Skip to main content
NCBI home page
PLOS One logoLink to PLOS One
. 2020 Mar 6;15(3):e0227831. doi: 10.1371/journal.pone.0227831

Characterization of the complete mitochondrial genome of Orthaga olivacea Warre (Lepidoptera Pyralidae) and comparison with other Lepidopteran insects

Liangli Yang 1,#, Junjun Dai 2,#, Qiuping Gao 1, Guozhen Yuan 1, Jiang Liu 1, Yu Sun 1, Yuxuan Sun 1, Lei Wang 1, Cen Qian 1, Baojian Zhu 1, Chaoliang Liu 1, Guoqing Wei 1,*
Editor: Jeffrey M Marcus3
PMCID: PMC7059908  PMID: 32142522

Abstract

Orthaga olivacea Warre (Lepidoptera: Pyralidae) is an important agricultural pest of camphor trees (Cinnamomum camphora). To further supplement the known genome-level features of related species, the complete mitochondrial genome of Orthaga olivacea is amplified, sequenced, annotated, analyzed, and compared with 58 other species of Lepidopteran. The complete sequence is 15,174 bp, containing 13 protein-coding genes (PCGs), 22 transfer RNA (tRNA) genes, 2 ribosomal RNA (rRNA) genes, and a putative control region. Base composition is biased toward adenine and thymine (79.02% A+T) and A+T skew are slightly negative. Twelve of the 13 PCGs use typical ATN start codons. The exception is cytochrome oxidase 1 (cox1) that utilizes a CGA initiation codon. Nine PCGs have standard termination codon (TAA); others have incomplete stop codons, a single T or TA nucleotide. All the tRNA genes have the typical clover-leaf secondary structure, except for trnS(AGN), in which dihydrouridine (DHU) arm fails to form a stable stem-loop structure. The A+T-rich region (293 bp) contains a typical Lepidopter motifs ‘ATAGA’ followed by a 17 bp poly-T stretch, and a microsatellite-like (AT)13 repeat. Codon usage analysis revealed that Asn, Ile, Leu2, Lys, Tyr and Phe were the most frequently used amino acids, while Cys was the least utilized. Phylogenetic analysis suggested that among sequenced lepidopteran mitochondrial genomes, Orthaga olivacea Warre was most closely related to Hypsopygia regina, and confirmed that Orthaga olivacea Warre belongs to the Pyralidae family.

Introduction

The insect mitochondrial DNA (mtDNA) is a closed-circular molecule ranging in size from 14,000 to 19,000 bp [1]. It generally contains 37 genes, of which seven are NADH dehydrogenase subunits (nad1-nad6 and nad4L), three cytochrome C oxidase subunits (cox1-cox3), two ATPase subunits (atp6 and atp8), one cytochrome b (cytb) subunit, two ribosomal RNAs (rrnL and rrnS), and 22 transfer RNAs (tRNA) [2, 3], and a variable length A+T-rich region, the largest noncoding sequence that modulates transcription and replication [4, 5, 6]. Whole mitochondrial genomes are a useful data source for several research areas [7, 8], such as evolutionary genomics [9, 10] and comparative molecular evolution [11, 12], phylogeography [13], and population genetics [14].

The Lepidoptera (butterflies and moths) comprises over 160,000 described species, classified into 45–48 superfamilies and is cosmopolitan in distribution [15]. Pyralidae is one of the largest families in Lepidoptera, including over 25,000 species and some of pyralids are important agricultural pests, such as Ostrinia nubilalis and Cnaphalocrocis medinalis, whose complete mitogenomes had been sequenced [16–18]. Despite their diversity and great importance as pests of agricultural and forestry plants, they are also valuable for pollinating plants of economic importance. Most species in the family Pyralidae do not yet have sequenced mitogenomes.

Orthaga olivacea Warre (Lepidoptera: Pyralidae) is a notorious pest, widely distributed in East China. The larvae feed on Cinnamomum camphora leaves and cause considerable economic losses. Farmers apply chemical prevention and removal strategies to combat this pest species particularly during larval and pupa life stages [19]. However, overlapping generations and irregularity of abundance in the field from May to October make it very difficult to control [19]. Previous studies have investigated the host preference, distribution and morphological characteristics of Orthaga olivacea Warre, and the control of it by bio-pesticide has been investigated [20, 21]. However, the use of pesticides is harmful to the environment. Therefore, it is necessary to find new strategies to prevent this pest. In this study we sequenced the complete mitogenome of Orthaga olivacea Warre, and compared it with other insect species, especially with the members of Pyralidae species. Phylogenetic relationships among lepidopteran superfamilies were reconstructed using the nucleotide sequences from the 13 PCGs to test the position of Orthaga olivacea within Pyralidae. The study of mitogenomes of Orthaga olivacea can provide fundamental information for mitogenome architecture, phylogeography, future phylogenetic analyses of Pyralidae, and biological control of pests.

Materials and methods

Sample collection and DNA isolation

Orthaga olivacea Warre, larvae (the larvae are about 22–30 mm long, brown, reddish-brown on the head and anterior thoracic plate, and have a brown wide band on the back of the body, with two yellow-brown lines on each side.) were collected from the camphor trees on the campus of Anhui Agricultural University (Hefei, China). Specimens were preserved with 100% ethanol and stored at -80°C. This insect is not an endangered or protected species. Total genomic DNA was extracted from the larvae using the Aidlab Genomic DNA Extraction Kit (Aidlab Co., Beijing, China) according to the manufacturer’s instructions. Extracted DNA quality was assessed by 1% agarose (w/v) gel electrophoresis.

Amplification and sequencing

Thirteen pairs of conserved primers were designed from the mitogenomes of previously sequenced Pyralidae species (synthesized by BGI Tech Co., Shenzhen, China) (Table 1). All PCRs were performed in 50 μL reaction volumes; 34.75 μL sterilized distilled water, 5 μL 5 × Taq buffer (Mg2+ plus), 4 μL dNTPs (2.5 mM), 2 μL genomic DNA, 2 μL of each primer (10 μM) and 0.25 μL (1.25 unit) Taq polymerase (TaKaRa Co., Dalian, China). A two-step PCR was performed under the following conditions: initial denaturation at 94°C for 5 min followed by 35 cycles of 30s at 94°C, annealing 2–3 min (depending on putative length of the fragments) at 51–58°C (depending on primer combination) and a final extension step of 72°C for 10 min.

Table 1. Details of the primers used to amplify the mitogenome of O. olivacea Warre.

Primer pair Primer sequence (5’ -3’)
F1 TAAAAATAAGCTAAATTTAAGCTT
R1 TATTAAAATTGCAAATTTTAAGGA
F2 AAACTAATAATCTTCAAAATTAT
R2 AAAATAATTTGTTCTATTAAAG
F3 ATTCTATATTTCTTGAAATATTAT
R3 CATAAATTATAAATCTTAATCATA
F4 TGAAAATGATAAGTAATTTATTT
R4 AATATTAATGGAATTTAACCACTA
F5 TAAGCTGCTAACTTAATTTTTAGT
R5 CCTGTTTCAGCTTTAGTTCATTC
F6 CCTAATTGTCTTAAAGTAGATAA
R6 TGCTTATTCTTCTGTAGCTCATAT
F7 TAATGTATAATCTTCGTCTATGTAA
R7 ATCAATAATCTCCAAAATTATTAT
F8 ACTTTAAAAACTTCAAAGAAAAA
R8 TCATAATAAATTCCTCGTCCAATAT
F9 GTAAATTATGGTTGATTAATTCG
R9 TGATCTTCAAATTCTAATTATGC
F10 CCGAAACTAACTCTCTCTCACCT
R10 CTTACATGATCTGAGTTCAAACCG
F11 CGTTCTAATAAAGTTAAATAAGCA
R11 AATATGTACATATTGCCCGTCGCT
F12 TCTAGAAACACTTTCCAGTACCTC
R12 AATTTTAAATTATTAGGTGAAATT
F13 TAATAGGGTATCTAATCCTAGTT
R13 ACTTAATTTATCCTATCAGAATAA
Open in a new tab

PCR amplicons were analyzed on 1.0% agarose gel electrophoresis, and purified using a gel extraction kit (CWBIO Co., Beijing, China). Purified fragments were ligated into the T-vector (TaKaRa Co., Dalian, China) and transformed into Escherichia coli DH5α. Positive recombinant colonies with insert DNA were sequenced in both directions and at least three times by Invitrogen Co. Ltd. (Shanghai, China).

Sequence annotation

The complete mtDNA sequence was assembly using the DNAStar package (DNAStar Inc. Madison, USA) and sequence annotation was performed using the blast tools from NCBI (http://blast.ncbi.nlm.nih.gov/Blast). The sequences were submitted to GenBank at NCBI under the accession number MN078362. The tRNA genes were identified using the tRNAscan-Se program software available online at http://lowelab.ucsc.edu/tRNAscan-SE/, and visually identify sequences using the alignment with the appropriate anticodons capable of folding into the typical clover-leaf structure [22]. PCGs were initially identified by sequence identity with Pyralidae species and aligned with the other lepidopteran using ClustalX version 2.0 [23]. Nucleotide sequences of the PCGs were translated into their putative amino acids based on the invertebrate mtDNA genetic code. Composition skew was performed according to the formulas AT skew = [A−T]/[A+T], GC skew = [G−C]/[G+C]) [24]. Relative Synonymous Codon Usage (RSCU) values were calculated in MEGA 6.0 [25]. Tandem repeats in the A+T-rich region were predicted using the Tandem Repeats Finder program (http://tandem.bu.edu/trf/trf.html) [26].

Phylogenetic analysis

To reconstruct the phylogenetic relationships of Lepidoptera, 58 lepidopteran mitogenomes (Table 2) representing seven lepidopteran superfamilies (Bombycoidea, Noctuoidea, Geometroidea, Pyraloidea, Tortricoidea, Papilionoidea and Yponomeutoidea) were used. The mitogenomes of Limnephilus hyalinus (NC_044710.1) [27], Locusta migratoria (NC_001712.1) [28], and Drosophila yakuba (NC_001322) [29] were used as outgroups. The 13 PCGs concatenated nucleotide sequences of these lepidopterans were initially aligned using ClustalX version 2.0. Phylogenetic analysis was performed using Maximum Likelihood (ML) method with the MEGA 6.0 program. This method was used to infer phylogenetic trees with 1000 bootstrap replicates.

Table 2. Details of the lepidopteran mitogenomes used in this study.

Superfamily Family Species Size (bp) GenBank accession no. Reference
Bombycoidea Bombycidae Bombyx mandarina 15,682 AY301620 [30]
Bombyx mori 15,643 NC_002355 Direct submission
Rondotia menciana 15,301 KC881286.1 [31]
Saturniidae Antheraea pernyi 15,566 AY242996 [32]
Antheraea yamamai 15,338 NC_012739 [33]
Sphingidae Manduca sexta 15,516 NC_010266 [34]
Sphinx morio 15299 KC470083.1 [35]
Noctuoidea Lymantriidae Lymantria dispar 15,569 NC_012893 Unpublished
Euproctis pseudoconspersa 15461 KJ716847.1 [36]
Erebidae Amata formosae 15,463 KC513737 [37]
Notodontidae Ochrogaster lunifer 15,593 NC_011128 [38]
Noctuidae Ctenoplusia agnata 15261 KC414791.1 [39]
Agrotis ipsilon 15,377 KF163965 [40]
Nolidae Gabala argentata 15,337 KJ410747 [41]
Geometroidea Geometridae Apocheima cinerarium 15,722 KF836545 [42]
Biston thibetaria 15,484 KJ670146.1 Unpublished
Pyraloidea Crambidae Chilo suppressalis 15,395 NC_015612 [43]
Diatraea saccharalis 15,490 NC_013274 [44]
Ostrinia furnacalis 14,536 NC_003368 [45]
Ostrinia nubilalis 14,535 NC_003367.1 [45]
Cnaphalocrocis medinalis 15388 NC_015985 [43]
Paracymoriza distinctalis 15354 KF859965.1 [46]
Tyspanodes hypsalis 15329 NC_025569 [47]
Paracymoriza prodigalis 15,326 NC_020094.1 [48]
Elophila interruptalis 15,351 NC_021756.1 [49]
Pseudargyria interruptella 15.231 NC_029751.1 Direct submission
Chilo auricilius 15,367 NC_024644.1 [50]
Chilo sacchariphagus 15,378 NC_029716.1 Direct submission
Evergestis junctalis 15,438 NC_030509.1 Direct submission
Nomophila noctuella 15,309 NC_025764.1 [51]
Tyspanodes striata 15,255 NC_030510.1 Direct submission
Glyphodes quadrimaculalis 15,255 NC_022699.1 [52]
Spoladea recurvalis 15,273 NC_027443.1 [53]
Dichocrocis punctiferalis 15,355 NC_021389.1 [54]
Glyphodes pyloalis 14,960 NC_025933.1 Unpublished
Maruca vitrata 15,385 NC_024099.1 Unpublished
Maruca testulalis 15,110 NC_024283.1 [55]
Haritalodes derogat 15,253 NC_029202.1 Unpublished
Pycnarmon lactiferalis 15,219 NC_033540.1 [56]
Loxostege sticticalis 15,218 NC_027174.1 Unpublished
Pyralidae Orthaga olivacea Warre This study
Lista haraldusalis 15213 NC_024535 [57]
Galleria mellonella 15320 KT750964 Unpublished
Corcyra cephalonica 15,273 NC_016866.1 [58]
Amyelois transitella 15,205 NC_028443.1 [59]
Plodia interpunctella 15,264 NC_027961.1 Unpublished
Ephestia kuehniella 15,295 NC_022476.1 Direct submission
Meroptera pravella 15,260 NC_035242.1 [60]
Hypsopygia regina 15,212 NC_030508.1 Direct submission
Endotricha consocia 15,201 NC_037501.1 [61]
Euzophera pyriella 15,184 NC_037175.1 [62]
Tortricoidea Tortricidae Grapholita molesta 15,717 NC_014806 [63]
Spilonota lechriaspis 15,368 NC_014294 [64]
Papilionoidea Papilionidae Luehdorfia taibai 15,553 KC952673 [65]
Teinopalpus aureus 15,242 NC_014398 Unpublished
Apatura ilia 15,242 NC_016062 [66]
Apatura metis 15,236 NC_015537 [67]
Yponomeutoidea Plutellidae Plutella xylostella 16,179 JF911819 [68]
Lyonetiidae Leucoptera malifoliella 15,646 NC_018547 [69]
Open in a new tab

Results and discussion

Genomic structure, organization and composition

The complete mitogenome of Orthaga olivacea Warre is a circular molecule with 15,174 base pairs (bp) in size (Fig 1). This is comparable to the mitogenome sizes documented for other sequenced lepidopterans which range from 14,535 bp in Ostrinia nubilalis to 16,179 bp in Plutella xylostella, and it is similar to Lista haraldusalis (15213) (Table 2). The Orthaga olivacea Warre mitogenome is identical to that of other lepidopterans in terms of gene organization, including all 13 PCGs (cox1–3, nad1–6, nad4L, cytb, atp6 and atp8), 22 tRNA genes, two ribosomal RNAs (rrnS and rrnL), and the important non-coding region also known as “A+T-rich region” [70, 71] (Fig 1; Table 3). Variety in non-coding regions is the primarily reason for size differences across Lepidoptera mitochondrial genomes. Nucleotide composition revealed that the most common base is T = 6249 (41.18%) and the least common base is G = 1249 (8.23%) and AT skew [72] (As to Ts) is slightly negative (−0.042). This trend has also been reported from Manduca sexta (−0.005) [34], Ctenoplusia agnata (−0.023) [39], Paracymoriza distinctalis (−0.002) [46], and Lista haraldusalis (−0.007) [57]. In addition, the GC skew (Gs to Cs) is also negative (−0.215). Base composition of the Orthaga olivacea Warre mitogenome is A+T rich (79.02% A+T content and 20.98% G+C content). Highly A+T biased mitogenomes have been previously sequenced from lepidopterans (ranging from 77.8% in Rondotia menciana to 81.94% in Cnaphalocrocis medinalis) [17, 31], (Table 4). Nucleotide skew is negative, similar to the mitogenome of other lepidopterans, such as M. sexta (-0.005 and -0.181) [33] and C.medinalis (-0.030 and -0.175) [17] (Table 4).

Fig 1. Map of the mitogenome of O. olivacea Warre.

Fig 1

Open in a new tab

Labeling tRNA genes according to the IUPAC-IUB single-letter amino acids: cox1, cox2 and cox3 present the three subunits of cytochrome c oxidase; cob present cytochrome b; nad1-nad6 constitutes NADH dehydrogenase; rrnL and rrnS refer to ribosomal RNAs. Genes named above the bar are located on major strand, while the others are located on minor strand. Anti-clockwise rRNA or PCGs genes are located on L strand and others are located on H strand.

Table 3. Summary results for characteristics of the mitogenome of Orthaga olivacea Warre.

Gene Location Direction Size Intergenic Nucleotides Start codon Stop codon
tRNA-Met 1–67 F 67 1 — —
tRNA-Ile 69–132 F 64 -3 — —
tRNA-Gln 130–198 R 69 52 — —
ND2 251–1264 F 1014 0 ATT TAA
tRNA-Trp 1265–1332 F 68 -8 — —
tRNA-Cys 1325–1394 R 70 4 — —
tRNA-Tyr 1399–1464 R 66 3 — —
COX1 1468–2973 F 1506 0 CGA TAA
tRNA-Leu1 2974–3040 F 67 0 —
COX2 3041–3712 F 672 0 ATT TAA
tRNA-Sup 3713–3781 F 69 4 — —
tRNA-Asp 3786–3853 F 68 0 — —
ATP8 3854–4015 F 162 -7 ATC TAA
ATP6 4009–4689 F 681 -1 ATG TAA
COX3 4689–5478 F 790 2 ATG T
tRNA-Gly 5481–5548 F 68 0 — —
ND3 5549–5902 F 354 12 ATT TAA
tRNA-Ala 5915–5980 F 66 0 — —
tRNA-Arg 5981–6044 F 64 2 — —
tRNA-Asn 6047–6112 F 66 3 — —
tRNA-Ser1 6116–6168 F 53 19 — —
tRNA-Glu 6188–6253 F 66 -2 — —
tRNA-Phe 6252–6318 R 67 0 — —
ND5 6319–8052 R 1734 0 ATT TAA
tRNA-His 8053–8118 R 66 0 — —
ND4 8119–9455 R 1337 0 ATA TA
ND4L 9456–9746 R 291 2 ATG TAA
tRNA-Thr 9749–9812 F 64 0 — —
tRNA-Pro 9813–9877 R 65 0 — —
ND6 9878–10398 F 521 9 ATA TAA
CYTB 10408–11566 F 1159 -2 ATG T
tRNA-Ser2 11565–11631 F 67 20 — —
ND1 11652–12577 R 926 1 ATG TA
tRNA-Leu2 12579–12648 R 70 0 — —
rRNA-16s 12649–14032 R 1384 0 — —
tRNA-Val 14033–14096 R 64 0 — —
rRNA-12s 14097–14881 R 785 0 — —
A-T-rich region 14882–15174 F 293 — —
Open in a new tab

Table 4. Composition and skewness in different Lepidopteran mitogenomes.

Species Size (bp) A% G% T% C% A+T % ATskewness GCskewness
Whole genome
O. olivacea Warre 15174 37.83 8.23 41.18 12.75 79.02 −0.042 −0.215
B. mori 15643 43.05 7.32 38.27 11.36 81.32 0.051 −0.216
R. menciana 15301 41.42 7.82 37.45 13.31 78.86 0.050 −0.259
M. sexta 15516 40.67 7.46 41.11 10.76 81.79 −0.005 −0.181
E. pseudoconspersa 15461 40.42 7.61 39.51 12.46 79.93 0.011 −0.241
C. agnata 15261 39.58 7.71 41.52 11.2 81.1 −0.023 −0.184
A. cinerarium 15722 41.51 7.80 39.32 11.37 80.83 0.027 −0.186
D. saccharalis 15490 40.87 7.42 39.15 12.56 80.02 0.021 −0.258
C. medinalis 15388 40.36 7.45 41.58 10.61 81.94 −0.030 −0.175
1P. distinctalis 15354 41.04 7.49 41.22 10.24 82.27 −0.002 −0.155
L. haraldusalis 15213 40.47 7.66 41.04 10.83 81.52 −0.007 −0.172
G. mellonella 15320 38.62 7.47 41.80 12.11 80.42 −0.039 −0.237
S. lechriaspis 15368 39.86 7.63 41.34 11.17 81.19 −0.018 −0.188
A. ilia 15,242 39.77 7.75 40.68 11.80 80.45 −0.011 −0.207
P. xylostella 16179 40.66 7.68 40.22 10.82 80.89 0.005 −0.170
PCG
O. olivacea Warre 11147 37.12 9.11 40.24 13.53 77.36 −0.040 −0.195
B. mori 11177 42.92 8.17 36.66 12.26 79.57 0.079 −0.200
R. menciana 11225 40.97 8.58 36.12 14.33 77.1 0.063 −0.251
M. sexta 11185 40.41 8.23 39.88 11.48 80.30 0.007 -0.165
E. pseudoconspersa 11187 3969 8.43 38.3 13.58 77.99 0.017 −0.233
C. agnata 11238 39.12 8.37 40.79 11.72 79.91 −0.020 −0.166
A. cinerarium 11227 40.63 8.78 38.19 12.39 78.83 0.031 −0.171
D. saccharalis 11206 40.34 8.27 37.55 13.83 77.90 0.036 −0.252
C. medinalis 11210 39.88 8.15 40.69 11.28 80.56 −0.010 −0.161
P. distinctalis 11189 40.54 8.12 40.53 10.81 81.07 0 −0.142
L. haraldusalis 11193 39.88 8.47 40.16 11.49 80.04 −0.003 −0.151
G. mellonella 11196 38.03 8.20 40.84 12.92 78.88 −0.036 −0.224
S. lechriaspis 11256 39.30 8.35 40.41 11.93 79.72 −0.014 −0.177
A. ilia 11,148 39.41 8.41 39.49 12.69 78.89 −0.001 −0.203
P. xylostella 11049 40.47 8.82 38.85 11.86 79.32 0.020 −0.147
tRNA
O. olivacea Warre 1452 39.461 8.26 40.70 11.57 80.17 −0.015 −0.167
B. mori 1468 42.10 7.90 39.31 10.69 81.40 0.034 −0.150
R. menciana 1485 41.08 8.08 39.93 10.91 81.01 0.014 −0.149
M. sexta 1554 40.99 7.92 41.06 10.04 82.05 −0.001 −0.118
E. pseudoconspersa 1466 41.41 8.19 40.18 10.23 81.58 0.015 −0.111
C. agnata 1477 41.23 8.19 40.22 10.36 81.45 0.012 −0.117
A. cinerarium 1483 42.01 8.02 39.45 10.52 81.46 0.031 −0.135
D. saccharalis 1478 41.81 7.713 40.32 10.15 82.14 0.018 −0.136
C. medinalis 1475 41.29 8.00 40.81 9.90 82.10 0.006 −0.106
P. distinctalis 1536 42.19 8.14 39.78 9.9 81.97 0.029 −0.098
L. haraldusalis 1451 41.08 7.86 41.42 9.65 82.49 −0.004 −0.102
G. mellonella 1489 40.09 8.06 40.90 10.95 80.51 −0.010 −0.152
S. lechriaspis 1450 40.97 8.00 40.90 10.14 81.86 0.001 −0.118
A. ilia 1433 40.61 8.30 40.96 10.12 81.58 −0.004 −0.099
P. xylostella 1468 42.51 8.17 38.83 10.49 81.34 0.045 −0.124
rRNA
O. olivacea Warre 2169 39.65 4.84 44.35 11.16 84.00 −0.056 −0.389
B. mori 2158 43.74 4.59 41.06 10.61 84.80 0.032 −0.396
R. menciana 2147 43.04 4.84 40.71 11.41 83.74 0.028 −0.404
M. sexta 2168 41.37 4.84 44.05 9.73 85.42 −0.031 −0.335
E. pseudoconspersa 2225 42.56 4.54 42.11 10.79 84.67 0.005 −0.408
C. agnata 2112 40.01 5.07 44.65 10.27 84.66 −0.055 −0.339
A.cinerarium 2179 43.97 4.77 41.17 10.10 85.13 0.033 −0.358
D. saccharalis 2193 41.45 6.84 43.59 10.17 85.04 −0.025 −0.360
C. medinalis 2170 41.47 5.02 43.87 9.63 85.35 −0.028 −0.314
P. distinctalis 2174 41.31 5.34 44.02 9.34 85.33 −0.032 −0.272
L. haraldusalis 2121 42.20 4.67 43.33 9.81 85.53 −0.013 −0.355
G. mellonella 2143 40.18 4.95 44.19 10.69 84.37 −0.048 −0.367
S. lechriaspis 2160 41.71 4.95 43.84 9.49 85.56 −0.025 −0.314
A. ilia 2109 40.11 4.98 44.86 10.05 84.97 −0.056 −0.337
P. xylostella 2162 41.44 4.90 43.94 9.71 85.38 −0.029 −0.329
A+T-rich region
O. olivacea Warre 293 44.03 2.73 49.83 3.41 93.86 −0.062 −0.111
B. mori 449 44.69 1.60 50.70 3.00 95.39 −0.063 −0.304
R. menciana 357 43.7 3.36 47.34 5.6 91.04 −0.040 −0.250
M. sexta 324 45.06 1.54 50.31 3.09 95.37 −0.005 −0.335
E. pseudoconspersa 388 43.56 2.32 50.26 3.87 93.81 −0.071 −0.250
C. agnata 334 46.71 1.5 46.71 5.09 93.41 0.000 −0.545
A. cinerarium 625 47.20 1.92 48.64 2.24 95.84 −0.015 −0.077
D. saccharalis 335 43.28 0.60 51.64 4.48 94.93 −0.088 −0.765
C. medinalis 339 42.48 0.88 53.39 3.24 95.87 −0.114 −0.571
P. distinctalis 349 46.13 1.15 49 3.72 95.13 −0.030 −0.528
L. haraldusalis 310 45.81 0.97 50.32 2.90 96.13 −0.047 −0.499
G. mellonella 350 44.29 0.29 52.86 2.57 97.14 −0.088 −0.8
S. lechriaspis 441 40.36 2.49 52.38 4.76 92.74 −0.130 −0.313
A. ilia 403 42.93 3.23 49.63 4.22 92.56 −0.072 −0.133
P. xylostella 1081 37.74 2.50 45.42 5.09 83.16 −0.092 −0.341
Open in a new tab

Protein-coding genes

The concatenated protein-coding genes are 11,147 bp in length, accounting for approximately 73.46% of the mitogenome. All PCGs are initiated by typical ATN start codons, except cox1, which is initiated by CGA (Table 3). The use of a non-canonical start codon for this gene is common across lepidopterans [17, 37, 73, 74], and cox1 transcripts do not overlap with the upstream tRNA, as has been proposed for several insect species [75]. Annotation of cox1 start codon can be justifiably conducted on the basis of comparative amino acid alignments, aiming to identify conserved sites downstream of the flanking tRNA, and there is thus no justification for continued speculation about polynucleotide start codon [76].

Nine PCGs have canonical termination codons TAA or TAG, while four have incomplete termination codons single T (cox3 and cytb) or TA (nad4 and nad1) (Table 3). Incomplete stop codons have been observed in most other lepidopteran mitogenomes and are common across mitogenomes [77]. It has been proposed that polycistronic pre-mRNA transcripts are processed by endonucleases, cleaving between tRNAs, and that polyadenylation of adjacent PCGs produces functional stop-codons from the partial termination codons such as a single T [78].

Complete mitogenome sequences of several lepidopterans were evaluated for codon usage. These species belonged to seven superfamilies (three species belonging to Pyraloidea, two species belonging to Bombycoidea, and one from each Noctuoidea, Geometroidea, Tortricoidea, Papilionoidea and Yponomeutoidea) (Fig 2). The analysis of codon usage showed that Asn, Ile, Leu2, Lys, Tyr and Phe were the amino acids with high relative usage frequency, while Arg was the least used amino acid. Three species of Geometroidea have consistent codon distributions in and each amino acid has equal content in them (Fig 3). The least used codons are those with high G and C, possibly due to high AT skew in lepidoptera PCGs [37, 79], for instance, L. haraldusalis, G. mellonella, B. mori, B. thibetaria, and L. malifoliella species all lack GCT codons, while G. molesta lacks CGT codons. However, in the present study all of these codons were observed in the mitogenome of Orthaga olivacea Warre (Fig 4) like that of A. yamamai, L. dispar and A. metis species [33, 67].

Fig 2. Codon usage patterns of O. olivacea Warre mitochondrial genome compared with other species of the Lepidoptera.

Fig 2

Open in a new tab

The lowercase letters above species name (a, b, c, d, e, f and g) indicate the superfamily which the species belong to (a: Pyraloidea, b: Bombycoidea, c: Noctuoidea, d: Geometroidea, e: Tortricoidea, f: Papilionoidea, g: Yponomeutoidea).

Fig 3. Codon distribution of O. olivacea Warre compared with other species of the Lepidoptera.

Fig 3

Open in a new tab

CDspT = codons per thousand codons.

Fig 4. The Relative Synonymous Codon Usage (RSCU) of the eight superfamilies mitochondrial genome of Lepidoptera.

Fig 4

Open in a new tab

Codon family is displayed on the X axis. Codons which are not present in mitochondrial genomes are indicated above.

Transfer and ribosomal RNA genes

Orthaga olivacea Warre mitogenome has 22 tRNA genes, ranging in size from 53 bp (tRNASer1) to 70 bp (tRNACys and tRNALeu). TRNAs show high A+T content (80.17%) and negative AT-skew (−0.015). All the tRNAs display typical cloverleaf secondary structures, except trnSAGN which is missing a stable dihydrouridine (DHU) arm (Fig 5); this phenomenon is common across insects [17, 80, 81].

Fig 5. Putative secondary structures of the 22 tRNA genes of the Orthaga olivacea Warre mitogenome.

Fig 5

Open in a new tab

The rRNAs showed higher A+T content (84.00%) in comparison to the PCGs and tRNAs; this value falls within the range of sequenced insects (Table 4).

Overlapping and intergenic spacer regions

Six overlapping sequences with a total length of 23 bp were identified in the Orthaga olivacea Warre mitogenome. These sequences varied in length from 1 to 8 bp, and between tRNATrp and tRNACys with the biggest overlapping region (8 bp). The overlapping region located between atp8 and atp6 was 7 bp, 3 bp between tRNAIle and tRNAGln, while the remainders were shorter than 3 bp (Table 3). The 7 bp overlapping region “ATGATAA” (Fig 6B) has also been documented in several lepidopterans sequenced to date [82, 83].

Fig 6. Conserved sequence across the Lepidoptera order.

Fig 6

Open in a new tab

(A) Intergenic spacer region alignment between trnS2 (UCN) and ND1 of several Lepidopterans. The framework ‘ATACTAA’ motif is conserved across the Lepidoptera order. (B) Intergenic overlap region alignment between ATP8 and ATP6 of several Lepidopterans. The bold ‘ATGATAA’ motif is the overlap region and it’s conserved across the Lepidoptera order. (C) Features present in the A+T-rich region of Orthaga olivacea Warre. The sequence is shown in the reverse strand. The ATAGA motif is bolded. The poly-T stretch is underlined. The single microsatellite T/A repeat sequence are double underlined.

The intergenic spacers of Orthaga olivacea Warre mitogenomes spread over fourteen regions and ranged in size from 1 to 52 bp with a total length of 134 bp. The longest intergenic spacer (52 bp) resided between tRNAGln and nad2. The 20 bp intergenic spacer region located between tRNASer2 and nad1 contained the ‘ATACTAA’ motif. The 7 bp motif is considered to be a conserved structure found in most of the insect mtDNAs (Fig 6A).

The A+T-rich region

The mitogenome of Orthaga olivacea Warre includes an A+T-rich region of 293 bp. This region showed the highest A+T content (93.86%), within the range reported of other lepidopterans (Table 4). Variation in intergenic length of noncoding regions particularly repeat sequences is responsible for most size variation in mitogenome. The control region is usually the largest noncoding part in the mitogenome [84, 85]. Several conserved structures found in other lepidopteran mitogenomes were also observed in the AT-rich region of Orthaga olivacea Warre, including the ‘ATAGA’ motif followed by a 17 bp poly-T stretch, and a microsatellite-like (AT)13 reapeat [86, 87] (Fig 6C).

Above all, there are many remarkable characteristics in nucleotide composition. Compared with reported lepidopteran species, these characteristics include the structure of tRNAs and PCGs, A+T rich region and intergenic spacer region share similarities but also some differences. And these differences and similarities between them can be used as potential markers in phylogenetic analysis.

Phylogenetic analysis

We reconstructed the phylogenetic relationships among seven lepidopteran superfamilies using Maximum Likelihood (ML) method based on concatenated nucleotide sequences of the 13 PCGs. Phylogenetic analysis revealed that different species from the same family clustered together (Fig 7). The complete nucleotide sequences of 59 species of Lepidoptera, represent 16 families (Bombycidae, Saturniidae, Sphingidae, Lymantriidae, Erebidae, Notodontidae, Noctuidae, Nolidae, Geometridae, Crambidae, Pyralidae, Tortricidae, Papilionidae, Nymphalidae, Plutellidae, and Lyonetiidae) were downloaded from GenBank to reconstruct phylogenetic relationships among them. The species Orthaga olivacea Warre belonging to the superfamily Pyralidae, and the relationship were closer with Hypsopygia regina than that with Galleria mellonella and Corcyra cephalonica. Phylogenetic analyses showed that Pyraloidea is clustered with other superfamilies including Bombycoidea, Geometroidea, Noctuoidea, Papilionoidea, Tortricoidea, and Yponomeutoidea. Of these Bombycoidea and Geometroidea were sister groups, and the relationgship of them were closer than Noctuoidea in ML analysis (Fig 7). In the present study, the relationships at superfamily level are consistent with prior studies of lepidopteran phylogeny [88–90]. Previous classifications of Pyralidae species were mostly based on morphology, of which numerous studies are regionally limited; therefore, the precise position of Pyralidae within the Pyraloidea remained unclear, more studies are needed on the complete mitochondrial genome of the diverse Pyraloidea species in order to understand the complexity of phylogenetic relationships.

Fig 7. Phylogenetic relationships tree among Lepidopteran insects.

Fig 7

Open in a new tab

The Maximum Likelihood method was used in the tree constructing. Bootstrap values (1000 repetitions) of the branches are indicated. Limnephilus hyalinus (NC_044710.1), Drosophila incompta (NC_025936) and Locusta migratoria (JN858212) were used as outgroups.

Conclusion

The newly accessible mitogenome of Orthaga olivacea Warre (Lepidoptera: Pyralidae) is 15,174 bp long, including 13 protein-coding genes (PCGs), two rRNA genes, 22 tRNA genes and an A+T-rich region. The arrangement of 13 PCGs is same to that of other sequenced lepidopterans. All PCGs of the mitogenome start with typical ATN codons, except for cytochrome c oxidase 1 (cox1) with the start codon CGA. The canonical termination codon (TAA or TAG) occurs in nine PCGs (TAA for nad2, cox1, cox2, atp8, atp6, nad3, nad5, nad4L and nad6 genes), and the remainders PCGs were terminated with a single T or TA (a single T for cox3 and cytb genes, TA for nad4 and nad1 genes). Phylogenetic analysis suggested that Orthaga olivacea Warre is more closely related to the Lista haraldusalis, and confirms that Orthaga olivacea Warre belongs to the family Pyralidae.

Data Availability

All sequences date files are available from the GenBank at NCBI database (accession number mitochondrion MN078362).

Funding Statement

GQW was supported by the grant from the National Natural Science Foundation of China (31472147) the earmarked fund for Anhui International Joint Research and Development Center of Sericulture Resources Utilization (2017R0101). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Jiang ST, Hong GY, Yu M, Li N, Yang Y, Liu YQ, et al. Characterization of the complete mitochondrial genome of the giant silkworm moth, Eriogyna pyretorum (Lepidoptera: Saturniidae). Int J Biol Sci. 2009;5(4):351–65. 10.7150/ijbs.5.351 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Boore JL. Animal mitochondrial genomes. Nucleic Acids Res. 1999;27(8):1767–80. 10.1093/nar/27.8.1767 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Wolstenholme DR. Animal mitochondrial DNA: structure and evolution. International Review of Cytology. 1992;141(6):173 10.1016/S0074-7696(08)62066-5 [DOI] [PubMed] [Google Scholar]
  • 4.Cameron SL. Insect Mitochondrial Genomics: Implications for Evolution and Phylogeny. Annu Rev Entomol. 2014;59:95–117. 10.1146/annurev-ento-011613-162007 [DOI] [PubMed] [Google Scholar]
  • 5.Taanman JW. The mitochondrial genome: structure, transcription, translation and replication. Biochimica et biophysica acta. 1999;1410(2):103–23. 10.1016/s0005-2728(98)00161-3 . [DOI] [PubMed] [Google Scholar]
  • 6.Zhang DX, Hewitt G.M.,. Insect mitochondrial control region: a review of its structure, evolution and usefulness in evolutionary studies. Biochem Syst Evol. 1997;25:99–120. 10.1016/s0305-1978(96)00042-7 [DOI] [Google Scholar]
  • 7.Bae JS, Kim I, Sohn HD, Jin BR. The mitochondrial genome of the firefly, Pyrocoelia rufa: complete DNA sequence, genome organization, and phylogenetic analysis with other insects. Mol Phylogenet Evol. 2004;32(3):978–85. 10.1016/j.ympev.2004.03.009 [DOI] [PubMed] [Google Scholar]
  • 8.Dowton M, Castro LR, Austin AD. Mitochondrial gene rearrangements as phylogenetic characters in the invertebrates: the examination of genome ‘morphology’. Invertebrate Systematics. 2002;16(3):345–56. 10.1071/IS02003 [DOI] [Google Scholar]
  • 9.Saccone C, De GC, Gissi C, Pesole G, Reyes A. Evolutionary genomics in Metazoa: the mitochondrial DNA as a model system. Gene. 1999;238(1):195–209. 10.1016/s0378-1119(99)00270-x [DOI] [PubMed] [Google Scholar]
  • 10.Miya M, Kawaguchi A, Nishida M. Mitogenomic exploration of higher teleostean phylogenies: a case study for moderate-scale evolutionary genomics with 38 newly determined complete mitochondrial DNA sequences. Molecular Biology & Evolution. 2001;18(11):1993–2009. 10.1093/oxfordjournals.molbev.a003741 [DOI] [PubMed] [Google Scholar]
  • 11.Forstén A. Mitochondrial-DNA time-table and the evolution of Equus: comparison of molecular and paleontological evidence. Annales Zoologici Fennici. 1991;28(3/4):301–9. [Google Scholar]
  • 12.Hayasaka K, Gojobori T, Horai S. Molecular phylogeny and evolution of primate mitochondrial DNA. Molecular Biology & Evolution. 1988;5(6):626 10.1093/oxfordjournals.molbev.a040524 [DOI] [PubMed] [Google Scholar]
  • 13.Avise JC, Arnold J, Ball RM, Bermingham E, Lamb T, Neigel JE, et al. Intraspecific Phylogeography: The Mitochondrial DNA Bridge Between Population Genetics and Systematics. Annual Review of Ecology & Systematics. 1987;18(X):489–522. 10.1146/annurev.es.18.110187.002421 [DOI] [Google Scholar]
  • 14.Ort BS, Pogson GH. Molecular population genetics of the male and female mitochondrial DNA molecules of the California sea mussel, Mytilus californianus. Genetics. 2007;177(2):1087 10.1534/genetics.107.072934 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Hao JS, Sun QQ, Zhao HB, Sun XY, Gai YH, Yang Q. The Complete Mitochondrial Genome of Ctenoptilum vasava (Lepidoptera: Hesperiidae: Pyrginae) and Its Phylogenetic Implication. Comp Funct Genom. 2012;2012(3):328049 10.1155/2012/328049 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Coates BS, Sumerford DV, Hellmich RL. Geographic and voltinism differentiation among North American Ostrinia nubilalis (European corn borer) mitochondrial cytochrome c oxidase haplotypes. J Insect Sci. 2004;4(1):35 10.1673/031.004.3501 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Chai HN, Du YZ, Zhai BP. Characterization of the complete mitochondrial genomes of Cnaphalocrocis medinalis and Chilo suppressalis (Lepidoptera: Pyralidae). Int J Biol Sci. 2012;8(4):561–79. 10.7150/ijbs.3540 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Liu Q, Jiang X, Hou X, Hong Y, Chen W. The mitochondrial genome of Ephestia elutella (Insecta: Lepidoptera: Pyralidae). Mitochondrial DNA Part B. 2018;3(1):189–90. 10.1080/23802359.2018.1436993 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Wei SJ, Xu FL, Hua FL, Lu JD, Zhang CG, Chen XX. A camphor insect pest——bionomics of Orthaga olivacea. Chinese Bulletin of Entomology. 2008;45(4):562–5. [Google Scholar]
  • 20.Chen HL. A Differentiation on Orthaga olivacea and Orthaga achatina [J]. Journal of Zhejiang Forestry College, 1994;11(2):218–21. [Google Scholar]
  • 21.Zhang N, Qian B. Preliminary report on control of Orthaga achatina by bio-pesticide [J]. Journal of Zhejiang Forestry Science and Technology, 2004;24(6):24–5. [Google Scholar]
  • 22.Lowe TM, Eddy SR. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 1997;25(5):955–64. 10.1093/nar/25.5.955 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, et al. Clustal W and clustal X version 2.0. Bioinformatics. 2007;23(21):2947–8. 10.1093/bioinformatics/btm404 [DOI] [PubMed] [Google Scholar]
  • 24.Junqueira ACM, Lessinger AC, Torres TT, da Silva FR, Vettore AL, Arruda P, et al. The mitochondrial genome of the blowfly Chrysomya chloropyga (Diptera: Calliphoridae). Gene. 2004;339:7–15. 10.1016/j.gene.2004.06.031 [DOI] [PubMed] [Google Scholar]
  • 25.Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol Biol Evol. 2013;30(12):2725–9. 10.1093/molbev/mst197 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Benson G. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 1999;27(2):573–80. 10.1093/nar/27.2.573 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Al-Baeity H, Allard LS, Arreza L, et al. The complete mitochondrial genome of the North American pale summer sedge caddisfly Limnephilus hyalinus (Insecta: Trichoptera: Limnephilidae). Mitochondrial DNA Part B. 2019;4(1): 413–15. 10.1080/23802359.2018.1547158 [DOI] [Google Scholar]
  • 28.Flook PK, Rowell CH, Gellissen G. The sequence, organization, and evolution of the Locusta migratoria mitochondrial genome. J Mol Evol. 1995;41(6):928–41. 10.1007/bf00173173 . [DOI] [PubMed] [Google Scholar]
  • 29.Clary DO, Wolstenholme DR. The mitochondrial DNA molecular of Drosophila yakuba: nucleotide sequence, gene organization, and genetic code. J Mol Evol. 1985;22(3):252–71. 10.1007/bf02099755 . [DOI] [PubMed] [Google Scholar]
  • 30.Pan MH, Yu QY, Xia YL, Dai FY, Liu YQ, Lu C, et al. Characterization of mitochondrial genome of Chinese wild mulberry silkworm, Bomyx mandarina (Lepidoptera: Bombycidae). Sci China Ser C. 2008;51(8):693–701. 10.1007/s11427-008-0097-6 [DOI] [PubMed] [Google Scholar]
  • 31.Kong WQ, Yang JH. The complete mitochondrial genome of Rondotia menciana (Lepidoptera: Bombycidae). J Insect Sci. 2015;15(1):48 10.1093/Jisesa/Iev032 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Liu YQ, Li YP, Pan MH, Dai FY, Zhu XW, Lu Cheng, et al. The complete mitochondrial genome of the Chinese oak silkmoth, Antheraea pernyi (Lepidoptera: Saturniidae). Acta Biochimica et Biophysica Sinica. 40(8):693–703 [PubMed] [Google Scholar]
  • 33.Kim SR, Kim MI, Hong MY, Kim KY, Kang PD, Hwang JS, et al. The complete mitogenome sequence of the Japanese oak silkmoth, Antheraea yamamai (Lepidoptera: Saturniidae). Mol Biol Rep. 2009;36(7):1871–80. 10.1007/s11033-008-9393-2 [DOI] [PubMed] [Google Scholar]
  • 34.Cameron SL, Whiting MF. The complete mitochondrial genome of the tobacco hornworm, Manduca sexta, (Insecta: Lepidoptera: Sphingidae), and an examination of mitochondrial gene variability within butterflies and moths. Gene. 2008;408(2):112–23. 10.1016/j.gene.2007.10.023 [DOI] [PubMed] [Google Scholar]
  • 35.Kim MJ, Choi SW, Kim I. Complete mitochondrial genome of the larch hawk moth, Sphinx morio (Lepidoptera: Sphingidae). Mitochondr DNA. 2013;24(6):622–4. 10.3109/19401736.2013.772155 [DOI] [PubMed] [Google Scholar]
  • 36.Dong WW, Dong SY, Jiang GF, Huang GH. Characterization of the complete mitochondrial genome of tea tussock moth, Euproctis pseudoconspersa (Lepidoptera: Lymantriidae) and its phylogenetic implications. Gene. 2016;577(1):37–46. 10.1016/j.gene.2015.11.020 [DOI] [PubMed] [Google Scholar]
  • 37.Lu HF, Su TJ, Luo AR, Zhu CD, Wu CS. Characterization of the Complete Mitochondrion Genome of Diurnal Moth Amata emma (Butler) (Lepidoptera: Erebidae) and Its Phylogenetic Implications. Plos One. 2013;8(9):e72410 10.1371/journal.pone.0072410 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Salvato P, Simonato M, Battisti A, Negrisolo E. The complete mitochondrial genome of the bag-shelter moth Ochrogaster lunifer (Lepidoptera, Notodontidae). Bmc Genomics. 2008;9(1):331 10.1186/1471-2164-9-331 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Gong YJ, Wu QL, Wei SJ. Complete mitogenome of the Argyrogramma agnata (Lepidoptera: Noctuidae). Mitochondr DNA. 2013;24(4):391 10.3109/19401736.2013.763241 [DOI] [PubMed] [Google Scholar]
  • 40.Wu QL, Cui WX, Wei SJ. Characterization of the complete mitochondrial genome of the black cutworm Agrotis ipsilon (Lepidoptera: Noctuidae). Mitochondr DNA. 2015;26(1):139–40. 10.3109/19401736.2013.815175 . [DOI] [PubMed] [Google Scholar]
  • 41.Yang X, Cameron SL, Lees DC, Xue D, Han H. A mitochondrial genome phylogeny of owlet moths (Lepidoptera: Noctuoidea), and examination of the utility of mitochondrial genomes for lepidopteran phylogenetics. Mol Phylogenet Evol. 2015;85:230–7. 10.1016/j.ympev.2015.02.005 . [DOI] [PubMed] [Google Scholar]
  • 42.Liu SX, Xue DY, Cheng R, Han HX. The complete mitogenome of Apocheima cinerarius (Lepidoptera: Geometridae: Ennominae) and comparison with that of other lepidopteran insects. Gene. 2014;547(1):136–44. 10.1016/j.gene.2014.06.044 [DOI] [PubMed] [Google Scholar]
  • 43.Chai HN, Du YZ, Zhai BP. Characterization of the Complete Mitochondrial Genomes of Cnaphalocrocis medinalis and Chilo suppressalis (Lepidoptera: Pyralidae). Int J Biol Sci. 2012;8(4):561–79. 10.7150/ijbs.3540 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Li WW, Zhang XY, Fan ZX, Yue BS, Huang FN, King E, et al. Structural Characteristics and Phylogenetic Analysis of the Mitochondrial Genome of the Sugarcane Borer, Diatraea saccharalis (Lepidoptera: Crambidae). DNA Cell Biol. 2011;30(1):3–8. 10.1089/dna.2010.1058 [DOI] [PubMed] [Google Scholar]
  • 45.Coates BS, Sumerford DV, Hellmich RL, Lewis LC. Partial mitochondrial genome sequences of Ostrinia nubilalis and Ostrinia furnicalis. Int J Biol Sci. 2005;1(1):13–8. 10.7150/ijbs.1.13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Ye F, You P. The complete mitochondrial genome of Paracymoriza distinctalis (Lepidoptera: Crambidae). Mitochondrial Dna A Dna Mappseq Anal. 2014;27(1):28–9. 10.3109/19401736.2013.869678 [DOI] [PubMed] [Google Scholar]
  • 47.Wang J, Li PF, You P. The complete mitochondrial genome of Tyspanodes hypsalis (Lepidoptera: Crambidae). Mitochondr DNA Part A. 2016;27(3):1821–2. 10.3109/19401736.2014.971241 [DOI] [PubMed] [Google Scholar]
  • 48.Ye F, Shi Y, Xing L, Yu H, You P. The complete mitochondrial genome of\\r Paracymoriza prodigalis\\r (Leech, 1889) (Lepidoptera), with a preliminary phylogenetic analysis of Pyraloidea. Aquatic Insects. 35(3–4):71–88. 10.1080/01650424.2014.948456 [DOI] [Google Scholar]
  • 49.Park JS, Kim MJ, Kim S-S, Kim I. Complete mitochondrial genome of an aquatic moth, Elophila interruptalis (Lepidoptera: Crambidae). Mitochondr DNA. 2014;25(4):275–7. 10.3109/19401736.2013.800504 [DOI] [PubMed] [Google Scholar]
  • 50.Cao SS, Du YZ. Characterization of the complete mitochondrial genome of Chilo auricilius and comparison with three other rice stem borers. Gene. 2014;548(2):270–6. 10.1016/j.gene.2014.07.045 [DOI] [PubMed] [Google Scholar]
  • 51.Min T, Tan M, Meng G, Yang S, Xu S, Liu S, et al. Multiplex sequencing of pooled mitochondrial genomes—a crucial step toward biodiversity analysis using mito-metagenomics. Nucleic Acids Res. 2014;42(22):e166 10.1093/nar/gku917 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Park JS, Min JK, Ahn SJ, Kim I. Complete mitochondrial genome of the grass moth Glyphodes quadrimaculalis (Lepidoptera: Crambidae). Mitochondr DNA. 2013;26(2):247–9. 10.3109/19401736.2013.823183 [DOI] [PubMed] [Google Scholar]
  • 53.He SL, Yuan Z, Li-Fang Z, Wen-Qi M, Xiu-Yue Z, Bi-Song Y, et al. The Complete Mitochondrial Genome of the Beet Webworm, Spoladea recurvalis (Lepidoptera: Crambidae) and Its Phylogenetic Implications. Plos One. 2015;10(6):e0129355 10.1371/journal.pone.0129355 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Wu QL, Gong YJ, Shi BC, Gu Y, Wei SJ. The complete mitochondrial genome of the yellow peach moth Dichocrocis punctiferalis (Lepidoptera: Pyralidae). Mitochondr DNA. 2012;24(2):105–7. 10.3109/19401736.2012.726621 [DOI] [PubMed] [Google Scholar]
  • 55.Zou Y, Ma W, Zhang L, He S, Zhang X, Tao Z. The complete mitochondrial genome of the bean pod borer, Maruca testulalis (Lepidoptera: Crambidae: Spilomelinae). Mitochondrial DNA Part A. 2016;27(1):740–1. 10.3109/19401736.2014.913167 [DOI] [PubMed] [Google Scholar]
  • 56.Chen S, Li FH, Lan XE, You P. The complete mitochondrial genome of Pycnarmon lactiferalis (Lepidoptera: Crambidae). Mitochondrial DNA Part B. 2016;1(1):638–9. 10.1080/23802359.2016.1214551 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Ye F, Yu HL, Li PF, You P. The complete mitochondrial genome of Lista haraldusalis (Lepidoptera: Pyralidae). Mitochondr DNA. 2015;26(6):853–4. 10.3109/19401736.2013.861427 [DOI] [PubMed] [Google Scholar]
  • 58.Wu YP, Li J, Zhao JL, Su TJ, Luo AR. The complete mitochondrial genome of the rice moth, Corcyra cephalonica. J Insect Sci. 2012;12(72). 10.1673/031.012.7201 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Chang Z, Shen Q-Q. The complete mitochondrial genome of the navel orangeworm Amyelois transitella (Insecta: Lepidoptera: Pyralidae). Mitochondr DNA Part A. 2016;27(6):4561–2. 10.3109/19401736.2015.1101564 [DOI] [PubMed] [Google Scholar]
  • 60.Consortium LPM, Peterson CS, M JM. The complete mitochondrial genome of the lesser aspen webworm moth Meroptera pravella (Insecta: Lepidoptera: Pyralidae). Mitochondrial DNA Part B. 2017;2(1):344–6. 10.1080/23802359.2017.1334525 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Zhu WB, Yan J, Song JR, You P. The first mitochondrial genomes for Pyralinae (Pyralidae) and Glaphyriinae (Crambidae), with phylogenetic implications of Pyraloidea. Plos One. 2018;13(3):e0133068 10.1371/journal.pone.0194672 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Yang ML, Feng SQ, Gao Y, Han X, Xiong RC, Li ZH. The complete mitochondrial genome of the pear pyralid moth, Euzophera pyriella Yang. Mitochondrial DNA Part B. 2017;2(1):275–6. 10.1080/23802359.2017.1325338 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Gong YJ, Shi BC, Kang ZJ, Zhang F, Wei SJ. The complete mitochondrial genome of the oriental fruit moth Grapholita molesta (Busck) (Lepidoptera: Tortricidae). Mol Biol Rep. 2012;39(3):2893–900. 10.1007/s11033-011-1049-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Zhao JL, Zhang YY, Luo AR, Jiang GF, Cameron SL, Zhu CD. The complete mitochondrial genome of Spilonota lechriaspis Meyrick (Lepidoptera: Tortricidae). Mol Biol Rep. 2011;38(6):3757–64. 10.1007/s11033-010-0491-6 [DOI] [PubMed] [Google Scholar]
  • 65.Xing LX, Li PF, Wu J, Wang K, You P. The complete mitochondrial genome of the endangered butterfly Luehdorfia taibai Chou (Lepidoptera: Papilionidae). Mitochondr DNA. 2014;25(2):122–3. 10.3109/19401736.2013.800506 [DOI] [PubMed] [Google Scholar]
  • 66.Chen M, Tian LL, Shi QH, Cao TW, Hao JS. Complete mitogenome of the Lesser Purple Emperor Apatura ilia (Lepidoptera: Nymphalidae: Apaturinae) and comparison with other nymphalid butterflies. Zoological research. 2012;33(2):191–201. 10.3724/SP.J.1141.2012.02191 . [DOI] [PubMed] [Google Scholar]
  • 67.Zhang M, Nie XP, Cao TW, Wang JP, Li T, Zhang XN, et al. The complete mitochondrial genome of the butterfly Apatura metis (Lepidoptera: Nymphalidae). Mol Biol Rep. 2012;39(6):6529–36. 10.1007/s11033-012-1481-7 [DOI] [PubMed] [Google Scholar]
  • 68.Wei SJ, Shi BC, Gong YJ, Li Q, Chen XX. Characterization of the Mitochondrial Genome of the Diamondback Moth Plutella xylostella (Lepidoptera: Plutellidae) and Phylogenetic Analysis of Advanced Moths and Butterflies. Dna & Cell Biology. 2013;32(4):173–87. 10.1089/dna.2012.1942 [DOI] [PubMed] [Google Scholar]
  • 69.Wu YP, Zhao JL, Su TJ, Li J, Zhu CD. The Complete Mitochondrial Genome of Leucoptera malifoliella Costa (Lepidoptera: Lyonetiidae). Dna & Cell Biology. 2012;31(10):1508–22. 10.1089/dna.2012.1642 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Rand DM. Endotherms, ectotherms, and mitochondrial genome-size variation. J Mol Evol. 1993;37(3):281–95. 10.1007/bf00175505 [DOI] [PubMed] [Google Scholar]
  • 71.Mcknight ML, Shaffer HB. Large, rapidly evolving intergenic spacer in the mitochondrial DNA of the salamander family Ambystomatidae (Amphibia: Caudata). Molecular Biology & Evolution. 1997;14(11):1167–76. [DOI] [PubMed] [Google Scholar]
  • 72.Perna NT, Kocher TD. Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes. J Mol Evol. 1995;41(3):353–8. 10.1007/bf00186547 [DOI] [PubMed] [Google Scholar]
  • 73.Liao F, Wang L, Wu S, Li YP, Zhao L, Huang GM, et al. The complete mitochondrial genome of the fall webworm, Hyphantria cunea (Lepidoptera: Arctiidae). Int J Biol Sci. 2010;6(2):172–86. 10.7150/ijbs.6.172 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Liu QN, Zhu BJ, Dai LS, Wang L, Qian C, Wei GQ, et al. The complete mitochondrial genome of the common cutworm, Spodoptera litura (Lepidoptera: Noctuidade). Mitochondr DNA. 2016;27(1):122–3. 10.3109/19401736.2013.873934 [DOI] [PubMed] [Google Scholar]
  • 75.Sheffield NC, Song H, Cameron SL, Whiting MF. A comparative analysis of mitochondrial genomes in Coleoptera (Arthropoda: Insecta) and genome descriptions of six new beetles. Mol Biol Evol. 2008;25(11):2499–509. 10.1093/molbev/msn198 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Cameron SL. How to sequence and annotate insect mitochondrial genomes for systematic and comparative genomics research. Systematic Entomology. 2014;39(3):400–411. 10.1111/syen.12071 [DOI] [Google Scholar]
  • 77.Ojala D, Merkel C, Gelfand R, Attardi G. The tRNA genes punctuate the reading of genetic information in human mitochondrial DNA. Cell. 1980;22(2):393–403. 10.1016/0092-8674(80)90350-5 [DOI] [PubMed] [Google Scholar]
  • 78.Wich GN, Hummel H, Jarsch M, Bär U, Böck A. Transcription signals for stable RNA genes in Methanococcus. Nucleic Acids Res. 1986;14(6):2459 10.1093/nar/14.6.2459 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Sun QQ, Sun XY, Wang XC, Gai YH, Hu J, Zhu CD, et al. Complete sequence of the mitochondrial genome of the Japanese buff-tip moth, Phalera flavescens (Lepidoptera: Notodontidae). Genet Mol Res. 2012;11(4):4213–25. 10.4238/2012.September.10.2 [DOI] [PubMed] [Google Scholar]
  • 80.Jiao Y, Hong GY, Wang AM, Cao YZ, Wei ZJ. Mitochondrial genome of the cotton bollworm Helicoverpa armigera (Lepidoptera: Noctuidae) and comparison with other Lepidopterans. Mitochondr DNA. 2010;21(5):160–9. 10.3109/19401736.2010.503242 [DOI] [PubMed] [Google Scholar]
  • 81.Yin J, Wang AM, Hong GY, Cao YZ, Wei ZJ. Complete mitochondrial genome of Chilo suppressalis (Walker) (Lepidoptera: Crambidae). Mitochondr DNA. 2011;22(3):41 10.3109/19401736.2011.605126 [DOI] [PubMed] [Google Scholar]
  • 82.Liu LT, Su BL, Ma JT, et al. A research on biological characteristics and occurrence regularity of semiothisa cinerearia. Jouanal of Jilin agriculture university. 2008;30(8):24–6. [Google Scholar]
  • 83.Zhu BJ, Liu QN, Dai LS, Wang L, Sun Y, Lin KZ, et al. Characterization of the complete mitochondrial genome of Diaphania pyloalis (Lepidoptera: Pyralididae). Gene. 2013;527(1):283–91. 10.1016/j.gene.2013.06.035 . [DOI] [PubMed] [Google Scholar]
  • 84.Saito S, Tamura K, Aotsuka T. Replication origin of mitochondrial DNA in insects. Genetics. 2005;171(4):1695–705. 10.1534/genetics.105.046243 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85.Oliveira MT, Azeredoespin AML, Lessinger AC. The Mitochondrial DNA Control Region of Muscidae Flies: Evolution and Structural Conservation in a Dipteran Context. J Mol Evol. 2007;64(5):519 10.1007/s00239-006-0099-6 [DOI] [PubMed] [Google Scholar]
  • 86.Kim MJ, Wan X, Kim KG, Hwang JS, Kim I. Complete nucleotide sequence and organization of the mitogenome of endangered Eumenis autonoe (Lepidoptera: Nymphalidae). Afr J Biotechnol. 2010;9(5):735–54. 10.5897/ajb09.1486 [DOI] [Google Scholar]
  • 87.Park JS, Cho Y, Kim MJ, Nam SH, Kim I. Description of complete mitochondrial genome of the black-veined white, Aporia crataegi (Lepidoptera: Papilionoidea), and comparison to papilionoid species. J Asia-Pac Entomol. 2012;15(3):331–41. 10.1016/j.aspen.2012.01.002 [DOI] [Google Scholar]
  • 88.Zheng N, Sun YX, Yang LL, Wu L, Abbas MN, Chen C, et al. Characterization of the complete mitochondrial genome of Biston marginata (Lepidoptera: Geometridae) and phylogenetic analysis among lepidopteran insects. International journal of biological macromolecules. 2018;113:961–70. 10.1016/j.ijbiomac.2018.02.110 . [DOI] [PubMed] [Google Scholar]
  • 89.Dai LS, Qian C, Zhang CF, Wang L, Wei GQ, Li J, et al. Characterization of the Complete Mitochondrial Genome of Cerura menciana and Comparison with Other Lepidopteran Insects. Plos One. 2015;10(8):e0132951 10.1371/journal.pone.0132951 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Sun YX, Wang L, Wei GQ, Qian C, Dai LS, Sun Y, et al. Characterization of the Complete Mitochondrial Genome of Leucoma salicis (Lepidoptera: Lymantriidae) and Comparison with Other Lepidopteran Insects. Sci Rep. 2016;6:39153 10.1038/srep39153 [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Iratxe Puebla

25 Oct 2019

PONE-D-19-24590

Characterization of the complete mitochondrial genome of Orthaga olivacea Warre (Lepidoptera Pyralididae) and comparison with other Lepidopteran insects

PLOS ONE

Dear Dr Wei,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

The manuscript has been assessed by three reviewers; their comments are available below.

The reviewers have raised major concerns that need attention in a revision. The reviewers note that the phylogenetic analysis needs to be substantially revised to add more species and to revisit the approach employed for the analyses. The reviewers also feel that the manuscript should provide a clearer outline of the study aims and research question addressed in the Introduction section and they request improvements to the written language.

Could you please carefully revise the manuscript to address the concerns raised by the reviewers?

We would appreciate receiving your revised manuscript by Dec 08 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Iratxe Puebla

Senior Managing Editor, PLOS ONE

Journal Requirements:

1. When submitting your revision, we need you to address these additional requirements.

Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We noticed you have some occurrence of overlapping text between the current submission and your previous publication(s) as following, which needs to be addressed:

- https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0132951

-https://www.nature.com/articles/srep39153

-https://www.sciencedirect.com/science/article/pii/S0141813017324807?via%3Dihub

In your revision ensure you cite all your sources (including your own works), and quote or rephrase any duplicated text outside the methods section. Further consideration is dependent on these concerns being addressed.""

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

Reviewer #3: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In this manuscript, the authors sequence the complete mitochondrial genome of the moth, Orthaga olivacea. They then describe the annotation of this moth and use phylogenetic methods to compare it with the mitochondrial genomes of 34 other Lepidoptera. The writing is somewhat uneven—I have a number of suggestions for improvement, especially for the Abstract and Introduction in the Minor comments section at the end of this reviewer report. The annotation of the mitochondrial genome is acceptable, but I have a number of concerns especially about the phylogenetic analysis that will need to be addressed before this manuscript will be suitable for publication.

Major issues:

1. Pyraloidea taxon sampling. Line 62. “Considering the limited information of the mitochondrial sequences in Pyralidae, we sequenced the complete mitogenome of Orthaga olivacea, and compared it with other insect species, especially with the members of Pyralidae species.” This is a reasonable justification for sequencing the mitogenome of O. olivacea, but it is very curious that only 3 mitogenomes were included in the phylogenetic analysis and many of the other pyralid mitochondrial genomes that are available from Genbank were not included in these analyses including Corcyra cephalonica, Amyelois transitella, Plodia interpunctella (3 mitogenomes), Ephestia kuehniella (3 mitogenomes), Meroptera pravella, and Hypsopygia regina. Similarly, the sister-family to the Pyralidae includes an even larger number of species with sequenced mitochondrial genomes that were not included in the presented analyses including Paracymoriza prodigalis, Elophila interruptalis, Pseudargyria interruptella, Chilo auriculius, Chilo sacchariphagus, Evergestis junctalis, Nomophila noctuella, , Tryspandoes striata, Glyphodes quadrimaculalis, Spoladea recurvalis, Dichocrocis punctiferalis, Glyphodes pyloalis, Maruca vitrata, Maruca testulalis, Haritalodes derogate, Pycnarmon lactiferalis, Loxostege stricticalis, Endotricha consoci, Euzophera pyriella, Dichocrocis punctiferalis, and Cnaphalocrocis medinalis (3 mitogenomes). If one of the goals of the authors is to demonstrate that Orthaga olivacea belongs within the Pyralidae and to determine its closest relatives with sequences mitochondrial genomes, then they need to repeat their phylogenetic analysis after supplementing their current data set with all of these additional species. (Also note that Lista haraldusalis is misspelled in Fig. 7 and in other locations in the manuscript. Also, Family Pyralidae (and probably also Family Crambidae) should be indicated in Fig. 7.)

2. The authors employ 2 non-Lepidoptera outgroup species: Drosophila yakuba, a fly (Order Diptera) and Locusta migratoria, a grasshopper (Order Orthoptera), but the authors do not include any representatives of the insect Order most closely related to the Lepidoptera, the caddisflies (Order Trichoptera). There are at least 17 complete mitochondrial genomes representing several caddisfly Families available through Genbank (Al-Baeity et al. 2019). To root the Lepidopteran tree properly caddisflies sequences MUST also be included in the phylogenetic analyses.

Minor issues:

Line 2. Title: In modern usage, the lepidopteran family is usually called Pyralidae, not “Pyralididae”. Change here and throughout manuscript.

Line 18. Abstract: Suggested reword with greater specificity “Orthaga olivacea Ware (Lepidoptera Pyralidae) is an important agricultural pest of camphor trees (Cinnamomum camphora).”

Line 19. Suggested reword “To further supplement the known genome-level…”

Line 20. Suggested reword “…other species of Lepidoptera.”

Lines 31-31. Suggested reword “Phylogenetic analysis suggested that among sequenced lepidopteran mitochondrial genomes, Orthaga olivacea Warre was most closely related…”

Line 38. Suggested reword “…(mtDNA) is a circular molecule range in size from 14 to 19 kb…”

Line 42. Suggested reword “…A+T-rich region, the largest noncoding…”

Line 43-47. Suggested reword to remove repetition “Whole mitochondrial genomes are a useful data source for several research areas, such as evolutionary genomics (9, 10), comparative molecular evolution (11, 12), phylogeography (13), and population genetics (14).”

Line 50-51. Suggested reword to remove extraneous information “…over 25,000 species and some pyralids are important agricultural pests…”

Line 53-53. Suggested reword “Despite their diversity and great importance as pests of agricultural and forestry plants, they are also valuable for pollinating plants of economic importance. Most species in the family Pyralidae do not yet have sequenced mitogenomes.”

Line 58. “remove” should be “removal”

Line 59-60. “However, overlapping generations and irregularity of abundance in the field from May to October make it very difficult to control.”

Line 72. Suggested reword “…the camphor trees on the campus of…”

Line 94. “…insert DNA were sequenced at least three times…” Query: was sequencing of the inserts done in both directions? If yes, please specify in the text.

Lines 99-100. Suggested reword “…under the accession number MN078362.”

Line 125-126. “…mitogenome sizes documented for other sequenced lepidopterans which range from 14,534 bp in Ostrinia nublilalis (incomplete)…” Since the sequencing of the mitochondrial genome of O. nublilalis is incomplete, it is inappropriate and incorrect to use this sequence to estimate the minimum mitochondrial genome size in the Lepidoptera. This data point should be replaced with the smallest completely sequenced mitochondrial genome from the Lepidoptera.

Lines 136-137. Suggested reword “In addition, the GC skew…”

Line 146. Table 4. I’m not sure that this table is necessary and perhaps should be removed.

Line 166. Suggested reword “…observed in most other lepidopteran mitogenomes and are…”

Line 177-179. Suggested reword “…for instance, L. haraldusalis, G. mellonella, B. mori, B. thibetaria, and L. malifoliella species all lack GCT codons, while G. mollesta lacks CGT codons.”

Line 246-248. “The species Orthaga olivacea…” This sentence should be revised based on the updated phylogenetic analysis after adding the taxa I suggested in the major revisions section above.

Lines 252-253. Suggested reword “…constituent with prior studies of lepidopteran phylogeny.”

References:

Al-Baeity, H., Allard, L.S., Arreza, L., et al. (2019) The complete mitochondrial genome of the North American pale summer sedge caddisfly Limnephilus hyalinus (Insecta: Trichoptera: Limnephilidae). Mitochondrial DNA Part B 4: 413-415.

Reviewer #2: The manuscript mainly determined the complete mitochondrial genome of Orthaga olivacea Warre (Lepidoptera Pyralididae) and compare the mtDNA with other Lepidopteran insects. The English is acceptable. The literature cited is appropriate and draws on numerous comparative examples of similar research. Overall structure is of good quality and the raw data complete. The paper touches on the pertinent theoretical ideas proposed by earlier researchers. Overall, this manuscript is interesting, the description of the methods is complete and sound, and worthy to be published in “PLoS ONE” after minor modified.

1. the tables would be “three line”.

2. the literature 34 (line 353) was not complete.

3. “Warre” (ects.) in the figures would not be italic.

4. correct others, for examples, line 194 “TRNAs” (tRNAs ?); line 201 “The rNAs” (The rRNAs ?), ect.

Reviewer #3: In the manuscript, the mitogenome of Orthaga olivacea was determined and comparison with other lepidopteran sequences were also analyzed. The results of the study are valuable for the readers interested in the comparative mitogenome and phylogeny of Pyralididae. These results are informative and useful. I suggest this article can be published in this journal. However, the manuscript needs to be improved before acceptance for publication.

1. Introduction: the authors should provide clearly the study aim and scientific questions. It includes a description of the importance of the research and the study and reviews most of the previous literature. However, the authors have omitted a few studies of relevance and these should be included,

2. It is not clear from the manuscript that the collected Orthaga olivacea samples were verified astruly belong to the said species. It is suggested for the author to delimit the detailed morphological characters of the species to confirm.

3. Based on the dataset of 13 concatenated protein sequences, the authors reconstructed the phylogeny of Lepidoptera using MEGA with the Maximum Likelihood method. It is more persuasive and popular to carry out such analysis with RAxML method.

4. There are some errors in grammar and syntax throughout the text of the manuscript, the English writing should be further improved.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Ping You

Reviewer #3: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 Mar 6;15(3):e0227831. doi: 10.1371/journal.pone.0227831.r002

Author response to Decision Letter 0

7 Dec 2019

Responds to the reviewer’s comments:

Reviewer #1:

Major issues:

1. Response to comment: (Pyraloidea taxon sampling. Line 62. “Considering the limited information of the mitochondrial sequences in Pyralidae, we sequenced the complete mitogenome of Orthaga olivacea, and compared it with other insect species, especially with the members of Pyralidae species.” This is a reasonable justification for sequencing the mitogenome of O. olivacea, but it is very curious that only 3 mitogenomes were included in the phylogenetic analysis and many of the other pyralid mitochondrial genomes that are available from Genbank were not included in these analyses including Corcyra cephalonica, Amyelois transitella, Plodia interpunctella (3 mitogenomes), Ephestia kuehniella (3 mitogenomes), Meroptera pravella, and Hypsopygia regina. Similarly, the sister-family to the Pyralidae includes an even larger number of species with sequenced mitochondrial genomes that were not included in the presented analyses including Paracymoriza prodigalis, Elophila interruptalis, Pseudargyria interruptella, Chilo auriculius, Chilo sacchariphagus, Evergestis junctalis, Nomophila noctuella, , Tryspandoes striata, Glyphodes quadrimaculalis, Spoladea recurvalis, Dichocrocis punctiferalis, Glyphodes pyloalis, Maruca vitrata, Maruca testulalis, Haritalodes derogate, Pycnarmon lactiferalis, Loxostege stricticalis, Endotricha consoci, Euzophera pyriella, Dichocrocis punctiferalis, and Cnaphalocrocis medinalis (3 mitogenomes). If one of the goals of the authors is to demonstrate that Orthaga olivacea belongs within the Pyralidae and to determine its closest relatives with sequences mitochondrial genomes, then they need to repeat their phylogenetic analysis after supplementing their current data set with all of these additional species. (Also note that Lista haraldusalis is misspelled in Fig. 7 and in other locations in the manuscript. Also, Family Pyralidae (and probably also Family Crambidae) should be indicated in Fig. 7.))

Response: We are very sorry for our omission that it is inadequate to the goals to demonstrate that Orthaga olivacea belongs within the Pyralidae and to determine its closest relatives with sequences mitochondrial genomes with only 3 pyralid mitochondrial genomes were included in the phylogenetic analysis. According reviewer’s suggestion, we have repeated our phylogenetic analysis after supplementing our current data set with all of these additional species. And we have corrected the misspelled of Lista haraldusalis in Fig. 7 and in other locations in the manuscript. Also, Family Pyralidae (and probably also Family Crambidae) was indicated in Fig. 7.

2. Response to comment: (The authors employ 2 non-Lepidoptera outgroup species: Drosophila yakuba, a fly (Order Diptera) and Locusta migratoria, a grasshopper (Order Orthoptera), but the authors do not include any representatives of the insect Order most closely related to the Lepidoptera, the caddisflies (Order Trichoptera). There are at least 17 complete mitochondrial genomes representing several caddisfly Families available through Genbank (Al-Baeity et al. 2019). To root the Lepidopteran tree properly caddisflies sequences MUST also be included in the phylogenetic analyses.)

Response: Considering the Reviewer’s suggestion, we have included the caddisflies sequences of Limnephilus hyalinus in the phylogenetic analyses as outgroup.

Minor issues:

1. Response to comment: (Line 2. Title: In modern usage, the lepidopteran family is usually called Pyralidae, not “Pyralididae”. Change here and throughout manuscript.)

Response: We are very sorry for our Negligence of the use of “Pyralididae”, and we have corrected it to “Pyralidae” throughout manuscript.

2. Response to comment: (Line 18. Abstract: Suggested reword with greater specificity “Orthaga olivacea Ware (Lepidoptera Pyralidae) is an important agricultural pest of camphor trees (Cinnamomum camphora).”)

Response: According reviewer’s suggestion, we have reworded with greater specificity.

3. Response to comment: (Line 19. Suggested reword “To further supplement the known genome-level…”)

Response: According reviewer’s suggestion, we have reworded it in the target location.

4. Response to comment: (Line 20. Suggested reword “…other species of Lepidoptera.”)

Response: According reviewer’s suggestion, we have reworded it in the target location.

5. Response to comment: (Lines 31-31. Suggested reword “Phylogenetic analysis suggested that among sequenced lepidopteran mitochondrial genomes, Orthaga olivacea Warre was most closely related…”)

Response: According reviewer’s suggestion, we have reworded it in the target location.

6. Response to comment: (Line 38. Suggested reword “…(mtDNA) is a circular molecule range in size from 14 to 19 kb…”)

Response: According reviewer’s suggestion, we have reworded it in the target location.

7. Response to comment: (Line 42. Suggested reword “…A+T-rich region, the largest noncoding…”)

Response: According reviewer’s suggestion, we have reworded it in the target location.

8. Response to comment: (Line 43-47. Suggested reword to remove repetition “Whole mitochondrial genomes are a useful data source for several research areas, such as evolutionary genomics (9, 10), comparative molecular evolution (11, 12), phylogeography (13), and population genetics (14).)

Response: According reviewer’s suggestion, we have removed repetition in the target location.

9. Response to comment: (Line 50-51. Suggested reword to remove extraneous information “…over 25,000 species and some pyralids are important agricultural pests…”)

Response: According reviewer’s suggestion, we have removed extraneous information in the target location.

10. Response to comment: (Line 53-53. Suggested reword “Despite their diversity and great importance as pests of agricultural and forestry plants, they are also valuable for pollinating plants of economic importance. Most species in the family Pyralidae do not yet have sequenced mitogenomes.”)

Response: According reviewer’s suggestion, we have reworded it in the target location.

11. Response to comment: (Line 58. “remove” should be “removal”)

Response: According reviewer’s suggestion, we have corrected “remove” to “removal”.

12. Response to comment: (Line 59-60. “However, overlapping generations and irregularity of abundance in the field from May to October make it very difficult to control.”)

Response: According reviewer’s suggestion, we have reworded it in the target location.

13. Response to comment: (Line 72. Suggested reword “…the camphor trees on the campus of…”)

Response: According reviewer’s suggestion, we have reworded it in the target location.

14. Response to comment: (Line 94. “…insert DNA were sequenced at least three times…” Query: was sequencing of the inserts done in both directions? If yes, please specify in the text.)

Response: Yes, the sequencing of the inserts was done in both directins. According reviewer’s suggestion, we have specified in the text.

15. Response to comment: (Lines 99-100. Suggested reword “…under the accession number MN078362.”)

Response: According reviewer’s suggestion, we have reworded it in the target location.

16. Response to comment: (Line 125-126. “…mitogenome sizes documented for other sequenced lepidopterans which range from 14,534 bp in Ostrinia nublilalis (incomplete)…” Since the sequencing of the mitochondrial genome of O. nublilalis is incomplete, it is inappropriate and incorrect to use this sequence to estimate the minimum mitochondrial genome size in the Lepidoptera. This data point should be replaced with the smallest completely sequenced mitochondrial genome from the Lepidoptera.)

Response: Thank you for pointing out the error. We have re-searched NCBI, and found that the sequencing of the mitochondrial genome of Ostrinia nublilalis is complete with 14,535 bp. And maybe Ostrinia nublilalis is the smallest completely sequenced mitochondrial genome from the Lepidoptera. we have corrected it in the target location.

17. Response to comment: (Lines 136-137. Suggested reword “In addition, the GC skew…”)

Response: According reviewer’s suggestion, we have reworded it in the target location.

18. Response to comment: (Line 146. Table 4. I’m not sure that this table is necessary and perhaps should be removed.)

Response: Thank you for your suggestion, but we think by base preference and compared it with other species in table 4, can better understand this mitochondrial genome. Therefore, we chose to keep table 4 in the manuscript.

19. Response to comment: (Line 166. Suggested reword “…observed in most other lepidopteran mitogenomes and are…”)

Response: According reviewer’s suggestion, we have reworded it in the target location.

20. Response to comment: (Line 177-179. Suggested reword “…for instance, L. haraldusalis, G. mellonella, B. mori, B. thibetaria, and L. malifoliella species all lack GCT codons, while G. mollesta lacks CGT codons.”)

Response: According reviewer’s suggestion, we have reworded it in the target location.

21. Response to comment: (Line 246-248. “The species Orthaga olivacea…” This sentence should be revised based on the updated phylogenetic analysis after adding the taxa I suggested in the major revisions section above.)

Response: According reviewer’s suggestion, we have revised this sentence based on the updated phylogenetic analysis.

22. Response to comment: (Lines 252-253. Suggested reword “…constituent with prior studies of lepidopteran phylogeny.”)

Response: According reviewer’s suggestion, we have reworded it in the target location.

Reviewer #2:

1. Response to comment: (the tables would be “three line”.)

Response: According reviewer’s suggestion, we have changed all tables into “three line” forms.

2. Response to comment: (the literature 34 (line 353) was not complete.)

Response: According reviewer’s suggestion, we have reworded it in the target location.

3. Response to comment: (“Warre” (ects.) in the figures would not be italic.)

Response: We are very sorry for our error application of the italic of “Warre” (ects.) in the figures, we have corrected it in all figures.

4. Response to comment: (“correct others, for examples, line 194 “TRNAs” (tRNAs ?); line 201 “The rNAs” (The rRNAs ?), ect.)

Response: We are very sorry for our incorrect in spelling, and we have already corrected them in the text and marked in color.

Reviewer #3:

1. Response to comment: (Introduction: the authors should provide clearly the study aim and scientific questions. It includes a description of the importance of the research and the study and reviews most of the previous literature. However, the authors have omitted a few studies of relevance and these should be included,)

Response: According reviewer’s suggestion, we have reworded the Introduction section to provide a clearer outline of the study aims and research question and marked in color.

2. Response to comment: (It is not clear from the manuscript that the collected Orthaga olivacea samples were verified as truly belongs to the said species. It is suggested for the author to delimit the detailed morphological characters of the species to confirm.)

Response: According reviewer’s suggestion, we have added detailed description of the morphological characteristics of the species' larvae in the materials and methods section to better delimit the species.

3. Response to comment: (Based on the dataset of 13 concatenated protein sequences, the authors reconstructed the phylogeny of Lepidoptera using MEGA with the Maximum Likelihood method. It is more persuasive and popular to carry out such analysis with RAxML method.)

Response: We are very sorry that we didn’t reconstruct the phylogeny of Lepidoptera using the RAxML method as you suggested. Because we think the RAxML method is an alternative solution in phylogeny, we found that using MEGA method to analyze the phylogeny of Lepidoptera is also popular. For example, in the study of Cerura menciana (Dai et. al., 2015), Biston marginata (Zheng et al., 2018) and Ctenoptilum vasava (Hao et. al., 2012) in Lepidoptera, they used MEGA to reconstruct the evolutionary relationship of Lepidoptera with the Maximum Likelihood method, and also got a better evolutionary relationship tree. In this study, based on the analysis of the original evolutionary relationship, we added another 25 species of Pyralidae and finally got a better evolutionary relationship of Lepidoptera. So we think that the MEGA method can also be used to construct the evolutionary tree based on Lepidoptera mitochondria.

4. Response to comment: (There are some errors in grammar and syntax throughout the text of the manuscript, the English writing should be further improved.)

Response: We are very sorry for our incorrect in grammar and syntax, and we have already corrected them in the text and marked in color.

We tried our best to improve the manuscript and made some changes in the manuscript. These changes will not influence the content and framework of the paper. And here we did not list the changes but marked in revised manuscript. We appreciate for Editors/Reviewers’ warm work earnestly, and hope that the corrections will meet with approval. Once again, thank you very much for your comments and suggestions.

Yours Sincerely

Guoqing Wei

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file. (24.2KB, docx)

Decision Letter 1

Jeffrey M Marcus

16 Dec 2019

PONE-D-19-24590R1

Characterization of the complete mitochondrial genome of Orthaga olivacea Warre (Lepidoptera Pyralidae) and comparison with other Lepidopteran insects

PLOS ONE

Dear Dr Wei,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We would appreciate receiving your revised manuscript by Jan 30 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Jeffrey M. Marcus

Academic Editor

PLOS ONE

Additional Editor Comments (if provided):

Greetings. After receiving the first round of reviewer comments responding to your initial submission, PLOS ONE has asked me to change my role from Reviewer (I was Reviewer #1) to Guest Academic Editor to guide you through the remainder of the peer review process.

I have read your revision and overall, I am very pleased with how you have responded to the reviewer comments. However, there are a few remaining items that you will need to address before your manuscript can be considered acceptable for publication in PLOS ONE. They are listed below. Please make theses additional necessary changes and resubmit your work for final consideration by the journal.

1. Line 62. Delete entire sentence beginning with "What'more considering the limited..." It is unnecessary.

2. Table 2 includes a column of references. These table citations are not in the same format as the in-text citations in the rest of the manuscript and some of these references do not appear in the reference section at the end of the manuscript. Please correct the formatting, and ensure that all of the references listed in Table 2 also appear in the reference section.

3. The reference for the Meroptera pravella mitochondrial genome in Table 2 is listed as "Consortium et al. (2017)". This is properly referenced as "Living Prairie Consortium (2017)".

4. Fig. 7. The vertical line associated with the label "Pyraloidea" should extend from Glyphodes quadrimaculalis to Ephestia kuehniella in this figure.

[Note: HTML markup is below. Please do not edit.]

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 Mar 6;15(3):e0227831. doi: 10.1371/journal.pone.0227831.r004

Author response to Decision Letter 1

27 Dec 2019

Dear Editor:

Thank you very much for your letter and the comments concerning our manuscript entitled “Characterization of the complete mitochondrial genome of Orthaga olivacea Warre (Lepidoptera Pyralidae) and comparison with other Lepidopteran insects” (ID: PONE-D-19-24590). Those comments are all valuable and very helpful for revising our paper to meet the acceptable criterion for publication in PLOS ONE. We have studied comments carefully and have made corrections which we hope to meet with approval. Revised portions are marked in color in the manuscript. The main corrections in the paper and the responds to the comments are as flowing:

Responds to the reviewer’s comments:

1. Response to comment: (Line 62. Delete entire sentence beginning with "What'more considering the limited..." It is unnecessary.)

Response: According to the reviewer’s suggestion, we have deleted it in the target location.

2. Response to comment: (Table 2 includes a column of references. These table citations are not in the same format as the in-text citations in the rest of the manuscript and some of these references do not appear in the reference section at the end of the manuscript. Please correct the formatting, and ensure that all of the references listed in Table 2 also appear in the reference section.)

Response: We are very sorry for our negligence of the citations format and omission of some references in Table 2, and we have corrected the formatting in Table 2 and increased the omissive references in the reference section.

3. Response to comment: (The reference for the Meroptera pravella mitochondrial genome in Table 2 is listed as "Consortium et al. (2017)". This is properly referenced as "Living Prairie Consortium (2017)".)

Response: Considering the second suggestion, we have modified the reference formats in table 2.

4. Response to comment: (Fig. 7. The vertical line associated with the label "Pyraloidea" should extend from Glyphodes quadrimaculalis to Ephestia kuehniella in this figure.)

Response: According the suggestion, we modified the vertical line associated with the label "Pyraloidea" and make sure it is extended from Glyphodes quadrimaculalis to Ephestia kuehniella in fig. 7.

We tried our best to improve the manuscript and made some changes in the manuscript. These changes will not influence the content and framework of the paper. And here we did not list the changes but marked in revised manuscript. We appreciate for Editors/Reviewers’ warm work earnestly, and hope that the corrections will meet with approval. Once again, thank you very much for your comments and suggestions.

Yours Sincerely

Guoqing Wei

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file. (15.7KB, docx)

Decision Letter 2

Jeffrey M Marcus

31 Dec 2019

Characterization of the complete mitochondrial genome of Orthaga olivacea Warre (Lepidoptera Pyralidae) and comparison with other Lepidopteran insects

PONE-D-19-24590R2

Dear Dr. Wei,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Jeffrey M. Marcus

Guest Editor

PLOS ONE

Additional Editor Comments (optional):

Thank you for responding to my recommendations for revision. I am now prepared to recommend acceptance of this manuscript at PLOS ONE.

Reviewers' comments:

Acceptance letter

Jeffrey M Marcus

24 Feb 2020

PONE-D-19-24590R2

Characterization of the complete mitochondrial genome of Orthaga olivacea Warre (Lepidoptera Pyralidae) and comparison with other Lepidopteran insects

Dear Dr. Wei:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Jeffrey M. Marcus

Guest Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Attachment

    Submitted filename: Response to Reviewers.docx

    Click here for additional data file. (24.2KB, docx)
    Attachment

    Submitted filename: Response to Reviewers.docx

    Click here for additional data file. (15.7KB, docx)

    Data Availability Statement

    All sequences date files are available from the GenBank at NCBI database (accession number mitochondrion MN078362).

    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES