Skip to main content
Experimental and Therapeutic Medicine logoLink to Experimental and Therapeutic Medicine
. 2019 Dec 27;19(2):1522–1527. doi: 10.3892/etm.2019.8384

Prevention of arachidonic acid-induced liver injury by controlling oxidative stress-mediated transglutaminase activation with garlic extracts

Xian-Yang Qin 1,, Ting Su 1, Soichi Kojima 1,*
PMCID: PMC6966192  PMID: 32010333

Abstract

Garlic and its sulfur constituents have numerous biological functions, such as antioxidant, anti-inflammatory, anti-microbial, anticancer, antidiabetic and cardioprotective effects. Fatty liver diseases, such as non-alcoholic steatohepatitis, which is characterized by the accumulation of lipids and oxidative stress in hepatocytes and continual liver damage, has attracted much attention, and it is believed that it will become the leading etiology of liver cancer. We have previously reported that the growth-suppressive effects of arachidonic acid (AA), an unsaturated fatty acid known to be a pro-inflammatory precursor, is accompanied by the production of reactive oxygen species followed by the nuclear accumulation and activation of the protein crosslinking enzyme, transglutaminase (TG)2. In this study, we examined the potential role of garlic extracts in preventing the growth-suppressive effects of AA on human hepatic cells. We also aimed to provide a mechanistic insight regarding the association between the hepatoprotective effects of garlic extract and the inhibition of the TG-related crosslinking of nuclear proteins, which is not associated with hepatic lipid partitioning mediated by stearoyl-CoA desaturase-1. Given the critical roles of unsaturated fatty acids in the regulation of cancer cell stemness and immune surveillance in the context of chronic injury, we propose that garlic extracts may serve as a therapeutic option for the prevention of chronic liver injury and inflammation, as well as for the prevention of the carcinogenesis of fatty livers.

Keywords: garlic extracts, arachidonic acid, oxidative stress, hepatic cell injury, nuclear transglutaminase 2

Introduction

Garlic (Allium sativum L.) is known to play important roles in diet and traditional medicine for centuries (1). A number of in vitro and in vivo studies have demonstrated that garlic extracts have numerous biological functions, such as antioxidant (1), anti-inflammatory (2), antimicrobial (3), anticancer (4), antidiabetic (5) and cardioprotective effects (6). Additionally, garlic extracts have been shown to exert hepatoprotective effects against acute hepatic injury (7), non-alcoholic steatohepatitis (NASH) (8) and hepatocellular carcinoma [HCC; International Classification of Diseases for Oncology (ICD-O) code: 8170/3] (9), partly by targeting the LRP6/Wnt signaling pathway (9). Supplementation with allicin, a compound found in fresh aqueous extracts of garlic, has been shown to exert protective effects against alcoholic fatty liver disease by improving inflammatory conditions and exerting antioxidant effects (10).

Lipid-associated inflammation, which leads to repeated liver injury and compensatory proliferation, has recently become the leading etiology of HCC (11). Non-alcoholic fatty liver disease has been reported to contribute to 10–12% of HCC cases in Western populations and 1–6% of HCC cases in Asian populations (12). We have previously reported that arachidonic acid (AA), an unsaturated fatty acid known to be a pro-inflammatory precursor and the levels of which are increased during hepatic tumorigenesis, is a target for the chemoprevention of HCC by acyclic retinoid, a novel anticancer agent (13,14). On the other hand, we found that the nuclear accumulation of the protein crosslinking enzyme transglutaminase (TG)2 under conditions of oxidative stress plays a critical role in regulating cell death in the liver, partly by crosslinking and inactivating the transcription factor, Sp1 (15,16). Recently, a mechanistic study by our group revealed that the suppression of cell growth by AA accompanied the production of reactive oxygen species (ROS) followed by the activation of nuclear TG2 in hepatic cells, suggesting a critical role of the ROS-mediated activation of nuclear TG2 by AA in chronic liver injury and inflammation (17).

In this study, we investigated the protective effect of garlic extracts against AA-induced cell death in hepatic cells and aimed to elucidate the underlying mechanism associated with ROS/TG2-dependent signaling pathways.

Materials and methods

Chemicals

Aged garlic extracts (AGEs) and the water-soluble compound, S-allylmercaptocysteine (SAMC), were provided by Wakunaga Pharmaceutical Co., Ltd. AA (A9673) and the ROS inhibitor, N-acetyl-L-cysteine (NAC; A7250), were obtained from Sigma-Aldrich. The irreversible TG inhibitor, Z-DON-Val-Pro-Leu-OMe (ZDON; Z006), was purchased from Zedira, as previously described (17).

Cell culture

The human liver cancer cell line, JHH7 (also known as FLC7), was kindly supplied by Professor T. Matsuura of the Jikei University School of Medicine, Tokyo, Japan (18). The cells were maintained in Dulbecco's modified Eagle's medium (Wako Industries) containing 10% fetal bovine serum (Mediatech), 100 U/ml penicillin/streptomycin and 2 mmol/l L-glutamine (Mediatech) and were grown at 37°C in a humidified incubator under 5% CO2 as previously described (19). The cells were seeded at a concentration of 100,000 cells/ml and cultured in serum-containing medium for 24 h prior to chemical treatment. H2O was used as the solvent control for SAMC. Ethanol (EtOH) was used as the solvent control for AA. The doses and treatment times of the chemical treatments are shown and explained in detail in the figures and figure legends.

Cellular ROS detection

Cellular ROS levels were determined using the chloromethyl derivative of 20,70-dichlorodihydrofluorescein diacetate (CM-H2DCFDA; Life Technologies; Thermo Fisher Scientific), a general oxidative stress probe, as previously described (16). Following chemical treatment for 16 h for AA treatment or 4 h for SAMC treatment, the cells were monitored for FITC fluorescence signals using a plate reader (ARVO MX; Perkin Elmer Inc.).

Determination of cell viability

The number of viable cells was determined using the Cell Counting Kit-8 (Dojindo Molecular Technologies, Kumamoto, Japan) in a plate reader (ARVO MX; Perkin-Elmer Inc.) at 450 nm as previously described (19).

Determination of cellular TG2 activity

The cellular activity of TG2 was measured based on the incorporation of 0.2 mM 5-biotinamidopentylamine (5-BAPA, 21345; Thermo Fisher Scientific) into the cells as previously described (16). The cells were then washed and stained with TRITC-conjugated secondary antibody (1:500, 016-020-084; Jackson ImmunoResearch Laboratories) for 20 min at room temperature and cell nuclei were visualized using DAPI for 20 min at room temperature. Images were captured using an ImageXpress Micro Confocal High-Content Imaging System (Molecular Devices). The morphological analysis was performed using MetaXpress Image Analysis software version 5.1 (Molecular Devices).

shRNA lentiviral particle transduction

Stearoyl-CoA desaturase-1 (SCD1; sc-36464-V) and control (sc-108080) short hairpin RNA (shRNA) lentiviral particles were obtained from Santa Cruz Biotechnology. The cells were transduced with lentiviral vectors expressing the shRNAs at approximately 0.5 multiplicity of infection (MOI) using 5 µg/ml Polybrene (Santa Cruz Biotechnology) and then selected with 2 µg/ml puromycin-containing culture medium for >1 month for further analysis.

Reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was isolated from the cells using an RNeasy kit (Qiagen) and quantified using a NanoDrop spectrophotometer (NanoDrop Products) in accordance with the manufacturer's instructions. cDNA was synthesized using a PrimeScript RT Master Mix Kit (Takara Bio). The sequences of the primers used were as follows: Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) forward, CAATGACCCCTTCATTGACC and reverse, GACAAGCTTCCCGTTCTCAG; and SCD1 forward, GTACCGCTGGCACATCAACTT and reverse, TTGGAG ACTTTCTTCCGGTCAT. PCRs were performed using a combination of the Roche LightCycler 96 Real-Time PCR System (Roche Diagnostic Co., Ltd.) and SYBR Premix ExTaq II (Takara Bio) under the following cycling conditions: 95°C for 10 min, followed by 40 cycles of 95°C for 10 sec and 60°C for 10 sec. Relative gene expression analysis calculation was performed using the ΔΔCq method (20).

Statistical analysis

Quantitative data are expressed as the means ± SD of at least 3 replicates. The significance of the differences between the values was assessed using a Student's t-test or analysis of variance (ANOVA) with the Bonferroni multiple comparison test. Values of P<0.05 were considered to indicate statistically significant differences.

Results and Discussion

Antioxidant and cytotoxic effects of SAMC on JHH7 cells

Both AGEs and their sulfur constituents, such as SAMC and S-allyl cysteine (SAC), are recognized as potent antioxidants (2123). In this study, we first, we examined the antioxidant effects of SAMC on the hepatic cells used in this study. A dose-dependent decrease in cellular ROS levels in the JHH7 cells was observed upon SAMC treatment for 4 h, as detected using CM-H2DCFDA (Fig. 1A and B), while no obvious cytotoxic effect was observed in the JHH7 cells treated with SAMC at concentrations as high as 0.5 mM for 24 h (Fig. 1C).

Figure 1.

Figure 1.

Antioxidant and cytotoxic effects of SAMC on hepatic cells. (A) Representative images of the CM-H2DCFDA staining of JHH7 cells treated with EtOH or 10 µM AA for 16 h. (B) A dose-dependent decrease in cellular ROS levels, as measured by CM-H2DCFDA staining, following SAMC treatment for 4 h in JHH7 cells. (C) No cytotoxic effect of SAMC treatment for 24 h was observed on the JHH7 cells. The data are presented as the means ± SD; *P<0.05, ANOVA with the Bonferroni multiple comparisons test. Ctl, H2O. SAMC, S-allylmercaptocysteine; CM-H2DCFDA, chloromethyl derivative of 20,70-dichlorodihydrofluorescein diacetate; AA, arachidonic acid; ROS, reactive oxygen species.

Garlic extracts suppressed the AA-induced cellular activation of TG2 in JHH7 cells

We have previously reported that the AA-induced suppression of cell growth accompanies the production of ROS followed by the activation of nuclear TG2 in hepatic cells (17). In this study, we examined the effects of garlic extracts on the activation of TG2 induced by AA (Fig. 2). In accordance with a previous study (17), AA treatment at a concentration of 10 µM for 24 h significantly increased the nuclear activation of TG2 in the JHH7 cells. As the positive control, TG2 activation induced by AA was significantly blocked by the irreversible TG2 inhibitor, ZDON. Notably, co-treatment with AA and either SMAC or AGEs almost completely inhibited the activity of nuclear TG2 to basal levels.

Figure 2.

Figure 2.

Effect of garlic extracts on AA-induced cellular TG2 activation in hepatic cells. (A) Quantitative data and (B) representative images of the nuclear activity of TG2 in JHH7 cells treated with 20 µM AA in the absence or presence of 0.5 mg/ml AGEs, 0.25 mM SAMC, or 50 µM ZDON for 24 h. The cellular activity of TG2 was measured based on the fluorescence intensity resulting from the TRITC-based incorporation of 5-BAPA. White arrows indicated the cells with nuclear activation of TG2. The data are presented as the means ± SD; *P<0.05, Student's t-test. AA, arachidonic acid; TG2, transglutaminase 2; SAMC, S-allylmercaptocysteine; AGE, aged garlic extract; ZDON, Z-DON-Val-Pro-Leu-OMe; 5-BAPA, 5-biotinamidopentylamine.

Garlic extracts prevent the AA-induced suppression of the growth of JHH7 cells

Finally, we examined whether the growth-suppressive effects of AA on hepatic cells may be prevented by garlic extracts (Fig. 3). AA treatment for 24 h suppressed the viability of the JHH7 cells in a dose-dependent manner. Co-treatment with SMAC, AGEs and ZDON significantly prevented the growth-suppressive effects of AA on the JHH7 cells. Fatty acids are critical constituents of the membrane and serve as energy sources and signal mediators of transduction signals (24). Increasing attention has been paid to the critical roles of unsaturated fatty acids in promoting liver damage and tumorigenesis. SCD1 is a rate-limiting lipid desaturase responsible for generating monounsaturated fatty acids, such as palmitoleic acid and oleic acid. Recently, we reported that the upregulation of SCD1 levels is observed in cancer stem cell (CSC)-like populations compared to non-CSC liver populations within human liver cancer cell lines (25). SCD1-mediated ceramide synthesis has been reported to induce mitochondrial dysfunction, ROS generation and cell apoptosis (26). The protective effects of SCD1 inhibition has been reported to ameliorate ethanol-induced liver injury (27). A SCD1 inhibitor has also been developed to attenuate lipid accumulation and liver injury in a rat model of NASH (28). Therefore, in this study, we examined whether the knockdown of SCD1 prevents the growth-suppressive effect of AA on hepatic cells. For this purpose, the cells were transduced with SCD1 shRNA lentiviral particles, and endogenous SCD1 was stably knocked down by 60% (Fig. 4A). The knockdown of SCD1 did not significantly affect the growth-suppressive effect of AA or the protective effects of AGEs, SAMC and ZDON against AA on the JHH7 cells (Fig. 4B). These data suggested that AA may directly stimulate cellular ROS production and initiate downstream signaling cascades, including nuclear TG2 activation, leading to the growth suppression of hepatic cells.

Figure 3.

Figure 3.

Effects of garlic extracts on AA-induced cell death in hepatic cells. The viability of JHH7 cells treated with increasing concentrations of AA (as indicated) in the absence or presence of 0.25 mM SAMC, 0.5 mg/ml AGEs or 50 µM ZDON for 24 h. The data are presented as the means ± SD; *P<0.05, ANOVA with the Bonferroni multiple comparison test. AA, arachidonic acid; SAMC, S-allylmercaptocysteine; AGE, aged garlic extract; ZDON, Z-DON-Val-Pro-Leu-OMe.

Figure 4.

Figure 4.

Effects of garlic extracts on the AA-induced death of hepatic cells in which SCD1 was knocked down (A) Gene expression of SCD1 in JHH7 cells transduced with control (shCtl) or SCD1 (shSCD1) shRNA lentiviral particles. (B) The viability of shCtl- and shSCD1-transduced JHH7 cells treated with 20 µM AA in the absence or presence of 5 mM NAC, 0.5 mg/ml AGEs, or 0.25 mM SAMC for 24 h. The data are presented as the means ± SD; *P<0.05, Student's t-test; n.s., not significant. AA, arachidonic acid; SCD1, stearoyl-CoA desaturase-1; SAMC, S-allylmercaptocysteine; AGE, aged garlic extract; NAC, N-acetyl-L-cysteine.

We have previously reported that i) the level of AA is upregulated during liver tumorigenesis (13); ii) the nuclear accumulation of TG2 in hepatic cells results in crosslinking and in the inactivation of the transcription factor Sp1, which leads to the downregulation of Sp1-responsive genes involved in cell survival, and thus resulting in apoptosis (15); and iii) ROS play critical roles in nuclear TG2-dependent AA-induced liver injury (17). In this study, we addressed a potential role of garlic extracts in preventing the growth-suppressive effects of AA on hepatic cells by controlling oxidative stress-mediated cellular TG2 activation (Fig. 5). Opposing roles of TG2 in the onset of liver injury have been reported due to its dual function in the regulation of cell survival and death (15,29,30). Extracellular and cytoplasmic TG2 in the closed form exhibit multiple functions, such as GTPase, cell adhesion and scaffold activities, which are associated with cell growth and may prevent liver injury by favoring tissue stability (31). By contrast, oxidative stress, the Ca2+-dependent protein crosslinking activity of TG2 in the open form and its subcellular location in the nucleus may lead to crosslinking and the inactivation of proliferation-associated transcription factors, such as Sp1, leading to the downregulation of Sp1-responsive genes involved in cell survival and resulting in apoptosis (31). This study provides molecular evidence that the mechanism underlying the hepatoprotective effects of garlic extract is associated with the inhibition of the nuclear protein crosslinking activity of TG2. Although the underlying mechanisms are not yet fully understood, it is possible that the antioxidant garlic extracts may suppress the transformation of TG2 from the closed form to the open form, which is essential for the crosslinking activity of TG2 and likely enhances the ability of TG2 to bind importins for nuclear translocation (32).

Figure 5.

Figure 5.

Schematic diagram illustrating the mechanisms through which garlic extracts prevent the AA-induced growth suppression of liver cancer cells by targeting the ROS/TG2-dependent signaling pathway. AA, arachidonic acid; ROS, reactive oxygen species; TG2, transglutaminase 2.

Panyod et al reported that allicin, a compound in fresh aqueous extracts of garlic, prevented alcohol induced liver injury and inflammation, partly by increasing the hepatic alcohol dehydrogenase activity (10). Colín-González et al (22) and Kodai et al (23) reported that the cytoprotective effects of SAC were associated with the attenuation of oxidative stress. However, this study further provided a mechanistic insight regarding the association between the hepatoprotective effects of garlic extract and the inhibition of the TG-related crosslinking of nuclear proteins under oxidative stress conditions. Given the critical roles of unsaturated fatty acids in the maintenance of cancer cell stemness (33) and the loss of cancer immune surveillance (34) in the context of chronic injury, we propose that garlic extracts may serve as a therapeutic option for preventing chronic liver injury and inflammation and the carcinogenesis of fatty livers.

Acknowledgements

The authors would like to thank Dr T. Oka, Dr K. Tamura and Dr K. Sakata of Wakunaga Pharmaceutical Co., Ltd. for providing AGEs and SAMC.

Funding

This study was supported by Grants-in-Aid for Young Scientists JP18K15833 (to XYQ) and a Grant-in-Aid for Scientific Research (C) JP18K06976 (to SK) from the Ministry of Education, Culture, Sports, Science and Technology of Japan, the Takeda Science Foundation (to XYQ), and a Research on the Innovative Development and the Practical Application of New Drugs for Hepatitis B Grant JP19fk0310112 from the Japan Agency for Medical Research and Development (to SK).

Availability of data and materials

All data generated or analyzed during this study are included in this published article or are available from the corresponding author on reasonable request.

Authors' contributions

XYQ and SK designed the study. XYQ and TS conducted the experiments. XYQ performed the statistical analysis and data interpretation. XYQ, TS and SK wrote the manuscript. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

  • 1.Banerjee SK, Mukherjee PK, Maulik SK. Garlic as an antioxidant: The good, the bad and the ugly. Phytotherapy research. PTR. 2003;17:97–106. doi: 10.1002/ptr.1281. [DOI] [PubMed] [Google Scholar]
  • 2.Kyo E, Uda N, Kasuga S, Itakura Y. Immunomodulatory effects of aged garlic extract. J Nutr. 2001;131(Suppl 3):1075S–1079S. doi: 10.1093/jn/131.3.1075S. [DOI] [PubMed] [Google Scholar]
  • 3.Fratianni F, Riccardi R, Spigno P, Ombra MN, Cozzolino A, Tremonte P, Coppola R, Nazzaro F. Biochemical Characterization and Antimicrobial and Antifungal Activity of Two Endemic Varieties of Garlic (Allium sativum L.) of the Campania Region, Southern Italy. J Med Food. 2016;19:686–691. doi: 10.1089/jmf.2016.0027. [DOI] [PubMed] [Google Scholar]
  • 4.Xiao D, Pinto JT, Soh JW, Deguchi A, Gundersen GG, Palazzo AF, Yoon JT, Shirin H, Weinstein IB. Induction of apoptosis by the garlic-derived compound S-allylmercaptocysteine (SAMC) is associated with microtubule depolymerization and c-Jun NH(2)-terminal kinase 1 activation. Cancer Res. 2003;63:6825–6837. [PubMed] [Google Scholar]
  • 5.Ghyasi R, Mohaddes G, Naderi R. Combination effect of voluntary exercise and garlic (Allium sativum) on oxidative stress, cholesterol level and histopathology of heart tissue in type 1 diabetic rats. J Cardiovasc Thorac Res. 2019;11:61–67. doi: 10.15171/jcvtr.2019.10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.García-Villalón AL, Amor S, Monge L, Fernández N, Prodanov M, Muñoz M, Inarejos-García AM, Granado M. In vitro studies of an aged black garlic extract enriched in S-allylcysteine and polyphenols with cardioprotective effects. J Funct Foods. 2016;27:189–200. doi: 10.1016/j.jff.2016.08.062. [DOI] [Google Scholar]
  • 7.Tsai JC, Chen YA, Wu JT, Cheng KC, Lai PS, Liu KF, Lin YK, Huang YT, Hsieh CW. Extracts from Fermented Black Garlic Exhibit a Hepatoprotective Effect on Acute Hepatic Injury. Molecules. 2019;24(pii):E1112. doi: 10.3390/molecules24061112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Wu ZR, Peng-Chen, Yang-Li, Li JY, Xin-Wang, Yong-Wang, Guo DD, Lei-Cui, Guan QG, Li HY. Two cinnamoyloctopamine antioxidants from garlic skin attenuates oxidative stress and liver pathology in rats with non-alcoholic steatohepatitis. Phytomedicine. 2015;22:178–182. doi: 10.1016/j.phymed.2014.11.013. [DOI] [PubMed] [Google Scholar]
  • 9.Xiao J, Xing F, Liu Y, Lv Y, Wang X, Ling M-T, Gao H, Ouyang S, Yang M, Zhu J, et al. Garlic-derived compound S-allylmercaptocysteine inhibits hepatocarcinogenesis through targeting LRP6/Wnt pathway. Acta Pharm Sin B. 2018;8:575–586. doi: 10.1016/j.apsb.2017.10.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Panyod S, Wu WK, Ho CT, Lu KH, Liu CT, Chu YL, Lai YS, Chen WC, Lin YE, Lin SH, Sheen LY. Diet Supplementation with Allicin Protects against Alcoholic Fatty Liver Disease in Mice by Improving Anti-inflammation and Antioxidative Functions. J Agric Food Chem. 2016;64:7104–7113. doi: 10.1021/acs.jafc.6b02763. [DOI] [PubMed] [Google Scholar]
  • 11.Starley BQ, Calcagno CJ, Harrison SA. Nonalcoholic fatty liver disease and hepatocellular carcinoma: A weighty connection. Hepatology. 2010;51:1820–1832. doi: 10.1002/hep.23594. [DOI] [PubMed] [Google Scholar]
  • 12.Wong SW, Ting YW, Chan WK. Epidemiology of non-alcoholic fatty liver disease-related hepatocellular carcinoma and its implications. JGH Open. 2018;2:235–241. doi: 10.1002/jgh3.12070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Qin XY, Tatsukawa H, Hitomi K, Shirakami Y, Ishibashi N, Shimizu M, Moriwaki H, Kojima S. Metabolome Analyses Uncovered a Novel Inhibitory Effect of Acyclic Retinoid on Aberrant Lipogenesis in a Mouse Diethylnitrosamine-Induced Hepatic Tumorigenesis Model. Cancer Prev Res (Phila) 2016;9:205–214. doi: 10.1158/1940-6207.CAPR-15-0326. [DOI] [PubMed] [Google Scholar]
  • 14.Qin XY, Suzuki H, Honda M, Okada H, Kaneko S, Inoue I, Ebisui E, Hashimoto K, Carninci P, Kanki K, et al. Prevention of hepatocellular carcinoma by targeting MYCN-positive liver cancer stem cells with acyclic retinoid. Proc Natl Acad Sci USA. 2018;115:4969–4974. doi: 10.1073/pnas.1802279115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Tatsukawa H, Fukaya Y, Frampton G, Martinez-Fuentes A, Suzuki K, Kuo TF, Nagatsuma K, Shimokado K, Okuno M, Wu J, et al. Role of transglutaminase 2 in liver injury via cross-linking and silencing of transcription factor Sp1. Gastroenterology. 2009;136:1783–1795.e10. doi: 10.1053/j.gastro.2009.01.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Shrestha R, Shrestha R, Qin XY, Kuo TF, Oshima Y, Iwatani S, Teraoka R, Fujii K, Hara M, Li M, et al. Fungus-derived hydroxyl radicals kill hepatic cells by enhancing nuclear transglutaminase. Sci Rep. 2017;7:4746. doi: 10.1038/s41598-017-04630-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Qin XY, Lu J, Cai M, Kojima S. Arachidonic acid suppresses hepatic cell growth through ROS-mediated activation of transglutaminase. FEBS Open Bio. 2018;8:1703–1710. doi: 10.1002/2211-5463.12511. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Fujise K, Nagamori S, Hasumura S, Homma S, Sujino H, Matsuura T, Shimizu K, Niiya M, Kameda H, Fujita K, et al. Integration of hepatitis B virus DNA into cells of six established human hepatocellular carcinoma cell lines. Hepatogastroenterology. 1990;37:457–460. [PubMed] [Google Scholar]
  • 19.Qin XY, Wei F, Tanokura M, Ishibashi N, Shimizu M, Moriwaki H, Kojima S. The effect of acyclic retinoid on the metabolomic profiles of hepatocytes and hepatocellular carcinoma cells. PLoS One. 2013;8:e82860. doi: 10.1371/journal.pone.0082860. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 21.Rose P, Moore PK, Zhu YZ. Garlic and Gaseous Mediators. Trends Pharmacol Sci. 2018;39:624–634. doi: 10.1016/j.tips.2018.03.009. [DOI] [PubMed] [Google Scholar]
  • 22.Colín-González AL, Santana RA, Silva-Islas CA, Chánez-Cárdenas ME, Santamaria A, Maldonado PD. The antioxidant mechanisms underlying the aged garlic extract- and S-allylcysteine-induced protection. Oxid Med Cell Longev. 2012;2012:907162. doi: 10.1155/2012/907162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kodai S, Takemura S, Minamiyama Y, Hai S, Yamamoto S, Kubo S, Yoshida Y, Niki E, Okada S, Hirohashi K, et al. S-allyl cysteine prevents CCl(4)-induced acute liver injury in rats. Free Radic Res. 2007;41:489–497. doi: 10.1080/10715760601118361. [DOI] [PubMed] [Google Scholar]
  • 24.Eyster KM. The membrane and lipids as integral participants in signal transduction: Lipid signal transduction for the non-lipid biochemist. Adv Physiol Educ. 2007;31:5–16. doi: 10.1152/advan.00088.2006. [DOI] [PubMed] [Google Scholar]
  • 25.Qin XY, Dohmae N, Kojima S. Reply to Yoshida: Liver cancer stem cells: Identification and lipid metabolic reprogramming. Proc Natl Acad Sci USA. 2018;115:E6390–E6391. doi: 10.1073/pnas.1808740115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Chen L, Ren J, Yang L, Li Y, Fu J, Li Y, Tian Y, Qiu F, Liu Z, Qiu Y. Stearoyl-CoA desaturase-1 mediated cell apoptosis in colorectal cancer by promoting ceramide synthesis. Sci Rep. 2016;6:19665. doi: 10.1038/srep19665. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Lounis MA, Escoula Q, Veillette C, Bergeron KF, Ntambi JM, Mounier C. SCD1 deficiency protects mice against ethanol-induced liver injury. Biochim Biophys Acta. 2016;1861:1662–1670. doi: 10.1016/j.bbalip.2016.07.012. [DOI] [PubMed] [Google Scholar]
  • 28.Kurikawa N, Takagi T, Wakimoto S, Uto Y, Terashima H, Kono K, Ogata T, Ohsumi J. A novel inhibitor of stearoyl-CoA desaturase-1 attenuates hepatic lipid accumulation, liver injury and inflammation in model of nonalcoholic steatohepatitis. Biol Pharm Bull. 2013;36:259–267. doi: 10.1248/bpb.b12-00702. [DOI] [PubMed] [Google Scholar]
  • 29.Nardacci R, Lo Iacono O, Ciccosanti F, Falasca L, Addesso M, Amendola A, Antonucci G, Craxì A, Fimia GM, Iadevaia V, et al. Transglutaminase type II plays a protective role in hepatic injury. Am J Pathol. 2003;162:1293–1303. doi: 10.1016/S0002-9440(10)63925-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Piacentini M, Baiocchini A, Del Nonno F, Melino G, Barlev NA, Rossin F, D'Eletto M, Falasca L. Non-alcoholic fatty liver disease severity is modulated by transglutaminase type 2. Cell Death Dis. 2018;9:257. doi: 10.1038/s41419-018-0292-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Tatsukawa H, Furutani Y, Hitomi K, Kojima S. Transglutaminase 2 has opposing roles in the regulation of cellular functions as well as cell growth and death. Cell Death Dis. 2016;7:e2244. doi: 10.1038/cddis.2016.150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Shrestha R, Tatsukawa H, Shrestha R, Ishibashi N, Matsuura T, Kagechika H, Kose S, Hitomi K, Imamoto N, Kojima S. Molecular mechanism by which acyclic retinoid induces nuclear localization of transglutaminase 2 in human hepatocellular carcinoma cells. Cell Death Dis. 2015;6:e2002. doi: 10.1038/cddis.2015.339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Li J, Condello S, Thomes-Pepin J, Ma X, Xia Y, Hurley TD, Matei D, Cheng JX. Lipid Desaturation Is a Metabolic Marker and Therapeutic Target of Ovarian Cancer Stem Cells. Cell Stem Cell. 2017;20:303–314.e5. doi: 10.1016/j.stem.2016.11.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Ma C, Kesarwala AH, Eggert T, Medina-Echeverz J, Kleiner DE, Jin P, Stroncek DF, Terabe M, Kapoor V, ElGindi M, et al. NAFLD causes selective CD4(+) T lymphocyte loss and promotes hepatocarcinogenesis. Nature. 2016;531:253–257. doi: 10.1038/nature16969. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data generated or analyzed during this study are included in this published article or are available from the corresponding author on reasonable request.


Articles from Experimental and Therapeutic Medicine are provided here courtesy of Spandidos Publications

RESOURCES