Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2020 Feb 21;64(3):e01836-19. doi: 10.1128/AAC.01836-19

Genetic Factors Associated with Enhanced blaKPC Expression in Tn3/Tn4401 Chimeras

Jiansheng Huang a,b,#, Xiaolei Hu a,#, Yunan Zhao a, Yang Shi a, Hui Ding a, Jianfen Xv a, Jianmin Ren a, Rongzhen Wu a,, Zhigang Zhao a,
PMCID: PMC7038255  PMID: 31844015

The expression of the blaKPC gene plays a key role in carbapenem resistance in Enterobacteriaceae. However, the genetic regulators of the blaKPC gene have not been completely elucidated, especially the genes in Tn3-Tn4401 chimeras.

KEYWORDS: blaKPC, Tn3-Tn4401 chimera, genetic factors, enhanced expression

ABSTRACT

The expression of the blaKPC gene plays a key role in carbapenem resistance in Enterobacteriaceae. However, the genetic regulators of the blaKPC gene have not been completely elucidated, especially the genes in Tn3-Tn4401 chimeras. Two novel Tn3-Tn4401 chimera isoforms were characterized in our hospital, isoform A (CTA), which harbors a 121-bp deletion containing the PX promoter and was present in 22.6% (54/239) of isolates, and isoform C (CTC), which harbors a 624-bp insertion and a P1 promoter deletion and was present in only 1 isolate. The carbapenem MICs of both isoforms were 2-fold or more higher than those of the wild type (Tn3-Tn4401 chimera, CTB), and blaKPC was most highly expressed in CTA. Bioinformatics and 5′ rapid amplification of cDNA ends (5′ RACE) experiments indicated a novel strong putative promoter, PY, at the 3′ end of the ISKpn8 gene. PY mutation nearly abrogated blaKPC expression (P < 0.01) and restored carbapenem susceptibility in all 3 isoforms. Although the mutation of PX or P1 halved blaKPC expression in CTB (P < 0.05), PX deletion caused a 68% increase in blaKPC expression (P = 0.037) in CTA. The level of blaKPC mRNA in CTC was 8-fold higher than that in InCTC, which harbors P1 (P = 0.011). These results suggest that PY is a core promoter of the blaKPC gene in the chimeras and that the deletion of the PX and P1 promoters enhanced gene expression in CTA and CTC, respectively.

INTRODUCTION

Carbapenems are considered the last effective agents against severe infections caused by extended spectrum beta-lactamase (ESBL)-producing Gram-negative bacteria (1, 2). However, the increasing prevalence of Klebsiella pneumoniae carbapenemase (KPC) has greatly limited the effectiveness of these agents in China (3, 4). The KPC-type carbapenemase, a powerful Ambler class A enzyme that can hydrolyze nearly all beta-lactams, was first identified from a K. pneumoniae strain in the United States in 2001 (5). Since then, this gene has rapidly disseminated into multiple genera and species of Enterobacteriaceae, including Escherichia coli, Citrobacter spp., Salmonella spp., and Serratia marcescens, and nonfermenters, such as Pseudomonas spp. and Acinetobacter spp., and has been distributed worldwide (613).

To date, two major genetic structures that carry the blaKPC gene, the Tn4401 transposon (a and b) and the Tn3-Tn4401 chimera CTB, have been characterized outside and inside China, respectively (1317). The Tn4401 transposon is considered the original genetic structure mediating blaKPC gene acquisition worldwide, and a total of eight unique isoforms (a to h) that differ in deletions immediately upstream of the blaKPC gene have been characterized (13, 15, 1822). In this transposon, three blaKPC promoters, P1, P2, and P3, were identified by Naas and colleagues (23). Among these promoters, P2 was reported as the core promoter, and P3 was suggested to function as a barrier (22, 23). In China, nearly all of the blaKPC genes are located in the Tn3-Tn4401 chimera CTB with the gene order Tn3 transposase, Tn3 resolvase, ISKpn8, blaKPC, ISKpn6-like element, Tn1721 resolvase, and Tn1721 transposase (14, 16). However, the chimera lacks both the P2 and P3 promoters and carries the P1 promoter (17). Although the wild-type chimera CTB was identified in 2009, only one isoform (named CTD in this study), in which a 671-bp fragment is inserted between ISKpn8 and the blaKPC-3 gene, has been characterized in two KPC-3-producing E. coli and Citrobacter freundii strains thus far (16, 24). Fortunately, a 4-fold reduction in the MICs of imipenem (IPM), meropenem (MEM), cefepime (FEP), and cefotaxime was observed in the E. coli and C. freundii strains carrying the insertion isoform (24). Previously, we comparatively analyzed blaKPC expression in Tn4401 transposons and the Tn3-Tn4401 chimera CTB and characterized a novel promoter, PX, that drives blaKPC expression (17). However, mutations in PX or the P1 promoter still preserved half of the mRNA transcription, indicating unknown regulators of blaKPC gene expression in the Tn3-Tn4401 chimera (17).

Recently, we characterized two novel Tn3-Tn4401 chimera isoforms, named CTA and CTC, with elevated blaKPC-2 expression. CTA has a unique 121-bp deletion in the noncoding region upstream of the P1 promoter, causing the deletion of the PX promoter. In contrast, in CTC, a 624-bp insertion containing a truncated blaTEM gene, was inserted downstream of the PX promoter, deleting the P1 promoter. Here, we assessed the effect of these mutations on KPC expression and resistance phenotypes and further explored the impact of genetic variability in the intervening sequence (IVS) on gene expression.

RESULTS

Genetic structures of the blaKPC gene.

Based on PCRs, the Tn3-Tn4401 chimera CTB was detected in 184 (77.0%) strains that were mainly recovered after 2014. In addition, the chimera isoform CTA, carrying a shortened IVS, was characterized in 54 (22.6%) strains that were recovered between 2010 and 2014 (25). Besides, a novel isoform (CTC) with elongated noncoding and/or promoter regions was detected in 1 Klebsiella oxytoca strain in 2018. DNA sequencing revealed a 121-bp deletion (corresponding to positions 115379 to 115499 of the plasmid pLSH-KPN148-1; GenBank accession number MK396843 [17]) immediately upstream of the P1 promoter, causing the deletion of the PX promoter in CTA compared with CTB. However, an additional 624-bp insertion containing a truncated blaTEM gene was added, and a 127-bp sequence carrying the P1 promoter was deleted at 143 bp downstream of the PX promoter in CTC (Fig. 1A).

FIG 1.

FIG 1

(A) Schematic structures surrounding the blaKPC gene in Tn4401 transposons and the Tn3-Tn4401 chimeras CTA, CTB, CTC, and CTD. The dotted line shows the 100% identical sequence (2,070 bp) between the transposons and the chimeras. Promoters of the blaKPC gene are shown by triangles and rectangles above the sequence bar. The inverted triangles above CTC and CTD indicate the insertion sequences that contain a truncated blaTEM gene. CTA-J is the Tn3-Tn4401 chimera isoform identified in Japan (GenBank accession number AB854326) (28). (B) Nucleotide sequences illustrating variations in the intervening sequence (IVS) between ISKpn8 and the blaKPC gene in the Tn3-Tn4401 chimera. Highlighted regions include the putative −35 and −10 boxes of the promoters P1, PX, and PY and the 10-bp IVS (MIVS) nucleotides immediately upstream of the P1 promoter. The bold and italic nucleotides and dashed sequences indicate mutation sites in different recombined plasmids. Additional insertions in CTC and CTD are indicated by black bars. The transcriptional start site (TSS; +1), putative ribosome binding site (RBS), and the blaKPC gene start codon (ATG) are also shown.

Promoters.

Besides the promoters PX and P1, bioinformatics analysis indicated a novel strong putative promoter, named PY, with the −10 and −35 conserved sequences of TGtcATgAT and TTGACA, respectively (Fig. 1B). The PY promoter crosses the 3′ end of the ISKpn8 gene and the IVS with a linear discriminant function (LDF) value of 4.06, which is much higher than that of PX (2.85) and P1 (0.2). Consistently, RACE experiments revealed transcription start sites (TSSs) of the P1 and PX promoters and a novel TSS 247 bp upstream of the blaKPC gene in KPN148 and CTB (Fig. 1B). The novel TSS was also detected 126 bp upstream of the blaKPC start codon in KPN25 and CTA strains and was exactly 8 bp downstream of the −10 box of the putative PY promoter.

Recombined plasmids.

Taking into account pCTB, pM1CTB, pMXCTB, and pSDKPC, which had been generated previously (17), a total of 19 plasmids were systematically constructed in this study (Table 1). Among all the plasmid transformants, no significant difference in the blaKPC gene copy numbers were observed (data not shown).

TABLE 1.

Recombined plasmids and their mutations designed in this study

Plasmid Promotersb Targetc Sequence ofa:
Note
Wild type Mutation
pCTB P1, PX, PY n
pM1CTB P1M, PX, PY P1 TAATCCCAGCTGTAGCGGCCTGATTACAT CGAGCCAGCTGCAGCGGCCTGATGCCGC Inactive
pMXCTB P1, PXM, PY PX TTCAAATATGTATCCGCTCATGAGACAAT TGCACGTATGTATCCGCTCACGAGCCAGG Inactive
pMYCTB PX, PX, PYM PY TTGACATATAGGTTAATGTCATGAT CGGCCGTATAGGTTAACGGCACGCT Inactive
pDYCTB P1, PX, PYDel PY Deletion Inactive
pCTA P1, PY n
pM1CTA P1M, PY P1 TAATCCCAGCTGTAGCGGCCTGATTACAT CGAGCCAGCTGCAGCGGCCTGATGCCGC Inactive
pMYCTA P1, PYM PY TTGACATATAGGTTAATGTCATGAT CGGCCGTATAGGTTAACGGCACGCT Inactive
pDYCTA P1, PYDel PY Deletion Inactive
pCTC PX, PY n -
pInCTC P1In, PX, PY P1 Insertion P1 as in the pHS1075 (24) Inactive
pMXCTC PXM, PY PX TTCAAATATGTATCCGCTCATGAGACAAT TGCACGTATGTATCCGCTCACGAGCCAGG Inactive
pMYCTC PX, PYM PY TTGACATATAGGTTAATGTCATGAT CGGCCGTATAGGTTAACGGCACGCT Inactive
pDelCTB P1, PX, PY IVS 65-bp deletion directly upstream of the PX Inactive
pInCTA P1, PY IVS 65-bp insertion at 18 bp upstream of the P1 Inactive
pDelCTA P1, PY IVS 30-bp deletion directly upstream of the P1 Inactive
pMIVSCTA P1, PY IVS GTCAGACCCCTAATCCCAGCTGTAGCGG ACCGAGTCAGTAATCCCAGCTGTAGCGG Inactive
pMIVSCTB P1, PX, PY IVS GTCAGACCCCTAATCCCAGCTGTAGCGG ACCGAGTCAGTAATCCCAGCTGTAGCGG Inactive
pSDKPC N n
a

The −35 and −10 consensus sequences of each promoter are underlined. Bold and italic nucleotides indicate mutations in each sequence.

b

M, mutation; Del, deletion; In, insertion; N, no blaKPC promoter available.

c

n, no mutation.

Susceptibility and MIC testing.

Three representative blaKPC-2-positive plasmids that carry the CTA, CTB, and CTC structures (pLSH-KPN25-1, pLSH-KPN148-1, and pLSCH-KOX18040-1, respectively) were acquired and transformed into E. coli. Identically to their clinical parents, all 3 plasmid transformants (ET25, ET148 and ET18040) were insensitive to carbapenems (Table 2). ET25 was the most resistant, while ET148 was the least, with both IPM and MEM MICs of 2 μg/ml. Compared with the wild-type recombinant CTB strain, the CTA strain, in which the PX promoter was deleted, exhibited enhanced IPM, MEM, FEP, and CAZ MICs of 32, 32, ≥256, and ≥256 μg/ml, respectively. Elevated MEM and FEP MICs were also detected in the CTC strain. Although the mutation of P1 or PX resulted in at least a 2-fold reduction in MICs for IPM, MEM, FEP, and CAZ in the CTA, CTB, and CTC strains, the mutants were still resistant to all 6 beta-lactams. Interestingly, the insertion of promoter P1 resulted in more than 8-fold decreases in MICs for IPM, MEM, FEP, and CAZ in InCTC. However, the PY mutants MYCTA, MYCTB, and MYCTC were susceptible to all 6 agents, and the MICs for IPM were only ≤0.25, 1, and 0.5 μg/ml, respectively. Consistently, the PY deletion strains DYCTB and DYCTA were also sensitive to all 6 antibiotics, while DYCTB showed slightly higher MICs than DYCTA for IMP, CAZ, TZP, and ATM. For the IVS mutants, reduced IMP, MEM, CAZ, and FEP MICs were observed in both MIVSCTA and MIVSCTB; the deletion of the IVS sequence resulted in more than 8-fold decreases in the MICs for all 6 agents in DelCTA.

TABLE 2.

MICs of the strains tested in this study

Straina Promoter(s)b MIC (μg/ml) ofc:
Note
IMP MEM CAZ FEP TZP ATM
K. pneumoniae
    KPN148 P1, PX, PY 32 ≥64 128 ≥256 512/4 ≥256 Clinical strain
    KPN25 P1, PY 8 16 32 8 ≥1,024 ≥256 Clinical strain
Klebsiella oxytoca
    KOX18040 PX, PY 4 16 32 ≥256 ≥1,024 ≥256 Clinical strain
E. coli
    ET148 P1, PX, PY 2 2 16 4 64 32
    ET25 P1, PY 4 8 16 8 256 64
    ET18040 PX, PY 4 4 16 4 128 64
    CTB P1, PX, PY 16 16 128 32 ≥1,024 ≥256
    M1CTB P1M, PX, PY 4 2 16 4 128 64
    MXCTB P1, PXM, PY 4 4 16 4 512 128
    MYCTB PX, PX, PYM 1 0.5 4 ≤1 64 8
    DYCTB P1, PX, PYDel 0.5 ≤0.25 4 ≤1 64 16
    CTA P1, PY 32 32 ≥256 ≥256 ≥1,024 ≥256
    M1CTA P1M, PY 8 4 32 8 512 128
    MYCTA P1, PYM ≤0.25 ≤0.25 ≤1 ≤1 ≤4 ≤1
    DYCTA P1, PYDel ≤0.25 ≤0.25 ≤1 ≤1 ≤4 ≤1
    CTC PX, PY 16 32 128 ≥256 ≥1,024 ≥256
    InCTC P1In, PX, PY 2 2 16 8 256 128
    MXCTC PXM, PY 8 16 64 32 ≥1,024 ≥256
    MYCTC PX, PYM 0.5 ≤0.25 ≤1 ≤1 8 ≤1
    DelCTB P1, PX, PY 8 8 ≥256 64 ≥1,024 ≥256 IVS partial deletion
    InCTA P1, PY 8 8 ≥256 32 ≥1,024 ≥256 IVS insertion
    DelCTA P1, PY 2 2 8 4 64 32 IVS partial deletion
    MIVSCTA P1, PY 8 8 64 16 ≥1,024 ≥256 IVS mutation
    MIVSCTB P1, PX, PY 8 8 32 16 256 128 IVS mutation
    SDKPC N ≤0.5 ≤0.5 ≤1 ≤1 ≤4 ≤1
    ET ≤0.5 ≤0.5 ≤1 ≤1 ≤4 ≤1
a

KPN, Klebsiella pneumoniae; KOX, Klebsiella oxytoca; ET, E. coli Trans1-T1, an E. coli DH5α competent cell line that was used as the recipient strain in this study.

b

M, mutation; Del, deletion; In, insertion; N, no blaKPC promoter available.

c

IPM, imipenem; MEM, meropenem; CAZ, ceftazidime; FEP, cefepime; TZP, piperacillin-tazobactam; ATM, aztreonam.

mRNA expression of the blaKPC gene.

In accordance with the MICs for IPM, the relative blaKPC mRNA expression levels of the CTA, CTB, and CTC strains were 1.68 ± 0.23, 1.00, and 0.77 ± 0.16, respectively (Fig. 2, Table S1). In comparison with these wild-type strains, the mutation of the P1 promoter significantly downregulated blaKPC mRNA expression levels by approximately 43.4% and 56.3% (P < 0.01) in M1CTA and M1CTB, respectively. However, the insertion of P1 caused a dramatic decrease in blaKPC mRNA expression by approximately 87.1% (P = 0.011) in the InCTC strain. Moreover, the mutation of the PX promoter greatly limited blaKPC expression in MXCTB (P = 0.041) but had no significant effect on blaKPC expression in MXCTC. In contrast, the mutation of the putative PY promoter nearly abrogated blaKPC expression in the MYCTA, MYCTB, and MYCTC strains (P < 0.01). Consistently, the deletion of PY nearly abrogated blaKPC expression in both the DYCTA and DYCTB strains (P < 0.01). However, blaKPC mRNA expression in MYCTB and DYCTB was 10-fold higher than that in MYCTA and DYCTA (P < 0.01). In addition, as the IVS sequence shortened, the blaKPC mRNA levels decreased gradually rather than increased, with the exception of CTA, which exhibited the highest levels of blaKPC mRNA expression. In particular, up to 81.5% and 65.5% (P < 0.01) of blaKPC expression was reduced in DelCTA and MIVSCTA, respectively. The downregulation of blaKPC mRNA was also observed in MIVSCTB (P = 0.051).

FIG 2.

FIG 2

Relative mRNA expression of the blaKPC gene with different promoter structures of the Tn3/Tn4401 chimera. Recombinant strains were cultured in LB broth for 4 h. Total RNA was extracted, and the blaKPC mRNA expression of each isolate was normalized to 16S rRNA after 3 replicates. The relative blaKPC mRNA expression in the CTB strain was set as 1. *, P < 0.05; **, P < 0.01 (Student’s t test).

KPC protein production.

In agreement with mRNA expression, KPC was most highly produced in CTA (1.61 ± 0.28), followed by CTB (1.00) and CTC (0.88 ± 0.15), and the mutation in PY resulted in a nearly 90% reduction in KPC production in all 3 structures (P ≤ 0.001) (Fig. 3, Table S1). Although the mutation of P1 or PX significantly decreased KPC production in M1CTB, MXCTB, and M1CTA (P < 0.05), little effect on KPC production was detected in MXCTC. The insertion of P1 caused a significant KPC reduction of approximately 63.6% in the InCTC strain (P = 0.025). Similarly, additional insertions in the IVS in InCTA greatly limited KPC production. In particular, the deletion or mutation of the 10-bp IVS sequence upstream of P1 resulted in approximately 68.9% and 49.1% reductions in KPC expression in DelCTA and MIVSCTA, respectively (P < 0.05).

FIG 3.

FIG 3

KPC production within different Tn3/Tn4401 structures. (A) Representative Western blot results by targeting the Flag tag. Total protein was extracted after culturing the strains in LB broth for 6 h. (B) The KPC production of each isolate was normalized to DnaK levels and reported relative to that of the CTB strain. *, P < 0.05; **, P < 0.01 (Student’s t test).

DISCUSSION

KPC-type carbapenemases are powerful β-lactamases that efficiently hydrolyze nearly all carbapenems and generate a serious threat to public health (1, 2). Although the porin proteins OmpK35 and OmpK36 may increase resistance, they serve only as a cooperative factor, and the blaKPC gene still plays a key role in high-level carbapenem resistance (26). Similarly to the Tn4401 transposon, the Tn3-Tn4401 chimera has previously been experimentally demonstrated to be an original structure capable of transferring blaKPC both internally and externally from one strain to another (27).

To date, nearly all of the blaKPC genes characterized in Enterobacteriaceae in China have been encompassed in CTB, which is typically characterized in the plasmid pKP048 (GenBank accession number FJ628167) (16, 24). As reported previously, 77.0% of the blaKPC genes detected in our hospital were integrated into the wild-type CTB chimera, which serves as a dominant isoform (25). The novel isoform CTA was detected in 22.6% of strains isolated before 2014. A variant that was designated CTA-J in this study was also detected in the K. pneumoniae strain Kp3018 in Japan in 2014 (28). Rather than the 124-bp deletion 28 bp upstream of P1 in CTA-J, there was a 121-bp deletion 18 bp upstream of P1 in CTA. In addition, although a 671-bp insertion with a similar sequence was identified in CTD (24), the novel variant CTC lacks the 127-bp fragment (position 1769 to 1895 of pHS1075; accession number FJ609231) that contains the P1 promoter.

The IPM and MEM MICs of ET148 carrying CTB were identical to those of the CKP048 (2 μg/ml) (14). In comparison, the ET25 and ET18040 strains carrying CTA exhibited 2-fold or greater increased carbapenem MICs that were the same as that of the pKp3018 transformant, which carries the variant CTA-J (28). Consistently, increased carbapenem resistance was also observed in the CTA and CTC recombinant strains compared with the CTB strain. In contrast to the 4-fold reduction in the IPM and MEM MICs caused by the 671-bp insertion in CTD (24), elevated carbapenem MICs were detected in CTC. However, an 8-fold reduction in the carbapenem MICs was also observed to result from insertion of the P1 sequence in InCTC.

Consequently, we further analyzed the genetic factors that improved blaKPC expression in the Tn3-Tn4401 chimeras. Previously, we identified the PX promoter upstream of P1 in the wild-type CTB chimera (17). However, it was deleted in the novel chimera isoform CTA (25). Bioinformatics analysis and RACE experiments suggested a novel promoter, PY. Excellent matches of the consensus sequences to the canonical motif indicated that PY was a typical σ70-dependent promoter (29). Although the mutation of P1 or PX halved blaKPC expression in M1CTB and MXCTB (17), the mutation of PY resulted in a greater than 90% reduction in blaKPC expression in the MYCTB, MYCTA, and MYCTC strains (P < 0.01) and restored sensitivity to all 6 β-lactams. Consistently, the deletion of PY nearly abrogated blaKPC expression and carbapenem resistance in the DYCTB and DYCTA strains. As indicated by the LDF value, PY impacts blaKPC expression far more than do PX and P1. Thus, similar to the role of P2 in Tn4401 transposons (23), these results supported the PY as a core promoter that controls blaKPC expression in the Tn3-Tn4401 chimera.

Furthermore, the fact that DYCTB exhibited higher CAZ, TZP, and IPM MICs and blaKPC expression levels than DYCTA further supported PX as a functional promoter, as we previously reported (17). However, similar to Tn4401a, which lacks the P3 promoter (23), the deletion of PX promoter caused a 68% increase in blaKPC expression in CTA (P = 0.037). Besides, elongating (InCTA) or shortening (DelCTA) the IVS resulted in a 50% to 80% downregulation of blaKPC expression in CTA (P < 0.05). Interestingly, the mutation of the 10-bp nucleotide region directly upstream of P1 in MIVSCTA had a greater impact on blaKPC expression than the mutation of P1 in M1CTA (65.4% versus 43.4%; P = 0.013). In particular, the level of blaKPC mRNA in CTC was 8-fold higher than that in InCTC, in which P1 was inserted (P = 0.011), indicating that the deletion of P1 elevated blaKPC expression in CTC.

In summary, we characterized two novel Tn3-Tn4401 chimera isoforms, CTA and CTC, both of which exhibit higher carbapenem resistance than the wild-type chimera CTB. We found, based on analyses of MICs, mRNA levels, and KPC production, that the novel PY promoter is a core promoter of the blaKPC gene that is harbored in the Tn3-Tn4401 chimera isoforms CTA, CTB, and CTC. Meanwhile, the IVS has an impact on KPC production, and deletion of PX and P1 may enhance KPC expression in CTA and CTC, respectively. This work provides further understanding of blaKPC expression in Tn3-Tn4401 chimeras.

MATERIALS AND METHODS

Bacterial strains.

From 2010 to 2018, a total of 239 nonduplicated KPC-producing Enterobacteriaceae strains belonging to K. pneumoniae (n = 221), Klebsiella aerogenes (n = 6), C. freundii (n = 5), E. coli (n = 2), Enterobacter asburiae (n = 2), or other species (n = 3) were isolated from Lishui Hospital of Zhejiang University, a tertiary hospital in Zhejiang Province, China. Bacterial species were initially identified by the Vitek 2 Compact System (bioMérieux Vitek, USA) and confirmed via an automated mass spectrometry microbial identification system (matrix-assisted laser desorption ionization–time of flight (MALDI-TOF; Bruker, USA) or via RecN and Hsp60 sequencing (9).

Evaluation of the blaKPC genetic structures.

Genetic environments of the blaKPC gene were amplified and sequenced using primers described in our previous study (25). Briefly, specific primers targeting ISKpn7, ISKpn8, and the blaKPC genes were designed, and PCR amplicons were sequenced. Then, genomic DNA of the representative K. pneumoniae strains KPN148 and KPN25 was completely sequenced by next-generation sequencing (NGS) (HiSeq; Illumina, USA) and single-molecule real-time (SMRT) (PacBio, USA) sequencing, and genetic environments of the blaKPC genes were finally confirmed (17).

Promoter identification.

Putative promoters within 500 bp directly upstream of the blaKPC gene that carried in KPN148 and KPN25 were predicted by the online software BPROM (Softberry). Then, 5′ rapid amplification of cDNA ends (5′ RACE) (catalog no. 634859; Clontech, USA) was performed to determine the transcription start site (TSS) of the blaKPC gene in strains harboring the wild-type Tn3-Tn4401 chimera (K. pneumoniae strain KPN148 and transconjugant E. coli strain CTB) or isoforms (K. pneumoniae strain KPN25 and transconjugant E. coli strain CTA), as described in previous studies (22, 23). Total RNA was initially tailed by poly(A) polymerase (catalog no. 2181; TaKaRa, Japan) and subsequently reverse transcribed and amplified with the primers UPM and GSPK (5′-GATTACGCCAAGCTTCATCGCGTACACACCGATGG-3′) (17). The TSS of each promoter was determined as the first nucleotide after the adapter primer UPM.

Recombined plasmid construction.

To explore key regulators that affect blaKPC expression, the blaKPC genetic structures were amplified and cloned into a modified pET28X vector, and then recombinant plasmids with mutations targeting the promoters P1, PX, and PY and the IVS were produced by overlap PCR or single-primer circular (SPC)-PCR (17, 23, 30). For comparison, the 127-bp sequence corresponding to position 1769 to 1895 of the plasmid pHS1075 (accession number FJ609231 [24], designated CTD in this work) that contains P1 was inserted into InCTC. For IVS mutations, the 65-bp sequence directly upstream of the PX promoter was deleted in DelCTB, the 30-bp sequence immediately upstream of the P1 promoter was deleted in DelCTA, and the 65-bp sequence from the Kanr gene (position 651 to 715) was inserted into InCTA at 18 bp upstream of the P1 promoter. pSDKPC, in which the blaKPC gene has a ribosome binding site (RBS) but harbors no promoter, was adopted as a negative control (17, 23). Relative blaKPC gene copy numbers of each isolate were normalized to 16S rRNA and relative to that of the CTB strain (17, 31).

Susceptibility and MIC testing.

The MICs of IPM, MEM, piperacillin-tazobactam (TZP), ceftazidime (CAZ), FEP, and aztreonam (ATM) for the strains were determined by the broth microdilution method and interpreted following the CLSI guidelines (32). E. coli strain ATCC 25922 was adopted as a quality control.

Reverse transcription-quantitative PCR analysis of blaKPC mRNA expression.

blaKPC mRNA expression was evaluated by quantitative PCR (qPCR) as described previously (17). Briefly, total RNA was extracted from E. coli transformants using the EasyPure RNA kit (catalog number ER101; TransGen Biotech, China). Then, cDNA was synthesized and qPCR was performed on an ABI7500 instrument with TransStart Green qPCR SuperMix (catalog no. AQ101; TransGen Biotech). Finally, relative mRNA expression was standardized to the level of the 16S rRNA gene with previously described primers (17, 23). Statistical analysis was performed with the software SPSS 22, using Student's t test with 3 replicates.

Western blot analysis of KPC production.

A copy of the Flag tag sequence was cloned into the 3′ end of the blaKPC gene, and the recombinant plasmids were transformed into the E. coli Trans1-T1 strains. Total proteins were extracted, and KPC production was evaluated via Flag tag expression by Western blotting (17). Experiments were performed in triplicate, and the results were normalized to DnaK and analyzed with SPSS 22.

Data availability.

The nucleotide sequences of pLSH-KPN25-1 and pLSCH-KOX18040-1 have been deposited in GenBank under the accession numbers CP040180 and MN401418, respectively.

Supplementary Material

Supplemental file 1
AAC.01836-19-s0001.pdf (196.8KB, pdf)

ACKNOWLEDGMENTS

This work was supported by the National Natural Science Foundation of China (grant 81802044), by the Medical and Health Technological Project of Zhejiang Province of China (grant 2018KY935), and by the Major Research and Development Project of Lishui City of China (grant 2017ZDYF13).

Footnotes

Supplemental material is available online only.

REFERENCES

  • 1.Sacha P, Ostas A, Jaworowska J, Wieczorek P, Ojdana D, Ratajczak J, Tryniszewska E. 2009. The KPC type beta-lactamases: new enzymes that confer resistance to carbapenems in Gram-negative bacilli. Folia Histochem Cytobiol 47:537–543. doi: 10.2478/v10042-009-0079-y. [DOI] [PubMed] [Google Scholar]
  • 2.Nordmann P, Cuzon G, Naas T. 2009. The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Lancet Infect Dis 9:228–236. doi: 10.1016/S1473-3099(09)70054-4. [DOI] [PubMed] [Google Scholar]
  • 3.Zhang Y, Wang Q, Yin Y, Chen H, Jin L, Gu B, Xie L, Yang C, Ma X, Li H, Li W, Zhang X, Liao K, Man S, Wang S, Wen H, Li B, Guo Z, Tian J, Pei F, Liu L, Zhang L, Zou C, Hu T, Cai J, Yang H, Huang J, Jia X, Huang W, Cao B, Wang H. 2018. Epidemiology of carbapenem-resistant Enterobacteriaceae infections: report from the China CRE Network. Antimicrob Agents Chemother 62:e01882-17. doi: 10.1128/AAC.01882-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Zhang R, Liu L, Zhou H, Chan EW, Li J, Fang Y, Li Y, Liao K, Chen S. 2017. Nationwide surveillance of clinical carbapenem-resistant Enterobacteriaceae (CRE) strains in China. EBioMedicine 19:98–106. doi: 10.1016/j.ebiom.2017.04.032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Yigit H, Queenan AM, Anderson GJ, Domenech-Sanchez A, Biddle JW, Steward CD, Alberti S, Bush K, Tenover FC. 2001. Novel carbapenem-hydrolyzing beta-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob Agents Chemother 45:1151–1161. doi: 10.1128/AAC.45.4.1151-1161.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Huang J, Li X, Zhu N, Li G. 2012. Genetic characteristics of one highly multi-drug-resistant strain of Klebsiella ozaenae. J Med Microbiol 61:1303–1305. doi: 10.1099/jmm.0.044115-0. [DOI] [PubMed] [Google Scholar]
  • 7.Chen L, Hu H, Chavda KD, Zhao S, Liu R, Liang H, Zhang W, Wang X, Jacobs MR, Bonomo RA, Kreiswirth BN. 2014. Complete sequence of a KPC-producing IncN multidrug-resistant plasmid from an epidemic Escherichia coli sequence type 131 strain in China. Antimicrob Agents Chemother 58:2422–2425. doi: 10.1128/AAC.02587-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Cai JC, Zhou HW, Zhang R, Chen GX. 2008. Emergence of Serratia marcescens, Klebsiella pneumoniae, and Escherichia coli isolates possessing the plasmid-mediated carbapenem-hydrolyzing beta-lactamase KPC-2 in intensive care units of a Chinese hospital. Antimicrob Agents Chemother 52:2014–2018. doi: 10.1128/AAC.01539-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Huang J, Ding H, Shi Y, Zhao Y, Hu X, Ren J, Huang G, Wu R, Zhao Z. 2018. Further spread of a blaKPC-harboring untypeable plasmid in Enterobacteriaceae in China. Front Microbiol 9:1938–1945. doi: 10.3389/fmicb.2018.01938. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Zhang R, Zhou HW, Cai JC, Chen GX. 2007. Plasmid-mediated carbapenem-hydrolysing beta-lactamase KPC-2 in carbapenem-resistant Serratia marcescens isolates from Hangzhou, China. J Antimicrob Chemother 59:574–576. doi: 10.1093/jac/dkl541. [DOI] [PubMed] [Google Scholar]
  • 11.Robledo IE, Aquino EE, Sante MI, Santana JL, Otero DM, Leon CF, Vazquez GJ. 2010. Detection of KPC in Acinetobacter spp. in Puerto Rico. Antimicrob Agents Chemother 54:1354–1357. doi: 10.1128/AAC.00899-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Poirel L, Nordmann P, Lagrutta E, Cleary T, Munoz-Price LS. 2010. Emergence of KPC-producing Pseudomonas aeruginosa in the United States. Antimicrob Agents Chemother 54:3072. doi: 10.1128/AAC.00513-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Cuzon G, Naas T, Truong H, Villegas MV, Wisell KT, Carmeli Y, Gales AC, Venezia SN, Quinn JP, Nordmann P. 2010. Worldwide diversity of Klebsiella pneumoniae that produce beta-lactamase blaKPC-2 gene. Emerg Infect Dis 16:1349–1356. doi: 10.3201/eid1609.091389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Jiang Y, Yu D, Wei Z, Shen P, Zhou Z, Yu Y. 2010. Complete nucleotide sequence of Klebsiella pneumoniae multidrug resistance plasmid pKP048, carrying blaKPC-2, blaDHA-1, qnrB4, and armA. Antimicrob Agents Chemother 54:3967–3969. doi: 10.1128/AAC.00137-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Naas T, Cuzon G, Villegas MV, Lartigue MF, Quinn JP, Nordmann P. 2008. Genetic structures at the origin of acquisition of the beta-lactamase blaKPC gene. Antimicrob Agents Chemother 52:1257–1263. doi: 10.1128/AAC.01451-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Shen P, Wei Z, Jiang Y, Du X, Ji S, Yu Y, Li L. 2009. Novel genetic environment of the carbapenem-hydrolyzing beta-lactamase KPC-2 among Enterobacteriaceae in China. Antimicrob Agents Chemother 53:4333–4338. doi: 10.1128/AAC.00260-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Huang J, Hu X, Zhao Y, Shi Y, Ding H, Wu R, Zhao Z, Ji J, Huang J, Hu X, Zhao Y, Shi Y, Ding H, Wu R, Zhao Z, Ji J. 2019. Comparative analysis of blaKPC expression in Tn4401 transposons and the Tn3-Tn4401 chimaera. Antimicrob Agents Chemother 63:e02434-18. doi: 10.1128/AAC.02434-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Pecora ND, Li N, Allard M, Li C, Albano E, Delaney M, Dubois A, Onderdonk AB, Bry L. 2015. Genomically informed surveillance for carbapenem-resistant Enterobacteriaceae in a health care system. mBio 6:e01030. doi: 10.1128/mBio.01030-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Bryant KA, Van Schooneveld TC, Thapa I, Bastola D, Williams LO, Safranek TJ, Hinrichs SH, Rupp ME, Fey PD. 2013. KPC-4 is encoded within a truncated Tn4401 in an IncL/M plasmid, pNE1280, isolated from Enterobacter cloacae and Serratia marcescens. Antimicrob Agents Chemother 57:37–41. doi: 10.1128/AAC.01062-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Baraniak A, MOSAR WP2, WP3, and WP5 Study Groups, Izdebski R, Fiett J, Herda M, Derde LP, Bonten MJ, Adler A, Carmeli Y, Goossens H, Hryniewicz W, Brun-Buisson C, Gniadkowski M, Mosar Wp WP, Groups W. 2015. KPC-like carbapenemase-producing Enterobacteriaceae colonizing patients in Europe and Israel. Antimicrob Agents Chemother 60:1912–1917. doi: 10.1128/AAC.02756-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Chen L, Chavda KD, Mediavilla JR, Jacobs MR, Levi MH, Bonomo RA, Kreiswirth BN. 2012. Partial excision of blaKPC from Tn4401 in carbapenem-resistant Klebsiella pneumoniae. Antimicrob Agents Chemother 56:1635–1638. doi: 10.1128/AAC.06182-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Cheruvanky A, Stoesser N, Sheppard AE, Crook DW, Hoffman PS, Weddle E, Carroll J, Sifri CD, Chai W, Barry K, Ramakrishnan G, Mathers AJ, Cheruvanky A, Stoesser N, Sheppard AE, Crook DW, Hoffman PS, Weddle E, Carroll J, Sifri CD, Chai W, Barry K, Ramakrishnan G, Mathers AJ. 2017. Enhanced Klebsiella pneumoniae carbapenemase expression from a novel Tn4401 deletion. Antimicrob Agents Chemother 61:e00025-17. doi: 10.1128/AAC.00025-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Naas T, Cuzon G, Truong HV, Nordmann P. 2012. Role of ISKpn7 and deletions in blaKPC gene expression. Antimicrob Agents Chemother 56:4753–4759. doi: 10.1128/AAC.00334-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Li G, Wei Q, Wang Y, Du X, Zhao Y, Jiang X. 2011. Novel genetic environment of the plasmid-mediated KPC-3 gene detected in Escherichia coli and Citrobacter freundii isolates from China. Eur J Clin Microbiol Infect Dis 30:575–580. doi: 10.1007/s10096-010-1124-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Huang J, Ding H, Shi Y, Zhao Y, Wu R, Zhao Z. 2018. Molecular epidemiology of Klebsiella pneumoniae blaKPC gene in Lishui from 2010 to 2016. Chin J Microbiol Immunol 38:616–622. [Google Scholar]
  • 26.Zhang Y, Jiang X, Wang Y, Li G, Tian Y, Liu H, Ai F, Ma Y, Wang B, Ruan F, Rajakumar K. 2014. Contribution of beta-lactamases and porin proteins OmpK35 and OmpK36 to carbapenem resistance in clinical isolates of KPC-2-producing Klebsiella pneumoniae. Antimicrob Agents Chemother 58:1214–1217. doi: 10.1128/AAC.02045-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Tang Y, Li G, Liang W, Shen P, Zhang Y, Jiang X, Tang Y, Li G, Liang W, Shen P, Zhang Y, Jiang X. 2017. Translocation of carbapenemase gene blaKPC-2 both internal and external to transposons occurs via novel structures of Tn1721 and exhibits distinct movement patterns. Antimicrob Agents Chemother 61:e01151-17. doi: 10.1128/AAC.01151-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Saito R, Takahashi R, Sawabe E, Koyano S, Takahashi Y, Shima M, Ushizawa H, Fujie T, Tosaka N, Kato Y, Moriya K, Tohda S, Tojo N, Koike R, Kubota T. 2014. First report of KPC-2 Carbapenemase-producing Klebsiella pneumoniae in Japan. Antimicrob Agents Chemother 58:2961–2963. doi: 10.1128/AAC.02072-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Browning DF, Busby SJ. 2004. The regulation of bacterial transcription initiation. Nat Rev Microbiol 2:57–65. doi: 10.1038/nrmicro787. [DOI] [PubMed] [Google Scholar]
  • 30.Huang J, Khan I, Liu R, Yang Y, Zhu N. 2016. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing. Anal Biochem 500:18–20. doi: 10.1016/j.ab.2015.12.022. [DOI] [PubMed] [Google Scholar]
  • 31.Kitchel B, Rasheed JK, Endimiani A, Hujer AM, Anderson KF, Bonomo RA, Patel JB. 2010. Genetic factors associated with elevated carbapenem resistance in KPC-producing Klebsiella pneumoniae. Antimicrob Agents Chemother 54:4201–4207. doi: 10.1128/AAC.00008-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Clinical and Laboratory Standards Institute. 2017. Performance standards for antimicrobial susceptibility testing, twenty-seventh informational supplement. CLSI document M100-S27. Clinical and Laboratory Standards Institute, Wayne, PA. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1
AAC.01836-19-s0001.pdf (196.8KB, pdf)

Data Availability Statement

The nucleotide sequences of pLSH-KPN25-1 and pLSCH-KOX18040-1 have been deposited in GenBank under the accession numbers CP040180 and MN401418, respectively.


Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES