al., 2012). A phylogenetic study conducted with over 100 isolates of F. culmorum from Australia, West Asia, North Africa and Europe identified three to four distinct groups or lineages. However, no correlation was found between lineages and their geographical origin, with the exception of one cluster including isolates from a single area (Obanor et al., 2010).

Two chemotypes have been described in F. culmorum: chemotype I, which produces deoxynivalenol (DON) and/or its acetylated derivatives (3‐ADON, 15‐ADON), and chemotype II, which produces nivalenol (NIV) and/or fusarenone‐X (FUS), NIV being 10 times more toxic than DON (Minervini et al., 2004). DNA sequence variation in the coding region of the trichothecene biosynthetic gene TRI8 was found in Fusarium spp., including F. culmorum, indicating that differential activity of the Tri8 protein (i.e. deacetylation of the trichothecene biosynthetic intermediate 3,15‐diacetyldeoxynivalenol at carbon 15 versus carbon 3 to yield 3‐ADON or 15‐ADON, respectively) determines the 3‐ADON and 15‐ADON subchemotypes in Fusarium (Alexander et al., 2011).

Studies on F. culmorum chemotypes are less frequent than those focusing on F. graminearum, but it is possible to trace their distribution in some geographical areas (Table 3).

Table 3.

Distribution of Fusarium culmorum chemotypes: country, chemotyping method used, number of isolates analysed, main finding and bibliographic reference

Country Chemotyping method used Number of isolates analysed Main finding Reference
Europe Chemical 42 ∼84% DON producers, ∼16% NIV producers Gang et al. (1998)
Germany Chemical 27 ∼60% NIV producers, ∼40% DON producers Muthomi et al. (2000)
Norway Chemical 23 Mostly 3‐ADON producers, two NIV producers Langseth et al. (2001)
France Genetic and chemical 60 58% NIV producers, 42% DON producers Bakan et al. (2001, 2001,2002)
Denmark, Germany, Austria Chemical 102 1995 sampling: ∼90% DON producers, ∼10% NIV producers Hestbjerg et al. (2002)
The Netherlands Genetic 85 2000–2001 sampling: mostly NIV producers Waalwijk et al. (2003)
Worldwide (Australia, Canada, Israel, Hungary, Germany, Denmark, the Netherlands, Morocco) Genetic and chemical 37 19% NIV producers, 81% 3‐ADON producers Tòth et al. (2004)
UK Genetic 157 DON producers are prevalent, but NIV producers are distributed consistently Jennings et al. (2004)
Europe (Spain, Italy, Poland, Norway, the Netherlands, France, Finland, former Yugoslavia) Genetic 55 ∼20% NIV producers, ∼80% 3‐ADON producers Quarta et al. (2005)
Belgium Genetic 128 In 2007 (95%) and in 2008 (88%) NIV producers are the most diffused Audenaert et al. (2009)
Luxembourg Genetic and chemical 175 3‐ADON and NIV producers are evenly distributed
Chemotyping is useful to predict toxin content
Chemical analysis confirms genetic chemotyping
Pasquali et al. (2010)
Tunisia Genetic and chemical 100 Mostly 3‐ADON producers, 2% NIV producers
Chemical analysis confirms genetic chemotyping
Kammoun et al. (2010)
Poland Genetic 68 6% NIV producers, 94% 3‐ADON producers Baturo‐Ciesniewska and Suchorzynska (2011)
Turkey Genetic 21 100% 3‐ADON producers Yörük and Albayrak (2012)

ADON, acetylated deoxynivalenol; DON, deoxynivalenol; NIV, nivalenol.

The link between the presence of the pathogen and its toxins (in this case, type B trichothecenes) is often complicated by the complexity of toxin induction and pathogen adaptation. Although F. culmorum has been reported to be one of the main fungal species associated with diseased wheat in warmer regions, such as Turkey (Tunalı et al., 2006), Tunisia (Kammoun et al., 2010), Australia and New Zealand (Lauren et al., 1992), no clear data on its role in toxin accumulation are evident. Moreover, although this species was the most prevalent in 2009 in the central region of Poland, the level of toxin contamination reported in the grains was very low, and no direct correlation between fungal contamination and toxin accumulation could be found (Chelkowski et al., 2012). The identification of the chemotype may provide insight into the toxigenic potential of F. culmorum isolates. For example, the presence of F. culmorum with the NIV subchemotype has been linked to the accumulation of NIV in wheat harvested in Luxembourg during 2007 and 2008 (Pasquali et al., 2010), confirming the findings obtained in a within‐field comparison experiment described by Xu et al. (2008). Similar results pinpointing a role of F. culmorum in the accumulation of NIV have been reported in a recent screening of historical Danish seed samples by real‐time PCR (Nielsen et al., 2012).

Host–Pathogen Interaction

Although a wide array of information on F. culmorum pathogenesis can be inferred from reports using F. graminearum as the species of interest, in the present review, we have attempted to limit references to related Fusarium species only when absolutely necessary. Fusarium culmorum remains viable as mycelium in crop residues left on the ground surface, and can survive in soil for 2–4 years by forming chlamydospores (Bateman et al., 1998; Cook, 1980; Inglis and Cook, 1986). When the seed germinates, the fungus penetrates through the lesions that are formed during primary root emergence, and then progresses towards the culm. Alternatively, it penetrates through the stomata at the insertion point of the basal leaf sheath towards the stem. The colonization follows, initially, an intercellular apoplastic pathway between cells of the epidermis and cortex; subsequently, the fungus progresses intracellularly in the symplast to complete colonization of the tissues (Beccari et al., 2011; Covarelli et al., 2012; Pettitt and Parry, 2001). The fungus may then grow further along the stem, although it is usually limited to the first basal internodes. The symptoms of basal browning may occur prior to the presence of the fungus in these portions, as a result of the plant response to infection (Beccari et al., 2011; Covarelli et al., 2012).

FHB infection occurs between flowering and the soft dough stage (GS 65–85; Zadoks' scale modified by Tottman and Makepeace, 1979), the phases between flowering and the milk stage (GS 65–77) being the most favourable for the infection by F. culmorum (Lacey et al., 1999). Once the macroconidia arrive onto the ear, they germinate rapidly and the fungus penetrates into host tissues, either directly through the stomata, or through the floret mouth or crevices formed between the palea and lemma, and then progresses inter‐ and intracellularly and reaches the endosperm within 12–24 h. Betaine and choline, which are contained in the anthers, stimulate the growth of conidial germ tubes towards the head surface (Strange et al., 1974, 1978). Similar to other FHB pathogens, F. culmorum may have an initial brief biotrophic phase within plant tissues, but then shifts to a necrotrophic stage through the production of trichothecenes and cell wall‐degrading enzymes (CWDEs; Bushnell et al., 2003).

The infection process by F. culmorum is strongly influenced by temperature, humidity, carbon and nitrogen availability, as well as the ability of the specific strain to produce mycotoxins that may confer a higher aggressiveness by inhibiting the defence response by the plant. Key factors for its growth are temperature and water availability (water activity a w; Magan et al., 2006). Schmidt‐Heydt et al. (2011) compared the effect of a w × temperature of one isolate of F. culmorum and F. graminearum on growth, F. culmorum showing an optimum at 30 °C and 0.98a w, whereas its minimum limit for growth was 15 °C over 0.88–0.995a w. Germination of F. culmorum macroconidia is restricted to a minimum of 0.86a w, but is functional over a wide temperature range from 5 to 35 °C (Magan et al., 2006). Fusarium culmorum hydrolytic enzymes are produced over the same broad temperature range, allowing the rapid utilization of nutritional resources (Magan and Lynch, 1986).

Mycotoxin biosynthesis is mainly influenced by temperature and moisture (Homdork et al., 2000; Tanaka et al., 1988). Studies with F. culmorum and F. graminearum isolates from Spain (Llorens et al., 2004) showed that both fungi require high humidity (>0.90a w) to support trichothecene production, with optimum temperatures of 25–28 °C for DON, 20 °C for NIV and a minimum of 15 °C for 3‐ADON. Fusarium culmorum demonstrated a significantly higher mycotoxigenic rate (up to five times higher for type B trichothecenes) than F. graminearum, and the toxin biosynthesis could not be correlated with mycelial growth (Llorens et al., 2004; Lori et al., 1999).

Trichothecene production, which is driven by the expression of the TRI5 gene encoding the key biosynthesis enzyme trichodiene synthase, can be observed as early as 36 h post‐inoculation during the colonization of wheat spikelets (Beccari et al., 2011; Kang and Buchenauer, 2002). The ability of aggressive strains of F. culmorum to infect wheat is related to their ability to produce larger amounts of DON in culture or in infected tissues (Hestbjerg et al., 2002; Manka et al., 1985; Scherm et al., 2011), although correlation is not always linear (Gang et al., 1998). Similar to F. graminearum, trichothecene mycotoxins produced by F. culmorum are essential for the spread of the disease by inhibiting defence mechanisms activated by the plant (Wagacha and Muthomi, 2007). Following inoculation of the stem base of soft wheat seedlings with F. culmorum, Covarelli et al. (2012) demonstrated the translocation of DON to the head, even though the fungus was unable to grow systemically beyond the third node. This finding suggests that FRR may represent an additional potential source of grain contamination, providing an explanation for previous reports on the presence of DON in grain harvested in the field, even in the absence of detectable fungus (Xu et al., 2008).

Different plant compounds involved in host–pathogen interactions are able to interfere with mycotoxin production within plant tissue (Boutigny et al., 2008). On infection, plant cells respond with a hypersensitive reaction by the generation of reactive oxygen species (ROS), such as H2O2 and superoxide. The strong oxidative properties of H2O2 modulate trichothecene biosynthesis (Ponts et al., 2006; Sweeney and Dobson, 1999), leading to increased expression of TRI genes (Ochiai et al., 2007; Ponts et al., 2007). In vitro production of DON and ADON by F. culmorum chemotype I isolates was enhanced after H2O2 treatment, whereas NIV and FUS production by chemotype II isolates was reduced (Ponts et al., 2009). Differences in the efficiencies of detoxification have been described in F. culmorum isolates of the two chemotypes. Usually, chemotype I isolates exposed to oxidative stress react with an increase in catalase activity, resulting in a higher H2O2‐destroying capacity (Ponts et al., 2009).

Typical growth patterns of F. culmorum are accompanied by a pH increase during infection (Lamour and Marchant, 1977), followed by increased extracellular enzyme expression activity and DON production. The role of CWDEs as virulence factors in F. culmorum has been investigated extensively (Cooper et al., 1988; Hestbjerg et al., 2002; Miedaner et al., 1997; Tunalı et al., 2012; Wang et al., 2006). The production of CWDEs able to hydrolyse cellulose, xylan and pectin of the plant cell wall (PCW) allows F. culmorum to invade host tissues within 3–4 days (Kang and Buchenauer, 2002). These alterations may occur even before the presence of fungal hyphae within the host tissues, suggesting an apoplastic movement of these enzymes (Kang and Buchenauer, 2000a, 2000b).

Fusarium culmorum creates the conditions for maximum activity of its pectin lyases (PNLs) and other depolymerizing enzymes by raising the apoplastic pH from 6 to 7.3. When grown with pectin as the sole carbon source, F. culmorum modulates the pH to more alkaline conditions, favouring significantly PNL production and repressing polygalacturonase (PG) expression, which has an activity window at the very initial stages of infection. This pH change triggers the synthesis of additional ‘weapons’, such as subtilisin and trypsin‐like enzymes, which are relevant in this colonization phase (Aleandri et al., 2007; Pekkarinen and Jones, 2002; Pekkarinen et al., 2002). In vivo, F. culmorum attacks an arabinoxylan‐rich cell wall (constituting up to 40% of its components) of graminaceous crops, and produces much more xylanases than other pathogens (Bëlien et al., 2006; Carpita, 1996; Hatsch et al., 2006). Moreover, effective hydrolysis of PCW requires the synergistic action of several CWDEs that have been found to be expressed and to act in complexes (Alfonso et al., 1995; Collins et al., 2005; Jaroszuk‐Scisel et al., 2011). The activities of seven CWDEs (glucanases, chitinases, xylanases, endo‐ and exocellulases, pectinases, PGs) have been traced in cultures of F. culmorum grown on fungal cell walls (FCWs) or PCW as carbon source, with glucanases, chitinases, xylanases and pectinases revealing a significantly higher activity. Replacement of FCW by PCW triggers an increase in PG activity, underlining their role in the initial phase of host cell wall attack (Jaroszuk‐Scisel and Kurek, 2012). Fusarium culmorum cultures with FCW as the only carbon source enhance their acid glucanase and chitinase repertoire, whereas PCW‐based cultures produce high concentrations of xylanases, as also documented for Fusarium‐infected barley (Jaroszuk‐Scisel and Kurek, 2012; Schwarz et al., 2002). Differences in the disease induction and tissue colonization between pathogenic and nonpathogenic isolates of F. culmorum have also been related to their different CWDE efficiencies (Jaroszuk‐Scisel and Kurek, 2012) and to their ability to induce local and systemic defence responses, i.e. cell wall thickening or oxidative burst (Jaroszuk‐Scisel et al., 2008; Martinez et al., 2000).

On infection with an F. culmorum spore suspension, wheat seeds and seedlings express several pathogenesis‐related (PR) proteins, including glucanases (PR1, PR2), chitinase (PR3), peroxidase (POX) and the PR protein Wheatwin1‐2 (PR4) (Aleandri et al., 2008; Bertini et al., 2003; Caruso et al., 1999). In in vitro experiments, stimulation of wheat seeds with different chemical inducers, such as salicylic acid (SA) and jasmonic acid (JA), or by mechanical damage through wounding, was followed in each case by an increase in PR4 expression, indicating its regulation by these pathways (Bertini et al., 2003). Fusarium culmorum‐infected wheat roots, instead, underwent increased expression of defence‐associated genes in leaf sheaths which had not yet been in contact with the fungus, indicating the role of a systemic response in FRR (Beccari et al., 2011).

Effective and persistent resistance in the host plant can be induced by low‐molecular‐mass molecules able to restrict fungal growth in the different tissue layers or by the inhibition of fungal CWDEs. In wheat, xylanase‐specific inhibitors, such as TAXI (Goesaert et al., 2003), XIP (Juge et al., 2004), thaumatin‐like XI (TLXI; Fierens et al., 2007) and PG‐inhibiting proteins (PGIPs; Di Matteo et al., 2003; Ferrari et al., 2012) have been described. Transgenic wheat plants expressing the bean PvPGIP2 gene in their flowers showed significantly reduced symptoms in F. graminearum‐incited FHB (Ferrari et al., 2012). Pectin methyl‐esterification influences plant resistance, as PCW becomes less susceptible to fungal pectinases and endopolygalacturonases. The level of esterification in the PCW is controlled by a pectin methyl‐esterase inhibitor (PMEI), supposed to confer resistance to the plant when demethylation is effectively inhibited. Wheat transgenic lines expressing AcPMEI from Actinidia chinensis showed reduced pectin methyl‐esterase (PME) activity, and hence high pectin methylation levels and significantly reduced disease symptoms following inoculation with F. graminearum (Volpi et al., 2011). Recently, three PMEI genes have been identified and characterized in wheat (Rocchi et al., 2012), opening up new perspectives in the development of transgenic wheat lines potentially resistant to different Fusarium species, including F. culmorum.

Plants are able to chemically transform trichothecenes by their degradation or detoxification, or to reduce their accumulation by the inhibition of biosynthesis through the activity of endogenous compounds (Alabouvette et al., 2009; Bollina and Kushalappa, 2011; Boutigny et al., 2010; Yoshinari et al., 2008). Glycosylation represents the main plant‐driven chemical transformation of mycotoxins in response to Fusarium attack (Karlovsky, 2011). In the naturally FHB‐resistant wheat cultivar Sumai3, genetic mapping has revealed that the ability to detoxify DON by a DON glucosyltransferase colocalizes with a major quantitative trait locus (QTL) for FHB resistance (Lemmens et al., 2005). Transgenic Arabidopsis thaliana expressing a barley UDP‐glucosyltransferase exhibited resistance to DON (Shin et al., 2012). Although several studies have been devoted to the selection of plant glycosylases, this does not appear to be an efficient strategy to control mycotoxin production, because of the possibility that glycosyl‐protected mycotoxins may be re‐converted into the original toxic form by hydrolysis in the digestive tract or during food/feed processing (the so‐called ‘masked’ mycotoxins).

Some secondary plant metabolites, present in larger amounts in FHB‐resistant plants, have been shown to inhibit fungal growth in vitro and/or mycotoxin production by Fusarium spp. These are phenolic and polyphenolic compounds belonging to the benzoic and cinnamic acids, furanocoumarins, phenylpropanoids, chromenes and flavones (Bakan et al., 2003; Boutigny et al., 2010; Mellon et al., 2012; Ojala et al., 2000; Takahashi‐Ando et al., 2008; Wu et al., 2008). Most are constituents of PCW: in response to infection, plants release phenols from the cell wall in order to limit the pathogen spread by reinforcing plant structural components. Some dialkyl resorcinols and coumarins manifest antifungal activity against F. culmorum (Ojala et al., 2000; Pohanka et al., 2006). Moreover, phenols present anti‐oxidant and/or radical scavenging activities (Kim et al., 2006). Therefore, defence mechanisms triggered in the plant in response to pathogenic oxidative processes involve the production of these secondary metabolites that can interfere in different ways with trichothecene biosynthesis.

Options for Control

The multiple factors influencing fungal growth and trichothecene production by F. culmorum require the application of an integrated pest management approach, combining genetic, agronomic, chemical and biological control measures.

The growth of susceptible wheat varieties does not only increase the severity of FHB, but also the fungal biomass, with a consequent increase in the amount of toxins present in the harvested grain (Blandino et al., 2012; Snijders and Krechting, 1992; Tòth et al., 2008). The adoption of wheat cultivars showing resistance to primary infection and to the spread of the disease would be the ideal strategy. Unfortunately, there are no highly resistant wheat cultivars (Pereyra et al., 2004; Wisniewska and Kowalczyk, 2005). Nonetheless, extensive effort has been devoted to map the QTLs associated with FHB resistance in wheat (see, for example, Häberle et al., 2009; Schmolke et al., 2008). Genotypes bearing resistance to FHB have been reported and it is encouraging that resistance of a given genotype is not specific to a single Fusarium species, but can be extended to all the causative agents of this disease (Mesterhazy et al., 2005; Miedaner et al., 2012).

Being a typical seed‐borne pathogen, F. culmorum survives on or within the infected seed, which remains the main cause of pre‐ or post‐emergence seedling death, and contributes to increase the inoculum potential in the soil. Consequently, ploughing should be preferred to direct sowing or minimum tillage practices, which favour inoculum survival (Blandino et al., 2012; Dill‐Macky and Jones, 2000; Miller et al., 1998; Teich and Nelson, 1984). Similarly, crop rotation with noncereal host crop intermediates, such as legumes, alfalfa and Brassicaceae, may reduce the incidence of disease (Kurowski et al., 2011; Parry et al., 1995). The use of healthy seed coated with fungicides represents a most efficient means of control, but is usually limited to the early stages of the wheat cycle, as fungicides do not maintain their efficiency over a longer period. To improve the slow release of the delivered compound, a tebuconazole–β‐cyclodextrin inclusion complex has been proposed for the control of FRR during the early stages of durum wheat growth (Balmas et al., 2006).

Several fungicides, mainly belonging to the azole (bromuconazole, cyproconazole, metconazole, prochloraz, propiconazole, prothioconazole and tebuconazole) and strobin (azoxystrobin) classes, have been shown to control the disease by up to 70% in the field and to reduce the amount of mycotoxins in kernels; this is particularly evident under low disease pressure or on wheat genotypes possessing moderate resistance (Chala et al., 2003; Jones, 2000; Menniti et al., 2003; Paul et al., 2008). However, an increase in mycotoxin content in the kernel can occur when fungicides are applied at sublethal concentration or if they differ in their activity against distinct Fusarium pathogens (Covarelli et al., 2004; Gardiner et al., 2009; Gareis and Ceynowa, 1994; Haidukowski et al., 2005; Hysek et al., 2005; Matthies and Buchenauer, 2000; Matthies et al., 1999; Ochiai et al., 2007; Simpson et al., 2001; Stack, 2000). Moreover, the prolonged use of molecules sharing the same mode of action may induce a selective pressure on the pathogenic fungal populations, enabling the selection of resistance traits. Resistance to trifloxystrobin (a complex III respiration inhibitor) and isopyrazam (a complex II respiration inhibitor) has been reported recently on two isolates within two different chemotypes (Pasquali et al., submitted). These results have been confirmed on a larger set of isolates collected in Luxembourg (M. Beyer, Centre de Recherche—Gabriel Lippmann, Belvaux, Luxembourg , personal communication), suggesting that, as in the case of F. graminearum, these resistance traits are of natural origin (Dubos et al., 2011, 2013).

An alternative approach to minimize the risk of resistance among fungal populations relies on the use of new molecules, based on the structure of natural and natural‐like inhibitors, able to counteract the pathogenic and mycotoxigenic potential of natural populations of Fusarium, rather than acting on their saprophytic phase, or capable of stimulating natural resistance responses by the host plant. Essential oils of plant origin and some natural monoterpenes, considered as ‘Generally Recognized As Safe’ (GRAS) chemicals (safe for food use), have both inhibitory effects against mycotoxin biosynthesis and fungicide activity (Dambolena et al., 2008; Ellouze et al., 2012; Yaguchi et al., 2009). In particular, extracts from malva, chamomile and citrus manifest fungistatic activity against F. culmorum (Ellouze et al., 2012; Magro et al., 2006).

A specific and powerful inhibitory activity has been demonstrated by phenolic and polyphenolic natural compounds (Bakan et al., 2003; Boutigny et al., 2010; Desjardins et al., 1988; Takahashi‐Ando et al., 2008). The most abundant phenols extracted from maize kernel pericarp and wheat bran are trans‐ferulic acid and the corresponding dehydrodimers (DFAs), namely dehydrodiferulates (Bily et al., 2003; Boutigny et al., 2008; Kim et al., 2006). Hydroxycinnamic acids are known to be major components of the primary cell wall of cereals (Bakan et al., 2003). These compounds are ester bound to the C5 hydroxyl of the arabinosyl side chain of cell wall arabinoxylan chains. The feruloyl residues, predominant species, can also be dimerized under an oxidative coupling mediated by POXs, form cross‐links or dehydrodimers of ferulic acid, and then lead to a reinforcement of the primary wall of the plant.

A phenolic fraction rich in these phenolic acids manifested a drastic reduction on in vitro DON and ADON biosynthesis by F. culmorum (Boutigny et al., 2010). Although the mechanism remains unclear, it is reasonable to hypothesize that these compounds, mainly DFAs, interfere with in vitro cell wall degradation by fungal hydrolases. The activity of fungal esterases, overexpressed during growth on host tissues, can release free forms of ferulic ester from cell wall tissues (Balcerzak et al., 2012; Jaroszuk‐Scisel et al., 2011). Once released, free ferulate may inhibit the ability of Fusarium to produce mycotoxins. One of the DFAs present in the phenolic acid mixture, 8,5′‐benzofuran dimer, shows the same inhibitory activity of ferulic acid against F. culmorum, although a synergism of the phenolic acid mixture may play a crucial role in the inhibition of mycotoxins (Boutigny et al., 2010).

The X‐ray crystal structure of trichodiene synthase, purified from F. sporotrichioides and complexed with Mg2+(three ions)‐inorganic pyrophosphate (PPi), provides critical details regarding the molecular recognition of PPi, giving further insights into the trichothecene pathway, and therefore on the possibility of using external ligands able to interfere with mycotoxin production (Rynkiewicz et al., 2001; Vedula et al., 2008). The combination of bioprospecting and computational studies offers a useful way to select and investigate new natural and natural‐like mycotoxin inhibitors and fungicides against Fusarium. A collection of natural and natural‐like phenols and dimers was recently correlated with their ability to inhibit in vitro 3‐ADON and DON in F. culmorum and to interact with the trichodiene synthase crystal structure (G. Delogu, Istituto CNR di Chimica Biomolecolare, Sassari, Italy, unpublished data).

The susceptibility of the model plant A. thaliana to both F. graminearum and F. culmorum infection (Urban et al., 2002) has opened up new possibilities of developing high‐throughput experimental approaches to select new protecting compounds. Working with F. graminearum, Schreiber et al. (2011) identified small molecules, such as sulphamethoxazole and the indole alkaloid gramine, that protect Arabidopsis seedlings from infection. The same chemicals reduced significantly the severity of F. graminearum infection in wheat (Schreiber et al., 2011).

The integration of biological control approaches may offer an effective support to F. culmorum management on wheat and other cereals. The flag leaf and ripening ear surfaces of wheat are colonized by a panoply of micro‐organisms whose numbers may vary with plant growth stage and environmental conditions (Magan and Lacey, 1986). The application of natural antagonists to the crop residues or directly onto plant organs by spray or by seed dressing achieved reduced severity of FRR or FHB by F. culmorum on wheat, and the contamination of grain with mycotoxins (Table 4).

Table 4.

Biological control agents developed to control Fusarium culmorum infection on wheat

Antagonist Target disease Application method Reference
Chaetomium sp.
Idriella bolleyi
Gliocladium roseum
FRR Seed coating (field) Knudsen et al. (1995)
Alternaria alternata
Botrytis cinerea
Cladosporium herbarum
FHB Spray at ear emergence complete or anthesis complete (glasshouse) Liggitt et al. (1997)
Trichoderma harzianum FRR Seed coating (field) Michalikova and Michrina (1997)
Trichoderma harzianum
Trichoderma atroviride
Trichoderma longibrachiatum
Gliocladium roseum
Penicillium frequentans
FRR, FHB Seed coating (field) Roberti et al. (2000)
Gliocladium roseum
(Clonostachys rosea)
FRR
FRR
Seed coating (field)
Seed coating (in vitro)
Jensen et al. (2000); Roberti et al. (2008)
Phoma betae FHB Spray at early anthesis (glasshouse) Diamond and Cooke (2003)
Pseudomonas fluorescens
Pantoea agglomerans
FRR Seed coating (glasshouse and field) Johansson et al. (2003)
Fusarium equiseti FHB Spray at anthesis (field) Dawson et al. (2004)
Bacillus mycoides FRR Seed coating (microplot) Czaban et al. (2004)
Different filamentous fungi and yeasts FRR, FHB Wheat straw (in vitro) Luongo et al. (2005)
Pseudomonas fluorescens
Pseudomonas frederiksbergensis
FHB Spray at mid‐anthesis (glasshouse and field) Khan and Doohan (2009); Petti et al. (2008)
Streptomyces sp. FRR Seed coating (glasshouse) Orakci et al. (2010)
Bacillus subtilis FRR Seed coating (glasshouse) Khezri et al. (2011)
Trichoderma gamsii FRR, FHB Wheat haulms and rice kernels (in vitro) Matarese et al. (2012)

Functional Genomics

The F. culmorum genome is largely unknown. On analysis of the National Center for Biotechnology Information (NCBI) database for proteins associated with F. culmorum, 189 hits were returned on 15 November 2012. Annotated proteins include elongation factor 1α, a putative reductase, the RNA polymerase II, a phosphate permease, a putative regulatory protein used for phylogenetic analysis (Ward et al., 2002) and genes of the TRI cluster, involved in the synthesis of trichothecenes, also used for phylogenetic studies. Other F. culmorum annotated proteins include an ABC transporter (Skov et al., 2004), the trichodiene synthase used for RNA silencing experiments (Scherm et al., 2011), three putative allergenic proteins (Hoff et al., 2003), hydrophobin precursors involved in gushing (Stübner et al., 2010) and further proteins involved in the foam effect in beers (Zapf et al., 2007), and a fragment of a polyketide synthase essential in zearalenone biosynthesis (Atoui et al., 2012). Other genes have also been cloned in F. culmorum whilst studying the production of secondary metabolites, such as the nonribosomal peptide synthetase NPS2 able to synthesize ferricrocin (Tobiasen et al., 2007). Proteinases have also been isolated from F. culmorum (Levleva et al., 2006).

Functional characterization of the genes involved in the pathogenic process in F. culmorum is even more limited. Genetic transformation of the fungus is well established (Doohan et al., 1998), but the lack of a full genome has limited the functional analysis of genes to a few examples. Scherm et al. (2011) demonstrated that RNAi silencing as a functional approach is working in F. culmorum. Silencing of the zinc finger transcription factor TRI6, using inverted repeat transgenes, led to significantly decreased expression rates of the trichodiene synthase encoding gene TRI5 and, consequently, to a decline in DON production. Hence, trichothecene production of F. culmorum is tightly related to its aggressiveness and virulence in determining the symptoms of FRR on wheat (Scherm et al., 2011).

A second gene shown to play a role in pathogenesis is an ABC transporter, FcABC1, supposed to confer resistance to defensive compounds produced by the plant during the head infection process in wheat (Skov et al., 2004). The FcABC1 deletion mutant was unaltered in its physiology, but showed up to 98% reduced aggressiveness compared with the wild‐type strain, suggesting that the ability to excrete secondary plant metabolites allows F. culmorum to overcome the inhibition of host tissue invasion (Skov et al., 2004).

An F. culmorum topoisomerase I gene (top1) was found by a random plasmid insertional mutagenesis approach in F. graminearum and deleted in F. culmorum (Baldwin et al., 2010). The deletion mutant showed a complete block of conidia production as a result of its inability to regulate the transcriptional changes required for perithecial development. Furthermore, the mutant showed a significantly reduced virulence in wheat ear infection with low ability to colonize tissues after penetration (Baldwin et al., 2010).

The role of the gene FcStuA, a stuA orthologue protein with an APSES domain sharing 98.5% homology to the FgStuA transcription factor (FGSG10129) of F. graminearum (Lysøe et al., 2011), was recently determined by the functional characterization of deletion mutants. FcStuA was found to completely control pathogenicity and to reduce significantly (but not by blocking as in F. graminearum) DON production in F. culmorum mutants, together with a strong impairment of conidiation and significant morphological changes (M. Pasquali, Centre de Recherche—Gabriel Lippmann, Belvaux, Luxembourg, personal communication).

Given the very limited number of genes described to be involved in the pathogenic process in F. culmorum, further instruments and approaches are needed to explore the pathogenic arsenal of the fungus. A forward genetic tool based on a transposon insertion screening in the genome of F. culmorum (Spanu et al., 2012) did not lead to the identification of FRR PR genes, but allowed the isolation of partial sequences of aurofusarin genes and other genes involved in oxidative stress resistance, and the partial mapping of this unknown genome by the generation of more than 50 000 bp of F. culmorum sequence.

The availability of genomes would facilitate targeted functional genomics studies that, at the moment, are based on the similarities of genes with F. graminearum (Baldwin et al., 2010), but this cannot explore genes that are peculiar to F. culmorum (Spanu et al., 2012).

It is quite opportune that two F. culmorum genome sequencing programmes are on their way to being released. The first involves F. culmorum isolate FcUK99 (NRRL 54111; FGSC 10436), recovered from an infected wheat ear in the UK in 1998 (Baldwin et al., 2010). This isolate is fully pathogenic on wheat ears, tomato fruits and Arabidopsis floral tissue, and produces DON and 3‐ADON. By 454 sequencing, a 13.4× coverage of the F. culmorum isolate FcUK99 genome has been generated. In addition, four normalized cDNA libraries have been Illumina sequenced to give a transcriptome coverage of 100× (6 Gb of data). The F. culmorum genome size is estimated to be 39 Mbp, i.e. slightly larger than F. graminearum. In addition, the draft genomes of a further three F. culmorum isolates with different biological properties have been generated by sequencing with Illumina technology using 100‐bp pair‐end reads (M. Urban, J. Antoniw, N. Hall and K. E. Hammond‐Kosack, Wheat Pathogenomics, Plant Biology and Crop Sciences Department, Rothamsted Research, Harpenden, Herts, UK, personal communication).

As part of a larger programme of sequencing of the genomes of cereal Fusarium pathogens causing crown rot disease using Illumina paired‐end sequencing (see Gardiner et al., 2012), Donald Gardiner and John Manners at the Commonwealth Scientific and Industrial Research Organization (CSIRO, Clayton, Vic., Australia), together with Bioplatforms Australia (Sydney, NSW, Australia), have obtained sequence information for another isolate of F. culmorum, obtained from infected crown tissue of a wheat plant grown in Western Australia. Genome coverage will be >30‐fold and sequence information will be made publicly available early in 2013 on an Australian‐based website, and ultimately published on the NCBI site (J. M. Manners, CSIRO, Clayton, Vic., Australia, personal communication).

Future Challenges

Although it is not yet regarded as a ‘model system’, the F. culmorum–wheat interaction presents several features allowing it to be considered as a tractable model for investigation. Sequencing data permit a comparison of F. culmorum with other species whose genome information has already been released. One of the future challenges of genomics research will be to identify the peculiarities of this species involved in environmental adaptation and toxigenic and pathogenic potential compared with the closely related Fusarium spp. Many fundamental questions remain open. Has F. culmorum indeed lost its sexual cycle? What favours the shift in the F. culmorum/F. graminearum ratio in cereals? What is the role of nonpathogenic populations of F. culmorum in conferring adaptation to their host plants and how do saprophytic strains differ from pathogenic strains? Knowledge on the F. culmorum chemotype distribution worldwide may help us to better understand how chemotypes can be favoured by certain agroclimatological conditions. Given the general lack of information on the chemotype from the Southern Hemisphere and from worldwide populations of F. culmorum, it would be worth studying the chemotype distribution in relation to the host and to the disease phases (i.e. FHB or FRR), and comparing this with isolates obtained from undisturbed soils, in order to decipher the role of the chemotype in the presence versus absence of agricultural selection environments.

Finally, the identification of new natural and natural‐like molecules inhibiting trichothecene biosynthesis by F. culmorum, without affecting its vegetative growth, presents a vast array of practical applications. The bioavailability of inhibiting molecules and the evidence that exposure in vitro to different concentrations may result in opposite effects (i.e. inhibition versus enhancement of trichothecene production; G. Delogu, unpublished data) may prompt the development of new ecofriendly formulations to reduce the risk of these compounds being strongly affected by environmental conditions when applied in the field.

Acknowledgements

The authors acknowledge support by the Regione Autonoma della Sardegna (Legge Regionale 7 agosto 2007, n. 7 ‘Promozione della ricerca scientifica e dell'innovazione tecnologica in Sardegna’), the Ministry of University and Research (PRIN 2007 and 2011) and the Qatar National Research Fund (a member of the Qatar Foundation; National Priorities Research Program Grant # 4‐259‐2‐083). MP acknowledges the AM2c program of the National Research Fund of Luxembourg. The authors wish to thank Renato D'Ovidio, Corby Kistler, Naresh Magan and anonymous referees for critical review of the manuscript, and Kim Hammond Kosack and John Manners for sharing unpublished data on genome sequencing initiatives. The statements made herein are solely the responsibility of the authors.

References

  1. Alabouvette, C. , Olivain, C. , Migheli, Q. and Steinberg, C. (2009) Microbiological control of soil‐borne phytopathogenic fungi with special emphasis on wilt‐inducing Fusarium oxysporum . New Phytol. 184, 529–544. [DOI] [PubMed] [Google Scholar]
  2. Aldred, D. and Magan, N. (2004) Prevention strategies for trichothecenes. Toxicol. Lett. 153, 165–171. [DOI] [PubMed] [Google Scholar]
  3. Aleandri, M.P. , Magro, P. and Chilosi, G. (2007) Modulation of host pH during the wheat–Fusarium culmorum interaction and its influence on the production and activity of pectolytic enzymes. Plant Pathol. 56, 517–525. [Google Scholar]
  4. Aleandri, M.P. , Magro, P. and Chilosi, G. (2008) Influence of environmental pH modulation on efficiency of apoplastic PR proteins during Fusarium culmorum–wheat seedling interaction. Plant Pathol. 57, 1017–1025. [Google Scholar]
  5. Alexander, N.J. , McCormick, S.P. , van der Waalwijk, C., Lee, T. and Proctor, R.H. (2011) The genetic basis for 3‐ADON and 15‐ADON trichothecene chemotypes in Fusarium . Fungal Genet. Biol. 48, 485–495. [DOI] [PubMed] [Google Scholar]
  6. Alfonso, C. , Santamaria, F. , Nuero, O.M. , Prleto, A. , Leal, J.A. and Reyes, F. (1995) Biochemical studies on the cell wall degradation of Fusarium oxysporum f. sp. lycopersici race 2 by its own lytic enzymes for its biocontrol. Lett. Appl. Microbiol. 20, 105–109. [Google Scholar]
  7. Atoui, A. , El Khoury, A. , Kallassy, M. and Lebrihi, A. (2012) Quantification of Fusarium graminearum and Fusarium culmorum by real‐time PCR system and zearalenone assessment in maize. Int. J. Food Microbiol. 154, 59–65. [DOI] [PubMed] [Google Scholar]
  8. Audenaert, K. , van Broeck, R. , van Bekaert, B. , de Witte, F. , Heremans, B. , Messens, K. , Höfte, M. and Haesaert, G. (2009) Fusarium head blight (FHB) in Flanders: population diversity, inter‐species associations and DON contamination in commercial winter wheat varieties. Eur. J. Plant. Pathol. 125, 445–458. [Google Scholar]
  9. Bai, G.H. , Desjardins, A.E. and Plattner, R.D. (2002) Deoxynivalenol‐nonproducing Fusarium graminearum causes initial infection, but does not cause disease spread in wheat spikes. Mycopathologia 15, 91–98. [DOI] [PubMed] [Google Scholar]
  10. Bakan, B. , Pinson, L. , Cahagnier, B. , Melcion, D. , Sémon, E. and Richard‐Molard, D. (2001) Toxigenic potential of Fusarium culmorum strains isolated from French wheat. Food Addit. Contam. 18, 998–1003. [DOI] [PubMed] [Google Scholar]
  11. Bakan, B. , Giraud‐Delville, C. , Pinson, L. , Richard‐Molard, D. , Fournier, E. and Brygoo, Y. (2002) Identification by PCR of Fusarium culmorum strains producing large and small amounts of deoxynivalenol. Appl. Environ. Microbiol. 68, 5472–5479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Bakan, B. , Bily, A.C. , Melcion, D. , Cahagnier, B. , Regnault‐Roger, C. , Philogène, B.J.R. and Richard‐Molard, D. (2003) Possible role of plant phenolics in the production of trichothecenes by Fusarium graminearum strains on different fractions of maize kernels. J. Agric. Food Chem. 51, 2826–2831. [DOI] [PubMed] [Google Scholar]
  13. Balcerzak, M. , Harris, L.J. , Subramaniam, R. and Ouellet, T. (2012) The feruloyl esterase gene family of Fusarium graminearum is differentially regulated by aromatic compounds and hosts. Fungal Biol. 116, 478–488. [DOI] [PubMed] [Google Scholar]
  14. Baldwin, T.K. , Urban, M. , Brown, N. and Hammond‐Kosack, K.E. (2010) A role for topoisomerase I in Fusarium graminearum and F. culmorum pathogenesis and sporulation. Mol. Plant–Microbe Interact. 23, 566–577. [DOI] [PubMed] [Google Scholar]
  15. Balmas, V. , Delogu, G. , Esposito, S. , Rau, D. and Migheli, Q. (2006) Use of a complexation of tebuconazole with β‐cyclodextrin for controlling foot and crown rot of durum wheat incited by Fusarium culmorum . J. Agric. Food Chem. 54, 480–484. [DOI] [PubMed] [Google Scholar]
  16. Bateman, G.L. (1993) Development of disease symptom and fungal pathogen on shoot bases in continuous winter wheat. Plant Pathol. 42, 595–608. [Google Scholar]
  17. Bateman, G.L. (2005) The contribution of ground‐level inoculum of Fusarium culmorum to ear blight of winter wheat. Plant Pathol. 54, 299–307. [Google Scholar]
  18. Bateman, G.L. , Murray, G. , Gutteridge, R.J. and Coşkun, H. (1998) Effects of method of straw disposal and depth of cultivation on populations of Fusarium spp. in soil and on brown foot rot in continuous winter wheat. Ann. Appl. Biol. 132, 35–47. [Google Scholar]
  19. Baturo‐Ciesniewska, A. and Suchorzynska, M. (2011) Verification of the effectiveness of SCAR (Sequence Characterized Amplified Region) primers for the identification of Polish strains of Fusarium culmorum and their potential ability to produce B‐trichothecenes and zearalenone. Int. J. Food Microbiol. 148, 168–176. [DOI] [PubMed] [Google Scholar]
  20. Beccari, G. , Covarelli, L. and Nicholson, P. (2011) Infection processes and soft wheat response to root rot and crown rot caused by Fusarium culmorum . Plant Pathol. 60, 671–684. [Google Scholar]
  21. Bëlien, T. , Van Campenhout, S. , Robben, J. and Volckaert, G. (2006) Microbial endoxylanases: effective weapons to breach the plant cell‐wall barrier or, rather, triggers of plant defense systems? Mol. Plant–Microbe Interact. 19, 1072–1081. [DOI] [PubMed] [Google Scholar]
  22. Bertini, L. , Leonardi, L. , Caporale, C. , Tucci, M. , Cascone, N. , Di Berardino, I. , Buonocore, V. and Caruso, C. (2003) Pathogen‐responsive wheat PR4 genes are induced by activators of systemic acquired resistance and wounding. Plant Sci. 164, 1067–1078. [Google Scholar]
  23. Bily, A.C. , Reid, L.M. , Taylor, J.H. , Johnston, D. , Malouin, C. , Burt, A.J. , Bakan, B. , Regnault‐Roger, C. , Pauls, K.P. , Arnason, J.T. and Philogène, B.J.R. (2003) Dehydrodimers of ferulic acid in maize grain pericarp and aleurone: resistance factors to Fusarium graminearum . Phytopathology 93, 712–719. [DOI] [PubMed] [Google Scholar]
  24. Blandino, M. , Haidukowski, M. , Pascale, M. , Plizzari, L. , Scudellari, D. and Reyneri, A. (2012) Integrated strategies for the control of Fusarium head blight and deoxynivalenol contamination in winter wheat. Field Crop. Res. 133, 139–149. [Google Scholar]
  25. Bollina, V. and Kushalappa, A.C. (2011) Identification of metabolites related to mechanisms of resistance in barley against Fusarium graminearum, based on mass spectrometry. Plant Mol. Biol. 77, 355–370. [DOI] [PubMed] [Google Scholar]
  26. Boutigny, A.L. , Richard‐Forget, F. and Barreau, C. (2008) Natural mechanisms for cereals resistance to the accumulation of Fusarium trichothecenes. Eur. J. Plant Pathol. 121, 411–423. [Google Scholar]
  27. Boutigny, A.L. , Atanasova‐Pénichon, V. , Benet, M. , Barreau, C. and Richard‐Forget, F. (2010) Natural phenolic acids from wheat bran inhibit Fusarium culmorum trichothecene biosynthesis in vitro by repressing Tri gene expression. Eur. J. Plant Pathol. 127, 275–286. [Google Scholar]
  28. Brandfass, C. and Karlovsky, P. (2006) Simultaneous detection of Fusarium culmorum and F. graminearum in plant material by duplex PCR with melting curve analysis. BMC Microbiol. 6, 4. doi: 10.1186/1471-2180-6-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Burgess, L.W. , Backhouse, D. , Summerell, B.A. and Swan, L.J. (2001) Crown rot of wheat In: Fusarium: Paul E. Nelson Memorial Symposium (Summerell B.A., Leslie J.F., Backhouse D., Bryden W.L. and Burgess L.W., eds), pp. 271–294. St. Paul, MN: APS Press. [Google Scholar]
  30. Bushnell, W.R. , Hazen, B.E. and Pritsch, C. (2003) Histology and physiology of Fusarium Head Blight In: Fusarium Head Blight of Wheat and Barley (Kurt J.L. and Bushnell W.R., eds), pp. 44–83. St. Paul, MN: APS Press. [Google Scholar]
  31. Cariddi, C. and Catalano, M. (1990) Water stress and Fusarium culmorum infections on durum wheat. Phytopathol. Mediterr. 29, 51–55. [Google Scholar]
  32. Carpita, N.C. (1996) Structure and biogenesis of the cell walls of grasses. Annu. Rev. Plant Physiol. Plant Mol. Biol. 47, 445–476. [DOI] [PubMed] [Google Scholar]
  33. Caruso, C. , Chilosi, G. , Caporale, C. , Leonardi, L. , Bertini, L. , Magro, P. and Buonocore, V. (1999) Induction of pathogenesis‐related proteins in germinating wheat seeds infected with Fusarium culmorum . Plant Sci. 140, 87–97. [Google Scholar]
  34. Çepni, E. , Tunalı, B. and Gürel, F. (2012) Genetic diversity and mating types of Fusarium culmorum and Fusarium graminearum originating from different agro‐ecological regions in Turkey. J. Basic Microbiol. doi: 10.1002/jobm.201200066. [DOI] [PubMed] [Google Scholar]
  35. Chala, A. , Weinert, J. and Wolf, G.A. (2003) An integrated approach to the evaluation of the efficacy of fungicides against Fusarium culmorum, the cause of head blight of wheat. J. Phytopathol. 151, 673–678. [Google Scholar]
  36. Chandler, E.A. , Simpson, D.R. , Thomsett, M.A. and Nicholson, P. (2003) Development of PCR assays to Tri7 and Tri13 trichothecene biosynthetic genes, and characterization of chemotypes of Fusarium graminearum, F. culmorum and F. cerealis . Physiol. Mol. Plant Pathol. 62, 355–367. [Google Scholar]
  37. Chekali, S. , Gargouri, S. , Paulitz, T. , Nicol, J.M. and Rezgui, M. (2010) Effects of Fusarium culmorum and water stress on durum wheat in Tunisia. Crop Prot. 30, 718–725. [Google Scholar]
  38. Chelkowski, J. , Gromadzka, K. , Stepien, L. , Lenc, L. , Kostecki, M. and Berthiller, F. (2012) Fusarium species, zearalenone and deoxynivalenol content in preharvest scabby wheat heads from Poland. World Mycotoxin J. 5, 133–141. [Google Scholar]
  39. Colhoun, J. , Taylor, G.S. and Tomlinson, T. (1968) Fusarium diseases of cereals: II. Infection of seedlings by F. culmorum and F. avenaceum in relation to environmental factors. Trans. Br. Mycol. Soc. 51, 397–404. [Google Scholar]
  40. Collins, T. , Gerday, C. and Feller, G. (2005) Xylanases, xylanase families and extremophilic xylanases. FEMS Microbiol. Rev. 29, 3–23. [DOI] [PubMed] [Google Scholar]
  41. Cook, R.J. (1980) Fusarium foot rot of wheat and its control in the Pacific Northwest. Plant Dis. 64, 1061–1066. [Google Scholar]
  42. Cooper, R.M. , Longman, D. , Campell, A. , Henry, M. and Lees, P.E. (1988) Enzymatic adaptation of cereal pathogens to monocotyledonous primary wall. Physiol. Mol. Plant Pathol. 32, 33–47. [Google Scholar]
  43. Corazza, L. , Balmas, V. , Santori, A. , Vitale, S. , Luongo, M. and Maccaroni, M. (2002) Head blight and foot rot of wheat in Italy. Petria 12, 25–36. [Google Scholar]
  44. Covarelli, L. , Turner, A.S. and Nicholson, P. (2004) Repression of deoxynivalenol accumulation and expression of Tri genes in Fusarium culmorum by fungicides in vitro . Plant Pathol. 53, 22–28. [Google Scholar]
  45. Covarelli, L. , Beccari, G. , Steed, A. and Nicholson, P. (2012) Colonization of soft wheat following infection on the stem base by Fusarium culmorum and trans location of deoxynivalenol to the head. Plant Pathol. 61, 1121–1129. [Google Scholar]
  46. Czaban, J. , Ksiezniak, A. and Perzynski, A. (2004) An attempt to protect winter wheat against Fusarium culmorum by the use of rhizobacteria Pseudomonas fluorescens and Bacillus mycoides . Pol. J. Microbiol. 53, 175–182. [PubMed] [Google Scholar]
  47. Dambolena, J.S. , López, A.G. , Cánepa, M.C. , Theumer, M.G. , Zygadlo, J.A. and Rubinstein, H.R. (2008) Inhibitory effect of cyclic terpenes (limonene, menthol, menthone and thymol) on Fusarium verticillioides MRC 826 growth and fumonisin B1 biosynthesis. Toxicon 51, 37–44. [DOI] [PubMed] [Google Scholar]
  48. Davis, R.A. , Huggins, D.R. , Cook, J.R. and Paulitz, T.C. (2009) Nitrogen and crop rotation effects on fusarium crown rot in no‐till spring wheat. Can. J. Plant Pathol. 31, 456–467. [Google Scholar]
  49. Dawson, W.A.J. , Jestoi, M. , Rizzo, A. , Nicholson, P. and Bateman, G.L. (2004) Field evaluation of fungal competitors of Fusarium culmorum and F. graminearum, causal agents of ear blight of winter wheat, for control of mycotoxin production in grain. Biocontrol Sci. Technol. 14, 783–799. [Google Scholar]
  50. Denschlag, C. , Vogel, R.F. and Niessen, L. (2012) Hyd5 gene‐based detection of the major gushing‐inducing Fusarium spp. in a loop‐mediated isothermal amplification (LAMP) assay. Int. J. Food Microbiol. 156, 189–196. [DOI] [PubMed] [Google Scholar]
  51. Desjardins, A.E. , Plattner, R.D. and Spencer, G.F. (1988) Inhibition of trichothecene toxin biosynthesis by naturally occurring shikimate aromatics. Phytochemistry 27, 767–771. [Google Scholar]
  52. Desjardins, A.E. , Proctor, R.H. , Bai, G. , McCormick, S.P. , Shaner, G. , Buechley, G. and Hohn, T.M. (1996) Reduced virulence of trichothecene‐nonproducing mutants of Gibberella zeae in wheat field tests. Mol. Plant–Microbe Interact. 9, 775–781. [Google Scholar]
  53. Desjardins, A.E. , Bai, G. , Plattner, R.D. and Proctor, R.H. (2000) Analysis of aberrant virulence of Gibberella zeae following transformation‐mediated complementation of a trichothecene‐deficient (Tri5) mutant. Microbiology 146, 2059–2068. [DOI] [PubMed] [Google Scholar]
  54. Desmond, O.J. , Manners, J.M. , Stephens, A.E. , MaClean, D.J. , Schenk, P.M. , Gardiner, D.M. , Munn, A.L. and Kazan, K. (2008) The Fusarium mycotoxin deoxynivalenol elicits hydrogen peroxide production, programmed cell death and defence responses in wheat. Mol. Plant Pathol. 9, 435–445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Diamond, H. and Cooke, B.M. (2003) Preliminary studies on biological control of Fusarium ear blight complex of wheat. Crop Prot. 22, 99–107. [Google Scholar]
  56. Dill‐Macky, R. and Jones, R.K. (2000) The effect of previous crop residues and tillage on Fusarium head blight of wheat. Plant Dis. 84, 71–76. [DOI] [PubMed] [Google Scholar]
  57. Di Matteo, A. , Federici, L. , Mattei, B. , Salvi, G. , Johnson, K.A. , Savino, C. , De Lorenzo, G. , Tsernoglou, D. and Cervone, F. (2003) The crystal structure of polygalacturonase‐inhibiting protein (PGIP), a leucine‐rich repeat protein involved in plant defense. Proc. Natl. Acad. Sci. USA 100, 10 124–10 128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Doohan, F.M. , Smith, P. , Parry, D.W. and Nicholson, P. (1998) Transformation of Fusarium culmorum with the beta‐D‐glucuronidase (GUS) reporter gene: a system for studying host–pathogen relationships and disease control. Physiol. Mol. Plant Pathol. 53, 253–268. [Google Scholar]
  59. Doohan, F.M. , Brennan, J. and Cooke, B.M. (2003) Influence of climatic factors on Fusarium pathogenic to cereals. Eur. J. Plant Pathol. 109, 755–768. [Google Scholar]
  60. Dubos, T. , Pasquali, M. , Pogoda, F. , Hoffmann, L. and Beyer, M. (2011) Evidence for natural resistance towards trifloxystrobin in Fusarium graminearum . Eur. J. Plant Pathol. 130, 239–248. [Google Scholar]
  61. Dubos, T. , Pogoda, F. , Ronellenfitsch, F.K. , Junk, J. , Hoffmann, L. and Beyer, M. (2012) Fractal dimension and shape parameters of asexual Fusarium spores from selected species: which species can be distinguished? J. Plant. Dis. Prot. 119, 8–14. [Google Scholar]
  62. Dubos, T. , Pasquali, M. , Pogoda, F. , Hoffmann, L. and Beyer, M. (2013) Differences between the succinate dehydrogenase sequences of isopyrazam sensitive Zymoseptoria tritici and insensitive Fusarium graminearum strains. Pestic. Biochem. Phys. doi: 10.1016/j.pestbp.2012.11.004. [DOI] [PubMed] [Google Scholar]
  63. Eifler, J. , Martinelli, E. , Santonico, M. , Capuano, R. , Schild, D. and Di Natale, C. (2011) Differential detection of potentially hazardous Fusarium species in wheat grains by an electronic nose. PLoS ONE 6, e21026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Ellouze, I. , Abderrabba, M. , Sabaou, N. , Mathieu, F. , Lebrihi, A. and Bouajila, J. (2012) Season's variation impact on Citrus aurantium leaves essential oil: chemical composition and biological activities. J. Food Sci. 77, 173–180. [DOI] [PubMed] [Google Scholar]
  65. Fakhfakh, M.M. , Yahyaoui, A. , Rezgui, S. , Elias, E.M. and Daaloul, A. (2011) Identification and pathogenicity assessment of Fusarium spp. sampled from durum wheat fields in Tunisia. Afr. J. Biotechnol. 10, 6529–6539. [Google Scholar]
  66. Ferrari, S. , Sella, L. , Janni, M. , De Lorenzo, G. , Favaron, F. and D'Ovidio, R. (2012) Transgenic expression of polygalacturonase‐inhibiting proteins in Arabidopsis and wheat increases resistance to the flower pathogen Fusarium graminearum . Plant Biol. 14, 31–38. [DOI] [PubMed] [Google Scholar]
  67. Fierens, E. , Rombouts, S. , Gebruers, K. , Goesaert, H. , Brijs, K. , Beaugrand, J. , Volckaert, G. , Van Campenhout, S. , Proost, P. , Courtin, C.M. and Delcour, J.A. (2007) TLXI, a novel type of xylanase inhibitor from wheat (Triticum aestivum) belonging to the thaumatin family. Biochem. J. 403, 583–591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Gang, G. , Miedaner, T. , Schuhmacher, U. , Schollenberger, M. and Geiger, H.H. (1998) Deoxynivalenol and nivalenol production by Fusarium culmorum isolates differing in aggressiveness toward winter rye. Phytopathology 88, 879–884. [DOI] [PubMed] [Google Scholar]
  69. Gardiner, D.M. , Kazan, K. and Manners, J.M. (2009) Nutrient profiling reveals potent inducers of trichothecene biosynthesis in Fusarium graminearum . Fungal Genet. Biol. 46, 604–613. [DOI] [PubMed] [Google Scholar]
  70. Gardiner, D.M. , McDonald, M.C. , Covarelli, L. , Solomon, P.S. , Rusu, A. , Marshall, M. , Kazan, K. , Chakraborty, S. , McDonald, B.A. and Manners, J.M. (2012) Comparative pathogenomics reveals horizontally acquired novel virulence genes in fungi infecting cereal hosts. PLoS Pathog 8, e1002952. doi: 10.1371/journal.ppat.1002952. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Gareis, M. and Ceynowa, J. (1994) Influence of the fungicide matador (tebuconazole triadimenol) on mycotoxin production by Fusarium culmorum . Z. Lebensm. Unters. Forsch. 198, 244–248. [DOI] [PubMed] [Google Scholar]
  72. Gargouri, S. , Bernier, L. , Hajlaoui, M.R. and Marrakchi, M. (2003) Genetic variability and population structure of the wheat foot rot fungus, Fusarium culmorum, in Tunisia. Eur. J. Plant Pathol. 109, 807–815. [Google Scholar]
  73. Giraud, F. , Pasquali, M. , El Jarroudi, M. , Vrancken, C. , Brochot, C. , Cocco, E. , Hoffmann, L. , Delfosse, P. and Bohn, T. (2010) Fusarium Head Blight and associated mycotoxin occurrence on winter wheat in Luxembourg in 2007/2008. Food Addit. Contam. Part A 27, 825–835. [DOI] [PubMed] [Google Scholar]
  74. Goesaert, H. , Gebruers, K. , Brijs, K. , Courtin, C.M. and Delcour, J.A. (2003) TAXI type endoxylanase inhibitors in different cereals. J. Agric. Food Chem. 51, 3770–3775. [DOI] [PubMed] [Google Scholar]
  75. Goswami, R.S. and Kistler, H.C. (2004) Heading for disaster: Fusarium graminearum on cereal crops. Mol. Plant Pathol. 5, 515–525. [DOI] [PubMed] [Google Scholar]
  76. Häberle, J. , Holzapfel, J. , Schweizer, G. and Hartl, L. (2009) A major QTL for resistance against Fusarium head blight in European winter wheat. Theor. Appl. Genet. 119, 325–332. [DOI] [PubMed] [Google Scholar]
  77. Haidukowski, M. , Pascale, M. , Perrone, G. , Pancaldi, D. , Campagna, C. and Visconti, A. (2005) Effect of fungicides on the development of Fusarium head blight, yield and deoxynivalenol accumulation in wheat inoculated under field conditions with Fusarium graminearum and Fusarium culmorum . J. Sci. Food Agric. 85, 191–198. [Google Scholar]
  78. Harris, L.J. , Desjardins, A.E. , Plattner, R.D. , Nicholson, P. , Butler, G. , Young, J.C. , Weston, G. , Proctor, R.H. and Hohn, T.M. (1999) Possible role of trichothecene mycotoxins in virulence of Fusarium graminearum on maize. Plant Dis. 83, 954–960. [DOI] [PubMed] [Google Scholar]
  79. Hatsch, D. , Phalip, V. , Petkovski, E. and Jeltsch, J.M. (2006) Fusarium graminearum on plant cell wall: no fewer than 30 xylanase genes transcribed. Biochem. Biophys. Res. Commun. 345, 959–966. [DOI] [PubMed] [Google Scholar]
  80. Hestbjerg, H. , Felding, G. and Elmholt, S. (2002) Fusarium culmorum infection of barley seedlings: correlation between aggressiveness and deoxynivalenol content. J. Phytopathol. 150, 308–312. [Google Scholar]
  81. Hoff, M. , Ballmer‐Weber, B.K. , Niggemann, B. , Cistero‐Bahima, A. , Miguel‐Moncin, M.S. , Conti, A. , Haustein, D. and Vieths, S. (2003) Molecular cloning and immunological characterisation of potential allergens from the mould Fusarium culmorum . Mol. Immunol. 39, 965–975. [DOI] [PubMed] [Google Scholar]
  82. Hogg, A.C. , Johnston, R.H. , Johnston, J.A. , Klouser, L. , Kephart, K.D. and Dyer, A.T. (2010) Monitoring Fusarium crown rot populations in spring wheat residues using quantitative real‐time polymerase chain reaction. Phytopathology 100, 49–57. [DOI] [PubMed] [Google Scholar]
  83. Homdork, S. , Fehrmann, H. and Beck, R. (2000) Influence of different storage conditions on the mycotoxin production and quality of Fusarium‐infected wheat grain. J. Phytopathol. 148, 7–15. [Google Scholar]
  84. Hope, R. , Aldred, D. and Magan, N. (2005) Comparison of environmental profiles for growth and deoxynivalenol production by Fusarium culmorum and F. graminearum on wheat grain. Lett. Appl. Microbiol. 40, 295–300. [DOI] [PubMed] [Google Scholar]
  85. Hysek, J. , Vanova, M. , Hajslova, J. , Brozova, J. , Sychrova, E. , Radova‐Sypecka, Z. , Sip, V. , Sykorova, S. , Chrpova, J. and Tvaruzek, L. (2005) Variation in the production of trichothecene mycotoxin deoxynivalenol (DON) in spring barley varieties after treatment with the fungicides azoxystrobin and tebuconazole. Plant Prot. Sci. 41, 58–62. [Google Scholar]
  86. Inglis, D.A. and Cook, R.J. (1986) Persistence of chlamydospores of Fusarium culmorum in wheat field soils of eastern Washington. Phytopathology 76, 1205–1208. [Google Scholar]
  87. Jansen, C. , von Wettstein, D. , Schafer, W. , Kogel, K.H. , Felk, A. and Maier, F.J. (2005) Infection patterns in barley and wheat spikes inoculated with wild‐type and trichodiene synthase gene disrupted Fusarium graminearum . Proc. Natl. Acad. Sci. USA 102, 16 892–16 897. [DOI] [PMC free article] [PubMed] [Google Scholar]
  88. Jaroszuk‐Scisel, J. and Kurek, E. (2012) Hydrolysis of fungal and plant cell walls by enzymatic complexes from cultures of Fusarium isolates with different aggressiveness to rye (Secale cereale). Arch. Microbiol. 194, 653–665. [DOI] [PubMed] [Google Scholar]
  89. Jaroszuk‐Scisel, J. , Kurek, E. , Winiarczyk, K. , Baturo, A. and Lukanowski, A. (2008) Colonization of root tissues and protection against Fusarium wilt of rye (Secale cereale) by nonpathogenic rhizosphere strains of Fusarium culmorum . Biol. Control 45, 297–307. [Google Scholar]
  90. Jaroszuk‐Scisel, J. , Kurek, E. , Slomka, A. , Janczarek, M. and Rodzik, B. (2011) Activities of cell wall degrading enzymes in autolyzing cultures of three Fusarium culmorum isolates: growth‐promoting, deleterious and pathogenic to rye (Secale cereale). Mycologia 103, 929–945. [DOI] [PubMed] [Google Scholar]
  91. Jenkinson, P. and Parry, D.W. (1994) Splash dispersal of conidia of Fusarium culmorum and Fusarium avenaceum . Mycol. Res. 98, 506–510. [Google Scholar]
  92. Jennings, P. , Coates, M.E. , Turner, J.A. , Chandler, E.A. and Nicholson, P. (2004) Determination of deoxynivalenol and nivalenol chemotypes of Fusarium culmorum isolates from England and Wales by PCR assay. Plant Pathol. 53, 182–190. [Google Scholar]
  93. Jensen, B. , Knudsen, I.M.B. and Jensen, D.F. (2000) Biological seed treatment of cereals with fresh and long‐term stored formulations of Clonostachys rosea: biocontrol efficacy against Fusarium culmorum . Eur. J. Plant Pathol. 106, 233–242. [Google Scholar]
  94. Johansson, P.M. , Johnsson, L. and Gerhardson, B. (2003) Suppression of wheat‐seedling diseases caused by Fusarium culmorum and Microdochium nivale using bacterial seed treatment. Plant Pathol. 52, 219–227. [Google Scholar]
  95. Jones, R.K. (2000) Assessments of Fusarium head blight of wheat and barley in response to fungicide treatment. Plant Dis. 84, 1021–1030. [DOI] [PubMed] [Google Scholar]
  96. Juge, N. , Payan, F. and Williamson, G. (2004) XIP‐I, a xylanase inhibitor protein from wheat: a novel protein function. Biochim. Biophys. Acta 1696, 203–211. [DOI] [PubMed] [Google Scholar]
  97. Jurado, M. , Vazquez, C. , Patino, B. and Gonzalez‐Jaen, M.T. (2005) PCR detection assays for the trichothecene‐producing species Fusarium graminearum, Fusarium culmorum, Fusarium poae, Fusarium equiseti and Fusarium sporotrichioides . Syst. Appl. Microbiol. 28, 562–568. [DOI] [PubMed] [Google Scholar]
  98. Kammoun, L.G. , Gargouri, S. , Barreau, C. , Richard‐Forget, F. and Hajlaoui, M.R. (2010) Trichothecene chemotypes of Fusarium culmorum infecting wheat in Tunisia. Int. J. Food Microbiol. 140, 84–89. [DOI] [PubMed] [Google Scholar]
  99. Kang, Z. and Buchenauer, H. (2000a) Ultrastructural and cytochemical studies on cellulose, xylan and pectin degradation in wheat spikes infected by Fusarium culmorum . J. Phytopathol. 148, 263–275. [Google Scholar]
  100. Kang, Z. and Buchenauer, H. (2000b) Ultrastructural and immunocytochemical investigation of pathogen development and host responses in resistant and susceptible wheat spikes infected by Fusarium culmorum . Physiol. Mol. Plant Pathol. 57, 255–268. [Google Scholar]
  101. Kang, Z. and Buchenauer, H. (2002) Studies on the infection process of Fusarium culmorum in wheat spikes: degradation of host cell wall components and localization of trichothecene toxins in infected tissue. Eur. J. Plant Pathol. 108, 653–660. [Google Scholar]
  102. Karlovsky, P. (2011) Biological detoxification of the mycotoxin deoxynivalenol and its use in genetically engineered crops and feed additives. Appl. Microbiol. Biotechnol. 91, 491–504. [DOI] [PMC free article] [PubMed] [Google Scholar]
  103. Kemptner, J. , Marchetti‐Deschmann, M. , Mach, R. , Druzhinina, I.S. , Kubicek, C.P. and Allmaier, G. (2009) Evaluation of matrix‐assisted laser desorption/ionization (MALDI) preparation techniques for surface characterization of intact Fusarium spores by MALDI linear time‐of‐flight mass spectrometry. Rapid Commun. Mass Spectrom. 23, 877–884. [DOI] [PubMed] [Google Scholar]
  104. Kerényi, Z. , Moretti, A. , Waalwijk, C. , Oláh, B. and Hornok, L. (2004) Mating type sequences in asexually reproducing Fusarium species. Appl. Environ. Microbiol. 70, 4419–4423. [DOI] [PMC free article] [PubMed] [Google Scholar]
  105. Khan, M.R. and Doohan, F.M. (2009) Bacterium‐mediated control of Fusarium head blight disease of wheat and barley and associated mycotoxin contamination of grain. Biol. Control 48, 42–47. [Google Scholar]
  106. Khezri, M. , Ahmadzadeh, M. , Jouzani, G.S. , Behboudi, K. , Ahangaran, A. , Mousivand, M. and Rahimian, H. (2011) Characterization of some biofilm‐forming Bacillus subtilis strains and evaluation of their biocontrol potential against Fusarium culmorum . J. Plant Pathol. 93, 373–382. [Google Scholar]
  107. Kim, K.H. , Tsao, R. , Yang, R. and Cui, S.W. (2006) Phenolic acid profiles and antioxidant activities of wheat bran extracts and the effect of hydrolysis conditions. Food Chem. 95, 466–473. [Google Scholar]
  108. Klix, M.B. , Beyer, B. and Verreet, J.‐A. (2008) Effects of cultivar, agronomic practices, geographic location, and meteorological conditions on the composition of selected Fusarium species on wheat heads. Can. J. Plant Pathol. 30, 46–57. [Google Scholar]
  109. Knudsen, I.M.B. , Hockenhull, J. and Jensen, D.F. (1995) Biocontrol of seedling diseases of barley and wheat caused by Fusarium culmorum and Bipolaris sorokiniana—effects of selected fungal antagonists on growth and yield components. Plant Pathol. 44, 467–477. [Google Scholar]
  110. Kosiak, B. , Skjerve, E. , Thrane, U. and Torp, M. (2003) The prevalence and distribution of Fusarium species in Norwegian cereals: a survey. Acta Agric. Scand. 53, 168–176. [Google Scholar]
  111. Kristensen, R. , Berdal, K.G. and Holst‐Jensen, A. (2007) Simultaneous detection and identification of trichothecene‐ and moniliformin‐producing Fusarium species based on multiplex SNP analysis. J. Appl. Microbiol. 102, 1071–1081. [DOI] [PubMed] [Google Scholar]
  112. Kulik, T. (2011) Development of TaqMan assays for 3ADON, 15ADON and NIV Fusarium genotypes based on Tri12 gene. Cereal Res. Commun. 39, 200–214. [Google Scholar]
  113. Kurowski, T.P. , Majchrzak, B. , Jankowski, K. and Jaz'win'ska, E. (2011) Influence of Brassicacea as a previous crop on intensity of winter wheat root and foot rot. Progr. Plant Protect. 51, 1319–1322. [Google Scholar]
  114. Lacey, J. , Bateman, G.L. and Mirocha, C.J. (1999) Effects of infection time and moisture on development of ear blight and deoxynivalenol production by Fusarium spp. in wheat. Ann. Appl. Biol. 134, 277–283. [Google Scholar]
  115. Lamour, R. and Marchant, R. (1977) The induction of conidiation in Fusarium culmorum grown in continuous culture. J. Gen. Microbiol. 99, 49–58. [Google Scholar]
  116. Langseth, W. , Ghebremeskel, M. , Kosiak, B. , Kolsaker, P. and Miller, D. (2001) Production of culmorin compounds and other secondary metabolites by Fusarium culmorum and F. graminearum strains isolated from Norwegian cereals. Mycopathologia 152, 23–34. [DOI] [PubMed] [Google Scholar]
  117. Lauren, D.R. , Sayer, S.T. and Di Menna, M.E. (1992) Trichothecene production by Fusarium species isolated from grain and pasture throughout New Zealand. Mycopathologia 120, 167–176. [Google Scholar]
  118. Leisova, L. , Kucera, L. , Chrpova, J. , Sykorova, S. , Sıp, V. and Ovesna, J. (2006) Quantification of Fusarium culmorum in wheat and barley tissues using real‐time PCR in comparison with DON content. J. Phytopathol. 154, 603–611. [Google Scholar]
  119. Lemmens, M. , Scholz, U. , Berthiller, F. , Dall'Asta, C. , Koutnik, A. , Schuhmacher, R. , Adam, G. , Buerstmayr, H. , Mesterhazy, A. , Krska, R. and Ruckenbauer, P. (2005) The ability to detoxify the mycotoxin deoxynivalenol colocalizes with a major quantitative trait locus for fusarium head blight resistance in wheat. Mol. Plant–Microbe Interact. 18, 1318–1324. [DOI] [PubMed] [Google Scholar]
  120. Levleva, E.V. , Revina, T.A. , Kudriavtseva, N.N. , Sof'in, A.V. and Valueva, T.A. (2006) Extracellular proteinases from the phytopathogenic fungus Fusarium culmorum . Prikl. Biokhim. Mikrobiol. 42, 338–344. [PubMed] [Google Scholar]
  121. Liggitt, J. , Jenkinson, P. and Parry, D.W. (1997) The role of saprophytic microflora in the development of Fusarium ear blight of winter wheat caused by Fusarium culmorum . Crop Prot. 16, 679–685. [Google Scholar]
  122. Llorens, A. , Mateo, R. , Hinojo, M.J. , Valle‐Algarra, F.M. and Jimenez, M. (2004) Influence of environmental factors on the biosynthesis of type B trichothecenes by isolates of Fusarium spp. from Spanish crops. Int. J. Food Microbiol. 94, 43–54. [DOI] [PubMed] [Google Scholar]
  123. Logrieco, A. , Mulè, G. , Moretti, A. and Bottalico, A. (2002) Toxigenic Fusarium species and mycotoxins associated with maize ear rot in Europe. Eur. J. Plant Pathol. 108, 597–609. [Google Scholar]
  124. Lori, G. , Salerno, M.I. , Wolcan, S. , Gimenez, J. and Basil, G. (1999) Fusarium species from a forest nursery soil in Western Patagonia and reduction of their population by soil solarization. J. Plant Dis. Prot. 106, 363–371. [Google Scholar]
  125. Lowe, R. , Jubault, M. , Canning, G. , Urban, M. and Hammond‐Kosack, K.E. (2012) The induction of mycotoxins by trichothecene producing Fusarium species. Methods Mol. Biol. 835, 439–455. [DOI] [PubMed] [Google Scholar]
  126. Lowe, R.G.T. , Allwood, J.W. , Galster, A.M. , Urban, M. , Daudi, A. , Canning, G. , Ward, J.L. , Beale, M.H. and Hammond‐Kosack, K.E. (2010) A combined 1H nuclear magnetic resonance and electrospray ionization‐mass spectrometry analysis to understand the basal metabolism of plant‐pathogen Fusarium spp . Mol. Plant–Microbe Interact. 23, 1605–1618. [DOI] [PubMed] [Google Scholar]
  127. Luongo, L. , Galli, M. , Corazza, L. , Meekes, E. , De Haas, L. , Van der Plas, C.L. and Kohl, J. (2005) Potential of fungal antagonists for biocontrol of Fusarium spp. in wheat and maize through competition in crop debris. Biocontrol Sci. 15, 229–242. [Google Scholar]
  128. Lysøe, E. , Klemsdal, S.S. , Bone, K.R. , Frandsen, R.J.N. , Johansen, T. , Thrane, U. and Giese, H. (2006) The PKS4 gene of Fusarium graminearum is essential for zearalenone production. Appl. Environ. Microbiol. 72, 3924–3932. [DOI] [PMC free article] [PubMed] [Google Scholar]
  129. Lysøe, E. , Seong, K.Y. and Kistler, H.C. (2011) The transcriptome of Fusarium graminearum during the infection of wheat. Mol. Plant–Microbe Interact. 24, 995–1000. [DOI] [PubMed] [Google Scholar]
  130. Magan, J. , Hope, R. and Aldred, D. (2006) Ecophysiology of Fusarium culmorum and mycotoxin production. Adv. Food Mycol. 571, 123–136. [DOI] [PubMed] [Google Scholar]
  131. Magan, N. (1988) Effects of water potential and temperature on spore germination and germ‐tube growth‐in vitro and on straw leaf sheaths. Trans. Br. Mycol. Soc. 90, 97–107. [Google Scholar]
  132. Magan, N. and Lacey, J. (1986) The phylloplane microflora of ripening wheat and effect of late fungicide applications. Ann. Appl. Biol. 109, 117–128. [Google Scholar]
  133. Magan, N. and Lynch, J.M. (1986) Water potential, growth and cellulolysis of fungi involved in decomposition of cereal residues. J. Gen. Microbiol. 132, 1181–1187. [Google Scholar]
  134. Magan, N. , Hope, R. , Cairns, V. and Aldred, D. (2003) Post‐harvest fungal ecology: impact of fungal growth and mycotoxin accumulation in stored grain. Eur. J. Plant Pathol. 109, 723–730. [Google Scholar]
  135. Magan, N. , Aldred, D. , Mylona, K. and Lambert, R.J.W. (2010) Limiting mycotoxins in stored wheat. Food Addit. Contam. Part A 27, 644–650. [DOI] [PubMed] [Google Scholar]
  136. Magro, A. , Carolino, M. , Bastos, M. and Mexia, A. (2006) Efficacy of plant extracts against stored products fungi. Rev. Iberoam. Micol. 23, 176–178. [DOI] [PubMed] [Google Scholar]
  137. Maier, F.J. , Miedaner, T. , Hadeler, B. , Felk, A. , Salomon, S. , Lemmens, M. , Kassner, H. and Schäfer, W. (2006) Involvement of trichothecenes in fusarioses of wheat, barley and maize evaluated by gene disruption of the trichodiene synthase (Tri5) gene in three field isolates of different chemotype and virulence. Mol. Plant Pathol. 7, 449–461. [DOI] [PubMed] [Google Scholar]
  138. Manka, M. , Visconti, A. , Chelkowski, J. and Bottalico, A. (1985) Pathogenicity of Fusarium isolates from wheat, rye and triticale towards seedlings and their ability to produce trichothecenes and zearalenone. Phytopathol. Z. 113, 24–29. [Google Scholar]
  139. Markell, S.G. and Francl, L.J. (2003) Fusarium head blight inoculum: species prevalence and Gibberella zeae spore type. Plant Dis. 87, 814–820. [DOI] [PubMed] [Google Scholar]
  140. Martinez, C. , Baccou, J.C. , Bresson, E. , Baissac, Y. , Daniel, J.F. , Jalloul, A. , Montillet, J.L. , Geiger, J.P. , Assigbetsé, K. and Nicole, M. (2000) Salicylic acid mediated by the oxidative burst is a key molecule in local and systemic responses of cotton challenged by an avirulent race of Xanthomonas campestris pv malvacearum . Plant Physiol. 122, 757–766. [DOI] [PMC free article] [PubMed] [Google Scholar]
  141. Matarese, F. , Sarrocco, S. , Gruber, S. , Seidl‐Seiboth, V. and Vannacci, G. (2012) Biocontrol of Fusarium head blight: interactions between Trichoderma and mycotoxigenic Fusarium . Microbiology 158, 98–106. [DOI] [PubMed] [Google Scholar]
  142. Matthies, A. and Buchenauer, H. (2000) Effect of tebuconazole (Folicur (R)) and prochloraz (Sportak (R)) treatments on Fusarium head scab development, yield and deoxynivalenol (DON) content in grains of wheat following artificial inoculation with Fusarium culmorum . J. Plant Dis. Prot. 107, 33–52. [Google Scholar]
  143. Matthies, A. , Walker, F. and Buchenauer, H. (1999) Interference of selected fungicides, plant growth retardants as well as piperonyl butoxide and 1‐aminobenzotriazole in trichothecene production of Fusarium graminearum (strain 4528) in vitro . J. Plant Dis. Prot. 106, 198–212. [Google Scholar]
  144. McCormick, S.P. (2003) The role of DON in pathogenicity In: Fusarium Head Blight of Wheat and Barley (Leonard K.J. and Bushnell W.R., eds), pp. 165–183. St. Paul, MN: APS Press. [Google Scholar]
  145. Mellon, J.E. , Zelaya, C.A. , Dowd, M.K. , Beltz, S.B. and Klich, M.A. (2012) Inhibitory effects of gossypol, gossypolone, and apogossypolone on a collection of economically important filamentous fungi. J. Agric. Food Chem. 60, 2740–2745. [DOI] [PubMed] [Google Scholar]
  146. Meng, K. , Wang, Y. , Yang, P. , Luo, H. , Bai, Y. , Shi, P. , Yuan, T. , Ma, R. and Yao, B. (2010) Rapid detection and quantification of zearalenone‐producing Fusarium species by targeting the zearalenone synthase gene PKS4 . Food Control 21, 207–211. [Google Scholar]
  147. Menniti, A.M. , Pancaldi, D. , Maccaferri, M. and Casalini, L. (2003) Effect of fungicides on Fusarium head blight and deoxynivalenol content in durum wheat grain. Eur. J. Plant Pathol. 109, 109–115. [Google Scholar]
  148. Mesterhazy, A. , Bartok, T. , Kaszonyi, G.C. , Varga, M. , Tòth, B. and Varga, J. (2005) Common resistance to different Fusarium spp. causing Fusarium head blight in wheat. Eur. J. Plant Pathol. 112, 267–281. [Google Scholar]
  149. Michalikova, A. and Michrina, J. (1997) Biological control of fusarium foot rot in wheat seedlings by Trichoderma harzianum . Biologia 52, 591–598. [Google Scholar]
  150. Miedaner, T. , Gang, G. , Schilling, A.G. and Geiger, H.H. (1997) Aggressiveness and mycotoxin production of populations of Fusarium culmorum and Fusarium graminearum in winter rye. Cereal Res. Commun. 25, 471–475. [Google Scholar]
  151. Miedaner, T. , Schilling, A.G. and Geiger, H.H. (2001) Molecular genetic diversity and variation for aggressiveness in populations of Fusarium graminearum and Fusarium culmorum sampled from wheat fields in different countries. J. Phytopathol. 149, 641–648. [Google Scholar]
  152. Miedaner, T. , Cumagun, C.J.R. and Chakraborty, S. (2008) Population genetics of three important head blight pathogens Fusarium graminearum, F. pseudograminearum and F. culmorum . J. Phytopathol. 156, 129–139. [Google Scholar]
  153. Miedaner, T. , Risser, P. , Paillard, S. , Schnurbusch, T. , Keller, B. , Hartl, L. , Holzapfel, J. , Korzun, V. , Ebmeyer, E. and Utz, H.F. (2012) Broad‐spectrum resistance loci for three quantitatively inherited diseases in two winter wheat populations. Mol. Breeding 29, 731–742. [Google Scholar]
  154. Miller, J.D. , Culley, J. , Fraser, K. , Hubbard, S. , Meloche, F. , Ouellet, T. , Seaman, L. , Seifert, K.A. , Turkington, K. and Voldeng, H. (1998) Effect of tillage practice on Fusarium head blight of wheat. Can. J. Plant Pathol. 20, 95–103. [Google Scholar]
  155. Minervini, F. , Fornelli, F. and Flynn, K.M. (2004) Toxicity and apoptosis induced by the mycotoxins nivalenol, deoxynivalenol and fumonisin B1 in a human erythroleukemia cell line. Toxicol. Vitro 18, 21–28. [DOI] [PubMed] [Google Scholar]
  156. Mishra, P.K. , Fox, R.T.V. and Culham, A. (2003) Inter‐simple sequence repeat and aggressiveness analyses revealed high genetic diversity, recombination and long‐range dispersal in Fusarium culmorum . Ann. Appl. Biol. 143, 291–301. [Google Scholar]
  157. Muthomi, J.W. , Schütze, A. , Dehne, H.W. , Mutitu, E.W. and Oerke, E.C. (2000) Characterization of Fusarium culmorum isolates by mycotoxin production and aggressiveness to winter wheat. J. Plant Dis. Prot. 107, 113–123. [DOI] [PubMed] [Google Scholar]
  158. Nicholson, P. , Jenkinson, P. , Rezanoor, H.N. and Parry, D.W. (1993) Restriction fragment length polymorphism analysis of variation in Fusarium species causing ear blight of cereals. Plant Pathol. 42, 905–914. [Google Scholar]
  159. Nicholson, P. , Simpson, D.R. , Weston, G. , Rezanoor, H.N. , Lees, A.K. , Parry, D. and Joyce, D. (1998) Detection and quantification of Fusarium culmorum and Fusarium graminearum in cereals using PCR assays. Physiol. Mol. Plant Pathol. 53, 17–37. [Google Scholar]
  160. Nicolaisen, M. , Suproniene, S. , Nielsen, L.K. , Lazzaro, I. , Spliid, N.H. and Justesen, A.F. (2009) Real‐time PCR for quantification of eleven individual Fusarium species in cereals. J. Microbiol. Methods 76, 234–240. [DOI] [PubMed] [Google Scholar]
  161. Nielsen, L.K. , Jensen, J.D. , Rodríguez, A. , Jørgensen, L.N. and Justesen, A.F. (2012) TRI12 based quantitative real‐time PCR assays reveal the distribution of trichothecene genotypes of F. graminearum and F. culmorum isolates in Danish small grain cereals. Int. J. Food Microbiol. 157, 384–392. [DOI] [PubMed] [Google Scholar]
  162. Niessen, L. and Vogel, R.F. (1998) Group specific PCR‐detection of potential trichothecene producing Fusarium species in pure cultures and cereal samples. Syst. Appl. Microbiol. 21, 618–631. [DOI] [PubMed] [Google Scholar]
  163. de Nijs, M. , Larsen, J. , Gams, W. , Rombouts, F.M. , Wernars, K. , Thrane, U. and Notermans, S.H.W. (1997) Variations in random polymorphic DNA patterns and secondary metabolite profiles within Fusarium species from cereals from various parts of the Netherlands. Food Microbiol. 14, 449–459. [Google Scholar]
  164. Obanor, F. , Erginbas‐Orakci, G. , Tunalı, B. , Nicol, J.M. and Chakraborty, S. (2010) Fusarium culmorum is a single phylogenetic species based on multilocus sequence analysis. Fungal Biol. 114, 753–765. [DOI] [PubMed] [Google Scholar]
  165. Ochiai, N. , Tokai, T. , Takahashi‐Ando, N. , Fujimura, M. and Kimura, M. (2007) Genetically engineered Fusarium as a tool to evaluate the effects of environmental factors on initiation of trichothecene biosynthesis. FEMS Microbiol. Lett. 275, 53–61. [DOI] [PubMed] [Google Scholar]
  166. Ojala, T. , Remes, S. , Haansuu, P. , Vuorela, H. , Hiltunen, R. , Haahtela, K. and Vuorela, P. (2000) Antimicrobial activity of same coumarin containing herbal plants growing in Finland. J. Ethnopharmacol. 73, 299–305. [DOI] [PubMed] [Google Scholar]
  167. Orakci, G.E. , Yamac, M. , Amoroso, M.J. and Cuozzo, S.A. (2010) Selection of antagonistic actinomycete isolates as biocontrol agents against root‐rot fungi. Fresenius' Environ. Bull. 19, 417–424. [Google Scholar]
  168. Pancaldi, D. , Tonti, S. , Prodi, A. , Salomoni, D. , Dal Prà, M. , Nipoti, P. , Alberti, I. and Pisi, A. (2010) Survey of the main causal agents of fusarium head blight of durum wheat around Bologna, northern Italy. Phytopathol. Mediterr. 49, 258–266. [Google Scholar]
  169. Papendick, R.I. and Cook, R.J. (1974) Plant water stress and development of Fusarium foot rot in wheat subjected to different cultural practices. Phytopathology 64, 358–363. [Google Scholar]
  170. Parry, D.W. (1990) The incidence of Fusarium spp. in stem bases of selected crops of winter wheat in the Midlands, UK. Plant Pathol. 39, 619–622. [Google Scholar]
  171. Parry, D.W. , Jenkinson, P. and McLeod, L. (1995) Fusarium ear blight (scab) in small grain cereals–a review. Plant Pathol. 44, 207–238. [Google Scholar]
  172. Pasquali, M. , Giraud, F. , Brochot, C. , Cocco, E. , Hoffmann, L. and Bohn, T. (2010) Genetic Fusarium chemotyping as a useful tool for predicting nivalenol contamination in winter wheat. Int. J. Food Microbiol. 137, 246–253. [DOI] [PubMed] [Google Scholar]
  173. Pasquali, M. , Beyer, M. , Bohn, T. and Hoffmann, L. (2011) Comparative analysis of genetic chemotyping methods for Fusarium: Tri13 polymorphism does not discriminate between 3‐ and 15‐acetylated deoxynivalenol chemotypes in Fusarium graminearum . J. Phytopathol. 159, 700–704. [Google Scholar]
  174. Paul, P.A. , Lipps, P.E. , Hershman, D.E. , McMullen, M.P. , Draper, M.A. and Madden, L.V. (2008) Efficacy of triazole‐based fungicides for Fusarium head‐blight and deoxynivalenol control in wheat: a multivariate meta‐analysis. Phytopathology 98, 999–1011. [DOI] [PubMed] [Google Scholar]
  175. Pekkarinen, A.I. and Jones, B.L. (2002) Trypsin‐like proteinase produced by Fusarium culmorum grown on grain proteins. J. Agric. Food Chem. 50, 3849–3855. [DOI] [PubMed] [Google Scholar]
  176. Pekkarinen, A.I. , Jones, B.L. and Niku‐Paavola, M.L. (2002) Purification and properties of an alkaline proteinase of Fusarium culmorum . Eur. J. Biochem. 269, 798–807. [DOI] [PubMed] [Google Scholar]
  177. Pereyra, S.A. , Dill‐Macky, R. and Sims, A.L. (2004) Survival and inoculum production of Gibberella zeae in wheat residue. Plant Dis. 88, 724–730. [DOI] [PubMed] [Google Scholar]
  178. Petti, C. , Mojibur, K. and Doohan, F. (2008) Investigating the mechanisms underpinning bacterium‐mediated control of FHB disease. Cereal Res. Commun. 36 (Suppl. B), 689–693. [Google Scholar]
  179. Pettitt, T.R. and Parry, D.W. (2001) Effect of temperature on Fusarium foot rot of wheat In: Fusarium: Paul E. Nelson Memorial Symposium (Summerell B.A., Leslie J.F., Backhouse D., Bryden W.L. and Burgess L.W., eds), pp. 145–160. St. Paul, MN: APS Press. [Google Scholar]
  180. Placinta, C.M. , D'Mello, J.P.F. and Macdonald, A.M.C. (1999) A review of worldwide contamination of cereal grains and animal feed with Fusarium mycotoxins. Anim. Feed Sci. Technol. 78, 21–37. [Google Scholar]
  181. Pohanka, A. , Levenfors, J. and Broberg, A. (2006) Antimicrobial dialkylresorcinols from Pseudomonas sp. Ki19 . J. Nat. Prod. 69, 654–657. [DOI] [PubMed] [Google Scholar]
  182. Ponts, N. , Pinson‐Gadais, L. , Verdal‐Bonnin, M.N. , Barreau, C. and Richard‐Forget, F. (2006) Accumulation of deoxynivalenol and its 15‐acetylated form is significantly modulated by oxidative stress in liquid cultures of Fusarium graminearum . FEMS Microbiol. Lett. 258, 102–107. [DOI] [PubMed] [Google Scholar]
  183. Ponts, N. , Pinson‐Gadais, L. , Barreau, C. , Richard‐Forget, F. and Ouellet, T. (2007) Exogenous H2O2 and catalase treatments interfere with Tri genes expression in liquid cultures of Fusarium graminearum . FEBS Lett. 581, 443–447. [DOI] [PubMed] [Google Scholar]
  184. Ponts, N. , Couedelo, L. , Pinson‐Gadais, L. , Verdal‐Bonnin, M.N. , Barreau, C. and Richard‐Forget, F. (2009) Fusarium response to oxidative stress by H2O2 is trichothecene chemotype‐dependent. FEBS Microbiol. Lett. 293, 255–262. [DOI] [PubMed] [Google Scholar]
  185. Prew, R.D. , Ashby, J.E. , Bacon, E.T.G. , Christian, D.G. , Gutteridge, R.J. , Jenkyn, J.F. , Powell, W. and Todd, A.D. (1995) Effects of incorporating or burning straw, and of different cultivation system, on winter wheat grown on two soil types, 1985–1991. J. Agric. Sci. 124, 173–194. [Google Scholar]
  186. Proctor, R.H. , Hohn, T.M. and McCormick, S.P. (1995) Reduced virulence of Gibberella zeae caused by disruption of a trichothecene toxin biosynthetic gene. Mol. Plant–Microbe Interact. 8, 593–601. [DOI] [PubMed] [Google Scholar]
  187. Proctor, R.H. , Desjardins, A.E. , McCormick, S.P. , Plattner, N.J. , Alexander, N.J. and Brown, D.W. (2002) Genetic analysis of the role of trichothecene and fumonisin mycotoxins in the virulence of Fusarium . Eur. J. Plant Pathol. 108, 691–698. [Google Scholar]
  188. Quarta, A. , Mita, G. , Haidukowski, M. , Santino, A. , Mulè, G. and Visconti, A. (2005) Assessment of trichothecene chemotypes of Fusarium culmorum occurring in Europe. Food Addit. Contam. 22, 309–315. [DOI] [PubMed] [Google Scholar]
  189. Quarta, A. , Mita, G. , Haidukowski, M. , Logrieco, A. , Mule, G. and Visconti, A. (2006) Multiplex PCR assay for the identification of nivalenol, 3‐ and 15‐acetyl‐deoxynivalenol chemotypes in Fusarium . FEMS Microbiol. Lett. 259, 7–13. [DOI] [PubMed] [Google Scholar]
  190. Raffaele, S. and Kamoun, S. (2012) Genome evolution in filamentous plant pathogens: why bigger can be better. Nat. Rev. Microbiol. 10, 417–430. [DOI] [PubMed] [Google Scholar]
  191. Roberti, R. , Flori, P. , Pisi, A. , Brunelli, A. and Cesari, A. (2000) Evaluation of biological seed treatment of wheat for the control of seed‐borne Fusarium culmorum . J. Plant Dis. Prot. 107, 484–493. [Google Scholar]
  192. Roberti, R. , Veronesi, A.R. , Cesari, A. , Cascone, A. , Di Berardino, I. , Bertini, L. and Caruso, C. (2008) Induction of PR proteins and resistance by the biocontrol agent Clonostachys rosea in wheat plants infected with Fusarium culmorum . Plant Sci. 175, 339–347. [Google Scholar]
  193. Rocchi, V. , Bellincampi, D. , Giardina, T. and D'Ovidio, R. (2012) Intron retention regulates the expression of pectin methyl esterase inhibitor (Pmei) genes during wheat growth and development. Plant Biol. 14, 365–373. [DOI] [PubMed] [Google Scholar]
  194. Rohweder, D. , Valenta, H. , Sondermann, S. , Schollenberger, M. , Drochner, W. , Pahlow, G. , Döll, S. and Dänicke, S. (2011) Effect of different storage conditions on the mycotoxin contamination of Fusarium culmorum‐infected and non‐infected wheat straw. Mycotox. Res. 27, 145–153. [DOI] [PubMed] [Google Scholar]
  195. Rossi, V. , Ravanetti, A. , Pattor, E. and Giosuè, S. (2001) Influence of temperature and humidity on the infection of wheat spikes by some fungi causing Fusarium head blight. J. Plant Pathol. 83, 189–198. [Google Scholar]
  196. Rossi, V. , Languasco, L. , Pattori, E. and Giosuè, S. (2002) Dynamics of airborne Fusarium macroconidia in wheat fields naturally affected by head blight. J. Plant Pathol. 84, 53–64. [Google Scholar]
  197. Rynkiewicz, M.J. , Cane, D.E. and Christianson, D.W. (2001) Structure of trichodiene synthase from Fusarium sporotrichioides provides mechanistic inferences on the terpene cyclization cascade. Proc. Natl. Acad. Sci. USA 98, 13 543–13 548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  198. Scauflaire, J. , Mahieu, O. , Louvieaux, J. , Foucart, G. , Renard, F. and Munaut, F. (2011) Biodiversity of Fusarium species in ears and stalks of maize plants in Belgium. Eur. J. Plant Pathol. 131, 59–66. [Google Scholar]
  199. Scherm, B. , Orrù, M. , Balmas, V. , Spanu, F. , Azara, E. , Delogu, G. , Hammond, T.M. , Keller, N.P. and Migheli, Q. (2011) Altered trichothecene biosynthesis in TRI6‐silenced transformants of Fusarium culmorum influences the severity of crown and foot rot on durum wheat seedlings. Mol. Plant Pathol. 12, 759–771. [DOI] [PMC free article] [PubMed] [Google Scholar]
  200. Schilling, A.G. , Möller, E.M. and Geiger, H.H. (1996) Polymerase chain reaction‐based assays for species‐specific detection of Fusarium culmorum, F. graminearum and F. avenaceum . Phytopathology 86, 515–522. [Google Scholar]
  201. Schmidt‐Heydt, M. , Parra, R. , Geisen, R. and Magan, N. (2011) Modelling the relationship between environmental factors, transcriptional genes and deoxynivalenol mycotoxin production by strains of two Fusarium species. J. R. Soc. Interface 8, 117–126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  202. Schmolke, M. , Zimmermann, G. , Schweizer, G. , Miedaner, T. , Korzun, V. , Ebmeyer, E. and Hartl, L. (2008) Molecular mapping of quantitative trait loci for field resistance to Fusarium head blight in a European winter wheat population. Plant Breeding 127, 459–464. [Google Scholar]
  203. Schreiber, K.J. , Nasmith, C.G. , Allard, G. , Singh, J. , Subramaniam, R. and Desveaux, D. (2011) Found in translation: high‐throughput chemical screening in Arabidopsis thaliana identifies small molecules that reduce Fusarium head blight disease in wheat. Mol. Plant–Microbe Interact. 24, 640–648. [DOI] [PubMed] [Google Scholar]
  204. Schwarz, P.B. , Jones, B.L. and Steffenson, B.J. (2002) Enzymes associated with Fusarium infection of barley. J. Am. Soc. Brew. Chem. 60, 130–134. [Google Scholar]
  205. Shin, S. , Torres‐Acosta, J.A. , Heinen, S.J. , McCormick, S. , Lemmens, M. , Paris, M.P.K. , Berthiller, F. , Adam, G. and Muehlbauer, G.J. (2012) Transgenic Arabidopsis thaliana expressing a barley UDP‐glucosyltransferase exhibit resistance to the mycotoxin deoxynivalenol. J. Exp. Bot. 63, 4731–4740. [DOI] [PMC free article] [PubMed] [Google Scholar]
  206. Simpson, D.R. , Weston, G.E. , Turner, J.A. , Jennings, P. and Nicholson, P. (2001) Differential control of head blight pathogens of wheat by fungicides and consequences for mycotoxin contamination of grain. Eur. J. Plant Pathol. 107, 421–431. [Google Scholar]
  207. Skov, J. , Lemmens, M. and Giese, H. (2004) Role of a Fusarium culmorum ABC transporter (FcABC1) during infection of wheat and barley. Physiol. Mol. Plant Pathol. 64, 245–254. [Google Scholar]
  208. Snijders, C.H.A. and Krechting, C.F. (1992) Inhibition of deoxynivalenol translocation and fungal colonization in Fusarium head blight resistant wheat. Can. J. Bot. 70, 1570–1576. [Google Scholar]
  209. Spanu, F. , Pasquali, M. , Scherm, B. , Balmas, V. , Marcello, A. , Ortu, G. , Dufresne, M. , Hoffmann, L. , Daboussi, M.J. and Migheli, Q. (2012) Transposition of the miniature inverted‐repeat transposable element mimp1 in the wheat pathogen Fusarium culmorum . Mol. Plant Pathol. 13, 1149–1155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  210. Stack, R.W. (2000) Return of an old problem: Fusarium head blight on small grains. Plant Health Prog. Available at https://www.apsnet.org/publications/apsnetfeatures/Pages/headblight.aspx [accessed on Dec 18, 2012]. [Google Scholar]
  211. Strange, R.N. , Mayer, J.R. and Smith, H. (1974) The isolation and identification of choline and betaine as the two major components in anthers and wheat stimulate Fusarium graminearum in vitro . Physiol. Plant Pathol. 1, 141–150. [Google Scholar]
  212. Strange, R.N. , Deramo, A. and Smith, H. (1978) Virulence enhancement of Fusarium graminearum by choline and betaine and of Botrytis cinerea by other constituents of wheat germ. Trans. Br. Mycol. Soc. 70, 201–207. [Google Scholar]
  213. Strausbaugh, C.A. and Maloy, O.C. (1986) Fusarium scab of irrigated wheat in Central Washington. Plant Dis. 70, 1104–1106. [Google Scholar]
  214. Strausbaugh, C.A. , Overturf, K. and Koehn, A.C. (2005) Pathogenicity and real‐time PCR detection of Fusarium spp. in wheat and barley roots. Can. J. Plant Pathol. Rev. Can. Phytopathol. 27, 430–438. [Google Scholar]
  215. Stübner, M. , Lutterschmid, G. , Vogel, R.F. and Niessen, L. (2010) Heterologous expression of the hydrophobin FcHyd5p from Fusarium culmorum in Pichia pastoris and evaluation of its surface activity and contribution to gushing of carbonated beverages. Int. J. Food Microbiol. 141, 110–115. [DOI] [PubMed] [Google Scholar]
  216. Sudakin, D.L. (2003) Trichothecenes in the environment: relevance to human health. Toxicol. Lett. 143, 97–107. [DOI] [PubMed] [Google Scholar]
  217. Sweeney, M.J. and Dobson, A.D.W. (1999) Molecular biology of mycotoxin biosynthesis. FEMS Microbiol. Lett. 175, 149–163. [DOI] [PubMed] [Google Scholar]
  218. Takahashi‐Ando, N. , Ochiai, N. , Tokai, T. , Ohsato, S. , Nishiuchi, T. , Yoshida, M. , Fujimura, M. and Kimura, M. (2008) A screening system for inhibitors of trichothecene biosynthesis: hydroxylation of trichodiene as target. Biotechnol. Lett. 30, 1055–1059. [DOI] [PubMed] [Google Scholar]
  219. Tanaka, T. , Hasegawa, A. , Yamamoto, S. , Lee, U.S. , Sugiura, Y. and Ueno, Y. (1988) Worldwide contamination of cereals by the Fusarium mycotoxins nivalenol, deoxynivalenol, and zearalenone. 1. Survey of 19 countries. J. Agric. Food Chem. 36, 979–983. [Google Scholar]
  220. Teich, A.H. and Nelson, K. (1984) Survey of Fusarium head blight and possible effects of cultural practices in wheat fields in Lambton Country in 1983. Can. Plant Dis. Surv. 6, 11–13. [Google Scholar]
  221. Terzi, V. , Morcia, C. , Faccioli, P. , Faccini, N. , Rossi, V. , Cigolini, M. , Corbellini, M. , Scudellari, D. and Delogu, G. (2007) Fusarium DNA traceability along the bread production chain. Int. J. Food Sci. Technol. 42, 1390–1396. [Google Scholar]
  222. Tobiasen, C. , Aahman, J. , Ravnholt, K.S. , Bjerrum, M.J. , Grell, M.N. and Giese, H. (2007) Nonribosomal peptide synthetase (NPS) genes in Fusarium graminearum, F. culmorum and F. pseudograminearium and identification of NPS2 as the producer of ferricrocin. Curr. Genet. 51, 43–58. [DOI] [PubMed] [Google Scholar]
  223. Tòth, B. , Mesterházy, A. , Nicholson, P. , Teren, J. and Varga, J. (2004) Mycotoxin production and molecular variability of European and American isolates of Fusarium culmorum . Eur. J. Plant Pathol. 110, 587–599. [Google Scholar]
  224. Tòth, B. , Kàszonyi, G. , Bartók, T. , Varga, J. and Mesterházy, A. (2008) Common resistance of wheat to members of the Fusarium graminearum species complex and F. culmorum . Plant Breeding 127, 1–8. [Google Scholar]
  225. Tottman, D.R. and Makepeace, R.J. (1979) An explanation of the decimal code for the growth stages of cereals, with illustrations. Ann. Appl. Biol. 93, 221–234. [Google Scholar]
  226. Treikale, O. , Priekule, I. , Javoisha, B. and Lazareva, L. (2010) Fusarium head blight: distribution in wheat in Latvia. Comm. Agric. Appl. Biol. Sci. 75, 627–634. [PubMed] [Google Scholar]
  227. Tunalı, B. , Nicol, J. , Erol, F.Y. and Altiparmak, G. (2006) Pathogenicity of Turkish crown and head scab isolates on stem bases on winter wheat under greenhouse conditions. Plant Pathol. J. 5, 143–149. [Google Scholar]
  228. Tunalı, B. , Obanor, F. , Erginbaş, G. , Westecott, R.A. , Nicol, J. and Chakraborty, S. (2012) Fitness of three Fusarium pathogens of wheat. FEMS Microbiol. Ecol. 81, 596–609. [DOI] [PubMed] [Google Scholar]
  229. Urban, M. , Daniels, S. , Mott, E. and Hammond‐Kosack, K. (2002) Arabidopsis is susceptible to the cereal ear blight fungal pathogens Fusarium graminearum and Fusarium culmorum . Plant J. 32, 961–973. [DOI] [PubMed] [Google Scholar]
  230. Van Asselt, E.D. , Azambuja, W. , Moretti, A. , Kastelein, P. , De Rijk, T.C. , Stratakou, I. and Van der Fels‐Klerx, H.J. (2012) A Dutch field survey on fungal infection and mycotoxin concentration in maize. Food Addit. Contam. Part A 29, 1556–1565. [DOI] [PubMed] [Google Scholar]
  231. Vedula, L.S. , Jiang, J. , Zakharian, T. , Cane, D.E. and Christianson, D.W. (2008) Structural and mechanistic analysis of trichodiene synthase using site‐directed mutagenesis: probing the catalytic function of tyrosine‐295 and the asparagine‐225/serine‐229/glutamate‐233‐Mg2+ B motif. Arch. Biochem. Biophys. 469, 184–194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  232. Visconti, A. and Pascale, M. (2010) An overview on Fusarium mycotoxin in the durum wheat pasta production chain. Cereal Chem. 87, 21–27. [Google Scholar]
  233. Volpi, C. , Janni, M. , Lionetti, V. , Bellincampi, D. , Favaron, F. and D'Ovidio, R. (2011) The ectopic expression of a pectin methyl esterase inhibitor increases pectin methyl esterification and limits fungal diseases in wheat. Mol. Plant–Microbe Interact. 24, 1012–1019. [DOI] [PubMed] [Google Scholar]
  234. Waalwijk, C. , de Kastelein, P., Vries, I. , van der Kerényi, Z., Lee, T. , Hesselink, T. , Köhl, J. and Kema, G. (2003) Major changes in Fusarium spp. in wheat in the Netherlands. Eur. J. Plant Pathol. 109, 743–754. [Google Scholar]
  235. Waalwijk, C. , van der Heide, R. , de Vries, I. , van der Lee, T. , Schoen, C. , Costrel‐de Corainville, G. , Häuser‐Hahn, I. , Kastelein, P. , Köhl, J. , Lonnet, P. , Demarquet, T. and Kema, G. (2004) Quantitative detection of Fusarium species in wheat using TaqMan. Eur. J. Plant Pathol. 110, 481–494. [Google Scholar]
  236. Wagacha, J.M. and Muthomi, J.W. (2007) Fusarium culmorum: infection process, mechanisms of mycotoxin production and their role in pathogenesis in wheat. Crop Prot. 26, 877–885. [Google Scholar]
  237. Wang, H. , Hwang, S.F. , Eudes, F. , Chang, K.F. , Howard, R.J. and Turnbull, G.D. (2006) Trichothecenes and aggressiveness of Fusarium graminearum causing seedling blight and root rot in cereals. Plant Pathol. 55, 224–230. [Google Scholar]
  238. Wang, J.H. , Li, H.P. , Qu, B. , Zhang, J.B. , Huang, T. , Chen, F.F. and Liao, Y.C. (2008) Development of a generic PCR detection of 3‐acetyldeoxynivalenol‐, 15‐acetyldeoxynivalenol‐ and nivalenol‐chemotypes of Fusarium graminearum clade. Int. J. Mol. Sci. 9, 2495–2504. [DOI] [PMC free article] [PubMed] [Google Scholar]
  239. Ward, T.J. , Bielawski, J.P. , Kistler, H.C. , Sullivan, E. and O'Donnell, K. (2002) Ancestral polymorphism and adaptive evolution in the trichothecene mycotoxin gene cluster of phytopathogenic Fusarium . Proc. Natl. Acad. Sci. USA 99, 9278–9283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  240. Ward, T.J. , Clear, R.M. , Rooney, A.P. , O'Donnell, K. , Gaba, D. , Patrick, S. , Starkey, D.E. , Gilbert, J. , Geiser, D.M. and Nowicki, T.W. (2008) An adaptive evolutionary shift in Fusarium head blight pathogen populations is driving the rapid spread of more toxigenic Fusarium graminearum in North America. Fungal Genet. Biol. 45, 473–484. [DOI] [PubMed] [Google Scholar]
  241. Wei, C.M. and McLaughlin, C.S. (1974) Structure–function relationship in the 12,13 epoxytrichothecenes. Novel inhibitors of protein synthesis. Biochem. Biophys. Res. Commun. 57, 838–844. [DOI] [PubMed] [Google Scholar]
  242. West, J.S. , Holdgate, S. , Townsend, J.A. , Edwards, S.G. , Jennings, P. and Fitt, B.D.L. (2012) Impacts of changing climate and agronomic factors on fusarium ear blight of wheat in the UK. Fungal Ecol. 5, 53–61. [Google Scholar]
  243. Wisniewska, H. and Kowalczyk, K. (2005) Resistance of cultivars and breeding lines of spring wheat to Fusarium culmorum and powdery mildew. J. Appl. Genet. 46, 35–40. [PubMed] [Google Scholar]
  244. Wu, H.S. , Raza, W. , Fan, J.Q. , Sun, Y.G. , Bao, W. and Shen, Q.R. (2008) Cinnamic acid inhibits growth but stimulates production of pathogenesis factors by in vitro cultures of Fusarium oxysporum f.sp. niveum . J. Agric. Food Chem. 56, 1316–1321. [DOI] [PubMed] [Google Scholar]
  245. Xu, X.M. , Parry, D.W. , Nicholson, P. , Thomsett, M.A. , Simpson, D. , Edwards, S.G. , Cooke, B.M. , Doohan, F.M. , Brennan, J.M. , Moretti, A. , Tocco, G. , Mulè, G. , Hornok, L. , Giczey, G. and Tatnell, J. (2005) Predominance and association of pathogenic fungi causing Fusarium ear blight in wheat in four European countries. Eur. J. Plant Pathol. 112, 143–154. [Google Scholar]
  246. Xu, X.M. , Parry, D.W. , Nicholson, P. , Thomsett, M.A. , Simpson, D. , Edwards, S.G. , Cooke, B.M. , Doohan, F.M. , Monaghan, S. , Moretti, A. , Tocco, G. , Mule, G. , Hornok, L. , Béki, E. , Tatnell, J. and Ritieni, A. (2008) Within‐field variability of Fusarium head blight pathogens and their associated mycotoxins. Eur. J. Plant Pathol. 120, 21–34. [Google Scholar]
  247. Yaguchi, A. , Yoshinari, T. , Tsuyuki, R. , Takahashi, H. , Nakajima, T. , Sugita‐Konishi, Y. , Nagasawa, H. and Sakuda, S. (2009) Isolation and identification of precocenes and piperitone from essential oils as specific inhibitors of trichothecene production by Fusarium graminearum . J. Agric. Food Chem. 57, 846–851. [DOI] [PubMed] [Google Scholar]
  248. Yang, G.H. , Jarvis, B.B. , Chung, Y.J. and Pestka, J.J. (2000) Apoptosis induction by the satratoxins and other trichothecene mycotoxins relationship to ERK, p8 MAPK, and SAPK/JNK activation. Toxicol. Appl. Pharmacol. 164, 149–160. [DOI] [PubMed] [Google Scholar]
  249. Yoder, W.T. and Christianson, L.M. (1998) Species‐specific primers resolve members of Fusarium section Fusarium. Taxonomic status of the edible ‘Quorn’ fungus reevaluated. Fungal Genet. Biol. 23, 68–80. [DOI] [PubMed] [Google Scholar]
  250. Yörük, E. and Albayrak, G. (2012) Chemotyping of Fusarium graminearum and F. culmorum isolates from Turkey by PCR assay. Mycopathologia 173, 53–61. [DOI] [PubMed] [Google Scholar]
  251. Yoshinari, T. , Yaguchi, A. , Takahashi‐Ando, N. , Kimura, M. , Takahashi, H. , Nakajima, T. , Sugita‐Konishi, Y. , Nagasawa, H. and Sakuda, S. (2008) Spiroethers of German chamomile inhibit production of a aflatoxin G1 and trichothecene mycotoxin by inhibiting cytochrome P450 monooxygenases involved in their biosynthesis. FEMS Microbiol. Lett. 284, 184–190. [DOI] [PubMed] [Google Scholar]
  252. Zapf, M.W. , Theisen, S. , Rohde, S. , Rabenstein, F. , Vogel, R.F. and Niessen, L. (2007) Characterization of AfpA, an alkaline foam protein from cultures of Fusarium culmorum and its identification in infected malt. J. Appl. Microbiol. 103, 36–52. [DOI] [PubMed] [Google Scholar]
  253. Zezza, F. , Pascale, M. , Mulè, G. and Visconti, A. (2006) Detection of Fusarium culmorum in wheat by a surface plasmon resonance‐based DNA sensor. J. Microbiol. Methods 66, 529–537. [DOI] [PubMed] [Google Scholar]
  254. Zhang, H. , van der Zhang, Z., Lee, T. , Chen, W.Q. , Xu, J. , Xu, J.S. , Yang, L. , Yu, D. , Waalwijk, C. and Feng, J. (2010) Population genetic analyses of Fusarium asiaticum populations from barley suggest a recent shift favoring 3ADON producers in southern China. Phytopathology 100, 328–336. [DOI] [PubMed] [Google Scholar]

Articles from Molecular Plant Pathology are provided here courtesy of Wiley

RESOURCES