Diverse resistance mechanisms to the third-generation ALK inhibitor lorlatinib in ALK-rearranged lung cancer

Abstract

Purpose

Lorlatinib is a third-generation ALK tyrosine kinase inhibitor with proven efficacy in patients with ALK-rearranged lung cancer previously treated with first and second-generation ALK inhibitors. Beside compound mutations in the ALK kinase domain, other resistance mechanisms driving lorlatinib resistance remain unknown. We aimed to characterize mechanisms of resistance to lorlatinib occurring in patients with ALK-rearranged lung cancer and design new therapeutic strategies in this setting.

Experimental Design

Resistance mechanisms were investigated in five patients resistant to lorlatinib. Longitudinal tumor biopsies were studied using high-throughput next-generation sequencing. Patient-derived models were developed to characterize the acquired resistance mechanisms and Ba/F3 cell mutants were generated to study the effect of novel ALK compound mutations. Drug combinatory strategies were evaluated in vitro and in vivo to overcome lorlatinib resistance.

Results

Divers biological mechanism leading to lorlatinib resistance were identified. Epithelial-mesenchymal transition (EMT) mediated resistance in two patient-derived cell lines and was susceptible to dual SRC and ALK inhibition. We characterized three ALK kinase domain compound mutations occurring in patients, L1196M/D1203N, F1174L/G1202R and C1156Y/G1269A, with differential susceptibility to ALK inhibition by lorlatinib. We identified a novel by-pass mechanism of resistance caused by NF2 loss of function mutations, conferring sensitivity to treatment with mTOR inhibitors.

Conclusion

This study shows that mechanisms of resistance to lorlatinib are diverse and complex, requiring new therapeutic strategies to tailor treatment upon disease progression.

Introduction

The anaplastic lymphoma kinase (ALK) is a member of the family of insulin-like tyrosine kinase receptors involved in the oncogenesis of several tumor types (1). ALK gene rearrangements occur in 3-6% of lung adenocarcinoma (2,3). Patients diagnosed with ALK-rearranged lung cancer benefit from treatment with ALK tyrosine kinase inhibitors (TKI) (4).

Lorlatinib is a potent third-generation ALK inhibitor able to overcome resistance to first and second generation ALK inhibitors, including those mediated by the G1202R mutation and has marked activity on brain metastasis (5). Clinical responses with lorlatinib were observed in 39% of patients previously treated with two or more ALK inhibitors and median PFS was 6.9 months (6,7). Nevertheless, as with first and second generation ALK inhibitors, resistance to lorlatinib treatment invariably occurs.

The spectrum of biological mechanisms driving lorlatinib resistance in patients remains to be elucidated. It has been recently reported that the sequential acquisition of two or more mutations in the ALK kinase domain (KD), also referred as compound mutations, is responsible for disease progression in about 35% of patients treated with lorlatinib, mainly by impairing its binding to the ALK kinase domain (8).

Herein we report the in vitro characterization of three resistance mechanisms detected in patients with ALK-rearranged lung cancer on lorlatinib, included in the prospective MATCH-R study (NCT02517892). These mechanisms include the occurrence of epithelial-mesenchymal transition (EMT) susceptible to combined ALK/SRC inhibition (patient MR57 and MR210), the acquisition of a novel compound mutation (G1202R/F1174L in MR144) and the pre-existing L1196M/D1203N (MR347) as well as NF2-loss of function mediated resistance overcome by mTOR inhibitors (MR135).

Materials and Methods

MATCH-R clinical trial

The MATCH-R study is a prospective single-institution trial running at Gustave Roussy Cancer Campus (Villejuif, France), aiming to identify mechanisms of resistance to targeted therapies in patients with advanced cancer (NCT02517892). Patients that achieved a partial or complete response, or stability of disease for at least six months with selected targeted agents were included in the study and underwent serial tumor biopsies. Extensive molecular tumor profiling was performed by panel targeted next-generation sequencing (NGS) (Ion torrent), whole exome sequencing (WES) and RNA sequencing (Illumina; Integragen) as previously described (9). For WES, mean coverage was 140X.

Development of patient-derived xenografts (PDX) in mice and in vivo pharmacological studies

All animal procedures and studies were performed in accordance with the approved guidelines for animal experimentation by the ethics committee at University Paris Sud (CEEA 26, Project 2014_055_2790) following EU regulation. Fresh tumor fragments from the patients MR57, MR135, MR144, MR210 and MR347 were implanted in the subrenal capsule of 6-week-old female NOD scid gamma (NSG) or nude mice obtained from Charles River Laboratories.

Cell lines

Patient-derived cell lines (MR57-S, MR57-R, MR135-R1, MR135-R2, MR210) were developed from PDX samples by enzymatic digestion with a tumor dissociation kit (Ref.130-095-929, Miltenyi Biotec) and mechanic degradation with the gentleMACs™ dissociator. Cells were cultured with DMEM/F-12+GlutamMAX™ 10% FBS and 10% enriched with hydrocortisone 0.4 μg/ml, cholera toxin 8,4 ng/ml, adenine 24 μg/ml and ROCK inhibitor 5 μM (Y-27632, S1049 Selleckchem) until a stable proliferation of tumor cells was observed, as previously described (10). Culture media was then transitioned to DMEM and cultured in the presence of lorlatinib from 300 nM to 1 μM. The H3122 cell line harboring EML4-ALK rearrangement was cultured in RPMI 10% FBS. Parental Ba/F3 cells were purchased from DSMZ and cultured in DMEM 10% FBS in the presence of IL-3 (0.5 ng/ml). Ba/F3 cells were infected with lentiviral constructs as previously reported to express the EML4-ALK variant 3 fusion with or without ALK kinase domain mutations (11). Ba/F3 cells harboring the EML4-ALK fusion were selected in the presence of blasticidine (21 μg/ml) and IL-3 (0.5 ng/ml) until recovery, and a second selection by culturing the cells in the absence of IL-3. EML4-ALK rearrangement and ALK kinase domain mutations or NF2 mutations were confirmed on the established cell lines by Sanger sequencing.

CRISPR-based NF2 knocking out

NF2 gene knock-out was performed with the CRISPR/Cas9 KO Plasmid (h) from Santa Cruz Biotechnology (sc-400504). CRISPR/Cas9 KO Plasmid (h) was transfected using Lipofectamine 3000 according to manufacturer’s protocol. Green fluorescent protein-based cell sorting was performed for clonal selection. Single clones were screened for NF2 gene disruption by RT-PCR followed by sequencing and Western Blot.

Site directed mutagenesis

Lentiviral vectors expressing the EML4-ALK variant 3 were created using the pLenti6/V5 directional TOPO cloning kit (#K495510, Thermofisher) according to manufacturer’s instructions. Point mutations were introduced using the QuickChange XL Site-Directed mutagenesis kit (#200516, Agilent) according to manufacturer’s protocol using the following primers:

G1269A F- GAGTGGCCAAGATTGCAGACTTCGGGATGGCC

G1269A R- GGCCATCCCGAAGTCTGCAATCTTGGCCACTC,

C1156Y-F GACGCTGCCTGAAGTGTACTCTGAACAGGACGAAC,

C1156Y R- GTTCGTCCTGTTCAGAGTACACTTCAGGCAGCGTC,

E1154K F- CTGTGAAGACGCTGCCTAAAGTGTGCTCTGAACAG,

E1154K R- CTGTTCAGAGCACACTTTAGGCAGCGTCTTCACAG,

F1174L F- TGTTCTGGTGGTTTAATTTGCTGATGATCAGGGCTTCC,

F1174L R- GGAAGCCCTGATCATCAGCAAATTAAACCACCAGAACA,

G1202R F- GCTCATGGCGGGGAGAGACCTCAAGTCC,

G1202R R-GCTCATGGCGGGGAGAGACCTCAAGTCC.

D1203N F- ATGGCGGGGGGAAACCTCAAGTCCTTCC

D1203N R- GGAAGGACTTGAGGTTTCCCCCCGCCAT

L1196M F- GCCCCGGTTCATCCTGATGGAGCTCATGGCGGG

L1196M R- CCCGCCATGAGCTCCATCAGGATGAACCGGGGC

Reagents

Saracatinib (AZD0530) and vistusertib (AZD2014) were provided by AstraZeneca. Crizotinib (S1068), alectinib (S2762), brigatinib (S8229), dasatinib (S1021), erdafitinib (S8401), debio-1347 (S7665), lorlatinib (S7536) and entrectinib (S7998) were purchased from Selleck Chemicals.

For Western Blot assays the antibodies used were: pALK Y1282/1283 (9687S), pALK Y1604 (3341S), ALK (#3333S), pAKT (#4060S), AKT (#4961S), pERK (9101S), ERK (9102S), pS6 (4858S), S6 (2217S), cleaved Parp (9541S), BIM (2933S), Merlin (1288S), pPaxillin (2541S), Paxillin (2542S), Snail (3879S) and Vimentin (5741S) purchased from Cell Signaling Technology.

For IHC assays the antibodies used were ALK (#6679072001), E-Cadh (#790-4497) and CD31 (#760-4378) purchased from Ventana; N-Cadh (#M3613), Ki-67 (#M7240), beta catenin (#M3539), podoplanin (#M3619) and CD68 (#M0814) purchased from DAKO; Vimentin (#790-2917) purchased from Roche; pSRC (#6943S) and pMAPK (#4376) purchased from Cell Signaling Technology; Glut1 (#RP128-05) purchased from Clinisciences; CA-IX (#NB100-417SS) purchased from NovusBio, NF2/Merlin purchased from Sigma-aldrich (#HPA003097) and CD47 (#M5792) purchased from Spring.

Cell Viability and Apoptosis Assays

Cell viability assays were performed in 96-well plates using the Cell-Titer Glo Luminescent Cell Viability Assay (G7570, Promega). Apoptosis was measured using the caspase-Glo 3/7 Assay (G8091, Promega).

In vivo pharmacological studies

MR135-R2 PDX bearing athymic nude mice were treated with vistusertib (qdx1 then bidx1 then qdx1);4d off, Lorlatinib (qdx5/2d off) or their combination by oral gavage. Vistusertib was resuspended in 1% Tween80 in sterile deionized water and lorlatinib in sterile deionized water pH 3.0.

Circulating tumor DNA (ctDNA) analysis from patient’s blood samples

A total of 20 ml of blood were collected in Streck BCT (Streck) or EDTA tubes and processed for DNA extraction. Molecular analysis from ctDNA was performed by Inivata (Cambridge, UK and Research Triangle Park, USA) using amplicon-based NGS (InVisionFirst™-Lung) as previously reported (12).

Actin microfilament staining with phalloidin

MR210, MR57-S and MR57-R cells were fixed in formaldehyde and permeabilized with PBS Triton X-100 (0.05%). Blocking solution with FBS 2% and BSA 1% was used. Alexa Fluor 488 Phalloidin (8878S, Cell Signaling) solution was diluted 1/200 in blocking buffer. Cells were incubated for one hour at room temperature, then washed with PBS and later incubated with DAPI 1/10.000 dilution for five minutes. Cells were imaged with an inverted IX73 microscope (Olympus).

Allelic distribution of ALK mutations

The ALK kinase domain was amplified by PCR and amplicons were subcloned into pCR2.1-TOPO vector (Invitrogen) according to manufacturer’s protocol. Individual cDNA was sequenced by Sanger sequencing to determine the cis/trans status of mutations.

Modeling Tumor Clonal Evolution

Paired-end RNA sequencing (RNA-seq) data for MR144 sequential biopsies was mapped against the human genome version "hg19" through Burrows-Wheeler Aligner (BWA-MEM) (13). The resulting Sequence Alignment Map (SAM) was converted into binary version BAM files. PCR duplicates identified in BAM files were removed with "samtools fixmate". Realign Target Creator, and realigner of GATK were used to check and realign the sorted BAM files with predefined BED files for indels. The GATK-Base Recalibrator was used to generate tables for user-specified covariates and GATK-MuTect2 was used to calculate Variant Allelic Frequency (VAF). Computed VAFs of different time-points were adjusted according to tumor cell percentages and subjected to R-SciClone clustering analysis (14). The phylogeny of subclonal tumor evolution was determined using R-clonevol (15) and visualised with R-fishplot (16).

Computational modelling of ALK

All molecules for reconstruction and analysis of human ALK-kinases were taken from RCSB Protein Data Bank (PDB) and information obtained from UniProtKB database (17, 18). Full 3D-models of ALK-domains were built using I-TASSER server(19). Structure and assembling of polypeptide chains were analyzed using data of SCOP database (20). The secondary structure of ALK-domain was verified based on self-optimized prediction method with alignment (SOPMA). Also, BioLuminate (Schrödinger) was used as a method for evaluating the role of amino acid mutations (21, 22). Geometry optimization and stability of reconstructed models were predicted based on results of molecular dynamics (MD) simulations. MD simulations were performed in an aqueous environment, using CHARMM force field and GROMACS 5.1.4 program package (23, 24). Each protein was solvated, optimized (10,000 steps steepest descent/conjugant gradient algorithms), equilibrated (30,000 steps) and relaxed during a free MD in water environment (50 ns). Lorlatinib topology was generated with online SwissParam tool(25). MD results were evaluated by RMSD, values of conformational energies and radius of gyration. Assessment of the amino acid composition, visualization and structure analysis were performed in PyMOL and BIOVIA DS Visualizer. CCDC GOLD 5.2.2 suite (www.ccdc.cam.ac.uk) was used for final exhaustive docking of hit compounds. The major part of docking options was turned on by default, however ChemScore function, which relies on the internal energy calculation, was altered to ASP algorithm(26). We kept GoldScore function as a primary function, as it provides best conformational search analysis. https://www.lifechemicals.com

Results

Resistance mechanisms to ALK TKI from MATCH-R clinical trial

From January 2015 to January 2019, 14 patients with ALK-rearranged tumors progressing on ALK TKI were included in the MATCH-R study. Four patients were excluded from the analysis due to inadequate biopsies for molecular profiling (Figure 1).

Figure 1.

Summary of ALK-rearranged patient included in the MATCH-R study. NSCLC: non-small cell lung cancer, EMT: epithelial mesenchymal transition

Among the eight patients with ALK-rearranged lung adenocarcinoma, tumor biopsies were obtained upon progression to crizotinib (n=1), ceritinib (n=3) and lorlatinib (n=4) (Table 1). NGS analysis of tumor biopsies from patients treated with crizotinib and ceritinib revealed the presence of secondary ALK kinase domain mutations in three cases (G1269A, L1196M/D1203N, and F1174L) and a NOTCH1 variant of unknown significance in one additional case (Table 1). The ceritinib resistant patient with the compound mutation L1196M/D1203N (MR347) experienced primary resistance to lorlatinib and is therefore characterized here as an additional lorlatinib resistance mechanism. Among the four patients with ALK-rearranged lung cancer with acquired resistance to lorlatinib, ALK compound mutations were observed in two cases (C1156Y/G1269A for patient MR57 and G1202R/F1174L for patient MR144). Off-target mutations in NF2 were encountered in two different temporo-spatial biopsies from patient MR135 obtained while on treatment with lorlatinib. The first biopsy was from an oligo-progressive lung lesion after 7 months of lorlatinib treatment that was treated with stereotactic radiation, and the second biopsy was obtained at the time of systemic progression from an adrenal metastasis after additional 8 months of treatment with lorlatinib. A single ALK C1156Y kinase domain mutation was found in one patient (MR210) after progression to lorlatinib, without evidence of additional genetic alterations. The ALK C1156Y mutation is known to confer resistance to crizotinib and ceritinib, but remains sensitive to lorlatinib, as previously reported in preclinical studies (5). Thus, the C1156Y mutation is not likely to be responsible for lorlatinib resistance in this case. Patient-derived cell lines were developed from patients MR57, MR135 and MR210. Biological processes driving tumor resistance to lorlatinib were further explored using patient-derived cell lines.

Table 1. Clinical and molecular features of patients with tumor molecular profiling on biopsies obtained upon resistance to ALK inhibitors in the MATCH-R study.

ID	Diagnosis	Previous ALK TKI	NGS at progression to previous line of ALK TKI	Line of ALK TKI inclusion	ALK TKI MATCH-R inclusion	Response (RECIST) PFS	Targeted sequencing	Whole exome sequencing / RNA sequencing	Putative Resistance Mechanism
MR 39	LUAD	Crizotinib	No	2	Ceritinib	PR 14 months	No detectable alterations	NOTCH1:p.Q2503P	Unknown
MR 57	LUAD	Crizotinib	No	2	Lorlatinib	PR 7 months	ALK: p.C1156Y+p.G1269A	ALK: p.C1156Y+p.G1269A	EMT
MR 135	LUAD	Crizotinib	NF2 c.8861G>A NF2 S288X	2	Lorlatinib	PR 15 months	PTPN11: p.S502L TP53 p.R273P	NF2: p.K543N NF2 c.886-1G>A	NF2 bypass
MR 143	ATC	No	NAP	1	Crizotinib	SD 5 months	TP53: p.E285*	TNIK: p.Q674*	Unknown
MR 144	LUAD	Crizotinib	ALK E1154K / G1202R	4	Lorlatinib	PR 4 months	ALK: p.G1202R+p.F1174L	ALK: p.G1202R+p.F1174L	ALK: p.G1202R+p.F1174L
		Ceritinib	N/A
		Brigatinib	G1202R
MR 154	MIT	Crizotinib	No	2	Ceritinib	SD 26 months	No detectable alterations	NF2: p.G151fs	NF2 bypass
MR 176	LUAD	No	N/A	1	Crizotinib	PR 30 months	No detectable alterations	ALK: p.G1269A	ALK: p.G1269A
MR 210	LUAD	Crizotinib Ceritinib	No	3	Lorlatinib	PR 16 months	ALK: p.C1156Y	ALK: p.C1156Y	EMT
MR 344	LUAD	Crizotinib	No	2	Ceritinib	PR 4 months	ALK: p.F1174L	ALK: p.F1174L; PIK3CB: p.E1051K	ALK: p.F1174L
MR 347	LUAD	Crizotinib	ALK: p.L1196M	2	Ceritinib	PR 5 months	ctDNA ALK: p.L1196M/D1203N	ALK: p.L1196M	ALK: p.L1196M/D1203N
				3	Lorlatinib	PD	N/A	N/A	N/A

TKI: tyrosine kinase inhibitor, PFS: progression-free survival, LUAD: lung adenocarcinoma, ATC: anaplastic thyroid carcinoma, MIT: myofibroblastic inflammatory tumor

Epithelial-mesenchymal transition mediates lorlatinib resistance

A 59-year-old male was diagnosed with a metastatic ALK rearranged lung adenocarcinoma (Figure 2A). The patient received first-line treatment crizotinib achieving a partial response and a progression-free survival (PFS) of 4.2 months. At the time of disease progression to crizotinib, no tumor nor plasma was available. The patient received sequential second line treatment with lorlatinib at 75 mg daily achieving a partial response (-78% per RECIST criteria). After 6.9 months, disease progression was observed, the patient was included in the MATCH-R trial (MR57) and a lung biopsy on the progressing primary site was performed.

Figure 2.

SRC and ALK inhibition overcomes lorlatinib resistance mediated by EMT. A, Treatment course of patient MR57 (PR, partial response). B, MR57-S and MR57-R cells were treated with increasing concentrations of lorlatinib for 24hs. Cell lysates were immunoblotted to detect the selected proteins. C, Treatment course of patient MR210 (PD, progressive disease). D, Phenotype of MR210 epithelial and mesenchymal cells labelled with Cy3 Phalloidin and DAPI. E, MR57-R cells were treated with the indicated doses of lorlatinib and saracatinib alone or in combination, for 7 days. Cell viability was assessed with Cell Titer Glo. F, MR210 cells were treated with single agents lorlatinib, saracatinib, erdafitinib and debio-1347 or in combination for 7 days. Cell viability was assessed with Cell Titer Glo. G, MR57 lorlatinib sensitive (epithelial) and resistant (mesenchymal) cells were treated with the specified concentrations of lorlatinib and saracatinib for 24hs. Cell lysates were probed with antibodies against the indicated proteins. H, Phenotypes of MR57 epithelial and mesenchymal cells labelled with Alexa Fluor 488 Phalloidin and DAPI after treatment with lorlatinib and saracatinib for 30 days.

Targeted NGS, WES and RNA sequencing showed the presence of both C1156Y and G1269A ALK mutations and the EML4-ALK variant 3 rearrangement (V3). cDNA Topo-TA cloning and sequencing of the ALK kinase domain, evidenced that both mutations were present in the same allele (compound mutation).

A PDX model was established directly from a biopsy and a cell line (MR57-S) was derived from the PDX, with a total elapsed time from the tumor biopsy to cell line establishment of 6 months. Cell survival assays showed that the patient derived cell line was sensitive to lorlatinib treatment (MR57-S), with an IC50 of 50 nM, suggesting that the C1156Y/G1269A compound mutation was not likely responsible for lorlatinib resistance (Supplementary Figure 1A). It remains to be elucidated if lorlatinib withdrawal during the time of PDX development and cell line establishment could have influenced the observed sensitivity of the MR57-S cell line. To further study the effect of this ALK compound mutation on ALK inhibitors sensitivity, we developed Ba/F3 engineered cells to express the EML4-ALK V3 with G1269A, C1156Y or compound C1156Y/G1269A mutations. Ba/F3 cells expressing EML4-ALK with the compound mutations were less sensitive to lorlatinib (IC50: 53 nM) than Ba/F3 cell expressing the C1156Y (IC50: 2.5 nM) or G1269A (IC50: 18 nM) single mutations (Supplementary Figure 1B). However, the doses required to induce cell death in these models were within the range of lorlatinib sensitivity, being lower than those required to target the G1202R mutation, known to be susceptible to lorlatinib inhibition in patients (5,6). The C1156Y/G1269A compound mutation conferred resistance to crizotinib, alectinib and entrectinib but not to brigatinib when tested in vitro (Supplementary Figure 1C).

The MR57-S cell line was exposed to incremental concentrations of lorlatinib until the tumor cells developed resistance, achieving stable growth at a dose of 300 nM. The MR57 resistant (MR57-R) cell line showed high levels of resistance to lorlatinib (IC50: 7.8 μM) (Supplementary Figure 1A). Sequencing of the ALK kinase domain in both MR57-S and MR57-R cells showed the presence of the C1156Y and G1269A mutations. MR57-R cells did not acquire any additional ALK kinase domain mutations during exposure to lorlatinib.

Immunoblot analysis of MR57 sensitive (MR57-S) and resistant (MR57-R) cells treated with incremental doses of lorlatinib showed that ALK inhibition resulted in inhibition of ERK, AKT and S6 phosphorylation and induction of apoptosis in MR57-S cells (Figure 2B). In contrast, MR57-R cells maintained high levels of ERK, AKT and S6 phosphorylation, with lower levels of apoptosis. This is in line with the occurrence of an off-target mechanism of resistance (i.e. the activation of a bypass track).

Because MR57-S and MR57-R cells had markedly different morphologies, we assessed the differential expression of EMT markers. Immunoblot analysis revealed that MR57-S cells expressed high levels of E-cadherin and lacked N-cadherin and vimentin, characteristic of an epithelial phenotype. In contrast, MR57-R cells lacked E-cadherin expression and had high levels of N-cadherin, Snail and vimentin expression, characteristic features of a mesenchymal phenotype (Figure 2B). RNA sequencing of the two cell lines confirmed the differential expression of EMT related genes at the mRNA level (Supplementary Figure 1D). Comparably, MR57-R cells had higher levels of vimentin, CDH-2 (N-cadherin), SNAIL, ZEB1, FGFR1 and TGFB1/2 mRNA expression and lower levels of EPCAM, CDH-1 (E-cadherin), and ICAM1 expression compared to MR57-S cells. In addition, we performed phalloidin staining of actin microfilaments on MR57-S and MR57-R cells. Lorlatinib sensitive cells manifested the formation of actin rings and proliferation in clusters, distinctive of an epithelial phenotype (Supplementary Figure 1E). In contrast, MR57-R contained actin stress fibers, which is characteristic of a mesenchymal phenotype.

To assess whether EMT features were present in the patient’s tumor upon progression to lorlatinib, we compared the expression of EMT markers by immunohistochemistry (IHC) on pre-crizotinib and at the time of disease progression with lorlatinib using FFPE specimens (Supplementary Figure 1F). EMT features were not observed in the patient´s tumor specimen upon lorlatinib progression, evidenced by the expression of E-cadherin and the absence of vimentin and N-cadherin expression. Cancer cells were spatially relocated in lymphatic vessels (CD31+, Podoplanin+), in a hypoxic (Carbonic Anhydrase 9 [CAIX+], Glucose Transporter 1 [Glut1+]) and immune evading microenvironment (CD47+ and CD68 low) with sustained MAPK phosphorylation. In the absence of EMT features in the tumor biopsy, these other factors could have contributed to disease progression by limiting drug availability. Nevertheless, the onset of an EMT program upon lorlatinib exposure in patient-derived cell line supports the role of EMT in lorlatinib resistance in this model in vitro.

A second patient became resistance to lorlatinib without evidence of any mutation causing TKI resistance (MR210). This 58-year-old never smoker female patient with metastatic ALK-rearranged NSCLC had a benefit over four years from crizotinib treatment (Figure 2C). The treatment was switched to ceritinib due to progressing bone metastasis, but ceritinib was suspended after one cycle due to toxicity. Treatment was switched to lorlatinib, achieving a response that lasted for 16 months, when oligoprogression in a bone lesion occurred. The patient was included in the MATCH-R trial (MR210) and a tumor biopsy was performed. The patient received treatment with cryoablation to the bone metastasis and currently continues to benefit from treatment with lorlatinib, ongoing for 35 months. The MR210 cell line was directly resistant to lorlatinib and similarly to MR57 displayed EMT features. Phalloidin staining confirmed the presence of actin stress fibers and the mesenchymal phenotype (Figure 2D).

We evaluated the expression of EMT markers by IHC on pre-crizotinib and post-lorlatinib FFPE specimens. While E-cadherin and N-cadherin expression were of similar intensity and percent positive cells among both samples, we observed an increase in vimentin expression in the post-lorlatinib specimen. This would suggest a partial EMT in the tumor at the time of resistance consistent with the observed EMT in the patient derived cell line (Supplementary Figure 1G).

Combined SRC and ALK inhibition overcome EMT mediated lorlatinib resistance

To overcome the resistance in these models, we tested 66 pharmacological compounds on MR57-R and MR210 cell lines in the presence or absence of lorlatinib. The SRC inhibitor saracatinib in combination with lorlatinib showed a potent synergistic effect on both mesenchymal cell lines (Figure 2E and F). No cytotoxic effect was observed with saracatinib on MR57-S cells with epithelial features (Supplementary Figure 1H). In concordance, a synergistic cytotoxic effect was observed in mesenchymal cells treated with dasatinib (another SRC inhibitor) and lorlatinib (Supplementary Figure 1I) and not in the epithelial cells (Supplementary Figure 1J). Interestingly, FGFR inhibitors also sensitized MR210 cells to lorlatinib treatment (and to a lower extent in MR57 - data not shown) as it has recently been shown for EGFR mutant NSCLC (Figure 2F) (17).

Immunoblot analysis showed that MR57-R mesenchymal cells had higher levels of paxillin phosphorylation (a surrogate for SRC activation), compared to the epithelial MR57-S cells, suggesting that SRC was driving EMT in this model, as previously reported (18) (Figure 2B and G). Consistently, treatment with saracatinib and lorlatinib inhibited ERK, AKT and S6 phosphorylation in MR57-R cells which translated in a mild increase in the expression of apoptosis markers such as cleaved PARP and BIM (Figure 2G).

To study if the cytotoxic effect of combining SRC and ALK inhibition could be due to a reversion of the mesenchymal state to an epithelial phenotype, we exposed MR57-R cells to 30 days of treatment with lorlatinib, saracatinib or their combination. We observed a partial reversion in E-cadherin expression in MR57-R cells treated with saracatinib (Supplementary Figure 1K). This effect was not observed when saracatinib was combined with lorlatinib. This suggests that continued exposure of MR57-R cells to lorlatinib can induce death in cells undergoing partial EMT reversal. Accordingly, we performed actin microfilament staining and observed that cells treated with saracatinib alone exhibited lower levels of actin stress fibers and increased formation of actin rings (Figure 2H), suggesting that SRC inhibition can promote a partial EMT reversal in the long-term.

Novel lorlatinib resistant ALK compound mutations

A 58-year-old non-smoker female was diagnosed with a metastatic ALK rearranged lung adenocarcinoma. The patient achieved a partial response with a 9.2 months PFS on first line treatment with crizotinib (Figure 3A). At disease progression, the patient was enrolled in the MATCH-R study (MR144). RNA sequencing confirmed the EML4-ALK V3 fusion and showed the presence of the ALK kinase domain resistant mutation G1202R (VAF: 7%) and an unreported E1154K variant (VAF: 29%) on different alleles (Supplementary Figure 2A). Amplicon-based NGS analysis of ctDNA also detected the G1202R and a I1268V mutation, but not the E1154K variant (Supplementary Figure 2B). Because lorlatinib was not available at that time, the patient received a short course of ceritinib treatment with rapid disease progression, and treatment was switched to brigatinib. A mixed response was observed with the occurrence of new lesions after 2.5 months of treatment. A second biopsy was performed and only the G1202R mutation was detected at a higher allelic frequency (VAF: 67%). The patient started lorlatinib treatment but the benefit lasted only 3.7 months. A third biopsy was performed, and RNA sequencing showed the presence of both, a G1202R mutation (VAF: 100%) and a F1174L mutation (VAF: 56%) confirmed to be in cis by TOPO-TA cloning and sequencing of ALK kinase domain (Supplementary Figure 2C). This was consistent with ctDNA sequencing which showed a rise in G1202R detection and the appearance of the F1174L mutation. Interestingly, ctDNA analysis detected four additional co-occurring ALK kinase mutations, not detected in the biopsy: C1156Y, G1269A, S1206F and T1151M (Supplementary Figure 2B). Solely, the G1202R/S1206F mutations were confirmed to be in the same read (cis) with amplicon-based NGS. C1156Y and T1151M were confirmed to be in trans, but due to the size of the amplicons covering the ALK kinase domain, the allelic distribution of the other mutations could not be assessed by this method. These other ALK KD mutations detected with ctDNA were not found in the sequencing analysis of the tumor biopsy, reflecting that these mutations could arise from polyclonal tumor cell sub-populations absent in the tumor biopsy.

Figure 3.

Resistance to lorlatinib mediated by ALK kinase domain compound mutations. A, Clinical course of patient MR144 and allelic frequencies of ALK resistant mutations (from RNA sequencing) with sequential treatments. B, Fish Plot illustrating the tumor clonal evolution obtained by WES analysis during treatment with ALK inhibitors. The ALK E1154K and G1202R subclones emerged independently upon resistance to crizotinib. After disease progression with brigatinib, the ALK G1202R clone predominated and the E1154K clone became undetectable. At lorlatinib resistance, a subclone emerged from the ALK G1202R clone acquiring an additional F1174L mutation. C, Clinical course of patient MR347. D, Cell survival assay of Ba/F3 models with the indicated ALK single and the F1174L/G1202R compound mutations treated with lorlatinib for 48hs. E, Cell survival assay of Ba/F3 models with the indicated ALK single and the L1196M/D1203N compound mutations treated with lorlatinib for 48hs. F, ALK and downstream kinases phosphorylation in Ba/F3 mutated cells treated with the indicated concentrations of lorlatinib for 3hs. G, Direct comparison of ALK phosphorylation in the same Ba/F3 models by immunoblotting of cell lysates after 3hs treatment with lorlatinib showing higher levels of ALK phosphorylation with the F1174L/G1202R compound mutation. H, Visual representation of aligned wild-type (green) and F1174L/G1202R mutated (brown) ALK structures in complex with lorlatinib.

To further characterize the clonal evolution on sequential ALK inhibitors, a FishPlot model was generated from WES compiling the three sequential patient biopsies (Figure 3B). While no ALK resistant mutation was detected prior to ALK TKI, multiple clones emerged at crizotinib resistance including a G1202R carrying cell population and an E1154K mutated population. Subsequent treatments with second generation ALK TKIs led to the disappearance of the E1154K population and the persistence of the G1202R carrying cells. Finally, at disease progression on lorlatinib, we observed an enrichment of the G1202R mutated tumor cell population and the appearance of the F1174L mutation within this population. This case illustrates the tumor cell population dynamics when exposed to different generations of ALK TKI, in accordance with the previously described sequential acquisition of ALK kinase domain mutations in cis (8).

A 40-year-old male patient with metastatic ALK-rearranged lung cancer received crizotinib for four months (Figure 3C). The patient was included in the MATCH-R trial (MR347), and tissue and ctDNA NGS detected the ALK gatekeeper L1196M mutation, previously known to confer resistance to crizotinib(19). The patient received ceritinib for 5 months and a second tumor biopsy was obtained from a progressive lung lesion. Targeted NGS, WES and RNA sequencing from the tissue detected only the ALK L1196M mutation. ctDNA NGS further detected the presence of a solvent front D1203N mutation, present in cis with the L1196M, revealing a sequential development of L1196M/D1203N compound mutation. The treatment was then switched to lorlatinib but disease progression was immediately documented, proving primary resistance to lorlatinib.

Lorlatinib activity against ALK compound mutations

We generated Ba/F3 cells expressing the EML4-ALK fusion with single mutations E1154K, F1174L, G1202R, L1196M, D1203N and the G1202R/F1174L, L1196M/D1203N compound mutations. Ba/F3 cells were treated with crizotinib, alectinib, brigatinib, entrectinib and lorlatinib to test the differential effect of these mutations on the sensitivity to ALK inhibitors. The E1154K mutation did not confer resistance to any ALK TKI (Supplementary Figure 2D). Its selection on crizotinib treatment remains, therefore, to be elucidated. While F1174L mutation did not confer resistance to lorlatinib, high concentrations of lorlatinib were required to induce a cytotoxic effect on EML4-ALK^G1202R and EML4-ALK^{G1202R/F1174L} expressing cells (5). Slightly higher concentrations of lorlatinib were required to induce cell death in Ba/F3 cells expressing EML4-ALK^{G1202R/F1174L} (IC50: 123 nM) compared to cells expressing EML4-ALK^G1202R (IC50: 83 nM) (Figure 3D) which could be sufficient to confer resistance in the patient. L1196M and D1203N single mutations conferred a 10-fold shift in IC50 compared to non-mutated cells but the L1196M/D1203N compound mutation induced a more than 300-fold higher IC50 confirming the highly lorlatinib resistant feature of this novel compound mutation (Figure 3E and Supplementary Figure 2E).

To better characterize the direct impact of those compound mutations on lorlatinib efficacy, we assessed ALK phosphorylation across these models exposed to incremental concentrations of lorlatinib. In concordance with the cell viability assay, ALK phosphorylation with the compound mutation L1196M/D1203N was maintained at high doses of lorlatinib (1 μM) (Figure 3F). Interestingly, Ba/F3 cells expressing the other compound mutation G1202R/F1174L displayed higher basal levels of ALK phosphorylation compared with Ba/F3 cells expressing the single mutations or no secondary mutation (Figure 3G and Supplementary Figure 2F). Computational modelling of ALK further supports our finding. The F1174L mutation does not affect lorlatinib binding. However, in the context of the G1202R/F1174L compound mutation, a greater kinase stability is achieved, which could explain higher basal levels of ALK phosphorylation, and possibly contribute to resistance in this case (Figure 3H).

NF2 loss of function mediates resistance to lorlatinib

A 44-year-old male was diagnosed with ALK-rearranged metastatic lung adenocarcinoma (Figure 4A). The patient experienced disease progression after 11 months on crizotinib. The treatment was switched to lorlatinib achieving a rapid partial response. Oligo-progressive disease occurred after 7 months of treatment with a new single lesion in the left lower lobe. The patient was included in the MATCH-R study (MR135), a biopsy of the lesion was performed and stereotactic radiotherapy (50 Gy) treatment was applied. Targeted NGS and WES of the biopsy revealed both, a NF2 S288X non-sense mutation and a NF2 splicing site mutation (NM_000268.3:c.886-1G>A). A PDX model was developed from this first site of progression (R1) and a patient derived cell line was established (MR135-R1).

Figure 4.

NF2 loss of function mediates resistance to lorlatinib. A, Clinical course of patient MR135 and mutational profile of samples obtained on lorlatinib progression (PD, progressive Disease). B, Cell survival assay assessed with Cell Titer Glo of MR135 lorlatinib resistant cells from biopsy 1 (MR135-R1) treated for 7 days with the indicated concentrations of lorlatinib and vistusertib (AZD2014) alone or in combination. C, Immunoblot analysis from cell lysates of MR135-R1 treated for 24hs with the specified doses of lorlatinib, vistusertib (AZD2014) and ponatinib alone or in combination using indicated antibodies. D, Athymic nude mice bearing MR135-R2 PDX were administered lorlatinib or vistusertib 20 mg/kg orally. Tumor volumes, mean ±SD (n =8); (*** p < 0.001). E, Cell lysates from H3122 parental and H3122 cells with NF2 heterozygous deletions or homozygous deletions, generated by CRISPR-CAS9 gene editing, were immunoblotted to detect merlin expression. H3122 cells with bi-allelic NF2 knock-out lacked merlin expression. F, Cell survival assay of H3122 parental and H3122 NF2 knock-out (NF2 KO) cells treated with lorlatinib for 7 days. Cell survival was assessed by Cell Titer Glo. G, Cell proliferation assay of H3122 parental and H3122 NF2 KO cells untreated and treated with lorlatinib measured at baseline, day 2, day 5 and day 7. Cell viability was assessed with Cell Titer Glo. H, Caspase 3/7 activation (Caspase 3/7-Glo assay) relative to the number of live cells simultaneously assessed in the cell proliferation assay previously described. I, H3122 parental and NF2 KO cells were treated with the indicated doses of lorlatinib for 24hs. Cell lysates were immunoblotted to detect the selected proteins.

After 8 months of lorlatinib treatment, multiple new lesions appeared, achieving a total benefit of lorlatinib treatment for 15 months. A biopsy of the right adrenal gland was performed confirming the presence of ALK-rearranged lung adenocarcinoma. Interestingly, WES and RNA sequencing of this biopsy showed the same splicing site mutation (NM_000268.3:c.886-1G>A), coexisting with a new NF2 K543N mutation. A second PDX model was developed and a second lorlatinib resistant patient derived cell line was established (MR135-R2). Sequencing of NF2 mRNA from both cell lines revealed a 9-base pair (bp) skipping in exon 10 as a consequence of the splicing site mutation (Supplementary Figure 3A) but the absence of the S288 non-sense mutation and no secondary ALK KD mutations. The K543N NF2 mutation was only present in MR135-R2 in concordance with tumor biopsy sequencing results. Both the 9 bp skipping (20) and the K543N mutation were predicted to be pathogenic (cancergenomeinterpreter.org). Merlin expression was detected by WB in the MR135-R1 cell line as well as in the pre- and post-biopsies by IHC staining, suggesting a loss of function but not a loss of expression mechanism of resistance (Supplementary Figure 3B). NF2 mutations are rare events (1.5%) in lung adenocarcinoma, and do not seem to overlap with ALK rearrangements (according to cBioportal) (21).

NF2 mutations K543N and S288* were not detected in the tumor biopsy prior to lorlatinib treatment. Importantly, the NF2 splicing site mutation was present prior to lorlatinib treatment. The acquisition of two different second NF2 events attests for the temporo-spatial convergence between metastatic sites. This preexisting NF2 splicing site mutation predisposed cancer cells to resist to lorlatinib by an NF2 loss of function mechanism.

Targeting lorlatinib resistance mediated by NF2 loss with mTOR inhibitors

NF2 encodes the merlin protein, a key tumor suppressor implied in the regulation of the PI3K-AKT-mTOR pathway through mTOR inhibition (22). We performed a drug screen in the MR135-R1 identifying the selective dual mTOR1-2 inhibitor, vistusertib (AZD2014, AstraZeneca), and the multi-kinase inhibitor, ponatinib, as hits in this cell line.

Both MR135-R1 and MR135-R2 cell lines were highly sensitive to vistusertib and the combination of vistusertib and lorlatinib (Figure 4B, MR135-R1) (Supplementary Figure 3C, MR135-R2). The activity of an mTOR inhibitor was confirmed by using the clinically available rapamycin analogue everolimus (Supplementary Figure 3D). Ponatinib, a multikinase inhibitor targeting ABL, VEGR, FGFR3, PDGFRA and RET, showed an important synergistic effect with lorlatinib in this cell line with a 57- to 80-fold IC50 reduction with the combination compared to lorlatinib single agent (Supplementary Figure 3E). However, we did not identify a by-pass mechanism related to the activation of tyrosine kinase receptors (RTK) targeted by ponatinib by phospho-receptor tyrosine kinase (p-RTK) arrays (data not shown).

Western blot analysis in MR135-R1 showed that ALK inhibition with lorlatinib alone had no inhibitory effect on the phosphorylation of the downstream signaling pathways (Figure 4C). Treatment of this cell line with vistusertib alone or in combination with lorlatinib inhibited S6 phosphorylation and increased the level of the pro-apoptotic BH3-only protein BIM and the proteolytic cleavage of PARP. This effect was more potent with the combination of vistusertib and lorlatinib. Similarly, the combination of lorlatinib and ponatinib reduced AKT, ERK and S6 phosphorylation, and increased apoptosis as compared to either treatment alone (Figure 4C).

To further assess the activity of the combined treatment against lorlatinib resistant ALK-positive tumors in vivo, we examined the efficacy of lorlatinib and vistusertib against the corresponding MR135-R2 PDX. As shown in Figure 4D, treatment of MR135-R2 PDX tumor-bearing mice with the combination was significantly more effective than with single agents in controlling tumor growth.

Independent validation of NF2 loss-mediated lorlatinib resistance

We performed NF2 knock-out (KO) by CRISPR-CAS9 gene editing in ALK-rearranged H3122 cell line to further validate the implication of NF2 loss of function in lorlatinib resistance. The resulting H3122-NF2KO cell line harbored a genomic 22,803 bp deletion causing a 434 bp frameshift deletion at the mRNA level (Exon 4-12). Immunoblot analysis confirmed the lack of merlin expression in H3122-NF2KO cells (Figure 4E).

Consistent with the MR135 cell lines, H3122-NF2KO cells were less sensitive to lorlatinib treatment than the parental cell line with an IC50 of 41.8 nM compared to 1.3 nM, respectively (Figure 4F). The shift in the IC50 value was also observed for other ALK TKI (Supplementary Figure 3F). We next assessed the magnitude of this effect in a time-course cell proliferation assay simultaneously with a caspase activity assay. H3122-NF2KO cells continued to proliferate in the presence of high doses of lorlatinib and exhibited low caspase activity compared to the parental cell line at each time point (Figure 4G-4H). Western blot analysis revealed that merlin deficient cells maintained higher levels of S6 phosphorylation compared to merlin proficient cells (Figure 4I). Consistently with the caspase-3/7 activity assay, H3122-NF2KO cells had decreased levels of cleaved PARP after 48 hours of treatment with lorlatinib. Importantly, vistusertib alone or in combination with lorlatinib potently inhibited S6 phosphorylation and induced PARP cleavage in H3122-NF2KO cells (Supplementary Figure 3G). This further supports the importance of merlin integrity in the regulation of mTOR signaling, evidenced by the overactivation of mTOR secondary to NF2 knock out in this model (Supplementary Figure 4.).

Discussion

Lorlatinib, which has been recently granted FDA approval, is the new standard treatment for patients progressing after crizotinib and a second generation ALK inhibitor or after upfront treatment with ceritinib or alectinib, and the last remaining available line of ALK-targeted therapy (6,7,23). With this study, we contributed to understand the adaptive mechanisms driving resistance to this targeted agent trough the longitudinal assessment of tumor biopsies and ctDNA by deep molecular profiling and the development of PDX and cell lines.

The sequential accumulation of mutations on a single allele of the ALK kinase domain has been recently described by Yoda and colleagues to mediate resistance in about 35% of patients previously exposed to first- and second-generation TKI (8). In addition to these pivotal findings, we identified and characterized three novel compound mutations from patient tumor biopsies (F1174L/G1202R, L1196M/D1203N and C1156Y/G1269A). The C1156Y/G1269A compound mutation retained sensitivity to lorlatinib both in Ba/F3 cells and the patient-derived cell line suggesting that co-occurring off-target mechanisms of resistance can drive disease progression even in the presence of compound mutations. Similarly to the previously described L1196M/G1202R mutation, the L1196M/D1203N mutation conferred high level of lorlatinib resistance. On the other hand, the G1202R/F1174L compound mutation resulted in a mild increase in resistance to lorlatinib compared to the single G1202R mutation, and is potentially targetable by increasing lorlatinib doses in vitro. However, this approach would not be feasible in patients, limited by the risk of increased toxicities. This is further supported by a recent study reporting the acquisition in vitro of the F1174L mutation arising from G1202R mutant Ba/F3 cells, exposed to low doses of lorlatinib using ENU mutagenesis screening, conveying low levels of resistance to this drug (24). In this patient, the detection in ctDNA of multiple secondary ALK mutations, of which G1202R and S1206F were confirmed to be in cis, shows that compound mutations can be polyclonal events.

Our studies on patient derived cell lines allowed to further explore off-target mechanisms of resistance to lorlatinib, contributing to past efforts in the design of novel therapeutic strategies (25). We developed two patient-derived cell lines that underwent EMT in vitro on treatment with lorlatinib involving SRC activation. EMT had previously been implied in resistance to ALK inhibitors and other targeted therapies in lung cancer (26–29). In addition, it is also known that SRC activation plays a key role in the development of EMT throughout different cancer types (30). Crystal and colleagues had previously reported that several ALK resistant patient-derived cell lines were susceptible to combined ALK and SRC inhibition. In the present study, we further demonstrated that this association is highly effective in lorlatinib resistant patient derived cell lines undergoing EMT, and showed that SRC inhibition could partially restore E-cadherin expression in mesenchymal cells without completely reverting them to an epithelial phenotype. Interestingly, as recently shown for EGFR mutant NSCLC, FGFR inhibitors sensitized ALK-rearranged EMT cell lines to lorlatinib in vitro (17). There are no effective therapies against lung cancer undergoing EMT, our work further supports the exploration of combination strategies in clinical trials for patients with off-target resistant mechanisms.

Finally, we identified NF2 loss of function as a novel bypass mechanism of resistance to lorlatinib (MR-135) and subsequently confirmed these findings in vitro by NF2 knock-out in the H3122 cell line. In this case, the NF2 splicing site mutation was present at the time of progression to crizotinib, and in this context, the patient experienced initial response to lorlatinib treatment. At the time of resistance, additional deleterious events in NF2 occurred and led to a potent bypass mechanism. We hypothesize that NF2 loss of function was a functional convergence among multiple metastatic sites where sequential genomic events led to biallelic NF2 deleterious mutations. The patient-derived cell lines were resistant to lorlatinib and sensitized by mTOR inhibition in vitro and in vivo, constituting a novel potential treatment approach in this context.

This study has several limitations, the first being the number of patients evaluable for resistance mechanisms and reported in this study. Among the four patients who achieved a partial response with lorlatinib, the PFS ranged from 3.7 (MR144) to 16 months (MR210) which seems shorter than reported in the phase II study of lorlatinib (7). Further studies are needed to disclose the full spectrum of resistance mechanisms to lorlatinib including from patients with prolonged benefit. Secondly, pre-lorlatinib tumor biopsies and plasma samples were not available in all cases, limiting the analysis of the impact of baseline genomic alterations in lorlatinib resistance. Thirdly, during the development of patient-derived cell lines, the selective pressure introduced by passages in vitro and treatment exposure, may result in the outgrowth of more aggressive tumor cells and force the acquisition of EMT features.

In summary, the mechanisms of resistance to lorlatinib in patients with ALK-rearranged lung cancer can be diverse and complex. We have shown here that longitudinal tumor samplings combined with patient derived models can provide new insights on tumor dynamics and biological processes underlying disease progression, thereby, contributing to the design of novel therapeutic strategies.

Statement of significance.

Diverse resistance mechanisms were identified using next-generation sequencing and cell lines established from patients with ALK-rearranged NSCLC treated with lorlatinib. These mechanisms include epithelial-mesenchymal transition (EMT) susceptible to combined ALK/SRC inhibition, ALK compound mutations, and a novel bypass mechanism, mediated by NF2 loss and overcome by mTOR inhibition. This study provides further evidence on the complexity of lorlatinib resistance and new treatment strategies to overcome resistance in selected scenarios.