This report describes TCS/ABC transporter modules characterized in Listeria monocytogenes EGD-e. The modules consist of the VirSR TCS and the VirAB and AnrAB ABC transporters. Our results showed that this system is involved in nisin and bacitracin resistance, as well as resistance to cephalosporins, ethidium bromide (EtBr), and benzalkonium chloride (BC). In this system, VirAB is responsible only for antimicrobial sensing and signaling by VirSR, while AnrAB contributes to transportation of antimicrobials. Interestingly, VirAB itself, rather than the VirAB-VirSR-AnrAB system as a whole, contributes to kanamycin and tetracycline resistance.
KEYWORDS: ABC transporter, Listeria monocytogenes, TCS, cephalosporins, resistance
ABSTRACT
In Listeria monocytogenes, it has been proposed that the VirSR two-component signal transduction systems (TCSs) and two ATP-binding cassette (ABC) transporters, VirAB and AnrAB, constitute a complex TCS/ABC transporter system which has been recognized as a unique resistance mode. The role of the putative VirAB-VirSR-AnrAB system in antimicrobial resistance and the respective contributions of the members of the system to resistance were investigated in this study. We constructed gene deletion mutants of L. monocytogenes EGD-e and complemented strains of the mutants and determined MICs of antimicrobial agents against these strains against using the agar dilution method. We assessed the relative expression levels of target genes by reverse transcription-quantitative PCR (RT-qPCR) and measured promoter activity levels by β-galactosidase assays. Our results showed that the VirAB-VirSR-AnrAB system mediates not only nisin and bacitracin resistance but also resistance to cephalosporins, ethidium bromide (EtBr), and benzalkonium chloride (BC). In this system, two ABC transporters, VirAB and AnrAB, play distinct roles in cefotaxime resistance: the former is responsible only for antimicrobial sensing and signaling by VirSR, while the latter contributes to transportation of antimicrobials. Notably, VirAB itself, rather than the VirAB-VirSR-AnrAB system as a whole, contributes to kanamycin and tetracycline resistance. On the basis of the results obtained from this study, we speculate that VirAB acts as a sensor for VirSR in response to cephalosporins, bacitracin, nisin, EtBr, and BC, while VirAB itself plays a role in response to kanamycin and tetracycline in L. monocytogenes EGD-e.
IMPORTANCE This report describes TCS/ABC transporter modules characterized in Listeria monocytogenes EGD-e. The modules consist of the VirSR TCS and the VirAB and AnrAB ABC transporters. Our results showed that this system is involved in nisin and bacitracin resistance, as well as resistance to cephalosporins, ethidium bromide (EtBr), and benzalkonium chloride (BC). In this system, VirAB is responsible only for antimicrobial sensing and signaling by VirSR, while AnrAB contributes to transportation of antimicrobials. Interestingly, VirAB itself, rather than the VirAB-VirSR-AnrAB system as a whole, contributes to kanamycin and tetracycline resistance.
INTRODUCTION
Listeria monocytogenes is a Gram-positive facultative intracellular foodborne pathogen which can cause listeriosis, a serious disease with a high fatality rate (1–3). Ampicillin, alone or in combination with gentamicin, is commonly used to treat patients with listeriosis (4). Earlier studies reported that L. monocytogenes was sensitive to most antibiotics (5, 6), but increasing numbers of strains showing resistance to at least one antibiotic have been documented recently (7, 8). Foodborne transmission appears to be the primary route of acquisition of infections caused by L. monocytogenes. There is evidence that almost all instances of human listeriosis are caused by consumption of contaminated food (9). Antimicrobial peptides (AMPs), such as nisin, are widely used to control a number of pathogens in food. Notably, strains of L. monocytogenes are more nisin resistant than other Gram-positive pathogens (10). The emergence of resistance to antibiotics and AMPs among strains of L. monocytogenes requires us to figure out how it senses and responds to the presence of these antimicrobial agents.
Two-component signal transduction systems (TCSs) are ubiquitous in bacteria and help them adapt to many environmental stresses. A transmembrane sensor histidine kinase (HK) and a cognate cytoplasmic response regulator (RR) make up a typical TCS (11). Genes encoding 16 TCSs, including 15 complete TCSs and an orphan RR, have been identified in L. monocytogenes EGD-e. Among the 15 HKs, VirS belongs to the subfamily of intramembrane-sensing HKs (IM-HKs). Unlike other HKs with an extracellular sensing domain, IM-HKs have a very short sensing domain and researchers have said that they believe that it is buried in the cytoplasmic membrane (12).
IM-HKs need a ligand to accomplish the sensing process due to a lack of extracellular sensor domains. In most cases, an ATP-binding cassette (ABC) transporter, which is usually encoded by genes neighboring the associated TCS genes in the genome, acts as the ligand, forming the TCS/ABC transporter modules which have been reported in Firmicutes bacteria (12). A typical example of these TCS/ABC transporter modules, the BceSR-BceAB system of Bacillus subtilis, contributes to bacitracin resistance (13, 14). A similar mode of signal transduction based on transporter and TCS activity has been discovered in the VraDE-BraSR-BraDE system of Staphylococcus aureus (15). Unlike BceSR-BceAB, the VraDE-BraSR-BraDE system consists of one TCS (BraSR) and two ABC transporters (VraDE and BraDE). It was reported previously that this multicomponent system is involved in resistance to nisin and bacitracin in S. aureus (15). All of these components make their respective contributions to AMP resistance; BraDE is necessary only for sensing and signaling via BraSR, while VraDE mediates resistance only (15). Phylogenetic analysis of the TCS/ABC transporter modules revealed that all permeases of these transporters are members of the family consisting of peptide 7 exporters (Pep7E), which share as a common feature the presence of 10 transmembrane helices with a large extracellular domain located between helices 7 and 8 (15).
Interestingly, genes named virAB (lmo1746-lmo1747), encoding a Pep7E transporter, are found in close proximity to the virS-virR in the genome of L. monocytogenes EGD-e. AnrAB, another Pep7E transporter, has been found to be involved in resistance to nisin, bacitracin, and various β-lactam antibiotics (16). Furthermore, the VirSR TCS was shown to be able to regulate expression of anrAB (17). It has been proposed that VirSR, VirAB, and AnrAB constitute a complex of TCS/ABC transporter modules similar to the VraDE-BraSR-BraDE system of S. aureus and that VirAB might act as a sensory transporter for the VirSR TCS (18). However, this presumption has not yet been confirmed experimentally. Therefore, the aims of this study were to investigate the role of the putative VirAB-VirSR-AnrAB system in antimicrobial resistance and the respective contributions of the members of the system to resistance in L. monocytogenes.
RESULTS
The putative VirAB-VirSR-AnrAB system is involved in resistance to cephalosporins, bacitracin, nisin, EtBr, and BC.
Results from analyses of the MICs of several compounds against L. monocytogenes strains are presented in Table 1. The ΔvirSR, ΔvirAB, and ΔanrAB mutants showed 2-fold more sensitivity to cefotaxime, cephalothin, cefepime and EtBr and 4-fold more sensitivity to ceftazidime than the wild type. Both the ΔvirAB mutant and the ΔanrAB mutant exhibited an 8-fold reduction in the MIC of bacitracin and a 2-fold reduction in the MIC of nisin compared to the wild type. The largest decrease in the MICs of bacitracin and nisin was observed in the ΔvirSR mutant, with a 128-fold decrease in bacitracin resistance and an 8-fold decrease in nisin resistance. Complementation of the ΔvirAB and ΔanrAB mutants restored resistance to cephalosporins, bacitracin, nisin, and EtBr (Table 2). The MICs of these agents for vector control strains ΔvirAB with plasmid pERL3 and ΔanrAB with plasmid pERL3 were similar to those for the corresponding mutant strains (Table 2). Although those three mutants had the same MICs for benzalkonium chloride (BC) as the wild type, their growth in brain heart infusion (BHI) medium with a mixture that included 2 μg/ml of BC was seriously impaired (Fig. 1). Taken together, our results suggest that the putative VirAB-VirSR-AnrAB system is associated with resistance to cephalosporins, bacitracin, nisin, and EtBr as well as to BC.
TABLE 1.
MICs of antimicrobial agents against the wild-type EGD-e strain and the gene deletion mutant strains
| Compound | MIC (μg/ml) for L. monocytogenes strain: |
|||||
|---|---|---|---|---|---|---|
| EGD-e | ΔvirSR | ΔvirAB | ΔanrAB | ΔvirA | ΔanrA | |
| Antibiotics | ||||||
| Ampicillin | 1 | 1 | 1 | 1 | 1 | 1 |
| Cefotaxime | 8 | 4 | 4 | 4 | 4 | 4 |
| Cephalothin | 8 | 4 | 4 | 4 | 4 | 4 |
| Ceftazidime | 16 | 4 | 4 | 4 | 4 | 4 |
| Cefepime | 4 | 2 | 2 | 2 | 2 | 2 |
| Ciprofloxacin | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 |
| Kanamycin | 2 | 2 | 2 | 2 | 2 | 2 |
| Tetracycline | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 |
| Chloramphenicol | 4 | 4 | 4 | 4 | 4 | 4 |
| Antimicrobial peptides | ||||||
| Bacitracin | 256 | 2 | 32 | 32 | 32 | 32 |
| Nisin | 12.5 | 1.56 | 6.25 | 6.25 | 6.25 | 6.25 |
| Dye | ||||||
| Ethidium bromide | 20 | 10 | 10 | 10 | 10 | 10 |
| Disinfectant | ||||||
| Benzalkonium chloride | 6 | 6 | 6 | 6 | 6 | 6 |
TABLE 2.
MICs of cephalosporins, bacitracin, nisin, and EtBr against L. monocytogenes strains
| Strain | MIC (μg/ml)a |
|||||||
|---|---|---|---|---|---|---|---|---|
| CTX | CEF | CAZ | FEP | Bacitracin | Nisin | EtBr | BC | |
| EGD-e | 8 | 8 | 16 | 4 | 256 | 12.5 | 20 | 6 |
| CΔvirAB | 8 | 8 | 16 | 4 | 256 | 12.5 | 20 | 6 |
| CΔanrAB | 8 | 8 | 16 | 4 | 256 | 12.5 | 20 | 6 |
| CΔvirA | 8 | 8 | 16 | 4 | 256 | 12.5 | 20 | 6 |
| CΔanrA | 8 | 8 | 16 | 4 | 256 | 12.5 | 20 | 6 |
| ΔvirAB pERL3 | 4 | 4 | 4 | 2 | 32 | 6.25 | 10 | 6 |
| ΔanrAB pERL3 | 4 | 4 | 4 | 2 | 32 | 6.25 | 10 | 6 |
| ΔvirA pERL3 | 4 | 4 | 4 | 2 | 32 | 6.25 | 10 | 6 |
| ΔanrA pERL3 | 4 | 4 | 4 | 2 | 32 | 6.25 | 10 | 6 |
| ΔvirRS pERL3-virAB | 4 | 4 | 4 | 2 | 2 | 1.56 | 10 | 6 |
| ΔanrAB pERL3-virAB | 4 | 4 | 4 | 2 | 32 | 6.25 | 10 | 6 |
| ΔvirRS pERL3-anrAB | 8 | 8 | 16 | 4 | 32 | 6.25 | 20 | 6 |
| ΔvirAB pERL3-anrAB | 8 | 8 | 16 | 4 | 256 | 12.5 | 20 | 6 |
CTX, cefotaxime; CEF, cephalothin; CAZ, ceftazidime, FEP, cefepime; ethidium bromide, EtBr; BC, benzalkonium chloride.
FIG 1.
(A) Growth curves for L. monocytogenes wild-type (WT) EGD-e, ΔvirSR, ΔvirAB, and ΔanrAB strains in BHI broth. (B) Growth curves for L. monocytogenes wild-type EGD-e, ΔvirSR, ΔvirAB, and ΔanrAB strains in BHI broth with 2 μg/ml of BC.
Expression of virAB and anrAB is induced by cefotaxime, bacitracin, nisin, and BC.
The relative expression levels of virAB and anrAB were investigated by reverse transcription-quantitative PCR (RT-qPCR) under different conditions. Significant increases (P < 0.05) in the relative expression levels of virAB and anrAB were observed in the presence of cefotaxime, bacitracin, nisin, and BC compared to the control (Fig. 2).
FIG 2.
Relative expression levels of (A) virAB and (B) anrAB in L. monocytogenes wild-type EGD-e under different conditions. The concentrations of cefotaxime, bacitracin, nisin, and BC were 2 μg/ml, 64 μg/ml, 3 μg/ml, and 2 μg/ml, respectively. Results are presented as fold changes relative to the expression level of the target gene in EGD-e grown in BHI. Error bars represent standard deviations of results from triplicate experiments (n = 3). The asterisk indicates a value statistically significantly different from that determined for EGD-e grown in BHI, with a P value of <0.05.
VirSR controls inducible expression of anrAB but does not regulate expression of virAB.
As shown in Fig. 3A, the level of expression of anrAB was reduced almost 5-fold in the ΔvirSR mutant from that in the wild-type strain. The addition of cefotaxime resulted in an increase in the expression level of anrAB (10.4-fold; P < 0.05) in the wild-type strain; however, no increase in anrAB expression was observed in the ΔvirSR mutant. Results of β-galactosidase assays showed that PanrAB activity in the wild-type EGD-e strain exhibited a 6.8-fold increase in the presence of cefotaxime, but such an increase was not observed in the ΔvirSR mutant.
FIG 3.
Relative expression levels of (A) anrAB and (B) virAB in L. monocytogenes wild-type EGD-e and ΔvirSR grown in BHI with or without cefotaxime (2 μg/ml). Results are presented as fold changes relative to the expression level of the target gene in EGD-e grown in BHI without antibiotic. Error bars represent standard deviations of results from triplicate experiments (n = 3). The asterisk indicates a value statistically significantly different from that determined for EGD-e grown in BHI, with a P value of <0.05.
A palindromic consensus motif of 16 bases, CTNACAWWWTGTNAG (where “W” represents A or T), has previously been identified as the VirR DNA-binding site for all the promoters of VirR-regulated genes (17). As this consensus motif was also found in the promoter region of anrAB, the interaction between VirR and the anrAB promoter was investigated in our study. Recombinant VirR was expressed, purified (see Fig. 5A), and then incubated with a 196-bp-long DNA sequence between anrAB and its upstream gene. Binding of recombinant VirR protein to the anrAB promoter was observed in our study (see Fig. 5B). However, VirR could not bind to an unrelated DNA sequence with the same GC content, suggesting that this binding was specific.
FIG 5.
(A) SDS-PAGE analysis of crude protein extracts from the recombinant E. coli strains and purified protein. Lanes 1 to 3 represent expression of recombinant VirR in E. coli induced by IPTG (isopropyl-β-d-thiogalactopyranoside); lanes 4 to 6 represent expression of purified VirR protein. M, molecular mass marker. Arrows indicate the proteins of interest. (B) VirR binds in vitro to the promoter of anrAB. The indicated amount of purified VirR protein was incubated with the anrAB promoter (lanes 1 to 4). An unrelated DNA sequence of the same GC content was used as negative control (lanes 5 to 8). Arrows indicate DNA-protein complexes.
As shown in Fig. 3B (see also Fig. 4A), no obvious differences between the wild-type strain and the ΔvirSR strain in the expression levels of virAB or the activity of PvirAB were observed in the presence of cefotaxime. Furthermore, the putative VirR DNA-binding site was not present in the promoter region of virAB (data not shown). Our results suggest that expression of virAB is independent of VirR activity.
FIG 4.
β-Galactosidase activity of (A) PvirAB-lacZ fusion and (B) PanrAB-lacZ in L. monocytogenes wild-type EGD-e, ΔvirSR, ΔvirAB, ΔanrAB, ΔvirA, and ΔanrA grown in BHI with or without cefotaxime (2 μg/ml). (C) Relative expression levels of anrAB in wild-type EGD-e, ΔvirAB, and CΔvirAB grown in BHI with or without cefotaxime (2 μg/ml). Results from qRT-PCR are presented as fold changes relative to the expression level of anrAB in EGD-e grown in BHI without antibiotic. Error bars represent standard deviations of results from triplicate experiments (n = 3). The asterisk indicates a value statistically significantly different from that determined for EGD-e grown in BHI, with a P value of <0.05.
VirAB is involved in antimicrobial detection.
Although both VirAB and AnrAB are involved in L. monocytogenes resistance to cephalosporins, bacitracin, nisin, EtBr, and BC, their respective roles in antimicrobial resistance are still unclear. To clarify this point, levels of expression of PvirAB-lacZ and PanrAB-lacZ were measured by β-galactosidase assays in strains ΔanrAB and ΔvirAB. As shown in Fig. 4A and B, VirAB was essential for inducible transcription of the virAB and anrAB promoters mediated by cefotaxime, but AnrAB was not required. anrAB expression was then determined by reverse transcription-quantitative PCR (qRT-PCR) in wild-type strain EGD-e, the ΔvirAB mutant strain, and the ΔvirAB complemented strain. As shown in Fig. 4C, VirAB was necessary for inducible expression of anrAB mediated by cefotaxime. Our results suggest that VirAB itself is indispensable for cefotaxime detection by the VirSR TCS.
AnrAB is responsible for antimicrobial detoxification.
Both the CΔvirAB and CΔanrAB complemented strains fully restored cefotaxime resistance (Table 2). Constitutive expression of anrAB restored the antimicrobial resistance of the ΔvirSR and ΔvirAB mutant strains (Table 2). However, neither the ΔvirSR mutant nor the ΔanrAB mutant was complemented by expression of virAB (Table 2). These results indicate that the AnrAB ABC transporter is responsible for antimicrobial detoxification.
Cefotaxime sensing and resistance require VirA and AnrA.
Our data suggest that VirAB and AnrAB play different roles in cefotaxime resistance. To investigate if these processes are energy dependent, virA and anrA, which encode the ABC transporter ATP-binding proteins, were deleted individually. Both the ΔvirA mutant and the ΔanrA mutant exhibited the same cefotaxime MICs as the ΔvirAB and ΔanrAB mutants (Table 1). Moreover, complementation of the ΔvirA and ΔanrA deletion mutants restored cefotaxime resistance (Table 2). Neither virAB nor anrAB was upregulated by cefotaxime in the ΔvirA mutant (Fig. 5A), suggesting that VirA is essential for cefotaxime sensing.
VirAB contributes to kanamycin and tetracycline resistance.
The ampicillin, ciprofloxacin, kanamycin, tetracycline, and chloramphenicol MICs for the ΔvirSR, ΔvirAB, and ΔanrAB mutants were consistent with those seen with the wild type (Table 1). Given that the agar dilution method used in this study might not have been sensitive enough to detect differences between the wild-type and mutant strains with respect to their levels of susceptibility to those antimicrobials, levels of growth of serial dilutions of the wild-type and mutant strains were also determined using agar plates with different antimicrobials. Differences in the growth levels of the wild-type strain and the ΔvirAB mutant were observed only in the presence of kanamycin or tetracycline, while the ΔvirSR and ΔanrAB mutants grew identically to the wild type in the plates with or without antimicrobials (Fig. 6). Our results suggest that among the VirSR/VirAB/AnrAB members, only VirAB is involved in kanamycin and tetracycline resistance. To confirm these results, the levels of expression of virSR, virAB, and anrAB in the presence of kanamycin and tetracycline were measured by qRT-PCR. Our results showed inducible expression of virAB mediated by kanamycin and tetracycline; however, neither kanamycin nor tetracycline affected the expression levels of virSR and anrAB. (Fig. 7). Our results indicate that VirAB, rather than the VirSR/VirAB/AnrAB multicomponent system, contributes to kanamycin and tetracycline resistance in L. monocytogenes.
FIG 6.
Growth of L. monocytogenes wild-type EGD-e, ΔvirSR, ΔvirAB, and ΔanrAB strains on BHI agar with kanamycin (0.5 μg/ml) and tetracyclines (0.25 μg/ml).
FIG 7.
Relative expression levels of virAB, anrAB, and virSR in L. monocytogenes wild-type EGD-e in BHI with or without antibiotics (0.5 μg/ml of kanamycin or 0.25 μg/ml of tetracyclines). Results are presented as fold changes relative to the expression level of the target gene in EGD-e grown in BHI. Error bars represent standard deviations of results from triplicate experiments (n = 3). The asterisk indicates a value statistically significantly different from that determined for EGD-e grown in BHI, with a P value of <0.05.
DISCUSSION
In this study, we identified an unusual TCS/ABC transporter signal transduction system in L. monocytogenes which consists of the VirSR TCS and two ABC transporters, VirAB and AnrAB. To our knowledge, all such TCS/ABC transporter modules characterized to date have been found to be associated with resistance to peptide antibiotics, such as nisin and bacitracin (14, 15, 18). The VirAB-VirSR-AnrAB system in L. monocytogenes mediates not only nisin and bacitracin resistance but also resistance to cephalosporins, EtBr, and BC. Bacitracin, nisin, and cephalosporins were shown previously to be capable of inhibiting the synthesis of cell wall (19, 20). The mode of action of BC against bacterial cells is known to involve perturbing the lipid bilayer membranes which constitute the bacterial cytoplasmic membrane by ionic and hydrophobic interactions (21). It is therefore suggested that the VirAB-VirSR-AnrAB system is an important mechanism of cell envelope stress response in L. monocytogenes. Unlike the antimicrobials mentioned above, EtBr targets bacterial DNA instead of the cell wall. It can inhibit the replication and transcription of bacterial DNA by intercalation between nucleic bases of DNA. The involvement of the VirAB-VirSR-AnrAB system in resistance to antimicrobial agents with different modes of action indicates that the substrates for this system might be nonspecific. Grubaugh et al. (22) suggested previously that VirAB is not necessary for bacitracin resistance in L. monocytogenes 10403S, which contrasts with our results seen with strain EGD-e. One possible explanation is that mutating a certain gene from different strains may not lead to consistent phenotypic consequences.
Our results showed that the ΔvirAB mutant no longer responded to the presence of extracellular cefotaxime, suggesting that the VirS HK is unable to sense the presence of the antimicrobial in the absence of the VirAB transporter and that the antimicrobial might be detected first by the VirAB transporter. VirS, which belongs to the subfamily of IM-HKs, was incapable of detecting the substrate alone and instead relied on detection by VirAB due to lacking an obvious signal input domain. In previous studies, a large extracellular loop in BceB of B. subtilis that is essential for direct binding of bacitracin by BceB was characterized (13). The membrane topology of the VirB permease is similar to that of BceB. It is likely that the extracellular loop in VirB is also essential for signal recognition and that it is involved in direct interaction with antimicrobials.
All the TCS/ABC transporter modules described share a characteristic in that they all need the transporter for sensing of stimuli (23). However, the reason for this phenomenon is unknown. The two possible explanations that have been proposed are as follows: (i) the transporter plays a role in transporting the substrate to a location where the HK can directly sense it and (ii) the transporter and TCS communicate by protein-protein interactions. It appears that several studies have provided strong evidence for the latter (24, 25). Coevolution between the transporter permeases and HKs was found according to the comparative phylogenetic analysis of TCS/ABC transporter modules, suggesting direct interactions between the proteins (25). Furthermore, the presence of a sensory complex consisting of the BceS HK and the BceB permease was also confirmed previously for the BceSR-BceAB system in B. subtilis, and the complex is formed constitutively, independently of the signal (24).
Our results demonstrated that VirAB contributes only to cefotaxime sensing and signaling by VirSR and that the second transporter, AnrAB, is responsible only for antimicrobial detoxification. Our results showed that complementation of strain ΔanrAB resulted in restoration of cefotaxime resistance, whereas that of CΔanrAB did not. In contrast, VirAB was essential for expression of the virAB and anrAB operons, whereas AnrAB was not, indicating that only AnrAB is involved in the detoxification process. VirAB is essential only for activating the VirSR TCS via phosphorylation and is not involved in the resistance process itself. The BceAB transporter in B. subtilis, regulated by the BceSR TCS, is required for both sensing and transport (14). However, functional specialization of two transporters, VirAB and AnrAB, was observed in L. monocytogenes, which is similar to the results seen with the BraDE-BraSR-VraDE system of S. aureus (15). Both the BraDE and VraDE transporters are regulated by the BraSR TCS in S. aureus, while AnrAB is regulated only by VirSR in L. monocytogenes. Transcriptional regulation of virAB by the antimicrobial agents tested in this study was found to be VirR independent, suggesting that the VirAB-VirSR-AnrAB system might be involved in a complex regulatory network that functions in response to these agents.
Although the AnrAB ABC transporter was found to confer cefotaxime resistance in the present study, the direction of drug transport by AnrAB is still unclear. In fact, this is also the case for BceAB of B. subtilis and VraDE of S. aureus, both of which are believed to transporter bacitracin. Some studies supported the view that these transporters are actually export systems due to their lack of a substrate-binding protein, but others suggested that they function as importers because of their general architectures (13, 14). Hiron et al. (15) found the extracellular loop of the VraE permease could act as a substrate-binding protein and favored the view that VraDE is an importer. The AnrB permease exhibits membrane topology similar to that of VraE, with the presence of a large extracellular loop, suggesting the role of AnrAB as an importer. But this speculation does not explain our results indicating that EtBr is also the substrate of AnrAB. Since the site of action of EtBr consists of nucleic bases of DNA, there is no doubt that the transporter associated with EtBr resistance transfers EtBr as a substrate to the extracellular region instead of the cytoplasm. This fact indeed shows that the efflux pump is the primary mechanism for EtBr resistance in both Gram-positive and Gram-negative bacteria (26, 27). Therefore, it is conceivable that the AnrAB transporter acts as an efflux pump in response to EtBr in L. monocytogenes. With respect to the direction of transport by AnrAB, two explanations are put forward in this report: first, AnrAB acts as an exporter for its substrates, which contrasts with the conclusions reported by Hiron et al. (15); second, AnrAB is a two-way transporter, that is to say, it can transfer the cell envelope-acting substrates, such as cefotaxime as detected in the current study, to the cytoplasm, resulting in the extrusion of EtBr from cells. Further work will be required to confirm our hypotheses.
Our data demonstrated that both the permease and the ATP-binding protein of VirAB are essential for cefotaxime sensing, as either domain alone is insufficient for such sensing. ATP binding by VirA is necessary for perception of cefotaxime, indicating that such compounds are sensed during transport. Similar results were also observed for AnrAB, indicating that both cefotaxime sensing and cefotaxime detoxification are energy dependent, because VirA and AnrA are each essential for cefotaxime resistance.
The data obtained in our study support the working model that the stimulus is first sensed by VirAB and then triggers activation of VirS and VirR, which leads to increased expression of AnrAB, resulting in the removal of the antimicrobial from its site of action, as suggested for the BceSR/BceAB system of B. subtilis (15). Previous studies reported an interesting phenomenon in which transcription of VirR-regulated genes, such as anrB and dltD, also appears to require the presence of VirAB (22), which is fully explainable according to our study.
The relationship between the ABC transporter and the TCS in the TCS/ABC transporter modules has attracted much attention. It is believed that the transporter is indispensable for signal transduction through the TCS. Moreover, coevolution and formation of a complex between the ABC transporter and the TCS have been reported in recent studies (24, 25). The evidence leads to the assumption that the transporter and the TCS are always involved in antimicrobial resistance as a whole system. In the current study, our results included the following interesting finding: the VirAB transporter is involved in kanamycin and tetracycline resistance, but neither the VirSR TCS nor the AnrAB transporter is associated with resistance to these two antibiotics. This suggests that VirAB itself, instead of the VirAB-VirSR-AnrAB system, mediates kanamycin and tetracycline resistance. Given that expression of virAB is not regulated by VirR, it is not surprising that VirAB is involved in kanamycin and tetracycline resistance in a VirSR-independent manner. In this case, it is likely that another (unknown) regulator controls the inducible expression of VirAB. The BraDE-BraSR-VraDE system has been well characterized in S. aureus, and serving as the sensing domain of the BraS HK seems the only duty of BraDE transporter-mediated resistance according to previous reports (15). However, VirAB is able to contribute to resistance in both VirSR-dependent and VirSR-independent manners. On the basis of our results, we propose a hypothesis according to which VirAB acts as a sensor for VirSR in response to cephalosporins, bacitracin, nisin, EtBr, and BC in L. monocytogenes whereas VirAB itself plays a role in response to kanamycin and tetracycline.
Takin the results together, this study identified the VirAB-VirSR-AnrAB system, an unusual arrangement of TCS/ABC transporter modules in L. monocytogenes. This system mediates not only nisin and bacitracin resistance but also resistance to cephalosporins, EtBr, and BC. Two ABC transporters of this system play distinct roles in cefotaxime resistance. Specifically, VirAB is responsible only for antimicrobial sensing and signaling via VirSR whereas AnrAB contributes to transportation of antimicrobials. Notably, VirAB itself contributes to kanamycin and tetracycline resistance in L. monocytogenes EGD-e.
MATERIALS AND METHODS
Bacterial strains and plasmids.
All the strains and plasmids used in our study are listed in Table 3. L. monocytogenes was grown at 37°C in brain heart infusion (BHI; Oxoid Ltd., Basingstoke, Hampshire, England), and Escherichia coli strains were grown in Luria-Bertani (LB; Huankai Ltd., Guangzhou, Guangdong, China). Selective media were obtained by adding appropriate antibiotics (Sigma-Aldrich, St. Louis, MO, USA). The primers used in this study are shown in Table 4.
TABLE 3.
Bacterial strains and plasmids used in this study
| Strain or plasmid | Genotypea | Source or reference |
|---|---|---|
| Strains | ||
| L. monocytogenes EGD-e | Wild-type strain; serotype 1/2a | A gift from Qin Luo |
| L. monocytogenes ΔvirR | In-frame deletion of virR | This study |
| L. monocytogenes ΔvirSR | In-frame deletion of virS and virR | This study |
| L. monocytogenes ΔvirAB | In-frame deletion of virAB | This study |
| L. monocytogenes ΔanrAB | In-frame deletion of anrAB | This study |
| L. monocytogenes ΔvirA | In-frame deletion of virA | This study |
| L. monocytogenes ΔanrA | In-frame deletion of anrA | This study |
| L. monocytogenes CΔvirAB | Complemented strain of ΔvirAB | This study |
| L. monocytogenes CΔanrAB | Complemented strain of ΔanrAB | This study |
| L. monocytogenes CΔvirA | Complemented strain of ΔvirA | This study |
| L. monocytogenes CΔanrA | Complemented strain of ΔanrA | This study |
| L. monocytogenes ΔvirAB pERL3 | ΔvirAB containing pERL3 | This study |
| L. monocytogenes ΔanrAB pERL3 | ΔanrAB containing pERL3 | This study |
| L. monocytogenes ΔvirA pERL3 | ΔvirA containing pERL3 | This study |
| L. monocytogenes ΔanrA pERL3 | ΔanrA containing pERL3 | This study |
| L. monocytogenes ΔvirSR pERL3-virAB | ΔvirSR containing pERL3-virAB | This study |
| L. monocytogenes ΔanrAB pERL3-virAB | ΔanrAB containing pERL3-virAB | This study |
| L. monocytogenes ΔvirSR pERL3-anrAB | ΔvirSR containing pERL3-anrAB | This study |
| L. monocytogenes ΔvirAB pERL3-anrAB | ΔvirAB containing pERL3-anrAB | This study |
| L. monocytogenes EGD-e pPTPL-PvirAB | EGD-e containing pPTPL-PvirAB | This study |
| L. monocytogenes ΔvirSR pPTPL-PvirAB | ΔvirSR containing pPTPL-PvirAB | This study |
| L. monocytogenes ΔvirAB pPTPL-PvirAB | ΔvirAB containing pPTPL-PvirAB | This study |
| L. monocytogenes ΔanrAB pPTPL-PvirAB | ΔanrAB containing pPTPL-PvirAB | This study |
| L. monocytogenes ΔvirA pPTPL-PvirAB | ΔvirA containing pPTPL-PvirAB | This study |
| L. monocytogenes ΔanrA pPTPL-PvirAB | ΔanrA containing pPTPL-PvirAB | This study |
| L. monocytogenes EGD-e pPTPL-PanrAB | EGD-e containing pPTPL-PanrAB | This study |
| L. monocytogenes ΔvirSR pPTPL-PanrAB | ΔvirSR containing pPTPL-PanrAB | This study |
| L. monocytogenes ΔvirAB pPTPL-PanrAB | ΔvirAB containing pPTPL-PanrAB | This study |
| L. monocytogenes ΔanrAB pPTPL-PanrAB | ΔanrAB containing pPTPL-PanrAB | This study |
| L. monocytogenes ΔvirA pPTPL-PanrAB | ΔvirA containing pPTPL-PanrAB | This study |
| L. monocytogenes ΔanrA pPTPL-PanrAB | ΔanrA containing pPTPL-PanrAB | This study |
| E. coli DH5α | Chemically competent strain | Biomed, Beijing, China |
| E. coli DH10β | Chemically competent strain | Biomed, Beijing, China |
| E. coli MC1000 | Cloning host for pPTPL | 34 |
| E. coli BL21(DE3) | Expression host | Biomed, Beijing, China |
| Plasmids | ||
| pMAD | Cloning shuttle integration vector plasmid, Ampr and Eryr | 28 |
| pMAD-ΔvirS | pMAD containing homologous arms up- and downstream of EGD-e virS | This study |
| pMAD-ΔvirR | pMAD containing homologous arms up- and downstream of EGD-e virR | This study |
| pMAD-ΔvirAB | pMAD containing homologous arms up- and downstream of EGD-e virAB | This study |
| pMAD-ΔanrAB | pMAD containing homologous arms up- and downstream of EGD-e anrAB | This study |
| pMAD-ΔvirA | pMAD containing homologous arms up- and downstream of EGD-e virA | This study |
| pMAD-ΔanrA | pMAD containing homologous arms up- and downstream of EGD-e anrA | This study |
| pERL3 | Plasmid capable of replication in L. monocytogenes, Eryr | 29 |
| pERL3-virAB | pERL3 containing the upstream region and the coding sequence of virAB | This study |
| pERL3-anrAB | pERL3 containing the upstream region and the coding sequence of anrAB | This study |
| pERL3-virA | pERL3 containing the upstream region and the coding sequence of virA | This study |
| pERL3-anrA | pERL3 containing the upstream region and the coding sequence of anrA | This study |
| pPTPL | Promoter probe vector, Tetr | 34 |
| pPTPL-PvirAB | pPTPL containing the putative promoter region of virAB | This study |
| pPTPL-PanrAB | pPTPL containing the putative promoter region of anrAB | This study |
| pET32a | Expression vector, Ampr | Biomed, Beijing, China |
| pET32a-virR | pET32a containing the full length of virR | This study |
Ampr, ampicillin resistance; Eryr, erythromycin resistance; Tetr, tetracycline resistance.
TABLE 4.
Primers used in this study
| Application and gene |
Primer name | Sequence (5′–3′)a |
|---|---|---|
| Mutant strain construction | ||
| virS | lmo1741-1 | NNNNNNGGATCCCAATAAACACGGCATCCA (BamHI) |
| lmo1741-2 | GCCATGAATTGGTGGAGTTCTGAGAGTGGCGTAGGAA | |
| lmo1741-3 | TTCCTACGCCACTCTCAGAACTCCACCAATTCATGGC | |
| lmo1741-4 | NNNNNNACGCGTTAGTCGTGGATAATGGTGTTC (MluI) | |
| virR | lmo1745-1 | NNNNNNGGATCCCGTATGTGCCATTGGAGGT (BamHI) |
| lmo1745-2 | ACCGAGGGAGGCACTAGAAGAATGACGAAAAAACAGGGAG | |
| lmo1745-3 | CTCCCTGTTTTTTCGTCATTCTTCTAGTGCCTCCCTCGGT | |
| lmo1745-4 | NNNNNNACGCGTTCGTAAAATGGTCGTTCAATC (MluI) | |
| virAB | lmo1746/7-1 | NNNNNNGGATCCTCACGACTTACAATGCTACCT (BamHI) |
| lmo1746/7-2 | AACGTAACGGGAGGAATACATTGGCTTTTGTGGTTATTTC | |
| lmo1746/7-3 | GAAATAACCACAAAAGCCAATGTATTCCTCCCGTTACGTT | |
| lmo1746/7-4 | NNNNNNACGCGTAGTTGTTTACTTTGGATGGC (MluI) | |
| anrAB | lmo2114/5-1 | NNNNNNGGATCCCATTTACAGCATTCTTGGTC (BamHI) |
| lmo2114/5-2 | GGTTAGAGGGCTTCTTTTTATGTCTCCATTATTTTCTCTCC | |
| lmo2114/5-3 | GGAGAGAAAATAATGGAGACATAAAAAGAAGCCCTCTAACC | |
| lmo2114/5-4 | NNNNNNACGCGTATTCCAAGGATTTTCGGTAT (MluI) | |
| virA | lmo1747-1 | NNNNNNGGATCCAAAGACCAGCATCGTATCG (BamHI) |
| lmo1747-2 | AACGTAACGGGAGGAATACAGAAATCTACCGAGGGACAA | |
| lmo1747-3 | TTGTCCCTCGGTAGATTTCTGTATTCCTCCCGTTACGTT | |
| lmo1747-4 | NNNNNNACGCGTAGTTGTTTACTTTGGATGGC (MluI) | |
| anrA | lmo2114-1 | NNNNNNGGATCCCATTTACAGCATTCTTGGTC (BamHI) |
| lmo2114-2 | AATAACGTCATCTGAGTCGCTGTCTCCATTATTTTCTCTCC | |
| lmo2114-3 | GGAGAGAAAATAATGGAGACAGCGACTCAGATGACGTTATT | |
| lmo2114-4 | NNNNNNACGCGTGAAAAGCCAAGTTGTGCC (MluI) | |
| Complementation | ||
| virAB | lmo1746/7-5 | NNNNNNGAGCTCGAAGAAGTGGCATGGGAC (SacI) |
| lmo1746/7-6 | NNNNNNGGATCCTTACTTTTTATTGGCCATCAC (BamHI) | |
| anrAB | lmo2114/5-5 | NNNNNNGTCGACACCTGTTACTATCCGAGCAA (SalI) |
| lmo2114/5-6 | NNNNNNGGATCCTTATTTTTTGCCGAAAACG (BamHI) | |
| virA | lmo1747-5 | NNNNNNGAGCTCGGAAGAAGTGGCATGGGA (SacI) |
| lmo1747-6 | NNNNNNGGATCCTTAAATAACATCGTTTTCGCC (BamHI) | |
| anrA | lmo2114-5 | NNNNNNGAGCTCACCTGTTACTATCCGAGCAA (SacI) |
| lmo2114-6 | NNNNNNGGATCCTCAAATAACGTCATCTGAGTCG (BamHI) | |
| RT-qPCR | ||
| virAB | RTlmo1746/7-1 | CGATTGCGATGATTGCTGTA |
| RTlmo1746/7-2 | CTCTGCTGCCTTTCACCGA | |
| anrAB | RTlmo2114/5-1 | CCGCTCCATCTAGCTTTG |
| RTlmo2114/5-2 | TGTGCTTCGTTTCCTTTG | |
| 16S rRNA | RT16S1 | GGGAGGCAGCAGTAGGGA |
| RT16S2 | CCGTCAAGGGACAAGCAG | |
| Recombinant VirR expression | ||
| virR | lmo1745-7 | NNNNNNGGATCCATGGTAAAGGTATATATCGTAGAA (BamHI) |
| lmo1745-8 | NNNNNNCTCGAGTTCAATCATATATCCTTGGC (XhoI) | |
| EMSA | ||
| Promoter region of anrAB | PanrAB-1 | TATAAGTAAAAACTGGAATTC |
| PanrAB-2 | TATTTTCTCTCCTTATAAAAC | |
| Construction of promoter-lacZ fusion | ||
| Promoter region of virAB | PvirAB-1 | NNNNNNAGATCTGAAGTGGCATGGGACATA (BglII) |
| PvirAB-2 | NNNNNNTATAGATGTATTCCTCCCGTTACG (XbaI) | |
| Promoter region of anrAB | PanrAB-3 | NNNNNNAGATCTTATAAGTAAAAACTGGAATTC (BglII) |
| PanrAB-4 | NNNNNNTATAGATATTTTCTCTCCTTATAAAAC (XbaI) | |
Restriction sites are underlined. N, any of the bases.
Construction of gene deletion mutants.
Temperature-sensitive shuttle vector pMAD was applied for construction of gene deletion mutants by the use a homologous recombination strategy as described previously (28). In particular, given that virS and virR were not adjacent genes in the genome of strain EGD-e, in order to obtain the ΔvirSR mutant strain, the ΔvirR gene deletion mutant was constructed first and then pMAD-ΔvirS was introduced into the ΔvirR mutant.
Complementation of the gene deletion mutants.
Plasmid pERL3 (29) was used for complementation experiments as described previously (30). Briefly, the amplification included the coding sequences of target gene and the related upstream region, which were cloned into pERL3. The recombinant plasmid was first transformed into E. coli DH10β (Biomed, Beijing, China) and was then electroporated into the gene deletion mutant strain. Finally, BHI plates supplemented with 5 μg/ml of erythromycin were employed to select transformants. Plasmid pERL3 was also introduced into the gene deletion mutants to construct the vector control.
MICs.
The agar dilution method was employed to measure MICs of antimicrobial agents for L. monocytogenes (31). Briefly, bacterial cultures were adjusted to a turbidity level equivalent to that of a 0.5 McFarland standard and were then further diluted 1:10 in 0.9% sterilized saline solution. A 1-μl volume of the suspensions was spotted on Mueller-Hinton agar (MHA; Huankai) with 2% defibrinated sheep blood. Following 48 h of incubation at 37°C, MICs were determined as the lowest concentrations of antimicrobial agents totally preventing growth. Each of the tests was done in triplicate.
Determination of growth curves.
In order to investigate the role of the VirAB-VirSR-AnrAB system in BC resistance, growth curves of wild-type strain EGD-e and the mutant strains were determined using BHI broth with or without BC (2 μg/ml) as previously described (32). All the strains were incubated in a Bioscreen C microbiology reader (Growth Curves, Helsinki, Finland) at 37°C for 48 h, and the optical density at 600 nm (OD600) was measured at 15-min intervals.
Gene expression analysis.
RT-qPCR was performed to assess the relative expression levels of the target genes in this study. Strains were grown in BHI broth at 37°C to the mid-logarithmic phase. One part of the culture without treatment was used as a control, and the other part was exposed to antimicrobial for 30 min. Total RNA from bacterial culture was obtained using an RNAprep pure cell/bacteria kit (Tiangen Biotech, Beijing, China) and then was reverse transcribed using an TIANScript RT kit (Tiangen). 16S rRNA was used as a reference gene. Relative expression levels were calculated by the threshold cycle (2−ΔΔCT) method (33). Assays were done in triplicate independently.
VirR protein expression and purification.
Expression and purification of VirR protein were conducted using a previously described method (31).
Electrophoretic mobility shift assay (EMSA).
To further confirm the regulation of VirR with anrAB, the interaction between VirR and the anrAB promoter was investigated in vitro using EMSA. First of all, amplification of the anrAB promoter region was obtained by PCR and purification was performed. the recombinant VirR protein was then incubated with 200 ng of DNA in binding buffer (Beyotime Biotechnology Co., Shanghai, China) at room temperature for 30 min. The mixture was detected by 6% nondenaturing polyacrylamide gel electrophoresis. Then, the polyacrylamide gel was visualized after EtBr staining with UV light.
Analysis of promoter activity by β-galactosidase assays.
Promoter probe plasmid pPTPL (34) was used to construct a promoter-lacZ fusion according to the method described previously by Collins et al. (35). β-Galactosidase activity was assayed by the method of Miller as previously described (36). Assays were done in triplicate independently. Finally, the results were quantified as means in Miller units.
Determination of antimicrobial susceptibility by dotting assay.
To determine if there was any difference between the wild-type strain and the deletion mutants in their levels of susceptibility to ampicillin, ciprofloxacin, kanamycin, tetracycline, chloramphenicol, and BC, a dotting assay was performed in this study. Strains were incubated until they reached exponential-phase growth, and the culture was then adjusted to approximately 107 CFU/ml. And then aliquots of 1-μl volumes of 10-fold serial dilutions of bacterial cultures were spotted on BHI agar plates with antibiotics or disinfectants at 1/4 MIC. The plates were incubated at 37°C for 24 h.
Statistics.
The unpaired two-tailed Student's t test (Microsoft Excel 2010) was applied to perform statistical comparisons of all data. Differences with P values of ≤0.05 were considered statistically significant.
ACKNOWLEDGMENTS
We are grateful to Qin Luo, Central China Normal University, for kindly providing L. monocytogenes EGD-e and the pERL3 plasmid. We also thank Douwe van Sinderen for providing the pPTPL plasmid and Jean-François Collet for providing E. coli MC1000.
This work was supported by the National Natural Science Foundation of China (31601568).
REFERENCES
- 1.Drevets DA, Bronze MS. 2008. Listeria monocytogenes: epidemiology, human disease, and mechanisms of brain invasion. FEMS Immunol Med Microbiol 53:151–165. doi: 10.1111/j.1574-695X.2008.00404.x. [DOI] [PubMed] [Google Scholar]
- 2.Gandhi M, Chikindas ML. 2007. Listeria: a foodborne pathogen that knows how to survive. Int J Food Microbiol 113:1–15. doi: 10.1016/j.ijfoodmicro.2006.07.008. [DOI] [PubMed] [Google Scholar]
- 3.Kallipolitis BH, Ingmer H, Gahan CG, Hill C, Søgaard-Andersen L. 2003. CesRK, a two-component signal transduction system in Listeria monocytogenes, responds to the presence of cell wall-acting antibiotics and affects beta-lactam resistance. Antimicrob Agents Chemother 47:3421–3429. doi: 10.1128/aac.47.11.3421-3429.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Temple ME, Nahata MC. 2000. Treatment of listeriosis. Ann Pharmacother 34:656–661. doi: 10.1345/aph.19315. [DOI] [PubMed] [Google Scholar]
- 5.Hof H. 2003. Therapeutic options. FEMS Immunol Med Microbiol 35:203–205. doi: 10.1016/S0928-8244(02)00466-2. [DOI] [PubMed] [Google Scholar]
- 6.Hadorn K, Hächler H, Schaffner A, Kayser FH. 1993. Genetic characterization of plasmid-encoded multiple antibiotic resistance in a strain of Listeria monocytogenes causing endocarditis. Eur J Clin Microbiol Infect Dis 12:928–937. doi: 10.1007/BF01992167. [DOI] [PubMed] [Google Scholar]
- 7.Yu T, Jiang X. 2014. Prevalence and characterization of Listeria monocytogenes isolated from retail food in Henan, China. Food Control 37:228–231. doi: 10.1016/j.foodcont.2013.09.047. [DOI] [Google Scholar]
- 8.Chenal-Francisque V, Charlier C, Mehvish S, Dieye H, Leclercq A, Courvalin P, Lecuit M. 2014. Highly rifampin-resistant Listeria monocytogenes isolated from a patient with prosthetic bone infection. Antimicrob Agents Chemother 58:1829–1830. doi: 10.1128/AAC.02449-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Scallan E, Hoekstra RM, Angulo FJ, Tauxe RV, Widdowson MA, Roy SL, Jones JL, Griffin PM. 2011. Foodborne illness acquired in the United States-major pathogens. Emerg Infect Dis 17:7–15. doi: 10.3201/eid1701.p11101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Field D, Quigley L, O'Connor PM, Rea MC, Daly K, Cotter PD, Hill C, Ross RP. 2010. Studies with bioengineered Nisin peptides highlight the broad-spectrum potency of Nisin V. Microb Biotechnol 3:473–486. doi: 10.1111/j.1751-7915.2010.00184.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.West AH, Stock AM. 2001. Histidine kinases and response regulator proteins in two-component signaling systems. Trends Biochem Sci 26:369–376. doi: 10.1016/S0968-0004(01)01852-7. [DOI] [PubMed] [Google Scholar]
- 12.Mascher T. 2006. Intramembrane-sensing histidine kinases: a new family of cell envelope stress sensors in Firmicutes bacteria. FEMS Microbiol Lett 264:133–144. doi: 10.1111/j.1574-6968.2006.00444.x. [DOI] [PubMed] [Google Scholar]
- 13.Bernard R, Guiseppi A, Chippaux M, Foglino M, Denizot F. 2007. Resistance to bacitracin in Bacillus subtilis: unexpected requirement of the BceAB ABC transporter in the control of expression of its own structural genes. J Bacteriol 189:8636–8642. doi: 10.1128/JB.01132-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Rietkötter E, Hoyer D, Mascher T. 2008. Bacitracin sensing in Bacillus subtilis. Mol Microbiol 68:768–785. doi: 10.1111/j.1365-2958.2008.06194.x. [DOI] [PubMed] [Google Scholar]
- 15.Hiron A, Falord M, Valle J, Débarbouillé M, Msadek T. 2011. Bacitracin and nisin resistance in Staphylococcus aureus: a novel pathway involving the BraS/BraR two-component system (SA2417/SA2418) and both the BraD/BraE and VraD/VraE ABC transporters. Mol Microbiol 81:602–622. doi: 10.1111/j.1365-2958.2011.07735.x. [DOI] [PubMed] [Google Scholar]
- 16.Collins B, Curtis N, Cotter PD, Hill C, Ross RP. 2010. The ABC transporter AnrAB contributes to the innate resistance of Listeria monocytogenes to nisin, bacitracin, and various beta-lactam antibiotics. Antimicrob Agents Chemother 54:4416–4423. doi: 10.1128/AAC.00503-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Mandin P, Fsihi H, Dussurget O, Vergassola M, Milohanic E, Toledo-Arana A, Lasa I, Johansson J, Cossart P. 2005. VirR, a response regulator critical for Listeria monocytogenes virulence. Mol Microbiol 57:1367–1380. doi: 10.1111/j.1365-2958.2005.04776.x. [DOI] [PubMed] [Google Scholar]
- 18.Gebhard S, Mascher T. 2011. Antimicrobial peptide sensing and detoxification modules: unravelling the regulatory circuitry of Staphylococcus aureus. Mol Microbiol 81:581–587. doi: 10.1111/j.1365-2958.2011.07747.x. [DOI] [PubMed] [Google Scholar]
- 19.Hasper HE, De Kruijff B, Breukink E. 2004. Assembly and stability of nisin-Lipid II pores. Biochemistry 43:11567–11575. doi: 10.1021/bi049476b. [DOI] [PubMed] [Google Scholar]
- 20.Stone KJ, Strominger JL. 1971. Mechanism of action of bacitracin: complexation with metal ion and C55-isoprenyl pyrophosphate. Proc Natl Acad Sci U S A 68:3223–3227. doi: 10.1073/pnas.68.12.3223. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Tezel U, Pavlostathis SG. 2015. Quaternary ammonium disinfectants: microbial adaptation, degradation and ecology. Curr Opin Biotechnol 33:296–304. doi: 10.1016/j.copbio.2015.03.018. [DOI] [PubMed] [Google Scholar]
- 22.Grubaugh D, Regeimbal JM, Ghosh P, Zhou Y, Lauer P, Dubensky TW, Higgins DE. 2018. The VirAB ABC transporter is required for VirR regulation of Listeria monocytogenes virulence and resistance to nisin. Infect Immun 86:e00901-17. doi: 10.1128/IAI.00901-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Gebhard S. 2012. ABC transporters of antimicrobial peptides in Firmicutes bacteria-phylogeny, function and regulation. Mol Microbiol 86:1295–1317. doi: 10.1111/mmi.12078. [DOI] [PubMed] [Google Scholar]
- 24.Dintner S, Heermann R, Fang C, Jung K, Gebhard S. 2014. A sensory complex consisting of an ATP-binding cassette transporter and a two-component regulatory system controls bacitracin resistance in Bacillus subtilis. J Biol Chem 289:27899–27910. doi: 10.1074/jbc.M114.596221. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Dintner S, Staron A, Berchtold E, Petri T, Mascher T, Gebhard S. 2011. Coevolution of ABC transporters and two-component regulatory systems as resistance modules against antimicrobial peptides in Firmicutes bacteria. J Bacteriol 193:3851–3862. doi: 10.1128/JB.05175-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Rodrigues L, Villellas C, Bailo R, Viveiros M, Aínsa JA. 2013. Role of the Mmr efflux pump in drug resistance in Mycobacterium tuberculosis. Antimicrob Agents Chemother 57:751–757. doi: 10.1128/AAC.01482-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Couto I, Costa SS, Viveiros M, Martins M, Amaral L. 2008. Efflux-mediated response of Staphylococcus aureus exposed to ethidium bromide. J Antimicrob Chemother 62:504–513. doi: 10.1093/jac/dkn217. [DOI] [PubMed] [Google Scholar]
- 28.Arnaud M, Chastanet A, Débarbouillé M. 2004. New vector for efficient allelic replacement in naturally nontransformable, low-GC-content, gram-positive bacteria. Appl Environ Microbiol 70:6887–6891. doi: 10.1128/AEM.70.11.6887-6891.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Sibelius U, Chakraborty T, Krögel B, Wolf J, Rose F, Schmidt R, Wehland J, Seeger W, Grimminger F. 1996. The listerial exotoxins listeriolysin and phosphatidylinositol-specific phospholipase C synergize to elicit endothelial cell phosphoinositide metabolism. J Immunol 157:4055–4060. [PubMed] [Google Scholar]
- 30.Jiang X, Yu T, Xu P, Xu X, Ji S, Gao W, Shi L. 27 September 2018, posting date. Role of efflux pumps in the in vitro development of ciprofloxacin resistance in Listeria monocytogenes. Front Microbiol doi: 10.3389/fmicb.2018.02350. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Jiang X, Yu T, Xu Y, Wang H, Korkeala H, Shi L. 2019. MdrL, a major facilitator superfamily efflux pump of Listeria monocytogenes involved in tolerance to benzalkonium chloride. Appl Microbiol Biotechnol 103:1339–1350. doi: 10.1007/s00253-018-9551-y. [DOI] [PubMed] [Google Scholar]
- 32.Markkula A, Mattila M, Lindström M, Korkeala H. 2012. Genes encoding putative DEAD-box RNA helicases in Listeria monocytogenes EGD-e are needed for growth and motility at 3°C. Environ Microbiol 14:2223–2232. doi: 10.1111/j.1462-2920.2012.02761.x. [DOI] [PubMed] [Google Scholar]
- 33.Manuel CS, Van Stelten A, Wiedmann M, Nightingale KK, Orsi RH. 2015. Prevalence and distribution of Listeria monocytogenes inlA alleles prone to phase variation and inlA alleles with premature stop codon mutations among human, food, animal, and environmental isolates. Appl Environ Microbiol 81:8339–8345. doi: 10.1128/AEM.02752-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.O’Driscoll J, Glynn F, Cahalane O, O'Connell-Motherway M, Fitzgerald GF, Van Sinderen D. 2004. Lactococcal plasmid pNP40 encodes a novel, temperature-sensitive restriction-modification system. Appl Environ Microbiol 70:5546–5556. doi: 10.1128/AEM.70.9.5546-5556.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Collins B, Guinane CM, Cotter PD, Hill C, Ross RP. 2012. Assessing the contributions of the lias histidine kinase to the innate resistance of Listeria monocytogenes to nisin, cephalosporins, and disinfectants. Appl Environ Microbiol 78:2923–2929. doi: 10.1128/AEM.07402-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Deng Z, Shan Y, Pan Q, Gao X, Yan A. 11 July 2013, posting date. Anaerobic expression of the gadE-mdtEF multidrug efflux operon is primarily regulated by the two-component system ArcBA through antagonizing the H-NS mediated repression. Front Microbiol doi: 10.3389/fmicb.2013.00194. [DOI] [PMC free article] [PubMed] [Google Scholar]