Abstract
The cannabinoid receptor type 2 (CB2) is the peripheral receptor for cannabinoids, involved in the homeostatic control of several physiological functions. Male mitotic germ cells express a high level of CB2, whose activation promotes their differentiation in both in vitro and in vivo experiments, controlling the correct progression of spermatogenesis. However, it remains elusive if CB2 activation in spermatogonia could affect reproductive success in terms of fertility and healthy pregnancy outcomes. In this study, we explored the effects of male CB2 activation on sperm number and quality and its influence on next generation health. We show that exposure of male mice to JWH-133, a selective CB2 agonist, decreased sperm count, impaired placental development and reduced offspring growth. These defects were associated with altered DNA methylation/hydroxymethylation levels at imprinted genes in sperm and conserved in placenta. Our findings reveal that paternal selective activation of CB2 alters the sperm epigenome and compromises offspring growth. This study demonstrates, for the first time, a new role of CB2 signaling in male gametes in causing epigenetic alterations that can be transmitted to the next generation by sperm, highlighting potential risks induced by recreational cannabinoid exposure.
Subject terms: Embryogenesis, Risk factors
Introduction
Cannabis sativa (Marijuana) is the drug most commonly used by young men and women and its usage is rising with its legalization. The main psychoactive constituent of cannabis, Δ9- tetrahydrocannabinol (THC) binds to and activates both cannabinoid receptors CB1 and CB2. CB1 is the most abundant G protein-coupled receptor expressed in the brain, while CB2 is mainly expressed in immune cells1,2. Cannabinoid receptors, together with their endogenous ligands and all the enzymes involved in endocannabinoids biosynthesis and degradation, form the endocannabinoid system (ECS)3. ECS is deeply involved in the regulation of male and female reproduction4–6. Interference with the delicate balance of the ECS in germ cells, by the use of exogenous cannabinoids, has an adverse effect on reproduction. The two main cannabinoid receptors, CB1 and CB2, are both involved in male reproductive biology and in the testis they have distinct expression and roles. CB1 is mainly expressed by Leydig cells and mature sperm and its activation negatively affects sperm functions by inhibiting motility, capacitation and acrosome reaction7,8. In absence of CB1 signaling, sperms acquire motility precociously, suggesting a physiological inhibitory regulation of endocannabinoids on their motility during the transition into the epididymis9. CB2 is expressed by Sertoli cells and, at a higher level, by spermatogonia and its activation promotes germ cell meiotic entry both in vitro and in vivo, regulating the correct progression of spermatogenesis5. Indeed, chronic administration of JWH-133, a potent and selective CB2 agonist, to young male mice causes an acceleration of spermatogenesis, while treatment with specific CB2 antagonist has the opposite effect, slowing down the process10. Nevertheless, so far, no information has been reported on the effects of male exposure to JWH-133 on sperm number, morphology and function as well as on the potential impact on the offspring. This last outcome is of particular interest for the possible transmission by sperm of epigenetic alterations that could interfere and influence the health and development of future generations. Epigenetic alterations such as DNA methylation, histone modifications and/or non-coding RNAs, can occur during spermatogenesis following drug exposure. A number of human and animal studies have begun to reveal the long-term impact of cannabis and cannabinoid exposure on the neurodevelopment and behavior of the next generation, outlining the aberrant epigenetic modifications in brain and in the periphery linked to cannabis exposure11,12. Very recently Murphy et al. reported altered DNA methylation in sperm from humans and rats after cannabis or tetrahydrocannabinol (THC) exposure13. Here we investigated the effects of chronic exposure of young male mice to JWH-133 on reproductive success in terms of sperm quality, fertility and healthy pregnancy outcomes. We show that paternal exposure to JWH-133 reduced sperm count and caused defects in placental and embryonic development. These effects were associated with altered DNA methylation and hydroxymethylation at specific imprinted genes in sperm and in placenta. Our results underline the urgent need for studies evaluating the potential risks of cannabis/cannabinoid usage for offspring development and health.
Results
Chronic administration of JWH-133 reduces sperm count
Young male mice at P7 were injected with JWH-133 (1.5 mg/kg)10,14,15 or vehicle (see methods) and, at the end of 5 weeks, they were weighed and sacrificed. No differences between control and treated mice in body weight were detected at adulthood when they reached sexual maturity (Fig. 1A), while a significant reduction in testis weight of treated males was observed (Fig. 1B). To understand if the observed reduction in testicular volume was associated with a reduction in the number of spermatozoa, cauda epididymis were collected and needled to allow spermatozoa to “swim-out”. As indicated in Fig. 1C a significant reduction in the number of sperm from treated mice (2.08 ± 0.76 × 106/ml) with respect to control mice (2.93 ± 0.50 × 106/ml) was observed. However, sperms from treated mice were normally developed, as they did not show shape abnormalities nor altered motility (Fig. 1D).
To test the effect of JWH-133 treatment on male mating and fertility, adult JWH-133 treated male mice were crossed with untreated sexually mature CD-1 females. Vaginal plugs were evaluated every morning to determine if mating had occurred and each mated mouse was isolated in a separate cage. The mating rate was calculated as mean of the number of plugs occurring every morning for a week, while fertility rate was evaluated as the number of certainly pregnant females over the total number of plugged females. JWH-133 treatment of male mice did not cause significant alterations in mating rate (69.0 ± 18.66% in JWH-133 vs 79.50 ± 6.54% in control, Fig. 1E), fertility rate (76.2 ± 11% in JWH-133 vs 82 ± 2.01% in control, Fig. 1F) and litter size (13.65 ± 2.2% in JWH-133 vs 13.5 ± 3.3% in control, Fig. 1G). We conclude that chronic treatment of young male mice for 5 weeks with JWH-133 reduced sperm count without impacting fertility rate and litter size.
Paternal exposure to JWH-133 impairs offspring growth
In order to test the capacity of sperm from JWH-133-exposed males to generate healthy offspring, adult males were bred with mature CD-1 females never exposed to the drug and their F1 litters were examined at E13.5, E18.5, P1, P5, P7, P15, P20 and adult age. Although the pregnancy rate of females mated with JWH-133 treated males did not change compared with females mated with control males, we found that JWH-133 sired had lower birth weight and size (Table 1). Representative images of control and JWH-133 sired pups at P1, P5 and P7 are shown in Fig. 2A and their difference in body weight recorded at these ages is shown by scatter plot in Fig. 2B. Difference in body weight was maintained until adult age (Fig. 2C), while body size was recovered by P15, reaching the same parameters of control pups (Fig. 2D). Frequency of these birth abnormalities was observed in every litter and included males and females. Some organs from control and treated mice were weighed at P7, time at which difference between control and JWH-133 sired pups was clearly evident. As shown in Fig. S1A each organs’ weight of pups from treated mice was decreased, according to their reduced body weight. Consequently the ratio between organ weight and body weight did not show significant changes for each organ (Fig. S1B) indicating that treatment of fathers with JWH-133 impacted the overall development of the embryos and did not alter specific organ development. Furthermore, in order to exclude the presence of alterations in reproductive organs of F1 pups, male and female gonads of pups from control and JWH-133 exposed fathers were morphologically analyzed. Representative images of histological sections of testis and ovary at P7 showed no apparent abnormalities (Fig. S1C,D), indicating that male and female germ cells were present and normally developed. In addition, to investigate fertility of F1 mice from JWH-133 treated father, males were crossed with untreated females for four consecutive weeks. Accordingly with the normal development of the gonad, they showed no changes in mating, fertility rate and litter size respect with control mice (Fig. S1E), suggesting that fathers’ exposure to JWH-133 did not interfere with the reproductive function of F1 progeny. However, further studies will be required to understand if sperm epigenetic modifications of the exposed father are inherited by F1 males and transmitted transgenerationally.
Table 1.
CTRL | JWH-133 | ||
---|---|---|---|
Weight | 1dpp | 1.58 ± 0.23 | 1.43 ± 0.09 |
5dpp | 4.27 ± 0.54 | 3.16 ± 0.42 | |
7dpp | 6.05 ± 0.65 | 4.30 ± 0.53 | |
15dpp | 10.15 ± 0.68 | 7.58 ± 0.59 | |
20dpp | 12.80 ± 1.39 | 10.09 ± 0.88 | |
Length | 1dpp | 2.85 ± 0.09 | 2.65 ± 0.11 |
5dpp | 4.17 ± 0.18 | 3.77 ± 0.18 | |
7dpp | 4.89 ± 0.18 | 4.30 ± 0.21 | |
15dpp | 5.78 ± 0.35 | 5.67 ± 0.09 | |
20dpp | 6.98 ± 0.12 | 6.96 ± 0.15 |
Paternal exposure to JWH-133 causes embryonic and placental size defects
In order to investigate if low weight and small size at birth of pups from JWH-133 fathers were the result of embryonic developmental defects, E13.5 and E18.5 embryos were analyzed. We observed that paternal exposure to JWH-133 caused an evident decrease in embryo size and weight with respect to embryos from control fathers (Fig. 3A,C). However, histological examination of E13.5 and E18.5 whole embryos showed no organ-specific abnormalities in fetuses sired by JWH-133 males (Fig. 3B), suggesting that drug administration to the father negatively affected overall embryo growth. Defects in embryo growth are often associated with abnormalities in placental development. Indeed the placenta plays a critical role in the growth and survival of the fetus by promoting nutrient transfer from mother to fetus and changes in placental glycogen deposition are a common feature of pregnancy complications, particularly those associated with altered fetal growth16. Mouse placenta can be divided into a maternal decidual component and two fetal layers, the labyrinth zone (La) and the spongiotrophoblast layer (Sp). To determine if paternal JWH-133 exposure affected placental development, placentas were collected at E13.5 and E18.5 (Fig. 4A) and morphologically analyzed. The placental weight of fetuses sired from JWH-133 males was significantly lower with respect to the placentas of fetuses from control mice (Fig. 4B). Histological examination of sections of placenta at late gestation (E18.5) showed that those derived from JWH-133 mice had a significantly reduced total area (Fig. 4C). Interestingly, after PAS staining that allows to better visualize the spongiotrophoblast containing glycogen cells, measurement of the area of each layer showed that the percentage of spongiotrophoblast layer/total area was significantly smaller in JWH-133 placentas (n = 6) than in control placentas (n = 6) (33.83% ± 2.40 in JWH-133 vs. 42.0% ± 1.26 in control, P < 0.0001, Fig. 4D), while the percentage of labyrinth zone/total area was increased (64.0% ± 2.37 in JWH-133 vs. 57.5% ± 1.05 in control, P < 0.001, Fig. 4E). Moreover, a strongly reduced number of islets of the spongiotrophoblast layer in the labyrinth zone was found in placentas from JWH-133 mice with respect to control placentas (Fig. 5A,B). The number of independent islets was quantified in the placentas of two groups, demonstrating that paternal exposure to cannabinoid JWH-133 caused them a strong reduction (24.67 ± 1.03 in JWH-133 vs. 59.17 ± 5.04 in control, P < 0.0001, Fig. 5C), indicating the presence of a thinner and less invasive spongiotrophoblast layer.
Altered DNA methylation in sperm of JWH-133 exposed males
Previous studies have established a critical function of some imprinted genes in embryonic and placental development17,18. Imprinted genes rely on DNA methylation to silence and activate alleles in a parent-of-origin specific manner, ensuring the reciprocal expression of specific genes. In mammals, de novo DNA methylation is established by DNMT3A and DNMT3B and is then maintained by DNMT1 during cell division19. Instead, TET proteins, including TET1, TET2, and TET3, are crucial regulators of active DNA demethylation and catalyze the oxidation of 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC)20. To understand the molecular events responsible for the phenotypic alterations observed in placentas and embryos from JWH-133 males, we analyzed the expression level of key genes responsible for DNA methylation (Dnmt1, Dnmt3a, Dnmt3b, Dnmt3l) and DNA hydroxymethylation (Tet1-3), in sperm from treated and untreated mice. We found that Tet3 gene expression was significantly decreased (p < 0.01) in sperm of exposed males as well as the expression of Tet1 and Tet2, although not significantly. On the other hand, no changes were detected for Dnmts expression levels (Fig. 6A). In order to investigate whether the observed reduction of Tet genes expression was functionally correlated to a change in DNA methylation and hydroxymethylation levels of imprinted genes involved in placental and embryonic growth/development, we focused our analysis on H19, Peg10 and Plagl1 genes. H19 is a maternally expressed imprinted gene that is hypermethylated in sperm and functions as a trans regulator of other imprinted genes during embryo growth21,22, Peg10 is a paternally expressed gene essential for the formation of the placenta in humans and mice23 and Plagl1 (also known as ZAC, LOT1 and Zac1 in mouse) is a paternally expressed gene and key regulator of a network of other imprinted genes, involved in embryonic growth and development24. DNA methylation/hydroxymethylation level of these target genes was assessed by DNA immunoprecipitation with anti-5mC and anti-5hmC antibodies, followed by real-time PCR (Fig. 6B). Interestingly, we found a significant enrichment of 5mC at Peg10 and Plagl1 genes in sperm of JWH-133 males concomitantly with a decrease in 5hmC, while no changes in DNA methylation/hydroxymethylation were observed for H19 gene which is maternally expressed (Fig. 6B). Next, we investigated the methylation levels of these genes in E13.5 placentas derived from control and treated males. We found that placentas from JWH-133 males showed alterations in 5mC and 5hmC levels at Peg10 and Plagl1 genes similar to those observed in sperm of JWH-133 treated males (Fig. 6C). In conclusion, our results indicate that paternal exposure to CB2 agonist JWH-133 causes alterations in the sperm epigenome, which are then transferred to embryonic tissues and may account for the observed growth defects.
Chronic exposure to JWH-133 affects the immune system
It is well established that CB2 is abundantly expressed in cells of the immune system2,25 and that selective activation of this receptor down-regulates immune response. Therefore, CB2-selective agonists have been demonstrated to play an anti-inflammatory and immunosuppressive role in mice models. In order to verify the health status of mice chronically exposed to JWH-133, we evaluated hematological parameters on blood samples collected from the orbital sinus through a hemocytometer. We report that drug treatment caused a significant decrease in the number of white blood cells (WBC, 6.12 ± 2.34 K/µl in JWH-133 vs 8.83 ± 3.16 K/µl in controls) and circulating lymphocytes (LYM, 4.32 ± 1.47 K/µl in JWH-133 vs 6.48 ± 2.75 K/µl in controls), while no differences were detected in mid-size cells (MID, 0.83 ± 0.38 K/µl in JWH-133 vs 0.77 ± 0.61 K/µl in controls), granulocytes (GRA, 0.73 ± 0.37 K/µl in JWH-133 vs 0.73 ± 0.44 K/µl in controls) as well as in red blood cells (RBC, 9.2 ± 0.60 M/µl in JWH-133 vs 8.86 ± 0.86 M/µl in controls) and platelets (892.0 ± 405.9 K/µl in JWH-133 vs 985.8 ± 261.9 in controls) (Fig. 7A). Spleen size and weight were similar between control and treated mice (Fig. 7B) as well as the number of T, B and NK lymphocytes analyzed by FACS (Fig. 7C). All together these results indicate that in vivo administration of JWH-133, reduced the number of WBC and circulating lymphocytes without affecting splenic lymphocyte populations.
Discussion
This study aimed at evaluating the involvement of CB2 cannabinoid receptor in male reproductive performance. We previously reported that in the testis CB2 is expressed at a high level by spermatogonia and its in vivo activation, by using JWH-133, a synthetic CB2‐selective cannabinoid agonist, caused alteration of the temporal progression of spermatogenesis5,10. Here we report evidence that chronic exposure of young male mice to JWH-133 altered sperm count and epigenome affecting offspring growth. JWH-133 drug has been recently indicated as one of the best recommended CB2 selective agonists to study the role of CB2 in biological and disease processes26. Indeed, JWH-133 has a high potency (inhibitor constant = 3.4 nM) and selectivity (200‐fold more binding affinity over CB1) to CB2 and it has been suggested very suitable for preclinical studies26,27. Here we show that overactivation of CB2 signaling in young males affected spermatogenesis by decreasing sperm count of about 30%, without altering their motility, a function instead correlated to CB1 activation7,9. Production of a correct sperm count is under strict control of testosterone and alteration in its level impairs fertility28. CB1 has been indicated as an important regulator of testosterone production in testis since its activation inhibits basal testosterone secretion in vivo and in vitro. Indeed CB1 is expressed in hypothalamus, pituitary gland and Leydig cells, while CB2 receptor has never been identified there29. Thus, we are confident that our results on the decrease of sperm count, induced by activation of CB2 and associated to unchanged mating and fertility, is not caused by altered testosterone level. Instead we speculate that this reduction in sperm count is determined by an apoptotic effect of the drug on CB2 expressing germ cells. Accordingly, we previously observed a similar effect in fetal oocytes, in which activation of CB2 induced their differentiation but concomitantly determined apoptotic cell death30. Although chronic exposure to JWH-133 caused a significant decrease in sperm count, mating and fertility were not impaired and no reduction of litter size nor frequency was observed. Additional studies will be needed in order to elucidate the molecular mechanisms involved in germ cell apoptosis induced by CB2 overactivation.
To test the function of sperm from JWH-133 exposed mice, we evaluated its capacity to generate healthy offspring after crossing with unexposed females. We found that pups, sired from JWH-133 male mice, were smaller and lighter at birth than those sired from control untreated mice, indicating that paternal cannabinoid administration altered offspring growth. Accordingly, we observed that growth defects were already evident in E13.5 and E18.5 embryos and were maintained after birth up to one month, when pups begin feeding themselves and become independent from maternal lactation. Several causes can affect fetal growth amongst which placental defects are the most common. Abnormal placental development underlies a wide range of complications during pregnancy, including intrauterine growth restriction, preeclampsia and miscarriage31–33. Analysis of placentas from females fertilized by JWH-133 exposed fathers, showed a reduction in total weight by about 10–15%, with a thinner spongiotrophoblast layer (Sp) with respect to placentas from females fertilized by control fathers.
Placental and embryonic development depends on information transmitted from the gametes and epigenetic modifications are important determinants for gamete quality and offspring development. DNA methylation is one of the most studied epigenetic modifications involved in gene silencing. The steady-state level of methylation of a gene is determined by a balance between the actions of DNMT and TET enzymes. While DNMT enzymes establish DNA methylation patterns19, TET proteins play an important role in active DNA demethylation, by catalyzing the oxidation of 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC)20. We found an evident decrease in the expression level of all Tet genes in sperm from JWH-133 exposed males, especially significant for Tet3, while the expression of Dnmts was not significantly modified. As TET enzymes promote DNA demethylation, their reduced expression could be compatible with an increased DNA methylation. We focused our attention on imprinted genes because (i) they are expressed in a parent-of-origin specific manner through epigenetic processes occurring during gametogenesis and maintained in the developing embryo34; (ii) several paternally expressed imprinted genes are crucial for placental development and fetal growth: DIO3, DLK1, HYMAI, IGF2, MAGEL2, MEST, PEG10, PEG3, PLAGL1, SFRP235,36. Among these genes, we selected Peg10 and Plagl1 for some considerations. Peg10, since it is a highly conserved gene among mammalian species and Plagl1 since it is considered a master regulator of growth and development of the fetus/placenta. Peg10 is a conserved retrotransposon-derived gene that is methylated in the female germline and its deletion causing severe defects in placenta formation and embryonic growth23. Plagl1 encodes a zinc finger transcription factor and has been shown to upregulate a cluster of imprinted genes (H19, IGF2, CDKN1C) in mice and its loss results in severe embryo growth restriction24. We showed a reduced DNA hydroxymethylation and an increased DNA methylation at these paternally expressed genes in sperm from JWH-133-exposed males. Notably, the maternally expressed H19 gene was unaffected by JWH-133 treatment. Interestingly, DNA hypermethylation of Peg10 and Plagl1 genes in sperm was found conserved in placentas from JWH-133 exposed fathers. These results indicate that JWH-133-dependent defects in the sperm epigenome can be inherited by embryonic tissues and may be responsible for the observed growth impairment, also via downregulation of Peg10 and Plagl1 imprinted genes37. We cannot exclude that other genes could be affected by JWH-133 paternal exposure, predisposing offspring to metabolic and chronic diseases in adulthood.
More broadly, our findings support the notion that epigenetic marks can be modified by cannabinoid exposure and are in agreement with recent data reporting altered DNA methylation linked to Cannabis exposure in humans and animal models, in immune cells, in the brain and in sperm13,38–40. More importantly, this study highlights the role of CB2 overactivation in causing alterations of sperm DNA methylation that are inherited by the next generation with negative implications for offspring growth. However, we cannot exclude that reduced fetal growth may have adverse consequences on lifelong health41. Further studies will be required to understand if paternal exposure to cannabinoid could generate heritable epigenetic changes that would impact the fate of the next generations.
We further report that CB2 overactivation on the immune system, where CB2 is particularly abundant, affected hematological parameters inducing a significant decrease in the number of circulating lymphocytes. We believe that such effect in healthy males is probably mediated by the CB2 pathway as it has been previously reported in autoimmune disease models, in which activation of CB2 has been shown to suppress inflammation42–45.
In the context of Cannabis abuse, THC is believed to exert the majority of its actions as a partial agonist at both CB1 and CB2 receptors. However, it should be underlined that, besides THC, marijuana contains more than 100 other cannabinoids, whose mechanisms of action are still poorly known46. Thus it is possible that, some of them could act as full agonists of CB2, like JWH-133, or might modulate the effects of THC.
In conclusion, our findings highlight the potential consequences that paternal Cannabis exposure may have on immune function and reproductive success.
Methods
Animal care and ethics statement
All animal breeding, maintenance and research protocols were conducted as described in the project approved by the Ethics Committee of the Interdepartmental Service Centre - Station for Animal Technology (STA)-University of Rome Tor Vergata and in accordance with national and international laws and policies (Directive 2010/63/EU of the European Parliament and of the Council, Italian Legislative Decree 26/2014). In this study, we used CD-1 mice provided by the STA. Mice were randomly assigned and housed in standard clear plastic cages, kept in light/dark cycle of 12:12 hr and ventilation 10–20 times/h, with ad libitum water and food. Mice were kept in social groups at a constant temperature of 20 ± 2 °C, and relative humidity of 50 ± 10%. A block randomization method was used to randomize subjects into groups resulting in equal sample sizes. The investigators were blinded to the treatments.
In vivo experimental procedure
P7 CD-1 male mice (n = 12) were intraperitoneally injected with JWH-133 (1.5 mg·kg−1) (Tocris, Bioscience, Bristol UK) for 5 consecutive days at 24 h intervals, followed by 2 days of rest. This procedure was repeated for five consecutive weeks. Control group (n = 12) was injected with the vehicle phosphate-buffered saline (PBS). The dosage of administrations were based on previous studies10,14,15,26,45. At the end of treatment, control (n = 6/12) and JWH-133-treated mice (n = 6/12) were randomly selected and crossed with untreated and sexually mature CD-1 female (single male pared with single female, n = 3 total females for each male) in order to analyze fertility and offspring health. Pregnancy was validated by visualizing the vaginal plug. Placentas and embryos from the two groups (control and JWH-133 treated) were recovered at E13.5 and E18.5 and morphologically analyzed. For each group, we recorded the number and weight of pups at delivery; weight of pups was recorded up to one month. For each group the number of animals analyzed was: n=80 embryos at E13.5, n=80 at E18.5 and n=80 newborns. Pups were generated from three independent treatments of male mice.
Sperm analysis
At the end of treatment, control (n = 6/12) and JWH-133-treated mice (n = 6/12) were randomly selected and sacrificed to analyze sperm number, morphology and motility. Epididymes were removed and cauda were isolated for spermatozoa collection. Tissues (cauda) were immersed in PBS and needled to allow spermatozoa “swim-out”. Then spermatozoa samples were filtered, and sperm suspensions were analyzed to evaluate the morphology and the number of viable and motile cells under a light microscope, by using a Burker Chamber. Sperm motility was determined by count of duplicate measures of 200 sperms. This procedure was validated using double-blind test.
Quantitative reverse transcription PCR (RT-qPCR)
Total RNA was isolated with TRI reagent (Ambion, Waltham, MA USA) according to manufacturer’s instructions by adding 20 µg of glycogen as a RNA carrier. Equal amounts of RNA were used to produce cDNA by means of PrimeScript RT Reagent Kit (Perfect Real Time) (Takara). Real-Time PCR reactions were performed by SYBR Premix Ex Taq II (Tli RNase H Plus) (Takara) with the following primers: Dnmt1(Forw: CTTCACCTAGTTCCGTGGCTA, Rev: CCCTCTTCCGACTCTTCCTT); Dnmt3a (Forw: GCACCAGGGAAAGATCATGT, Rev: CAATGGAGAGGTCATTGCAG); Dnmt3b (Forw: GGATGTTCGAGAATGTTGTGG, Rev: GTGAGCAGCAGACACCTTGA); Dnmt3l (Forw: CTGCTGACTGAGGATGACCA, Rev: GCTTGCTCCTGCTTCTGACT); Tet1 (Forw: TTTGGTTCGTGAGCGTGTAG, Rev: TGCAGGTACGCTTTTTGTTG); Tet2 (Forw: TGTTGTTGTCAGGGTGAGAATC, Rev: TCTTGCTTCTGGCAAACTTAC); Tet3 (Forw: AAGATAACAATCACGGCGTTC, Rev: CCGGATTGAGAAGGTCATCTAC); b-actin (Forw: CACACCCGCCACCAGTTCGC, Rev: TTGCACATGCCGGAGCCGTT).
Methylated and hydroxymethylated DNA immunoprecipitation (MeDIP/hMeDIP) from sperm and placenta
Total DNA was isolated with TRI reagent (Ambion, Waltham, MA USA) according to manufacturer’s instructions and adding 20 µg of glycogen as DNA carrier. DNA immunoprecipitation was performed as previously described with some modifications47. Equal amounts of purified DNA from sperm samples (n = 6 for each group) or from E13.5 placentas (n = 6 for each group), were sonicated (40% amplitude; 0.5 cycle) to obtain fragments about 500 bp-300bp. Samples were heat-denatured for 10 min at 95 °C and immediately cooled on ice for 10 min. Sonicated DNA (2.5 µg) was diluted in IP buffer (10 mM Na-Phosphate buffer pH 7.0, 0.14 M NaCl, 0.05% Triton X-100) and pooled DNA was used for immunoprecipitation with 1 μg of anti-5mC (EpiGentek) or anti-5hmC (Active Motif) antibodies and normal rabbit/mouse IgGs as control. DNA–antibody mixtures were incubated 16 h and then 45 μl of the Protein-A or G Agarose beads (Millipore) were added and incubated for 2 h on a rotating platform at 4 °C. Beads and immunocomplexes were washed with IP buffer, digested with proteinase K (Sigma-Aldrich) and subjected to standard phenol–chloroform, ethanol precipitation procedure for DNA extraction. Air-dried DNA pellets were used for qPCR amplification. The following primers pairs were used for PCR analyses: Plagl1 ICR (Forw: TAAGTAGTGACAACCGGGGC; Rev: TTTTGCTGCATCTCTGGCTG); Peg10 ICR (Forw: CGCTTCAGCGTACGAACGAGCA; Rev: GTGCCGCAGTTTGTAGCGCATT); H19 ICR (Forw: TGGCTCACTATAGGAAGGCAT; Rev: AAGTTGGCAGCATTTGGG).
Hemocytometric analysis
Blood samples from JWH-133 treated and control adult mice (n = 10 for each group) were collected through a withdrawal from the orbital sinus. Approximately 100 μl of blood were drawn from each pup. Complete blood counts were obtained on an automated cell counter (Drew-3 Hematologic System).
Flow cytometry
Splenocytes from control (n = 5) and JWH-133-treated (n = 5) mice were harvested and smashed through a 70 μm cell strainer (BD Falcon). After brief centrifugation, the cellular pellet was resuspended and incubated for 5 min in ACK lysing buffer (Lonza) in order to remove red blood cells. After extensive washing cells were counted and adjusted to a concentration of 1 × 106 cells/mL in ice-cold FACS buffer (PBS, 0.5% BSA, 0.01% Sodium Azide). Cells were stained with a mix of monoclonal antibodies containing PE-Cy5 conjugated anti-CD3 (BD Pharmingen, clone 17A2), FITC conjugated anti-mouse B220 (BD Pharmingen, clone RA3-6B2), and PE-conjugated anti-mouse NK (BD Pharmingen, clone DX5), all diluted 1:100 in FACS buffer; after an incubation of 30 min at 4 °C, in the dark, cells were washed and fixed with 1% paraformaldehyde. Cells were then acquired and analyzed with a flow cytometer (model FACSCalibur BD) using ProCellQuest software (BD). At least 10.000 events for each sample were acquired.
Histological analysis
Organs were fixed in Bouin’s solution or 4% paraformaldehyde, embedded in paraplast, sectioned at 5μm Leica-RM 2035 Microtome and stained with hematoxylin and eosin (H&E). Histological sections of placentas at E18.5 (n = 6 from each group) were stained with Periodic Acid Schiff (PAS) to visualize the spongiotrophoblast. Placental layers (labyrinth and spongiotrophoblast) were outlined manually and their areas were measured on five sections per placenta by using ImageJ. Histological sections of embryos at E13.5 and E18.5 were stained with H&E.
Statistical analysis
Student’s t-test was used to test for differences between two independent groups. All statistical tests were carried out using the GraphPad Prism statistical analysis software package, version 6.0.
Supplementary information
Acknowledgements
We thank Prof. Susanna Dolci and Prof. Claudio Sette for their suggestions, Prof. Raffaele Geremia and Dr. Marco Barchi for critically reading the manuscript. We thank Dr. Elisa Cirelli for technical assistance in animal manipulation. This work was supported by Mission Sustainability GRANT of the University of Rome Tor Vergata (2017).
Author contributions
E.I. and E.D.D. performed the experiments, analyzed and discussed the data; F.C. and M.Z. contributed to the study design of epigenetic modifications and performed sperm and placenta DNA methylation analysis; G.R. and E.I. performed histological analysis; R.B., R.C. and M.M. contributed to hematological analysis of blood and FACS analysis. P.G. designed the study, discussed data and wrote the manuscript. All authors read and approved the final version of the manuscript.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
These authors contributed equally: Elisa Innocenzi and Emanuela De Domenico.
Supplementary information
is available for this paper at 10.1038/s41598-019-53579-3.
References
- 1.Howlett AC, et al. International Union of Pharmacology. XXVII. Classification of Cannabinoid Receptors. Pharmacol Rev. 2002;54:161–202. doi: 10.1124/pr.54.2.161. [DOI] [PubMed] [Google Scholar]
- 2.Ziring D, et al. Formation of B and T cell subsets require the cannabinoid receptor CB2. Immunogenetics. 2006;58:714–725. doi: 10.1007/s00251-006-0138-x. [DOI] [PubMed] [Google Scholar]
- 3.De Petrocellis L, Cascio MG, Di Marzo V. The endocannabinoid system: a general view and latest additions. Br. J. Pharmacol. 2004;141:765–774. doi: 10.1038/sj.bjp.0705666. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.El-Talatini MR, et al. Localisation and function of the endocannabinoid system in the human ovary. PLoS ONE. 2009;4:e4579. doi: 10.1371/journal.pone.0004579. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Grimaldi P, et al. The endocannabinoid system and pivotal role of the CB2 receptor in mouse spermatogenesis. Proc. Natl. Acad. Sci. USA. 2009;106:11131–11136. doi: 10.1073/pnas.0812789106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Bari M, Battista N, Pirazzi V, Maccarrone M. The manifold actions of endocannabinoids on female and male reproductive events. Front Biosci (Landmark Ed) 2011;16:498–516. doi: 10.2741/3701. [DOI] [PubMed] [Google Scholar]
- 7.Rossato M, Ion Popa F, Ferigo M, Clari G, Foresta C. Human sperm express cannabinoid receptor Cb1, the activation of which inhibits motility, acrosome reaction, and mitochondrial function. J. Clin. Endocrinol. Metab. 2005;90:984–991. doi: 10.1210/jc.2004-1287. [DOI] [PubMed] [Google Scholar]
- 8.Cobellis G, et al. Endocannabinoid system in frog and rodent testis: type-1 cannabinoid receptor and fatty acid amide hydrolase activity in male germ cells. Biol. Reprod. 2006;75:82–89. doi: 10.1095/biolreprod.106.051730. [DOI] [PubMed] [Google Scholar]
- 9.Cobellis G, et al. A gradient of 2-arachidonoylglycerol regulates mouse epididymal sperm cell start-up. Biol. Reprod. 2010;82:451–458. doi: 10.1095/biolreprod.109.079210. [DOI] [PubMed] [Google Scholar]
- 10.Di Giacomo D, De Domenico E, Sette C, Geremia R, Grimaldi P. Type 2 cannabinoid receptor contributes to the physiological regulation of spermatogenesis. FASEB J. 2016;30:1453–1463. doi: 10.1096/fj.15-279034. [DOI] [PubMed] [Google Scholar]
- 11.Watson CT, et al. Genome-Wide DNA Methylation Profiling Reveals Epigenetic Changes in the Rat Nucleus Accumbens Associated With Cross-Generational Effects of Adolescent THC Exposure. Neuropsychopharmacology. 2015;40:2993–3005. doi: 10.1038/npp.2015.155. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Szutorisz H, Hurd YL. High times for cannabis: Epigenetic imprint and its legacy on brain and behavior. Neurosci Biobehav Rev. 2018;85:93–101. doi: 10.1016/j.neubiorev.2017.05.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Murphy Susan K., Itchon-Ramos Nilda, Visco Zachary, Huang Zhiqing, Grenier Carole, Schrott Rose, Acharya Kelly, Boudreau Marie-Helene, Price Thomas M., Raburn Douglas J., Corcoran David L., Lucas Joseph E., Mitchell John T., McClernon F. Joseph, Cauley Marty, Hall Brandon J., Levin Edward D., Kollins Scott H. Cannabinoid exposure and altered DNA methylation in rat and human sperm. Epigenetics. 2018;13(12):1208–1221. doi: 10.1080/15592294.2018.1554521. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Baker D, et al. Cannabinoids control spasticity and tremor in a multiple sclerosis model. Nature. 2000;404:84–87. doi: 10.1038/35003583. [DOI] [PubMed] [Google Scholar]
- 15.Pertwee RG. Pharmacology of cannabinoid receptor ligands. Curr. Med. Chem. 1999;6:635–664. [PubMed] [Google Scholar]
- 16.Akison LK, Nitert MD, Clifton VL, Moritz KM, Simmons DG. Review: Alterations in placental glycogen deposition in complicated pregnancies: Current preclinical and clinical evidence. Placenta. 2017;54:52–58. doi: 10.1016/j.placenta.2017.01.114. [DOI] [PubMed] [Google Scholar]
- 17.Bartolomei, M. S. & Ferguson-Smith, A. C. Mammalian genomic imprinting. Cold Spring Harb Perspect Biol3 (2011). [DOI] [PMC free article] [PubMed]
- 18.Wang X, Miller DC, Harman R, Antczak DF, Clark AG. Paternally expressed genes predominate in the placenta. Proc. Natl. Acad. Sci. USA. 2013;110:10705–10710. doi: 10.1073/pnas.1308998110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Chen T, Li E. Structure and function of eukaryotic DNA methyltransferases. Curr. Top. Dev. Biol. 2004;60:55–89. doi: 10.1016/S0070-2153(04)60003-2. [DOI] [PubMed] [Google Scholar]
- 20.Wu H, Zhang Y. Reversing DNA methylation: mechanisms, genomics, and biological functions. Cell. 2014;156:45–68. doi: 10.1016/j.cell.2013.12.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Gabory A, et al. H19 acts as a trans regulator of the imprinted gene network controlling growth in mice. Development. 2009;136:3413–3421. doi: 10.1242/dev.036061. [DOI] [PubMed] [Google Scholar]
- 22.Gebert C, Kunkel D, Grinberg A, Pfeifer K. H19 imprinting control region methylation requires an imprinted environment only in the male germ line. Mol. Cell. Biol. 2010;30:1108–1115. doi: 10.1128/MCB.00575-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Ono R, et al. Deletion of Peg10, an imprinted gene acquired from a retrotransposon, causes early embryonic lethality. Nat. Genet. 2006;38:101–106. doi: 10.1038/ng1699. [DOI] [PubMed] [Google Scholar]
- 24.Varrault A, et al. Zac1 regulates an imprinted gene network critically involved in the control of embryonic growth. Dev. Cell. 2006;11:711–722. doi: 10.1016/j.devcel.2006.09.003. [DOI] [PubMed] [Google Scholar]
- 25.Lee SF, Newton C, Widen R, Friedman H, Klein TW. Differential expression of cannabinoid CB2 receptor mRNA in mouse immune cell subpopulations and following B cell stimulation. European Journal of Pharmacology. 2001;423:235–241. doi: 10.1016/S0014-2999(01)01122-0. [DOI] [PubMed] [Google Scholar]
- 26.Soethoudt M, et al. Cannabinoid CB2 receptor ligand profiling reveals biased signalling and off-target activity. Nat Commun. 2017;8:13958. doi: 10.1038/ncomms13958. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Huffman JW, et al. 1-Bromo-3-(1′,1′-dimethylalkyl)-1-deoxy-Δ(8)-tetrahydrocannabinols: New selective ligands for the cannabinoid CB(2) receptor. Bioorg. Med. Chem. 2010;18:7809–7815. doi: 10.1016/j.bmc.2010.09.061. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Dohle GR, Smit M, Weber RFA. Androgens and male fertility. World J Urol. 2003;21:341–345. doi: 10.1007/s00345-003-0365-9. [DOI] [PubMed] [Google Scholar]
- 29.Wenger T, Ledent C, Csernus V, Gerendai I. The central cannabinoid receptor inactivation suppresses endocrine reproductive functions. Biochem. Biophys. Res. Commun. 2001;284:363–368. doi: 10.1006/bbrc.2001.4977. [DOI] [PubMed] [Google Scholar]
- 30.De Domenico E, et al. Overactive type 2 cannabinoid receptor induces meiosis in fetal gonads and impairs ovarian reserve. Cell Death Dis. 2017;8:e3085. doi: 10.1038/cddis.2017.496. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Cross JC, Nakano H, Natale DRC, Simmons DG, Watson ED. Branching morphogenesis during development of placental villi. Differentiation. 2006;74:393–401. doi: 10.1111/j.1432-0436.2006.00103.x. [DOI] [PubMed] [Google Scholar]
- 32.Fowden AL, Forhead AJ, Coan PM, Burton GJ. The placenta and intrauterine programming. J. Neuroendocrinol. 2008;20:439–450. doi: 10.1111/j.1365-2826.2008.01663.x. [DOI] [PubMed] [Google Scholar]
- 33.Longtine MS, Nelson DM. Placental dysfunction and fetal programming: the importance of placental size, shape, histopathology, and molecular composition. Semin. Reprod. Med. 2011;29:187–196. doi: 10.1055/s-0031-1275515. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Reik W, Walter J. Genomic imprinting: parental influence on the genome. Nat Rev Genet. 2001;2:21–32. doi: 10.1038/35047554. [DOI] [PubMed] [Google Scholar]
- 35.Bressan FF, et al. Unearthing the roles of imprinted genes in the placenta. Placenta. 2009;30:823–834. doi: 10.1016/j.placenta.2009.07.007. [DOI] [PubMed] [Google Scholar]
- 36.Piedrahita JA. The role of imprinted genes in fetal growth abnormalities. Birth Defects Research Part A: Clinical and Molecular Teratology. 2011;91:682–692. doi: 10.1002/bdra.20795. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Jacob S, Moley KH. Gametes and Embryo Epigenetic Reprogramming Affect Developmental Outcome: Implication for Assisted Reproductive Technologies. Pediatr Res. 2005;58:437–446. doi: 10.1203/01.PDR.0000179401.17161.D3. [DOI] [PubMed] [Google Scholar]
- 38.Jackson AR, Nagarkatti P, Nagarkatti M. Anandamide attenuates Th-17 cell-mediated delayed-type hypersensitivity response by triggering IL-10 production and consequent microRNA induction. PLoS ONE. 2014;9:e93954. doi: 10.1371/journal.pone.0093954. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Yang X, et al. Histone modifications are associated with Δ9-tetrahydrocannabinol-mediated alterations in antigen-specific T cell responses. J. Biol. Chem. 2014;289:18707–18718. doi: 10.1074/jbc.M113.545210. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Szutorisz H, Hurd YL. Epigenetic Effects of Cannabis Exposure. Biol. Psychiatry. 2016;79:586–594. doi: 10.1016/j.biopsych.2015.09.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Longo S, et al. Short-term and long-term sequelae in intrauterine growth retardation (IUGR) J. Matern. Fetal. Neonatal. Med. 2013;26:222–225. doi: 10.3109/14767058.2012.715006. [DOI] [PubMed] [Google Scholar]
- 42.Malfait AM, et al. The nonpsychoactive cannabis constituent cannabidiol is an oral anti-arthritic therapeutic in murine collagen-induced arthritis. Proc. Natl. Acad. Sci. USA. 2000;97:9561–9566. doi: 10.1073/pnas.160105897. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Arévalo-Martín A, Vela JM, Molina-Holgado E, Borrell J, Guaza C. Therapeutic action of cannabinoids in a murine model of multiple sclerosis. J. Neurosci. 2003;23:2511–2516. doi: 10.1523/JNEUROSCI.23-07-02511.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Sánchez AJ, González-Pérez P, Galve-Roperh I, García-Merino A. R-(+)-[2,3-Dihydro-5-methyl-3-(4-morpholinylmethyl)-pyrrolo-[1,2,3-de]-1,4-benzoxazin-6-yl]-1-naphtalenylmethanone (WIN-2) ameliorates experimental autoimmune encephalomyelitis and induces encephalitogenic T cell apoptosis: partial involvement of the CB(2) receptor. Biochem. Pharmacol. 2006;72:1697–1706. doi: 10.1016/j.bcp.2006.08.018. [DOI] [PubMed] [Google Scholar]
- 45.Xu H, et al. Anti-inflammatory property of the cannabinoid receptor-2-selective agonist JWH-133 in a rodent model of autoimmune uveoretinitis. J. Leukoc. Biol. 2007;82:532–541. doi: 10.1189/jlb.0307159. [DOI] [PubMed] [Google Scholar]
- 46.Izzo AA, Borrelli F, Capasso R, Di Marzo V, Mechoulam R. Non-psychotropic plant cannabinoids: new therapeutic opportunities from an ancient herb. Trends Pharmacol. Sci. 2009;30:515–527. doi: 10.1016/j.tips.2009.07.006. [DOI] [PubMed] [Google Scholar]
- 47.Ciccarone, F., Castelli, S., Ioannilli, L. & Ciriolo, M. R. High Dietary Fat Intake Affects DNA Methylation/Hydroxymethylation in Mouse Heart: Epigenetic Hints for Obesity-Related Cardiac Dysfunction. Mol Nutr Food Res e1800970, 10.1002/mnfr.201800970 (2018). [DOI] [PubMed]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.