Skip to main content
NCBI home page
American Journal of Translational Research logoLink to American Journal of Translational Research
. 2020 Mar 15;12(3):989–998.

Huangqi-Danshen decoction alleviates diabetic nephropathy in db/db mice by inhibiting PINK1/Parkin-mediated mitophagy

Xinhui Liu 1,*, Jiandong Lu 1,*, Siqi Liu 1, Dakun Huang 2, Mianxiong Chen 2, Guoliang Xiong 1, Shunmin Li 1
PMCID: PMC7137035  PMID: 32269729

Abstract

Huangqi-Danshen decoction (HDD) is composed of Astragali Radix (Huang-qi) and Salviae Miltiorrhizae Radix et Rhizoma (Dan-shen), both of which are the most commonly used herbs for the clinical treatment of diabetic nephropathy (DN) in traditional Chinese medicine and show good efficacy. However, the underlying mechanism of this effect is unclear. The aim of this study was to evaluate the effect and potential mechanism of HDD in the treatment of DN in a type 2 diabetic animal model, db/db mice. HDD extract was administered orally to db/db mice at a dose of 6.8 g/kg/day for 12 weeks. At the end of the study, serum, urine, and kidney samples were collected for biochemical and pathological examination. The expression of proteins associated with mitochondrial fission and mitophagy was determined by quantitative real-time PCR, Western blotting, and immunohistochemical analysis. The results showed that treatment with HDD substantially reduced urinary albumin excretion and improved renal injury in db/db mice. Moreover, mitochondrial fission was increased in the kidneys of the db/db mice, as evidenced by enhanced expression of dynamin-related protein 1 and mitochondrial morphological changes. Furthermore, PTEN-induced putative kinase 1 (PINK1)/Parkin-mediated mitophagy was activated in the db/db mice, which manifested as increased protein expression and obvious autophagic vacuole encapsulating mitochondria. HDD treatment significantly reversed the enhanced mitochondrial fission and PINK1/Parkin-mediated mitophagy in the db/db mice. In conclusion, this work suggested that HDD could protect against type 2 diabetes-induced kidney injury possibly by inhibiting PINK1/Parkin-mediated mitophagy.

Keywords: DIabetic nephropathy, traditional Chinese medicine, Huangqi-Danshen decoction, PINK1/Parkin, mitophagy, db/db mice

Introduction

Diabetic nephropathy (DN) is one of the most severe chronic microvascular complications of diabetes mellitus (DM) [1]. The results from the Global Burden of Disease 2017 Study showed that the age-standardized prevalence of DN in men and women was 15.48/1000 and 16.50/1000, respectively [2]. DN affects approximately 40% of people with diabetes and is the leading cause of chronic kidney disease (CKD) worldwide [3]. The current standard of treatment for DN involves early detection, glycaemic control and stringent blood pressure management with preferential use of renin-angiotensin system blockade [4,5]. In China and other Asian countries, traditional Chinese medicine (TCM) has been widely used to treat diabetes and its complications for a long time [6,7]. Huangqi-Danshen decoction (HDD) is composed of Astragali Radix (Huang-qi) and Salviae Miltiorrhizae Radix et Rhizoma (Dan-shen), both of which are the most commonly used herbs for the clinical treatment of DN [8]. Our previous studies have reported that HDD could retard the progression of CKD in rats [9,10]. However, the efficacy and potential mechanisms of HDD in DN remain unknown.

The kidney is the organ with the second highest mitochondrial content and oxygen consumption after the heart [11]. Accumulating evidence indicates that mitochondrial dysfunction contributes to the development and progression of DN [12,13]. Mitochondrial function depends on their quality control mechanism, and an essential characteristic of this quality control is the selective elimination of dysfunctional mitochondria by mitophagy [14,15]. In mammalian cells, the main orchestrators of mitophagy are (PTEN)-induced putative kinase 1 (PINK1) and the ubiquitin ligase Parkin [16,17]. A growing body of evidence has indicated that altered mitophagy may be important in the development and progression of DN [18-21]. In the present study, we investigated the role of HDD in delaying DN and explored the potential mechanism related to PINK1/Parkin-mediated mitophagy in a db/db mouse model of type 2 diabetes.

Materials and methods

Preparation of HDD extract

HDD consists of Astragali Radix [roots of Astragalus membranaceus (Fisch). Bge. var. mongholicus (Bge). Hsiao] and Salviae Miltiorrhizae Radix et Rhizoma (roots and rhizomes of Salvia miltiorrhiza Bge) at a ratio of 2:1 (W/W) based on the dry weight of the product. Astragali Radix and Salviae Miltiorrhizae Radix et Rhizoma were weighed and boiled twice in 8x ddH2O (w/v) for 1 h per time. The extraction liquid was centrifuged, and the supernatant was dried by a freeze dryer and stored at -80°C. Before the treatment, the powder was redissolved with Milli-Q water and vortexed at room temperature to obtain the HDD extract. The quality control of the HDD extract was conducted via high-performance liquid chromatography-mass spectrometry (HPLC-MS) analysis as previously described [9,10].

Animals

All animal experiments were conducted with protocols approved by the Ethics Committee of Shenzhen Traditional Chinese Medicine Hospital, Guangzhou University of Chinese Medicine, and all efforts were made to minimize animal suffering. Male diabetic db/db mice and nondiabetic littermate control db/m mice at the age of 8 weeks were obtained from the Nanjing Biomedical Research Institute of Nanjing University (Nanjing, China). After one week of acclimatization, 12 db/db mice were randomly divided into two groups: the model group (db/db, n = 6) and the HDD treatment group (db/db+HDD, n = 6). Six db/m mice served as a control group (db/m, n = 6). The db/db+HDD group was administered HDD extract (6.8 g/kg/day) by gastric irrigation for 12 weeks. All mice had free access to food and water during the experiments. At the end of the study, urine samples were collected in metabolic cages, all mice were anesthetized, and blood samples were obtained by eye enucleation. The mice were euthanized by cervical dislocation without regaining consciousness. The kidneys were rapidly harvested, weighed, and processed for histological examination, PCR, Western blotting, and immunohistochemical analysis.

Biochemical analysis

Blood glucose levels were determined by using GlucoDrTM Plus (Allmedicus, Anyang, Gyeonggi-Do, Korea). Serum creatinine (Scr) and blood urea nitrogen (BUN) were measured by a creatinine serum detection kit and a BUN detection kit (StressMarq Biosciences, British Columbia, Canada), respectively, following the manufacturer’s instructions. Urine creatinine was measured by a QuantiChromTM Creatinine Assay Kit (BioAssay Systems, Hayward, CA, USA). The urinary albumin concentrations were measured using a mouse albumin ELISA Kit (Bethyl Laboratories, Montgomery, TX, USA). Urinary albumin to creatinine ratio (ACR) was calculated by dividing urinary albumin by urine creatinine.

Histological analysis

Periodic-acid-Schiff (PAS) staining was performed to detect the structures of the paraffin-embedded kidney sections. One hundred and twenty glomeruli from six mice in each group were measured for glomerular tuft area using Nikon NIS-Elements BR software version 4.10.00 (Nikon, Japan) in a blinded manner.

Transmission electron microscopy (TEM)

Kidney cortexes were fixed in cold 2.5% glutaraldehyde, treated with osmium tetroxide and stained with uranyl acetate. After being dehydrated in gradient acetone, the kidney tissues were embedded in epoxy resin. Ultrathin sections were cut (EM UC7, Leica, Wetzlar, Germany) and visualized by using a transmission electron microscopy (HT7700, Hitachi, Tokyo, Japan).

Quantitative real-time PCR

Total RNA was extracted from the renal cortex using Trizol reagent (Invitrogen, Carlsbad, CA, USA). Equal amount of total RNA (1 μg) was reverse-transcribed into cDNA using a PrimeScript RT Reagent Kit (Perfect Real Time, Takara, Japan) according to the manufacturer’s instructions. The primer sequences used in this study were shown in Table 1. Quantitative real-time PCR was performed in triplicates on an Applied Biosystem 7500 quantitative PCR system (Applied Biosystems, Foster City, CA, USA). The Ct values obtained from different samples were compared using the 2-ΔΔCt method. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as an internal reference gene.

Table 1.

Primer sequences for quantitative real-time PCR

Gene Forward primer (5’ to 3’) Reverse primer (5’ to 3’)
Drp-1 (Mouse) ACCGGGAATGACCAAAGTACC TGGGATTACTGATGAACCGAAGA
PINK1 (Mouse) CACACTGTTCCTCGTTATGAAGA CTTGAGATCCCGATGGGCAAT
Parkin (Mouse) TCTTCCAGTGTAACCACCGTC GGCAGGGAGTAGCCAAGTT
GAPDH (Mouse) GGTTGTCTCCTGCGACTTCA TGGTCCAGGGTTTCTTACTCC
Open in a new tab

Western blotting

Proteins were extracted from kidneys using RIPA buffer (Cell Signaling Technology, Beverly, MA, USA) containing a protease inhibitor cocktail. The protein concentration was measured by the Bradford method. Equal amounts of protein lysates were loaded on and electrophoresed through 10% SDS-PAGE gels and were then transferred to nitrocellulose membranes (Millipore, Billerica, MA, USA). The membranes were blocked in 5% nonfat milk for 1 h at room temperature and then incubated with primary antibodies against dynamin-related protein 1 (Drp-1, 1:1000) (Cell Signaling Technology, Beverly, MA, USA), PINK1 (1:500) (Gene Tex, San Antonio, TX, USA), Parkin (1:200) (Santa Cruz Biotechnology, Santa Cruz, CA, USA), GAPDH (1:5000) (Proteintech, Wuhan, China), and β-actin (1:5000) (Sigma-Aldrich, St Louis, MO, USA) at 4°C overnight, followed by incubation with horseradish peroxidase (HRP)-conjugated secondary antibodies (1:2000) (Life Technologies, Carlsbad, CA, USA). The blots were visualized using Immobilon Western Chemiluminescent HRP Substrate (Millipore, Billerica, MA, USA) and a ChemiDoc MP Imaging System (Bio-Rad Laboratories, Hercules, CA, USA). Densitometric analysis was performed by using Image Lab software version 5.1 (BioRad Laboratories, Hercules, CA, USA).

Immunohistochemistry

Immunohistochemistry was performed on the formalin-fixed paraffin sections using sodium citrate (pH 6.0) for antigen retrieval. The slides were immersed in 3% hydrogen peroxide for 10 min to block endogenous peroxidase activity and then blocked with 10% goat serum for 1 h at 37°C. Primary antibodies against Drp-1 (1:100), PINK1 (1:100), and Parkin (1:50) were added, followed by treatment with SignalStain Boost Detection Reagent (Cell Signaling Technology). The sections were developed with SignalStain diaminobenzidine (DAB) substrate (Cell Signaling Technology) to produce a brown product. The integrated optical density (IOD) values of the positive staining for Drp-1, PINK1, and Parkin were measured by using ImagePro Plus 6.0 software (Media Cybernetics, Rockville, MD, USA). Five microscopic fields (200×) of each mouse and three mice in each group were used for quantification in a blinded manner.

Statistical analysis

The data are expressed as the mean ± standard error of the mean (SEM) or a box-and-whisker diagram. The significance of the differences among groups was examined by one-way ANOVA followed by post hoc analysis with Tukey’s test. SPSS 16.0 software (SPSS Inc., Chicago, IL, USA) was used for statistical analyses. A value of P < 0.05 was considered statistically significant.

Results

Effect of HDD on the physiological parameters of the db/db mice

Compared with the db/m mice, the db/db mice exhibited higher blood glucose, higher urinary ACR, a higher body weight and kidney weight, a lower kidney weight to body weight ratio, and a higher Scr level (Figure 1A-F). Strikingly, the high blood glucose and enhanced urinary ACR levels were significantly reversed after HDD treatment (Figure 1A, 1B). A slight reduction in the body weight, kidney weight, kidney weight to body weight ratio, and Scr levels was observed in the db/db mice treated with HDD (Figure 1C-F). No significant difference in the BUN levels was observed among the three groups (Figure 1G).

Figure 1.

Figure 1

Open in a new tab

Effect of HDD on the physiological parameters of the db/db mice. A. Blood glucose levels of each group at week 4, week 8, and week 12. B. Urinary albumin to creatinine ratio (ACR) level increased in the db/db mice and was reversed after HDD treatment. C. Body weight of each group at week 4, week 8, and week 12. D. Kidney weight was higher in the db/db mice at the end of the study. E. Kidney weight to body weight ratio was lower in the db/db mice at the end of the study. F. Serum creatinine (Scr) level was higher in the db/db mice at the end of the study. G. Blood urea nitrogen (BUN) levels were not significantly different among the three groups at the end of the study. n = 6 mice per group (***P < 0.001 compared with the db/m group; #P < 0.05, ##P < 0.01, ###P < 0.001 compared with the db/db group).

HDD ameliorated renal injury in the db/db mice

In PAS staining, the kidneys from the db/db mice demonstrated obvious features of DN, including glomerular hypertrophy and increases in mesangial cells and mesangial matrix. These histological lesions were significantly attenuated in the mice treated with HDD (Figure 2). Furthermore, transmission electron microscopy revealed extensive fusion of the podocyte foot processes in the db/db mice, which was obviously improved after HDD treatment (Figure 3). These results indicated that HDD ameliorated renal injury in the db/db mice.

Figure 2.

Figure 2

Open in a new tab

HDD ameliorated renal injury in the db/db mice. A. Representative images of periodic acid-Schiff staining (×200 and ×400) of the kidneys from the three indicated groups. B. Quantitative analysis of glomerular tuft area (n = 6). ***P < 0.001 compared with the db/m group; ###P < 0.001 compared with the db/db group.

Figure 3.

Figure 3

Open in a new tab

HDD attenuated podocyte foot process fusion in the db/db mice. Red triangle indicates fusion of podocyte foot processes in the db/db mice, which was obviously improved after HDD treatment.

HDD suppressed mitochondrial fission in the kidneys of the db/db mice

For mitophagy to occur, mitochondria must undergo fission to fragment into spheroids that can be encapsulated within autophagic vesicles [22]. Therefore, mitochondrial fission was investigated in the present experimental setting. PCR and Western blot results showed that the expression of Drp-1, a master regulator of mitochondrial fission, was significantly upregulated in the kidneys of the db/db mice and was markedly reduced after HDD treatment (Figure 4A-C). By immunohistochemistry, we confirmed that the enhanced protein level of Drp-1 was decreased in the db/db+HDD group (Figure 4D and 4E). Moreover, transmission electron microscopy showed that mitochondria fragmented into small, punctuated suborganelles in the db/db mice, and this effect was partially reversed in the db/db+HDD group (Figure 4F). These findings indicated that HDD suppressed mitochondrial fission in the db/db mice.

Figure 4.

Figure 4

Open in a new tab

HDD suppressed mitochondrial fission in the kidneys of the db/db mice. A. HDD decreased Drp-1 mRNA abundance in the db/db mice. B. Representative Western blot image of Drp-1 protein expression. C. Densitometric analysis of Drp-1 protein expression normalized to β-actin content (n = 6). D. Representative immunohistochemistry images of Drp-1. All images are shown at identical magnification, ×200, scale bar = 100 μm. E. Quantitative analysis of Drp-1 positive staining (n = 3). F. Representative transmission electron microscopy images of mitochondria in the kidneys from the three indicated groups. ***P < 0.001 compared with the db/m group; #P < 0.05, ##P < 0.01, compared with the db/db group.

HDD inhibited PINK1/Parkin-mediated mitophagy in the kidneys of the db/db mice

By PCR and Western blot analysis, the mRNA and protein expression of PINK1 and Parkin were significantly upregulated in the db/db mice, and were reduced after HDD treatment (Figure 5A-E). Immunohistochemistry analysis further confirmed that administration of HDD inhibited the enhanced expression of PINK1 and Parkin in the db/db mice (Figure 5F-H). Moreover, transmission electron microscopy showed obvious autophagic vacuole encapsulating mitochondria in the db/db group but not in the db/db+HDD group (Figure 5I). These data indicated that HDD inhibited PINK1/Parkin-mediated mitophagy in the db/db mice.

Figure 5.

Figure 5

Open in a new tab

HDD inhibited PINK1/Parkin-mediated mitophagy in the kidneys of the db/db mice. A. HDD decreased PINK1 mRNA abundance in the db/db mice. B. HDD decreased Parkin mRNA abundance in the db/db mice. C. Representative Western blot images of PINK1 and Parkin protein expression. D, E. Densitometric analysis of PINK1 and Parkin protein expression normalized to GAPDH content, respectively (n = 6). F. Representative immunohistochemistry images of PINK1 and Parkin. All images are shown at identical magnification, ×200, scale bar = 100 μm. G, H. Quantitative analysis of PINK1 and Parkin positive staining, respectively (n = 3). I. Representative transmission electron microscopy images of mitophagy in the kidneys from the three indicated groups. Red arrow indicates autophagic vacuole that encapsulates mitochondria. “M” indicates mitochondrion. **P < 0.01, ***P < 0.001 compared with the db/m group; #P < 0.05, ##P < 0.01, ###P < 0.001 compared with the db/db group.

Discussion

The db/db mouse model of type 2 diabetes is considered to be a suitable experimental model for studying the development and progression of DN since it exhibits typical characteristics similar to those of human DN [23,24]. In the present study, treatment with HDD decreased the urinary excretion of albumin and improved renal injury in the db/db mice. PINK1/Parkin-mediated mitophagy was activated in the kidneys of the db/db mice and was downregulated in response to HDD treatment.

Increasing evidence indicates that mitochondrial dysfunction contributes to the development and progression of DN [12,13]. Mitochondria have high plasticity and constantly undergo fission and fusion, biogenesis, and mitophagy. Timely removal of damaged mitochondria via mitophagy is critical for mitochondrial quality control and thus for cellular homeostasis and function [25]. However, similar to autophagy, mitophagy may also be a double-edged sword, indicating that overactivation of mitophagy may be harmful to cells [26,27]. The state of mitophagy in DN reported in previous studies is not consistent. Smith et al. reported that PINK1 protein was increased in the renal cortex in a rat model of STZ-induced diabetes [28]. Our previous study also found that PINK1/Parkin mediated mitophagy was activated in a db/db mouse model [19]. In contrast, defective mitophagy has also been reported to be present in DN in studies that used STZ-induced diabetic mice or db/db mice [29,30]. The possible explanation for these conflicting results includes animal model selection, the experimental cycle, and blood glucose levels. Therefore, how mitophagy is changed in DN and whether this change is beneficial or detrimental to kidney function should be further investigated [31].

Over two thousand years ago, diabetes-related symptoms were called “Xiaoke” disease in traditional Chinese medicine (TCM). Since then, many TCM therapeutic strategies, including Chinese herbal medicine (CHM), acupuncture, moxibustion, and massage for treating diabetes and its complications have been recorded, and abundant experience has been accumulated [6]. CHM is the main form of TCM treatment for DN, and decoction is a common form of CHM [8]. A systematic review and meta-analysis reported that CHM could reduce the albuminuria levels in patients with DN [32]. In a population-based cohort study, Chen et al. reported that CHM use was associated with decreased end-stage renal disease and mortality rates among patients with DN [33]. According to the TCM theory, deficiency of Qi with blood stasis (Qi-Xu-Xue-Yu) is the common syndrome pattern of DN. Therefore, tonifying Qi and promoting circulation (Yi-Qi-Huo-Xue) is one of the basic therapeutic principles of TCM in the treatment of DN [8]. Huangqi-Danshen decoction (HDD) is composed of Astragali Radix (Huang-qi), which serves to tonify Qi, and Salviae Miltiorrhizae Radix et Rhizoma (Dan-shen), which serves to promote circulation [9]. Huang-qi and Dan-shen are the most and the third most commonly used drugs, respectively, in herbal formulations for DN in clinical trials [8]. Huang-qi has been reported to protect the kidney by inhibiting oxidative stress [34] and rebalancing TGF-β/Smad signaling [35] in a diabetic model. In addition to attenuating oxidative stress [36] and inflammation [37], Dan-shen was recently shown to protect against DN through metabolome regulation and inhibition of Wnt/β-catenin and TGF-β signaling [38]. In the present study, we revealed the regulatory effect of HDD on PINK1/Parkin-mediated mitophagy in a db/db mouse model of type 2 diabetes. However, how HDD regulates mitophagy and how mitophagy contributes to DN require further investigation.

In conclusion, HDD significantly alleviated DN in db/db mice, which might be associated with the inhibition of PINK1/Parkin-mediated mitophagy.

Acknowledgements

This study was supported by Natural Science Foundation of China (81603437 and 81973602) and Shenzhen Science and Technology Project (JCYJ20170307154652899 and JCYJ20180507183842516).

Disclosure of conflict of interest

None.

References

  • 1.Gnudi L, Coward RJM, Long DA. Diabetic nephropathy: perspective on novel molecular mechanisms. Trends Endocrinol Metab. 2016;27:820–830. doi: 10.1016/j.tem.2016.07.002. [DOI] [PubMed] [Google Scholar]
  • 2.GBD 2017 Disease and Injury Incidence and Prevalence Collaborators. Global, regional, and national incidence, prevalence, and years lived with disability for 354 diseases and injuries for 195 countries and territories, 1990-2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet. 2018;392:1789–1858. doi: 10.1016/S0140-6736(18)32279-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Alicic RZ, Rooney MT, Tuttle KR. Diabetic kidney disease: challenges, progress, and possibilities. Clin J Am Soc Nephrol. 2017;12:2032–2045. doi: 10.2215/CJN.11491116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Tang SC, Chan GC, Lai KN. Recent advances in managing and understanding diabetic nephropathy. F1000Res. 2016;5:1044. doi: 10.12688/f1000research.7693.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Gallagher H, Suckling RJ. Diabetic nephropathy: where are we on the journey from pathophysiology to treatment? Diabetes Obes Metab. 2016;18:641–647. doi: 10.1111/dom.12630. [DOI] [PubMed] [Google Scholar]
  • 6.Tong XL, Dong L, Chen L, Zhen Z. Treatment of diabetes using traditional Chinese medicine: past, present and future. Am J Chin Med. 2012;40:877–886. doi: 10.1142/S0192415X12500656. [DOI] [PubMed] [Google Scholar]
  • 7.Sun GD, Li CY, Cui WP, Guo QY, Dong CQ, Zou HB, Liu SJ, Dong WP, Miao LN. Review of herbal traditional chinese medicine for the treatment of diabetic nephropathy. J Diabetes Res. 2016;2016:5749857. doi: 10.1155/2016/5749857. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Wen Y, Yan M, Zhang B, Li P. Chinese medicine for diabetic kidney disease in China. Nephrology (Carlton) 2017;22(Suppl 4):50–55. doi: 10.1111/nep.13149. [DOI] [PubMed] [Google Scholar]
  • 9.Liu X, Huang S, Wang F, Zheng L, Lu J, Chen J, Li S. Huangqi-Danshen decoction ameliorates adenine-induced chronic kidney disease by modulating mitochondrial dynamics. Evid Based Complement Alternat Med. 2019;2019:9574045. doi: 10.1155/2019/9574045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Liu X, Zhang B, Huang S, Wang F, Zheng L, Lu J, Zeng Y, Chen J, Li S. Metabolomics analysis reveals the protection mechanism of Huangqi-Danshen decoction on adenine-induced chronic kidney disease in rats. Front Pharmacol. 2019;10:992. doi: 10.3389/fphar.2019.00992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Bhargava P, Schnellmann RG. Mitochondrial energetics in the kidney. Nat Rev Nephrol. 2017;13:629–646. doi: 10.1038/nrneph.2017.107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Forbes JM, Thorburn DR. Mitochondrial dysfunction in diabetic kidney disease. Nat Rev Nephrol. 2018;14:291–312. doi: 10.1038/nrneph.2018.9. [DOI] [PubMed] [Google Scholar]
  • 13.Wei PZ, Szeto CC. Mitochondrial dysfunction in diabetic kidney disease. Clin Chim Acta. 2019;496:108–116. doi: 10.1016/j.cca.2019.07.005. [DOI] [PubMed] [Google Scholar]
  • 14.Hamacher-Brady A, Brady NR. Mitophagy programs: mechanisms and physiological implications of mitochondrial targeting by autophagy. Cell Mol Life Sci. 2016;73:775–795. doi: 10.1007/s00018-015-2087-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Rovira-Llopis S, Banuls C, Diaz-Morales N, Hernandez-Mijares A, Rocha M, Victor VM. Mitochondrial dynamics in type 2 diabetes: pathophysiological implications. Redox Biol. 2017;11:637–645. doi: 10.1016/j.redox.2017.01.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Springer W, Kahle PJ. Regulation of PINK1-Parkin-mediated mitophagy. Autophagy. 2011;7:266–278. doi: 10.4161/auto.7.3.14348. [DOI] [PubMed] [Google Scholar]
  • 17.Eiyama A, Okamoto K. PINK1/Parkin-mediated mitophagy in mammalian cells. Curr Opin Cell Biol. 2015;33:95–101. doi: 10.1016/j.ceb.2015.01.002. [DOI] [PubMed] [Google Scholar]
  • 18.Chen K, Dai H, Yuan J, Chen J, Lin L, Zhang W, Wang L, Zhang J, Li K, He Y. Optineurin-mediated mitophagy protects renal tubular epithelial cells against accelerated senescence in diabetic nephropathy. Cell Death Dis. 2018;9:105. doi: 10.1038/s41419-017-0127-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Liu X, Wang W, Song G, Wei X, Zeng Y, Han P, Wang D, Shao M, Wu J, Sun H, Xiong G, Li S. Astragaloside IV ameliorates diabetic nephropathy by modulating the mitochondrial quality control network. PLoS One. 2017;12:e0182558. doi: 10.1371/journal.pone.0182558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Sun J, Zhu H, Wang X, Gao Q, Li Z, Huang H. CoQ10 ameliorates mitochondrial dysfunction in diabetic nephropathy through mitophagy. J Endocrinol. 2019;240:445–465. doi: 10.1530/JOE-18-0578. [DOI] [PubMed] [Google Scholar]
  • 21.Zhou D, Zhou M, Wang Z, Fu Y, Jia M, Wang X, Liu M, Zhang Y, Sun Y, Lu Y, Tang W, Yi F. PGRN acts as a novel regulator of mitochondrial homeostasis by facilitating mitophagy and mitochondrial biogenesis to prevent podocyte injury in diabetic nephropathy. Cell Death Dis. 2019;10:524. doi: 10.1038/s41419-019-1754-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Twig G, Elorza A, Molina AJ, Mohamed H, Wikstrom JD, Walzer G, Stiles L, Haigh SE, Katz S, Las G, Alroy J, Wu M, Py BF, Yuan J, Deeney JT, Corkey BE, Shirihai OS. Fission and selective fusion govern mitochondrial segregation and elimination by autophagy. EMBO J. 2008;27:433–446. doi: 10.1038/sj.emboj.7601963. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Cohen MP, Clements RS, Hud E, Cohen JA, Ziyadeh FN. Evolution of renal function abnormalities in the db/db mouse that parallels the development of human diabetic nephropathy. Exp Nephrol. 1996;4:166–171. [PubMed] [Google Scholar]
  • 24.Sharma K, McCue P, Dunn SR. Diabetic kidney disease in the db/db mouse. Am J Physiol Renal Physiol. 2003;284:F1138–1144. doi: 10.1152/ajprenal.00315.2002. [DOI] [PubMed] [Google Scholar]
  • 25.Ni HM, Williams JA, Ding WX. Mitochondrial dynamics and mitochondrial quality control. Redox Biol. 2015;4:6–13. doi: 10.1016/j.redox.2014.11.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Shintani T, Klionsky DJ. Autophagy in health and disease: a double-edged sword. Science. 2004;306:990–995. doi: 10.1126/science.1099993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Higgins GC, Devenish RJ, Beart PM, Nagley P. Autophagic activity in cortical neurons under acute oxidative stress directly contributes to cell death. Cell Mol Life Sci. 2011;68:3725–3740. doi: 10.1007/s00018-011-0667-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Smith MA, Covington MD, Schnellmann RG. Loss of calpain 10 causes mitochondrial dysfunction during chronic hyperglycemia. Arch Biochem Biophys. 2012;523:161–168. doi: 10.1016/j.abb.2012.04.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Sheng J, Li H, Dai Q, Lu C, Xu M, Zhang J, Feng J. NR4A1 promotes diabetic nephropathy by activating Mff-mediated mitochondrial fission and suppressing Parkin-mediated mitophagy. Cell Physiol Biochem. 2018;48:1675–1693. doi: 10.1159/000492292. [DOI] [PubMed] [Google Scholar]
  • 30.Xiao L, Xu X, Zhang F, Wang M, Xu Y, Tang D, Wang J, Qin Y, Liu Y, Tang C, He L, Greka A, Zhou Z, Liu F, Dong Z, Sun L. The mitochondria-targeted antioxidant MitoQ ameliorated tubular injury mediated by mitophagy in diabetic kidney disease via Nrf2/PINK1. Redox Biol. 2017;11:297–311. doi: 10.1016/j.redox.2016.12.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Higgins GC, Coughlan MT. Mitochondrial dysfunction and mitophagy: the beginning and end to diabetic nephropathy? Br J Pharmacol. 2014;171:1917–1942. doi: 10.1111/bph.12503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Xiao Y, Liu Y, Yu K, Zhou L, Bi J, Cheng J, Li F, Luo R, Zhao X. The effect of Chinese herbal medicine on albuminuria levels in patients with diabetic nephropathy: a systematic review and meta-analysis. Evid Based Complement Alternat Med. 2013;2013:937549. doi: 10.1155/2013/937549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Chen HY, Pan HC, Chen YC, Chen YC, Lin YH, Yang SH, Chen JL, Wu HT. Traditional Chinese medicine use is associated with lower end-stage renal disease and mortality rates among patients with diabetic nephropathy: a population-based cohort study. BMC Complement Altern Med. 2019;19:81. doi: 10.1186/s12906-019-2491-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Gao Y, Zhang RR, Li JH, Ren M, Ren ZX, Shi JH, Pan QZ, Ren SP. Radix astragali lowers kidney oxidative stress in diabetic rats treated with insulin. Endocrine. 2012;42:592–598. doi: 10.1007/s12020-012-9670-7. [DOI] [PubMed] [Google Scholar]
  • 35.Nie Y, Li S, Yi Y, Su W, Chai X, Jia D, Wang Q. Effects of astragalus injection on the TGFβ/Smad pathway in the kidney in type 2 diabetic mice. BMC Complement Altern Med. 2014;14:148. doi: 10.1186/1472-6882-14-148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.An L, Zhou M, Marikar F, Hu XW, Miao QY, Li P, Chen J. Salvia miltiorrhiza lipophilic fraction attenuates oxidative stress in diabetic nephropathy through activation of nuclear factor erythroid 2-related factor 2. Am J Chin Med. 2017;45:1441–1457. doi: 10.1142/S0192415X17500781. [DOI] [PubMed] [Google Scholar]
  • 37.Xu L, Shen P, Bi Y, Chen J, Xiao Z, Zhang X, Wang Z. Danshen injection ameliorates STZ-induced diabetic nephropathy in association with suppression of oxidative stress, pro-inflammatory factors and fibrosis. Int Immunopharmacol. 2016;38:385–394. doi: 10.1016/j.intimp.2016.06.024. [DOI] [PubMed] [Google Scholar]
  • 38.Xiang X, Cai HD, Su SL, Dai XX, Zhu Y, Guo JM, Yan H, Guo S, Gu W, Qian DW, Tang ZS, Duan JA. Salvia miltiorrhiza protects against diabetic nephropathy through metabolome regulation and wnt/β-catenin and TGF-β signaling inhibition. Pharmacol Res. 2019;139:26–40. doi: 10.1016/j.phrs.2018.10.030. [DOI] [PubMed] [Google Scholar]

Articles from American Journal of Translational Research are provided here courtesy of e-Century Publishing Corporation

RESOURCES