Abstract
Background:
Malaria is one of the major communicable diseases in India and worldwide. PvMSP3β is a highly polymorphic gene due to its large insertions and deletions in the central alanine-rich region, which, in turn, makes it a valuable marker for population genetic analysis. Very few studies are available from India about the genetic diversity of Plasmodium vivax based on PvMSP3β gene, and hence, this study was designed to understand the molecular diversity of the P. vivax malaria parasite. The accumulating epidemiological data provide insights into the circulating genetic variants of P. vivax in India, and ultimately benefits the vaccine development.
Materials and Methods:
A total of 268 samples confirmed to be positive by microscopy, rapid diagnostic test, and quantitative buffy coat test were collected from four different regions of India (Puducherry, Mangaluru, Jodhpur, and Cuttack) in the present study. Polymerase chain reaction (PCR)-based diagnosis was carried out to confirm the P. vivax monoinfection, and only the mono-infected samples were subjected to PvMSP3β gene amplification and further restriction fragment length polymorphism (RFLP) to determine suballeles.
Results:
Based on the size of the amplified fragment, the PvMSP3β gene was apportioned into two major types, namely Type A genotype (1.6–2 Kb) was predominantly present in 148 isolates and Type B (1–1.5 Kb) was observed in 110 isolates. The percentage of mixed infections by PCR was 3.73%. All the PCR products were subjected to RFLP to categorize into suballeles and we detected 39 suballeles (A1–A39) in Type A, and 23 suballeles (B1–B23) in Type B genotype. A high degree of diversity was observed among the isolates collected from Mangaluru region when compared to isolates collected from other regions.
Conclusion:
The present study showed a high degree of genetic diversity of PvMSP3β gene among the isolates collected from various parts of India. High polymorphism in PvMSP3β gene makes it a promising marker for epidemiological and vaccine development studies.
Keywords: Genetic diversity, malaria, merozoite surface protein, merozoite surface protein-3β gene, Plasmodium vivax
INTRODUCTION
Malaria is one of the most important communicable diseases globally and also remains as a major public health burden in India.[1] More than 95% of the Indian population resides in the malaria-endemic regions.[2] According to the WHO Malaria Report 2018, approximately 219 million malaria cases were documented in the year 2017, with an estimated 435,000 deaths globally.[3] Among the human-infecting malaria parasite, Plasmodium vivax is the most widespread cause of malaria worldwide, infecting around 70–80 million individuals annually. More than 80% of deaths due to P. vivax infection outside the African countries, whereas India alone contributes to around 48% of P. vivax deaths worldwide.[3] P. vivax parasite is genetically more diverse than Plasmodium falciparum and its tendency to relapse makes it more difficult to devise control measures and to eliminate it on the whole.[4] In India, several reports of P. vivax have been associated with cerebral malaria in recent years.[5] Furthermore, the rising trend of chloroquine-resistant P. vivax strains is also a serious concern in this decade.[6,7,8]
An insight into the parasite population structure is, therefore, much needed for assessing the spread of drug resistance as well as to evaluate the vaccine performance in a particular parasite population.[9] It is also essential to understand the genetic structure of P. vivax to outline the transmission dynamics accurately.[10] Previous studies have focused mainly on the genetic structure of P. falciparum using polymorphic markers such as merozoite surface protein-1 (MSP1), MSP2, and glutamine-rich protein.[11,12,13] Similar approaches have been applied in P. vivax malaria parasite;[14] however, the knowledge is limited at the molecular level and thus poorly understood. The genetic diversity of P. vivax strains can be determined successfully with the help of polymorphic molecular markers in various epidemiological surveys, and help to perceive the distinct biological characteristics such as recrudescence, re-infection, and relapse patterns. Various polymorphic markers such as circumsporozoite surface protein, apical membrane antigen-1, Duffy-binding protein, MSPs, and microsatellites are being currently studied.[14] Because merozoites playing a vital role in the erythrocytic schizogony, and continuously exposed to antibody-mediated immune system makes them a valuable target for the vaccine development.[14] The merozoites are surrounded by a layer of integral and peripheral membrane proteins that constitutes an organized complex coat, which are collectively called as MSPs or MSPs, and encoded by various genes in P. vivax, such as PvMSP1, PvMSP3 β, PvMSP3β, PvMSP3 β, PvMSP4, PvMSP5, and PvMSP9.[15]
All the PvMSP3 protein family members have central alanine-rich core domain spanning 60%–70% of amino acid sequence that actively forms an α-helical secondary structure, and coiled tertiary structure.[15] PfMSP3 gene has been reported to show very limited sequence polymorphism when compared to PvMSP3β gene, which is highly polymorphic and known to be a valid genetic marker in population analysis.[16] Studies suggest that the high polymorphic nature of PvMSP3β may be due to intragenic recombinations.[16] Furthermore, the extensive polymorphism in PvMSP3β is due to large insertion/deletion mutations in the central alanine-rich domain, and hence, it is proved to be an efficient marker for population analysis.[15] Genotyping and allele detection in a particular isolate can be achieved with the help of molecular tools such as polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP). In this study, we have attempted to decipher the genetic variability of P. vivax isolates collected from various malaria prevalent regions of India using PvMSP3β polymorphic marker, which, in turn, have important implications for its function and utility in future vaccine development.
MATERIALS AND METHODS
Sample collection
The study was carried out after obtaining ethical clearance from the Institutional Human Ethics Committee, JIPMER, Puducherry. Venous blood samples were collected in ethylenediaminetetraacetic acid vacutainer from malaria-suspected patients from July 2015 to December 2017 with informed consent. Routine malaria investigation samples were collected from the four tertiary-care hospitals, such as, JIPMER in Puducherry, Kasturba Medical College in Mangaluru, AIIMS in Jodhpur, and SCB Medical College in Cuttack. The samples were collected from the four different regions of India, namely Puducherry (n = 105), Mangaluru (n = 104), Cuttack (n = 31), and Jodhpur (n = 28) during the study.
Laboratory diagnosis
Patients positive for malaria parasite, Plasmodium spp., were detected initially by rapid diagnostic tests (RDTs) (J Mitra and Co RDT/Flacivax RDT), followed by thin and thick blood smear examination using Giemsa stain. Furthermore, quantitative buffy coat (QBC) assay was performed for all the positive samples detected by RDT as well as microscopy. The samples were stored at −20°C until further molecular investigation by PCR.
DNA extraction and diagnostic polymerase chain reaction
Genomic DNA from the positive P. vivax blood samples were isolated using QIAamp DNA Blood Mini Kit (QIAGEN Inc., Germany), following the manufacture's instruction. DNA was eluted finally with 100 μl of elution buffer, and stored at −20°C till further use. The isolated DNA samples were tested for P. vivax mono-infection by targeting the 18S rRNA gene of malaria parasite as described previously.[17]
PvMSP3β gene amplification
A nested PCR approach was adopted for the amplification of PvMSP3β gene for all the mono-infected P. vivax samples using the previously published protocol with minor modifications.[16] The primers used for the primary PCR were F1 (5′ GGTATTCTTCGCAACACTC 3′) and R1 (5′ GCTTCTGATGTTATTTCCAG 3′), and the secondary PCR were F2 (5′ CGAGGGGCGAAATTGTAAACC 3′) and R2 (5′ GCTGCTTCTTTTGCAAAGG 3′), and 1 μl primary PCR product was used as the template for the secondary PCR. All the PCR reactions were carried out with a final reaction volume of 25 μl consisting of × 1 volume Ampliqon III Red Taq polymerase master mix (×2), 0.8 μM primers, and 3 μl template genomic DNA. The cycling conditions were as follows: 95°C for 1 min, 35 cycles of 95°C for 20 s, 55°C for 30 s, and 68°C for 2.5 min, and 72°C for 5 min. The PCR products were visualized in 1.5% agarose gel electrophoresis and documented using BioRad GelDoc XR documentation unit.
PvMSP3β digestion using restriction fragment length polymorphism
The genetic diversity of PvMSP3β marker was determined using the RFLP technique. Three microliters of PCR products were digested with 1 μl of PstI restriction enzyme (NEB, USA) in a 50 μl total reaction volume, as per the manufacturer's instruction. The restriction-digested fragments were analyzed using 2% agarose gel, and the patterns were documented using BioRad GelDoc XR unit.
RESULTS
Of the 279 samples included in the present study, 268 samples were positive for P. vivax monoinfection by various diagnostic approaches such as microscopy, RDT, QBC, and nested PCR, and eleven samples showed coinfection of P. vivax and P. falciparum parasite. All the eleven mixed infection samples were excluded for the genetic diversity study based on PvMSP3β gene amplification. The amplified products of PvMSP3β showed size polymorphism with two major genotypes, Type A and Type B [Figure 1]. Type A genotype with 1.6–2 Kb was predominant in 148 isolates, whereas Type B (1–1.5 Kb) was observed in 110 isolates. The presence of more than one genotype in the PvMSP3β amplicon was observed in 10 samples, of which, five were from Puducherry, four from Mangaluru, and one from Cuttack. Type B genotype was found to be occurring frequently (41%) in Puducherry, whereas Type A was more prevalent in Mangaluru, Cuttack, and Jodhpur. Type B has close similarity to the reference P. vivax belem strain, whereas Type A genotype have different insertions in the central alanine-rich region. The distribution of PvMSP3β genotypes from different regions of India is illustrated in Figure 2.
Figure 1.

Polymerase chain reaction amplification of PvMSP3β gene showing two major size polymorphisms. Lane M, 100–2000 bp DNA ladder; lane 1, 3 and 6, Type A genotype; lane 2, 4, Type B genotype; lane 5 and 7, mixed genotype of Type B
Figure 2.

Distribution of PvMSP3β subtypes among the different study regions
RFLP patterns of Type A and B digested products using PstI enzyme revealed different banding patterns that ranged from 150 to 2000 bp as shown in Figure 3. The difference in the RFLP patterns determines the presence of major alleles. Totally 62 individual alleles were identified, of which Type A showed 39 alleles (A1–A39) and Type B showed 23 alleles (B1–B23). Interestingly, 151 mixed infections were detected among the Type A and Type B genotypes based on the PCR-RFLP analysis of PvMSP3β. The percentage of mixed infections by PCR was only 3.73%. However, it increased to 53% by PCR-RFLP as summarized in Table 1. Mixed infection of a parasite was defined as when the sum of all RFLP banding patterns is more than the uncut PCR band size, which reveals that RFLP has the higher sensitivity than the PCR method for the identification of mixed infection.[16] The alleles B2, A8, A16, B1, A23, A7, and A35 were predominantly present with 38.09% among the present study isolates [Figure 4]. B2 allele was more predominant among the isolates from Puducherry (27.61%) as well as Mangaluru (11.53%). Furthermore, unique alleles were detected only in isolates from Puducherry (n = 4) and Mangaluru (n = 18) region.
Figure 3.

Restriction fragment length polymorphism patterns PvMSP3β gene polymerase chain reaction product digested with PstI showing ten alleles detected from all the four study centers in India. Lane M, 100–2000 bp DNA ladder; the details of genotypes observed were mentioned
Table 1.
Different alleles of MSP3β gene of Plasmodium vivax from four different regions of India
| PvMSP3β allele | Region | Total (n=268), n (%) | |||
|---|---|---|---|---|---|
| Puducherry (n=105) | Cuttack (n=31) | Jodhpur (n=28) | Mangaluru (n=104) | ||
| Type A, n (%) | 47 (44.76) | 20 (64.52) | 21 (75) | 59 (56.73) | 147 (54.85) |
| A1 | 1 | 0 | 0 | 0 | 1 (0.37) |
| A2 | 1 | 0 | 0 | 0 | 1 (0.37) |
| A3 | 1 | 0 | 0 | 0 | 1 (0.37) |
| A4 | 6 | 2 | 0 | 0 | 8 (2.99) |
| A5 | 2 | 0 | 1 | 1 | 4 (1.49) |
| A6 | 2 | 0 | 5 | 1 | 8 (2.99) |
| A7 | 4 | 0 | 1 | 4 | 9 (3.36) |
| A8 | 6 | 2 | 1 | 7 | 16 (5.97) |
| A9 | 1 | 3 | 0 | 3 | 7 (2.61) |
| A10 | 1 | 0 | 0 | 1 | 2 (0.75) |
| A11 | 2 | 0 | 0 | 5 | 7 (2.61) |
| A12 | 1 | 0 | 0 | 0 | 1 (0.37) |
| A13 | 2 | 0 | 1 | 0 | 3 (1.12) |
| A14 | 6 | 0 | 0 | 0 | 6 (2.24) |
| A15 | 3 | 0 | 0 | 0 | 3 (1.12) |
| A16 | 4 | 2 | 4 | 5 | 15 (5.60) |
| A17 | 0 | 3 | 2 | 1 | 6 (2.24) |
| A18 | 1 | 2 | 0 | 0 | 3 (1.12) |
| A19 | 1 | 0 | 0 | 0 | 1 (0.37) |
| A20 | 0 | 0 | 2 | 0 | 2 (0.75) |
| A21 | 0 | 0 | 1 | 0 | 1 (0.37) |
| A22 | 0 | 0 | 0 | 1 | 1 (0.37) |
| A23 | 0 | 0 | 1 | 9 | 10 (3.73) |
| A24 | 0 | 0 | 1 | 2 | 3 (1.12) |
| A25 | 2 | 0 | 0 | 2 | 4 (1.49) |
| A26 | 0 | 0 | 0 | 1 | 1 (0.37) |
| A27 | 0 | 0 | 0 | 1 | 1 (0.37) |
| A28 | 0 | 0 | 1 | 1 | 2 (0.75) |
| A29 | 0 | 0 | 0 | 1 | 1 (0.37) |
| A30 | 0 | 0 | 0 | 1 | 1 (0.37) |
| A31 | 0 | 0 | 0 | 1 | 1 (0.37) |
| A32 | 0 | 0 | 0 | 1 | 1 (0.37) |
| A33 | 0 | 0 | 0 | 2 | 2 (0.75) |
| A34 | 0 | 0 | 0 | 1 | 1 (0.37) |
| A35 | 0 | 4 | 0 | 4 | 8 (2.99) |
| A36 | 0 | 0 | 0 | 1 | 1 (0.37) |
| A37 | 0 | 0 | 0 | 1 | 1 (0.37) |
| A38 | 0 | 0 | 0 | 1 | 1 (0.37) |
| A39 | 0 | 2 | 0 | 0 | 2 (0.75) |
| Type B, n (%) | 54 (51.43) | 11 (35.48) | 5 (17.86) | 41 (39.42) | 111 (41.42) |
| B1 | 8 | 1 | 0 | 5 | 14 (5.22) |
| B2 | 29 | 3 | 0 | 12 | 44 (16.42) |
| B3 | 1 | 0 | 0 | 0 | 1 (0.37) |
| B4 | 1 | 0 | 1 | 1 | 3 (1.12) |
| B5 | 3 | 0 | 0 | 0 | 3 (1.12) |
| B6 | 1 | 0 | 0 | 0 | 1 (0.37) |
| B7 | 1 | 0 | 0 | 0 | 1 (0.37) |
| B8 | 1 | 1 | 0 | 5 | 7 (2.61) |
| B9 | 1 | 0 | 1 | 0 | 2 (0.75) |
| B10 | 1 | 0 | 0 | 0 | 1 (0.37) |
| B11 | 1 | 0 | 1 | 4 | 6 (2.24) |
| B12 | 3 | 2 | 0 | 1 | 6 (2.24) |
| B13 | 1 | 0 | 0 | 0 | 1 (0.37) |
| B14 | 1 | 4 | 0 | 0 | 5 (1.87) |
| B15 | 1 | 0 | 0 | 0 | 1 (0.37) |
| B16 | 0 | 0 | 2 | 3 | 5 (1.87) |
| B17 | 0 | 0 | 0 | 2 | 2 (0.75) |
| B18 | 0 | 0 | 0 | 2 | 2 (0.75) |
| B19 | 0 | 0 | 0 | 1 | 1 (0.37) |
| B20 | 0 | 0 | 0 | 1 | 1 (0.37) |
| B21 | 0 | 0 | 0 | 2 | 2 (0.75) |
| B22 | 0 | 0 | 0 | 1 | 1 (0.37) |
| B23 | 0 | 0 | 0 | 1 | 1 (0.37) |
| Type A and B, n (%) | 5 (4.76) | 1 (3.23) | 0 | 4 (3.85) | 10 (3.73) |
Figure 4.

Frequency distribution of PvMSP3β alleles observed in all the study isolates from different region of India
DISCUSSION
Few polymorphic molecular markers that encode parasitic surface antigens are found to have a pivotal role in vaccine development. PCR/RFLP method has been proved to be a powerful tool for large-scale genetic diversity studies, and these markers can also be useful in differentiating the recrudescence and relapse malaria in P. vivax.[18] Despite the higher prevalence of P. vivax in India, very few studies were carried out on the various polymorphic markers of P. vivax, such as PvMSP3 β, PvCSP, PvMSP1.[1,19] However, reports from other countries such as Pakistan,[20] Thailand,[21] China and Myanmar,[22] and Korea[23] have observed higher genetic diversity among the P. vivax isolates. Based on the previous data on PvMSP3β, the present study was found to be the second study in India till date.[24] The main aim of this study was to analyze the existing polymorphism in PvMSP3β gene which, in turn, helps its utility as an epidemiological marker in future.
In the present study, genotyping of PvMSP3β was carried out on a total number of 268 mono-infected P. vivax samples from four different regions in India, which showed different epidemiological patterns with extensive variability in their genetic makeup. Type A and B were the major genotypes observed in our P. vivax study isolates, which was in accordance with the previous studies of Asian origin.[1,24] Type C genotype was not detected in our study, which was earlier reported in a study from Indian P. vivax isolates.[1] Surprisingly, we have detected 3.73% mixed infections by PCR and 53% by PCR/RFLP. This observation was in disagreement with previous findings, which could be due to the larger sample size in the present study.[24] Interestingly, majority of our samples showed the presence of Type A genotype, whereas previous studies in India have shown the predominance of Type B genotype,[24] which suggests the spread of diverse parasitic strains across the country. A similar pattern of the predominance of Type A genotype and the absence of Type C genotype in the P. vivax strains were observed from previous studies from Pakistan and Thailand.[20,21]
The mixed genotype infections found in our study may be due to the genetic recombination in vectors, relapses of P. vivax malaria and high endemicity of malaria in a particular region. All these three factors certainly resulted in higher genetic diversity in the parasite population.[16] In the present study, the mixed genotype infections were detected mainly in Puducherry and Mangaluru isolates, and the absence of mixed infections in Jodhpur isolates were due to the low endemicity of P. vivax in Jodhpur region. Similarly, either very few or no mixed infections were seen in resurgent P. vivax isolates from Thailand, China, and Korea.[21,22,23]
Restriction digestion of the PvMSP3β amplified product revealed the presence of 62 suballeles among the total 268 P. vivax isolates, of which 22 were unique alleles. These unique alleles were not repeated in any of the study regions. P. vivax isolates from Mangaluru region showed the presence of 40 suballeles out of 104 samples, which is a highly endemic region for P. vivax infection throughout the year, whereas Puducherry isolates were observed with 34 suballeles of 105 samples, which has seasonal transmission of malaria. This could be due to the result of diversity in the parasite populations that are exposed to new parasite clones than in areas which are isolated geographically.[20] These results confirm the highly polymorphic nature of PvMSP3β gene which could be attributed by the large insertions and deletions in the central alanine-rich region of the protein.[15] Thus, the polymorphic PMSP3 β gene can be utilised as an efficient marker for large-scale epidemiological studies in India.
CONCLUSION
Genetic analysis of PvMSP3β polymorphic marker from our study showed high genetic diversity with primarily two genotypes (Type A and Type B). Rapid genotyping with molecular tools are revolutionizing the field of parasite diversity. PCR/RFLP is proved to be a useful tool for genetic diversity studies in resource-poor settings, as it is rapid and easy to perform without the need of sequencing which is more laborious, time-consuming, and not affordable in many developing or underdeveloped countries. These tools can be successfully employed for large-scale epidemiological studies in malaria-endemic regions, and also distinguishing the recrudescence from relapse malaria cases based on the polymorphic nature of PvMSP3β gene. Furthermore, large-scale studies have to be conducted for a better understanding the association of genotypes with clinical manifestations, which will be an invaluable tool for the management of disease in future.
Financial support and sponsorship
The study was supported by Intramural Research Grant from Jawaharlal Institute of Postgraduate Medical Education and Research (JIPMER), Puducherry, India. Hiasindh Ashmi A acknowledge Indian Council of Medical Research, New Delhi, for providing senior research fellowship. We extend our sincere thanks to Ambika PL, Ajay Philips, Shashiraja Padukone, JIPMER, Puducherry for their help and support to carry out this study.
Conflicts of interest
There are no conflicts of interest.
REFERENCES
- 1.Kim JR, Imwong M, Nandy A, Chotivanich K, Nontprasert A, Tonomsing N, et al. Genetic diversity of Plasmodium vivax in Kolkata, India. Malar J. 2006;5:71. doi: 10.1186/1475-2875-5-71. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Delhi: [Last accessed on 2019 Feb 25]. National Vector Borne Disease Control Programme. Available from: http://www.nvbdcp.gov.in/ [Google Scholar]
- 3.World Health Organization. Geneva, Switzerland: WHO Press; 2018. World Malaria Report 2018. [Google Scholar]
- 4.Olliaro PL, Barnwell JW, Barry A, Mendis K, Mueller I, Reeder JC, et al. Implications of Plasmodium vivax biology for control, elimination, and research. Am J Trop Med Hyg. 2016;95:4–14. doi: 10.4269/ajtmh.16-0160. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Chauhan V, Raina SK, Thakur S. State of the globe: The resurgence of vivax. J Glob Infect Dis. 2016;8:59–60. doi: 10.4103/0974-777X.182113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Saravu K, Kumar R, Ashok H, Kundapura P, Kamath V, Kamath A, et al. Therapeutic assessment of chloroquine-primaquine combined regimen in adult cohort of Plasmodium vivax malaria from primary care centres in Southwestern India. PLoS One. 2016;11:e0157666. doi: 10.1371/journal.pone.0157666. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Srivastava HC, Yadav RS, Joshi H, Valecha N, Mallick PK, Prajapati SK, et al. Therapeutic responses of Plasmodium vivax and P. falciparum to chloroquine, in an area of Western India where P. vivax predominates. Ann Trop Med Parasitol. 2008;102:471–80. doi: 10.1179/136485908X311759. [DOI] [PubMed] [Google Scholar]
- 8.Singh RK. Emergence of chloroquine-resistant vivax malaria in South Bihar (India) Trans R Soc Trop Med Hyg. 2000;94:327. [PubMed] [Google Scholar]
- 9.Cui L, Escalante AA, Imwong M, Snounou G. The genetic diversity of Plasmodium vivax populations. Trends Parasitol. 2003;19:220–6. doi: 10.1016/s1471-4922(03)00085-0. [DOI] [PubMed] [Google Scholar]
- 10.Brito CF, Ferreira MU. Molecular markers and genetic diversity of Plasmodium vivax. Mem Inst Oswaldo Cruz. 2011;106(Suppl 1):12–26. doi: 10.1590/s0074-02762011000900003. [DOI] [PubMed] [Google Scholar]
- 11.Snounou G, Zhu X, Siripoon N, Jarra W, Thaithong S, Brown KN, et al. Biased distribution of msp1 and msp2 allelic variants in Plasmodium falciparum populations in Thailand. Trans R Soc Trop Med Hyg. 1999;93:369–74. doi: 10.1016/s0035-9203(99)90120-7. [DOI] [PubMed] [Google Scholar]
- 12.Ranjit MR, Sharma YD. Genetic polymorphism of falciparum malaria vaccine candidate antigen genes among field isolates in India. Am J Trop Med Hyg. 1999;61:103–8. doi: 10.4269/ajtmh.1999.61.103. [DOI] [PubMed] [Google Scholar]
- 13.Olasehinde GI, Yah CS, Singh R, Ojuronbge OO, Ajayi AA, Valecha N, et al. Genetic diversity of Plasmodium falciparum field isolates from South Western Nigeria. Afr Health Sci. 2012;12:355–61. doi: 10.4314/ahs.v12i3.17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Beeson JG, Drew DR, Boyle MJ, Feng G, Fowkes FJ, Richards JS. Merozoite surface proteins in red blood cell invasion, immunity and vaccines against malaria. FEMS Microbiol Rev. 2016;40:343–72. doi: 10.1093/femsre/fuw001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Rayner JC, Huber CS, Feldman D, Ingravallo P, Galinski MR, Barnwell JW. Plasmodium vivax merozoite surface protein pvMSP-3 beta is radically polymorphic through mutation and large insertions and deletions. Infect Genet Evol. 2004;4:309–19. doi: 10.1016/j.meegid.2004.03.003. [DOI] [PubMed] [Google Scholar]
- 16.Yang Z, Miao J, Huang Y, Li X, Putaporntip C, Jongwutiwes S, et al. Genetic structures of geographically distinct Plasmodium vivax populations assessed by PCR/RFLP analysis of the merozoite surface protein 3beta gene. Acta Trop. 2006;100:205–12. doi: 10.1016/j.actatropica.2006.10.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Snounou G, Viriyakosol S, Zhu XP, Jarra W, Pinheiro L, do Rosario VE, et al. High sensitivity of detection of human malaria parasites by the use of nested polymerase chain reaction. Mol Biochem Parasitol. 1993;61:315–20. doi: 10.1016/0166-6851(93)90077-b. [DOI] [PubMed] [Google Scholar]
- 18.Orjuela-Sánchez P, da Silva NS, da Silva-Nunes M, Ferreira MU. Recurrent parasitemias and population dynamics of Plasmodium vivax polymorphisms in rural Amazonia. Am J Trop Med Hyg. 2009;81:961–8. doi: 10.4269/ajtmh.2009.09-0337. [DOI] [PubMed] [Google Scholar]
- 19.Verma A, Joshi H, Singh V, Anvikar A, Valecha N. Plasmodium vivax msp-3α polymorphisms: Analysis in the Indian subcontinent. Malar J. 2016;15:492. doi: 10.1186/s12936-016-1524-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Khatoon L, Baliraine FN, Bonizzoni M, Malik SA, Yan G. Genetic structure of Plasmodium vivax and Plasmodium falciparum in the Bannu district of Pakistan. Malar J. 2010;9:112. doi: 10.1186/1475-2875-9-112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Rungsihirunrat K, Chaijaroenkul W, Siripoon N, Seugorn A, Na-Bangchang K. Genotyping of polymorphic marker (MSP3α and MSP3β) genes of Plasmodium vivax field isolates from malaria endemic of Thailand. Trop Med Int Health. 2011;16:794–801. doi: 10.1111/j.1365-3156.2011.02771.x. [DOI] [PubMed] [Google Scholar]
- 22.Zhong D, Bonizzoni M, Zhou G, Wang G, Chen B, Vardo-Zalik A, et al. Genetic diversity of Plasmodium vivax malaria in China and Myanmar. Infect Genet Evol. 2011;11:1419–25. doi: 10.1016/j.meegid.2011.05.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Kang JM, Ju HL, Cho PY, Moon SU, Ahn SK, Sohn WM, et al. Polymorphic patterns of the merozoite surface protein-3β in Korean isolates of Plasmodium vivax. Malar J. 2014;13:104. doi: 10.1186/1475-2875-13-104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Gupta P, Pande V, Eapen A, Singh V. Genotyping of MSP3β gene in Indian Plasmodium vivax. J Vector Borne Dis. 2013;50:197–201. [PubMed] [Google Scholar]
