Ruminal fermentation, microbial population and lipid metabolism in gastrointestinal nematode-infected lambs fed a diet supplemented with herbal mixtures

Paulina Szulc; Dominika Mravčáková; Malgorzata Szumacher-Strabel; Zora Váradyová; Marián Várady; Klaudia Čobanová; Linggawastu Syahrulawal; Amlan Kumar Patra; Adam Cieslak

doi:10.1371/journal.pone.0231516

. 2020 Apr 16;15(4):e0231516. doi: 10.1371/journal.pone.0231516

Ruminal fermentation, microbial population and lipid metabolism in gastrointestinal nematode-infected lambs fed a diet supplemented with herbal mixtures

Paulina Szulc ¹, Dominika Mravčáková ², Malgorzata Szumacher-Strabel ¹, Zora Váradyová ², Marián Várady ³, Klaudia Čobanová ², Linggawastu Syahrulawal ¹, Amlan Kumar Patra ⁴, Adam Cieslak ^1,^*

Editor: Simon Russell Clegg⁵

PMCID: PMC7161954 PMID: 32298315

Abstract

The aim of this study was to evaluate the effects of medicinal herbal mixtures rich in phenolic, flavonoid and alkaloid compounds on ruminal fermentation and microbial populations, and fatty acid (FA) concentrations and lipid oxidation in tissues of lambs infected with the gastrointestinal nematode (GIN) parasite (Haemonchus contortus). Parallel in vitro and in vivo studies were performed using two different herbal mixtures (Mix1 and Mix2). The in vitro study was conducted in a 2 (infection status; non-infected versus infected) × 3 (diets; control, Mix1 and Mix2) factorial design. In the in vivo study, 24 lambs were equally divided into four treatments: non-infected lambs fed a control diet, infected lambs fed the control diet, infected lambs fed a diet with Mix1 and infected lambs fed a diet with Mix2. Herbal mixtures (100 g dry matter (DM)/d) were added to the basal diets of meadow hay (ad libitum) and a commercial concentrate (500 g DM/d). The experimental period lasted for 70 days. Ruminal fermentation characteristics and methane production were not affected by infection in vivo or in vitro. Both herbal mixture supplementation increased total volatile fatty acid (VFA) concentrations (P < 0.01) and DM digestibility (P < 0.01) in vitro. Archaea population was slightly diminished by both herbal mixtures (P < 0.05), but they did not lower methane production in vitro or in vivo (P > 0.05). Infection of H. contortus or herbal mixtures modulated FA proportion mainly in the liver, especially the long chain FA proportion. Concentrations of thiobarbituric acid reactive substances (TBARS) in serum were significantly higher after 70 days post-infection in the infected lambs. Herbal Mix1 supplementation reduced TBARS concentrations in meat after seven days of storage. In conclusion, supplementing of herbal mixtures to the diets of GIN parasite infected lambs did not affect the basic ruminal fermentation parameters. Herbal mixtures may improve few FA proportions mainly in liver as well as decrease lipid oxidation in meat.

Introduction

Gastrointestinal parasitic infections is one of the major issues impacting the health of livestock animals, especially by the most pathogenic gastrointestinal nematode (GIN) parasite Haemonchus contortus. This GIN sucks abomasum blood and causes anemia, reduces reproductive capacity and animal production, resulting in considerable economic losses [1,2]. Since GIN reduces productivity, infected animals require more resource input to achieve the same level of productive output compared to the non-infected animals. Ovine periparturient parasitism increases greenhouse gas intensity; and therefore gastrointestinal parasite control could improve production efficiency and decrease environmental footprints in sheep production systems [3]. Chemoprophylaxis against H. contortus by application of anthelmintics repeatedly poses the risk of development of anthelmintic resistance and residues in food products [4]. Therefore, there is a growing interest in feeding of diets supplemented with plant secondary metabolites (PSM) to GIN infected animals for reducing the transmission of the parasites and the diseases associated with parasites [5,6]. The use of PSM has been beneficial to treat various digestive or parasitic disorders due to their nutraceutical and anthelmintic activities. Many studies favored natural sources of PSM such as Hypericum perforatum, Malva parviflora, Prunella vulgaris, Juniperus communis, Pinus ponderosa, Melissa officinalis and Nepeta caesarea as well as mixed medicinal herbs to reduce the burdens of GIN [7,8]. In the earlier studies, PSM that contains phytochemical substances such as flavonoids considers as important bioactive compound as antioxidant and antimicrobial properties in the rumen [9,10]. Another bioactive compound is polyphenol known as highly abundant groups of substances found in plants that can be classified based on a simple structure, for instance, phenolic acids and more complex such as tannins [11]. Polyphenols inhibit the populations and/or activity of microbes responsible for methanogenesis and biohydrogenation by among others changing the rumen environment (pH value) and through the toxic effect on methanogens, consequently lowering methane emission and biohydrogenation rate of UFA in the rumen [12,13,14]. The degree of ruminal fatty acid (FA) saturation affects FA composition in ruminant products such as meat and milk [15,16].

The lambs used in the present study were a part of a comprehensive experiment that investigated the effects of two dry mixtures of medicinal herbs on parasitological, inflammatory, antioxidant, and fecal microbiota composition in lambs experimentally infected with H. contortus [17]. In the present study, we hypothesized that the dietary dry medicinal herb mixtures may affect the ruminal methane production, FA concentrations in the liver, blood, subcutaneous fat and musculus longissimus dorsi muscle, lipid peroxidation and oxidative stability in meat due to their inhibitory effects on the ruminal methanogens and biohydrogenating microbial population and antioxidant properties. Infections with GIN in animals causes extra endogenous protein loss and increased energy metabolism, which subsequently may alter lipid metabolism and antioxidant status [18]. The influences of GIN on FA profile have not yet been studied in GIN-infected lambs. Therefore, our objective was to assess the supplementation of two medicinal herbal mixtures on ruminal fermentation characteristics, microbial population, methane production and lipid metabolism in GIN-infected lambs.

Material and methods

Animals used and experimental design were approved by the Ethics Committee of the Institute of Parasitology of the Slovak Academy of Sciences, in accordance with European Community guidelines (EU Directive 2010/63/EU for animal experiments). Permission to collect samples and carry out the experiment was granted by the participating sheep farmers. Twenty-four Valachian female lambs with an initial mean body weight of 11.7 ± 1.23 kg and 3–4 months of age lambs were obtained from the same farm. All animals were humanely killed at the end of the experiment (abattoir of the Centre of Biosciences of SAS, Institute of Animal Physiology, Košice, Slovakia, No. SK U 06018). The carcasses of animals were sent to the Department of Pathological Anatomy and Pathological Physiology, University of Veterinary Medicine and Pharmacy in Košice in Slovak Republic.

Diet and supplements

This study was a part of a larger study that investigated natural chemotherapeutic alternatives for controlling of haemonchosis in lambs and had been described in more detail previously [17]. Animals were fed a concentrate mixture (500 g dry matter (DM)/d), herbal mixtures (non-commercial mixtures—Mix1 and Mix2; 100 g DM/d) and meadow hay (ad libitum). The concentrate mixture was composed of 700 g/kg of barley, 220 g/kg of soybean meal, 48 g/kg of wheat bran, 5 g/kg of bicarbonate and 27 g/kg of mineral-vitamin premix.

Experimental design

In vitro experiment

The in vitro study was carried out using a batch culture system according to the modified protocol described previously [19]. Two herbal mixtures (Mix1 and Mix2) were used with 9 different herbs in each mixture. Dry herbs were obtained from commercial sources (AGROKARPATY, Plavnica, Slovak Republic and BYLINY Mikeš s.r.o., Číčenice, Czech Republic). Herbal composition of Mix1: stems of Artemisia absinthium L. (1%), Fumaria officinalis L. (13.4%), Hyssopus officinalis L. (13.4%), Melissa officinalis L. (13.4%) and Solidago virgaurea L. (13.4%); flowers of Matricaria chamomilla L. (13.4%) and Malva sylvestris L. (13.4%); leaves of Plantago lanceolata L. (13.4%) and seeds of Foeniculum vulgare Mill. (5%). The phytochemical substances of Mix1 contained 57.3 g/kg DM of phenolic acids and 41.5 g/kg DM of flavonoids with greater concentrations of myricetin 3-O-galactoside (20.2 g/kg DM), 1,5-dicaffeoylquinic acid (15.4 g/kg DM),3-O-caffeoylquinic acid (11.3 g/kg DM), and dihydrocaffeoyl-4-caffeoyl quinic acid (9.72 g/kg DM) [17]. Herbal composition of Mix2: stems of Artemisia absinthium L. (1%), Malva sylvestris L. (12.4%), Achillea milefolium L. (12.4%), Cichorium intybus L. (12.4%), Hypericum perforatum L. (12.4%) and Urtica dioica L. (12.4%); flowers of Matricaria chamomilla L. (12.4%), Fumaria officinalis L. (12.4%) and Calendula officinalis L. (12.4%). The phytochemical substances of Mix2 contained 22.2 g/kg DM of phenolic acids and 29.5 g/kg DM of flavonoids with high concentrations of 3-O-caffeoylquinic acid (6.91 g/kg DM), 1,5-Dicaffeoylquinic acid (6.18 g/kg DM), rutin (5.73 g/kg DM) and 2-O-feruloylhydroxycitric acid (3.64 g/kg DM).Protoberberine-type alkaloids were also present in Mix1 (1.4 g/kg DM) and Mix2 (1.33 g/kg DM) [17].

For the in vitro study, the ruminal content was collected from the top, bottom and middle of the rumen of each lamb separately. The fresh ruminal content was collected at a slaughter house from six control non-infected (CN) and six control infected (CI) lambs with two CN and two CI at each run. Infection status was identified at autopsy by observing the H. contortus worms after the opening of the abomasum. The in vitro study was completed in three runs and total 12 lambs were used. The same diet was used as a control in the in vivo trial. After slaughtering of lambs, rumen digesta was taken from different parts (top, bottom and middle) of the rumen. The experiment was conducted in a 2 infection status (non-infection and infection) × 3 diets (control, Mix1 and Mix2) factorial arrangement with following 6 treatments: Control diet with non-infection (CN), Mix1 diet with non-infection (Mix1N), and Mix2 diet with non-infection (Mix2N), Control diet with infection (CI), Mix1 diet with infection (Mix1I), and Mix2 diet with infection (Mix2I). Ruminal content was squeezed through a four-layer cheesecloth into two separate Schott Duran^® bottles (SCHOTT North America, Inc. Corporate Office, Elmsford, NY 10523, USA) and immediately transported to the laboratory in a 39 °C preheated water bath. Two bottles were used for collecting rumen fluid separately for CN and CI. Five replicate bottles in each treatment (6 treatments × 5 bottles) were used in three consecutive runs. The ruminal fluid was diluted with buffer solution at a ratio of 1:4, and buffered fluid was transferred to the bottles with prepared substrates anaerobically. The control groups (CN and CI) contained 400 mg of substrate (252 mg DM of hay and 148 mg DM of the commercial concentrate). For the herbal mixture, 36 mg DM (9% of 400 mg substrate) of Mix1 or Mix2 was further added to the 400 mg substrate. The bottles with buffered ruminal fluid and substrate were filled with CO₂, closed with rubber stoppers and sealed with aluminum cups. Then the bottles were incubated in an incubator (Galaxy 170R, Eppendorf North America Inc., Hauppauge, NY) for 24 h at a temperature of 39 °C in an anaerobic condition with periodical mixing of the contents.

In vivo experiment

Based on the in vitro results, the in vivo experiment was designed. Twenty-four Improved Valachian female lambs with an initial mean body weight of 11.7 ± 1.23 kg and 3–4 months of age were kept in stalls for 15 d for adaptation to the diet. During the whole experiment, lambs had free access to drinking tap water. After the adaptive period, the lambs were divided into four treatment groups (n = 6): non-infected control group (CN), GIN-infected group fed with the control diet (CI), infected group fed the control diet supplemented with Mix1 (M1I) or Mix2 (M2I). Lambs were infected orally with 5000 third-stage larvae of the MHco1 (strain of H. contortus), which is susceptible to all main classes of anthelmintics. Infection increased egg counts in the infected animals as shown previously [17]. Lambs were fed with a basal diet of meadow hay ad libitum and a commercial concentrate at 500 g DM/day in the control groups for the growth rate of 150 g/d (Table 1). Commercial concentrate was composed of 700 g/kg of barley, 220 g/kg of soybean meal, 48 g/kg of wheat bran, 5 g/kg of bicarbonate and 27 g/kg of mineral-vitamin premix. In the herbal mixture groups, Mix1 and Mix2 were additionally fed at 100 g dry matter (DM)/day to the M1I and M2I lambs, respectively. The experimental period was 70 days (during summer), and the animals were housed on a sheep farm.

Table 1. Chemical composition and fatty acid profile of the diets.

Item	Meadow hay	Concentrate	Mix1	Mix2
Main chemical composition, g/kg DM
CP	163	309	160	180
aNDF	825	140	500	460
ADF	500	90	360	350
Ash	39	29	110	110
Fatty acid proportion, g/100 g of FA
C12:0	1.06	0.11	0.12	0.41
C14:0	0.90	0.34	0.36	1.57
C16:0	18.6	14.0	12.5	25.0
C18:0	5.09	2.26	3.22	8.84
*C18:1 cis-9*	14.5	19.4	22.3	8.8
*C18:2 cis-9 cis-12*	36.3	55.6	26.9	25.3
*C18:3 cis-9 cis-12 cis-15 (ALA)*^a	9.50	2.46	11.9	9.28
C20:3n-6	1.95	0.23	1.04	0.78
C20:5n-3 (EPA)^b	0.19	0.05	0.19	0.09
C22:5n-3 (DPA)^c	0.35	0.06	0.22	0.42
C22:6n-3 (DHA)^d	1.21	0.20	0.30	0.42
Other FA^e	10.3	5.29	20.9	19.1
SFA^f	29.4	18.0	17.9	37.8
UFA^g	70.6	82.0	82.1	62.2
MUFA^h	20.7	22.9	41.1	26.0
PUFAⁱ	49.8	59.2	41.0	36.2
n-6	38.6	56.4	28.4	26.3
n-3	25.9	22.2	12.6	9.84

Open in a new tab

^a ALA, [α]-Linolenic acid.

^b EPA, Eicosapentaenoic acid.

^c DPA, Docosapentaenoic acid.

^d DHA, Docosahexaenoic acid.

^e Other FA, (C10:0, C14:1, C15:1, C16:1, C18:1 c11, C20:0, C22:1 n‐9, C22:0, C23:0, C24:1)

^f SFA, Saturated fatty acids.

^g UFA, Unsaturated fatty acids.

^h MUFA, Monounsaturated fatty acids.

ⁱ PUFA, Polyunsaturated fatty acids.

Sample analysis

Chemical composition of feed

Chemical composition of dietary ingredients was analyzed in triplicates by standard procedures [20]. The dry matter (DM) content was determined by drying the samples at 105 °C for 48 h in a hot air oven. The ash content was determined by burning the samples at 550 °C for 12 h (method no. 942.05) in a muffle furnace (Nabertherm, LT 40/12, GmbH, Lilienthal, Germany. Nitrogen (N) content (method no. 968.06) was determined using a FLASH 400 Analyzer (Thermo Fisher Scientific, Cambridge, UK). Crude protein (CP) content was calculated by multiplying the N content by 6.25 (method no. 990.03). The acid-detergent fiber (ADF) and neutral detergent fiber (NDF) contents were determined as described previously [21] by using a FiberCap system (FiberCap ™ 2021/2023, FOSS Analytical AB, Höganäs, Sweden). In forages (i.e., meadow hay, Mix1 and Mix2), NDF was assayed without a heat-stable amylase and expressed inclusive of residual ash. In concentrate, NDF was assayed with a heat-stable amylase and expressed inclusive of residual ash. ADF was expressed inclusive of residual ash.

Basic ruminal fermentation

After 24 h of in vitro incubation, the volume of accumulated gas released from the batch culture was determined from the recorded pressure or the volume of gas produced after 24 h of fermentation using a mechanical manometer fitted to a transducer (Premagas, Stará Turá, Slovak Republic). Analysis of gas production was carried out by gas chromatography using a PerkinElmer Clarus 500 gas chromatograph (Perkin Elmer, Inc., Shelton, CT, USA). The ruminal fluid was then collected from each bottle for analysis of pH, volatile fatty acids (VFA) and ammonia concentrations, and ruminal microorganism populations (bacteria, protozoa, and methanogens). For the in vivo experiment, ruminal fluid samples were collected immediately after slaughtering the animals. The pH value was measured immediately after sample collection using a pH meter (CP-104; Elmetron, Zabrze, Poland). Methane concentration from in vitro samples was determined by gas chromatography on PerkinElmer Clarus 500 gas chromatograph (Perkin Elmer, Inc., Shelton, USA) as described previously [22]. In the in vivo study, methane production was calculated measuring the molar proportion of VFA in the rumen as follow: 57.5 mol glucose = 65 mol acetate + 20 mol propionate + 15 mol butyrate + 60 mol CO2 + 35 mol CH4 + 25 mol H2O. [23]. The concentration of ammonia-N was determined in the inocula by the phenol-hypochlorite method [24]. The VFA samples were analyzed by gas chromatography (PerkinElmer Clarus 500 gas chromatograph, Perkin Elmer, Inc., Shelton, USA) as described previously [22]. The in vitro DM digestibility (IVDMD) and volume of accumulated gas were determined as described previously [22].

Rumen microbial quantification

The total protozoa count in collected ruminal fluid was determined according to the previous method [25]. For bacterial quantification, DNA from the ruminal samples were isolated using a Mini Bead-Beater (BioSpec, Bartlesville, OK, USA) for cell lysis, followed by purification (QIAamp DNA Stool Mini Kit; Qiagen, Hilden, Germany) [26]. DNA concentrations and quality were measured with NanoDrop 2000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). The primers for the targeted species were Butyrivibrio proteoclasticus (F: CCTAGTGTAGCGGTGAAATG“, R: TTAGCGACGGCACTGAATGCCTA) [27], Butyrivibrio fibrisolvens (F: ACACACCGCCCGTCACA, R: TCCTTACGGTTGGGTCACAGA) [28], Ruminococucus flavefaciens (F: CGAACGGAGATAATTTGAGTTTACTTAGG, R: CGGTCTCTGTATGTTATGAGGTATTACC) [29], Fibrobacter succinogenes, (F: GTTCGGAATTACTGGGCGTAAA, R: CGCCTGCCCCTGAACTATC) [29], and Ruminococcus albus (F: CCCTAAAAGCAGTCTTAGTTCG, R: CCTCCTTGCGGTTAGAACA) [30] for the quantitative PCR method. For the total bacteria, the following primers were used (F: GTGATGCATGGTTGTCGTCA, R: GAGGAAGGTGKGGATGACGT) [31].

Methanogens and total bacteria were quantified by the fluorescence in situ hybridization technique [32]. The rumen fluid (50 μl) was diluted in phosphate-buffered saline and pipetted onto 0.22 μm polycarbonate filters (Frisentte K02BP02500) and vacuumed (Vaccum KNF Vacuport-Neuberg). The filters were transferred onto a cellulose disk for dehydration in an ethanol concentration at different level (500, 800, and 900 ml/L) for 3 min. Hybridization was carried out in 50 μl of hybridization buffer (0.9 M NaCl; 20 mM Tris/HCl, pH 7.2; 0.1 g/L of SDS) containing oligonucleotide probes (all methanogens (S-D-Arch-0915-a-A-20) and two order-specific probes: S-O-Mmic-1200-a-A-21) (Methanomicrobiales) and S-F-Mbac-0310-a-A-22 (Methanobacteriales) [33]. The filters were washed with washing buffer (20 mM Tris/HCl, pH 7.2; 0.1 g/L of SDS; 5 mM EDTA) for 20 minutes at 48 °C. The filters were then rinsed gently in distilled water, air-dried and mounted on object glasses with VectaShield (Vector laboratories nr. H-1000) anti-fading agent containing DAPI (4’,6-diamidino-2-phenylindole). To distinguish the total count of bacteria (DAPI) from other methanogens in the rumen fluid, filters were maintained at 4 °C for 1 h in the dark until visualization using an Axio Imager M2 microscope (Carl Zeiss Iberia, Madrid, Spain).

Fatty acids extraction and analysis

On the last day of experiment, the lambs were slaughtered and samples from longissimus dorsi muscle, subcutaneous fat and liver were collected. The muscle samples (approximately 200 g) were collected from the right side of each carcass and drawn at the level of 13^th thoracic rib. Samples of subcutaneous fat and liver were lyophilized by freezing, vacuuming and drying the samples (Epsilon 2-10D LSCplus, CHRIST, Germany). Samples of muscle were lyophilized after removing the epimysium. All collected samples were stored at -80 °C until lipid extraction [34]. The FA concentrations in feeds, liver, muscle, and subcutaneous fat [15], ruminal fluid [13] and blood [35] were determined using standard protocols [15]. FA were identified and quantified based on peaks and retention times by comparing FA sample target with appropriate fatty acids methyl ester (FAME) standards (37 FAME Mix, Sigma-Aldrich) and the concentrations of CLAs were determined using a CLA standard (a mixture of cis 9, trans 11 and trans 10, cis 12-octadecadienoic acid methyl esters; Sigma-Aldrich) using a Galaxie Work Station 10.1 (Varian, CA).

Gene expression with RT-qPCR

Samples of longissimus dorsi muscle were collected immediately after slaughter and shock frozen in liquid nitrogen. Relative transcript abundances of five lipogenic genes such as lipoprotein lipase (LPL), fatty acid synthase (FASN), stearoyl-CoA desaturase (SCD), fatty acid desaturase 1 (FADS1), fatty acid elongase 5 (ELOVL5) were measured by real-time PCR method as described previously [10]. The muscle samples were homogenized in 1 ml TriPure reagent (Roche Diagnostics, Mannheim, Germany) using Tissue Lyser II (Qiagen, USA). Then the RNA isolation was performed following the protocol provided by the manufacturer. Briefly, 200 μl of chloroform (Sigma Aldrich, Hamburg, Germany) was added into tubes and shaken. After 10 min, samples were centrifuged (15 min) at 12,000 g speed. The clear phase was transferred to a new tube and added with 0.5 ml isopropanol (Sigma Aldrich, Hamburg, Germany). Then probes were centrifuged (15 min) at 12 000 g speed once again. RNA pellets were washed with 750 ml/L of ethanol (POCH, Gliwice, Poland), centrifuged for the third time (10 min at 9000 g) and dried at 40 °C thermoblock (Eppendorf, Hamburg, Germany). The RNA was then resuspended in DEPC treated water (Invitrogen, Carlsbad, USA) for spectrophotometric measurement (Nanodrop c2000, Thermo Scientific, USA) of concentration and purity. A reverse transcription reaction (RT) was performed using a Transcriptor First Strand cDNA Synthesis Kit (Roche) according to the procedures described by the manufacturer. Each sample was adjusted to equal concentrations of RNA. Briefly, RNA (300 ng), random hexameters (60 μM), oligodT (2.5 mM) and water were mixed and denatured at 65 °C for 10 min. Reverse transcriptase and RNase inhibitor buffer were then added to the RNA mix to a final volume of 20 μl. The RT conditions were as follows: 25 °C for 5 min, followed by 42 °C for 45 min and 85 °C for 5 min. The gene expression of FA synthase (FASN), lipoprotein lipase (LPL), stearoyl-CoA desaturase (SCD), FA desaturase 1 (FADS1) and FA elongase 5 (ELOVL5) were measured in muscle. Primer pairs for RT-qPCR amplification were designed based on previously published oligonucleotides [36] and synthesized by Sigma-Aldrich (USA). Only standard curves with an efficiency of at least 1.9 were considered optimized for the reaction in particular conditions. RT-qPCR amplification was performed in duplicate on a Light Cycler 480 instrument (Roche Diagnostics, Germany) using Light Cycler Sybr Green 480 I Master (Bio-Rad, USA). The RT-qPCR mix (10 μl per sample) contained 2 μl of nuclease-free water, 2 μl of primers mix, 5 μl Sybr Green Master mix and 1 μl of cDNA. The RT-qPCR conditions were as follows: 95 °C, 5 min (pre-incubation); 40 cycles of: 95 °C, 5 s (denaturation); 60 °C, 12 s (primer annealing and elongation); 65–97 °C (PCR product melting). For each RT-qPCR run, a negative control sample (without cDNA) was also added. After each analysis, melting curves were checked to exclude any potential sample contamination. Relative gene expression was evaluated by delta delta CT (ΔΔCT) with Gapdh/beta actin as a reference.

Blood analyses

Blood samples were collected from the jugular vein of each animal on day 22, 37, 51 and 70 into 10-ml serum-separator tubes (Sarstedt AG & Co, Nümbrecht, Germany) and centrifuged at 1200 g for 10 min at room temperature. From all collected days, the serum samples were used for lipid peroxidation. For FA analysis, sera from day 70 were used. The sera were stored at—80 °C until analysis.

Lipid oxidation

The left m. longissimus dorsi muscle samples were excised within 15 min after the slaughter and were immediately vaccum packed. Meat oxidative stability was monitored in the muscle samples that were stored at 4 °C for 0, 1 or 7 days. The standard curve of malondialdehyde prepared by hydrolysis of 1,1,3,3,-tetraethoxypropane (Sigma-Aldrich) was used to assess the lipid oxidation by the thiobarbituric acid reactive substances (TBARS) method as described previously [37].

Calculations

The desaturase [38], atherogenic [39] and thrombogenic [21] indices were calculated from the FA profile. Methane and hydrogen production, and hydrogen utilization were estimated based on stoichiometry calculations [23].

Statistical analysis

All data were analyzed using SAS statistical software (Univ. Edition, version 9.4) [40]. In experiment 1 (in vitro study), data were analyzed using PROC MIXED procedure with models containing treatment group, infection, and their interaction as fixed factors and each consecutive run was considered as a random factor. In experiment 2 (in vivo study), data except for the lipid peroxidation were analyzed with one way ANOVA model with PROC GLM procedure. Two-way ANOVA (GraphPad Prism, GraphPad Software, Inc., San Diego, USA) was used for the analysis of lipid oxidation in serum and meat to test the effect of dietary treatment and the time of sampling/storage, as well as their interaction. The significant differences among treatment groups were tested with Tukey post-hoc test (P < 0.05). All values are shown as the means with pooled standard errors of means.

Results

In vitro experiment

The pH decreased due to infection (P < 0.01), but Mix2N group had also decreased the pH compared to the CN (P = 0.01; Table 2). The IVDMD of Mix1N, Mix2N, Mix1I, and Mix2I was improved compared to either the non-infected or infected control (P < 0.01). The gas produced in CI decreased compared to CN (P = 0.03), but was similar in the infected and non-infected groups supplemented with Mix1 and Mix2 (P = 0.02). Mix1N group produced more methane compared to CN and Mix1I (P < 0.02). However, methane production in Mix1I was lower than the Mix1N and Mix2I when CH₄ was expressed as CH₄/gas produced and CH₄/IVDMD (P = 0.03 and P = 0.05, respectively). Concentrations of total VFA were lower in CN group compared with the groups supplemented with Mix1 and Mix2 (P < 0.01). The acetic acid proportion decreased in all infected groups compared to the non-infected control (P < 0.01), but the iso-valerate and valerate concentrations in all infected groups increased compared to the CN.

Table 2. The effect of herbal mixtures and infection on the rumen fermentation and microbial populations in vitro.

Parameter^a	Non-infected			Infected^b			SEM	P
Parameter^a	CN	Mix1N	Mix2N	CI	Mix1I	Mix2I	SEM	I	G	I×G
pH	6.24^a	6.21^a	6.08^b	6.12^b	6.04^b	6.04^b	0.01	<0.01	<0.01	0.01
IVDMD, %	53.9^c	62.9^a	62.2^a ^b	54.1^c	63.3^a	60.0^b	0.70	0.47	<0.01	0.29
NH₃, mM	6.06^b	7.32^a	6.63^a ^b	6.09^a ^b	6.44^a ^b	6.10^a ^b	0.13	0.08	0.03	0.29
Gas produced, ml	66.3^a	67.9^a	67.2^a	59.1^b	66.9^a	66.9^a	0.94	0.03	<0.01	0.02
CH₄, mM	0.57^b	0.80^a	0.59^a ^b	0.61^a ^b	0.46^b	0.71^a ^b	0.04	0.37	0.70	0.02
CH₄/Gas produced, mM/ml	0.008^a ^b	0.011^a	0.009^a ^b	0.010^a ^b	0.007^b	0.011^a	0.001	0.74	0.67	0.03
CH₄/IVDMD, mM/g	2.51^a ^b	3.21^a	2.74^a ^b	2.83^a ^b	1.92^b	3.13^a	0.20	0.52	0.63	0.05
Total VFA, mM	52.5^c	57.1^a	55.7^a ^b	53.7^b ^c	56.0^a ^b	57.9^a	0.42	0.23	<0.01	0.17
Acetate, mol/100 mol	63.8^a	63.1^a ^b	62.9^a ^b	61.6^b	60.8^b	61.2^b	0.30	<0.01	0.32	0.88
Propionate, mol/100 mol	20.4	20.4	20.4	21.3	22.0	21.5	0.29	0.06	0.87	0.88
Isobutyrate, mol/100 mol	0.28^b	0.35^a ^b	0.30^a ^b	0.30^b	0.36^a	0.31^a ^b	0.01	0.51	<0.01	1.00
Butyrate, mol/100 mol	13.1	13.6	13.9	13.2	13.0	13.3	0.11	0.09	0.24	0.36
Isovalerate, mol/100 mol	0.79^b	0.86^a ^b	0.83^a ^b	0.88^a	0.93^a	0.92^a	0.01	<0.01	<0.01	0.81
Valerate, mol/100 mol	1.31^b	1.41^b	1.40^b	2.45^a	2.56^a	2.50^a	0.1	<0.01	0.78	0.99
Caproate, mol/100 mol	0.25	0.29	0.28	0.36	0.38	0.37	0.02	<0.01	0.64	0.95
A:P	3.2 ^a	3.14 ^a	3.11 ^a	3.01 ^b	2.85 ^b	2.94 ^b	0.05	0.05	0.64	0.90
Archaea, 10⁷/ml	1.07^a	0.88^b	0.56^c	0.86^b	0.61^c	0.54^c	0.05	0.05	<0.01	0.49
Total bacteria, 10⁸/ml	4.94^a	4.82^a	4.06^b	5.56^a	5.28^a	5.58^a	0.15	<0.01	0.47	0.31
*R. albus, AU*^c	1.29^b	1.0^b	0.25^b	11.63^a	0.64^b	bd	1.43	0.08	0.12	0.07
*R. flavefaciens, AU*	0.09	Bd	0.03	0.03	bd	bd	0.03	0.48	0.43	ND
*F. succinogenes, AU*	0.58^c	0.50^c	0.19^c	2.95^a	1.7^b	1.38^b	0.29	<0.01	0.16	0.42
*B. proteoclasticus, AU*	0.79^c	0.05^c	0.13^c	2.93^b	8.87^a	4.26^b	0.66	<0.01	<0.01	<0.01
*B. fibrisolvens, AU*	2.26^b	4.07^a ^b	0.51^b ^c^d	1.19^c	0.19^d	4.54^a	0.43	0.61	0.54	<0.01
Total protozoa, 10³/ml	67.0	66.9	68.8	71.0	68.3	74.8	0.03	0.11	0.40	0.78
Holotricha,10³/ml	0.71	0.55	0.59	0.51	0.45	0.61	1.15	0.10	0.24	0.23
Entodiniomorpha,10³/ml	66.3	66.3	68.2	70.5	67.9	74.2	1.15	0.10	0.41	0.78

Open in a new tab

Within each row, means with lower case superscripts (a–d) indicate significant differences at P < 0.05; SEM, standard error of the mean.

^aIVDMD, in vitro dry mater digestibility; VFA, volatile fatty acids; bd, below detection.

^bControl non-infected (CN); Mix 1 non-infected (Mix1N); Mix2 non-infected (Mix2N); Control infected (CI); Mix1 infected (Mix1I); Mix 2 infected (Mix2I); I, infected; G, group.

^cAU, The relative 16S rRNA gene copy abundance expressed as an arbitrary unit relative the total bacterial gene copy abundance of the control.

Regarding the ruminal microbial activity, the Archaea populations of Mix1 and Mix2 in both non-infected and infected animals were lower compared to the CN (P< 0.01). Total bacterial abundance in the Mix2N group was lower compared to all groups (P < 0.05). The relative abundance of R. albus tended to increase in CI compared to the CN (P < 0.08). Also, F. succinogenes abundance was higher in infected groups (P < 0.01) and significantly lower in Mix1N and Mix2N. The relative abundance of B. proteoclasticus was higher in the Mix1I compared to the CI or CN and also to other groups. In contrast, the B. fibrisolvens of the Mix1I was lower than in CI and CN and also than other groups (P < 0.01).

Regarding the FA concentration in the buffered rumen fluid, major changes occurred due to the infection for C16:0, C18:0, C18:1 trans-10, C18:1 trans-11, C18:2 cis-9 cis-12; docosapentaenoic acid (DPA), docosahexaenoic acid (DHA), saturated FA (SFA), UFA, PUFA, n6 FA, n6/n3 ratio, medium chain FA (MCFA), and long chain FA (LCFA) (Table 3). The lower proportions of α-linolenic acid (ALA) were found in rumen fluid treated with Mix2N, Mix1I and Mix2I compared to the CN and the CI. Herbal mixtures changed the FA concentration in the ruminal fluid. The C18:1 trans-11 and the SFA proportions of all herbal groups with infected and non-infected were higher compared to CN (P< 0.01); whereas higher UFA proportions of CN were noted compared to other groups except for the Mix2N (P = 0.02).

Table 3. The effect of herbal mixtures and infection on ruminal fatty acid proportions (g/100 g FA) in vitro.

Fatty acids, g/100 g FA	Non-infected			Infected^a			SEM	P value
Fatty acids, g/100 g FA	CN	Mix1N	Mix2N	CI	Mix1I	Mix2I		I	G	I×G
Saturated
C8:0	0.11^a ^b	0.14^a	0.11^a ^b	0.08^b	0.12^a ^b	0.10^a ^b	0.01	0.14	0.04	0.83
C10:0	0.07^a ^b	0.08^a	0.06^a ^b	0.05^b	0.06^a ^b	0.04^a ^b	0.004	0.01	0.13	0.98
C12:0	1.03^a ^b	1.18^a	0.89^b	1.05^a ^b	1.05^a ^b	0.84^b	0.03	0.42	0.02	0.57
C13:0	8.66^a ^b	9.72^a	8.91^a ^b	7.82^b	7.89^a ^b	7.47^b	0.20	<0.01	0.37	0.50
C14:0	1.59	1.79	1.74	1.77	1.90	1.89	0.04	0.06	0.09	0.90
C15:0	1.39	1.54	1.53	1.46	1.42	1.34	0.03	0.15	0.69	0.11
C16:0	22.7^a	23.5^a	23.1^a	21.2^b	21.1^b	20.8^b	0.18	<0.01	0.50	0.36
C17:0	0.96^a ^b	1.06^a	1.09^a	0.88^b	0.89^b	0.94^a ^b	0.02	<0.01	0.02	0.35
C18:0	27.1^b	27.2^b	28.6^b	32.5^a	32.1^a	33.4^a	0.40	<0.01	0.05	0.75
Monounsaturated
C14:1	0.58	0.71	0.68	0.71	0.74	0.69	0.02	0.12	0.11	0.23
C15:1	1.04	1.20	1.08	1.10	1.14	1.16	0.02	0.53	0.17	0.44
C16:1	0.61^a	0.42^b	0.43^b	0.47^b	0.42^b	0.38^b	0.02	0.04	<0.01	0.13
C17:1	0.23	0.19	0.17	0.22	0.21	0.27	0.01	0.06	0.61	0.08
*C18:1 trans-6-8*	0.47	0.51	0.53	0.47	0.45	0.56	0.01	0.64	0.02	0.42
*C18:1 trans-9*	0.45^b	0.46^b	0.51^a ^b	0.63^a	0.54^a ^b	0.67^a	0.02	<0.01	0.20	0.51
*C18:1 trans-10*	0.76^c	1.00^b ^c	1.09^b ^c	1.36^a ^b	1.41^a ^b	1.70^a	0.08	<0.01	0.04	0.72
*C18:1 trans-11*	2.80^c	4.04^a	4.11^a	3.20^b	3.87^a ^b	3.70^a ^b	0.09	0.70	<0.01	0.04
*C18:1 cis-9*	11.2^a	8.84^b	8.81^b ^c	8.52^b ^c	8.26^b ^c	8.08^c	0.23	<0.01	<0.01	0.05
*C18:1 cis-11*	1.24^c	1.33^a ^b ^c	1.41^a ^b ^c	1.32^b ^c	1.55^a	1.44^a ^b	0.02	0.01	<0.01	0.17
*C18:1 cis-12*	0.23^b	0.30^a ^b	0.35^a	0.29^a ^b	0.37^a	0.35^a	0.01	0.01	<0.01	0.18
*C18:1 cis-13*	0.18	0.18	0.21	0.16	0.19	0.14	0.01	0.03	0.74	0.10
*C18:1 cis-14*	0.37^b	0.39^a ^b	0.43^a ^b	0.45^a	0.47^a	0.46^a	0.01	<0.01	0.19	0.52
Polyunsaturated
*C18:2 cis-9 cis-12*	8.21^a	6.64^b	7.05^a ^b	6.84^b	6.66^b	6.18^b	0.17	0.03	0.02	0.21
*C18:3 cis-9 cis-12 cis-15 (ALA)*^b	0.50^a	0.45^a	0.15^b	0.47^a	0.16^b	0.13^b	0.04	0.04	<0.01	0.08
*C18:2 cis-9 trans-11 (RA/CLA)*^c	0.94	0.84	1.10	0.81	1.00	0.94	0.04	0.50	0.16	0.11
*C18:2 trans-10 cis-12*	0.23	0.21	0.22	0.24	0.25	0.22	0.01	0.20	0.59	0.44
C18:3n6	0.17	0.17	0.16	0.14	0.13	0.16	0.01	0.02	0.76	0.43
C20:2	0.06	0.04	0.05	0.06	0.05	0.05	0.01	0.63	0.57	0.94
C20:3n6	1.24^a	1.09^a ^b	0.87^b	0.88^b	0.99^a ^b	1.04^a ^b	0.04	0.21	0.47	0.01
C20:4n6	0.06	0.05	0.07	0.06	0.04	0.05	0.003	0.13	0.15	0.23
C20:5n3 (EPA)^d	0.16	0.12	0.11	0.10	0.11	0.16	0.01	0.63	0.75	0.04
C22:2	0.06	0.05	0.06	0.05	0.05	0.03	0.003	0.02	0.62	0.28
C22:5n3 (DPA)^e	0.42^a	0.21^a ^b	0.23^a ^b	0.20^b	0.29^a ^b	0.33^a ^b	0.03	0.88	0.59	0.01
C22:6n3 (DHA)^f	1.68^b	1.91^a ^b	2.00^a ^b	2.05^a	1.84^a ^b	2.00^a ^b	0.04	0.25	0.42	0.04
SFA^g	63.9^b	67.3^a	67.0^a	67.8^a	67.4^a	67.4^a	0.35	0.02	0.05	0.01
UFA^h	35.6^a	32.4^b	32.8^a ^b	31.9^b	32.2^b	31.9^b	0.34	0.01	0.05	0.02
MUFAⁱ	21.4	20.6	20.8	20.0	20.7	20.6	0.22	0.26	1.00	0.28
PUFA^j	13.7^a	11.8^b	12.0^a ^b	11.9^b	11.5^b	11.3^b	0.21	0.02	0.01	0.19
n6 FA	10.0^a	8.3^b	8.5^a ^b	8.3^b	8.2^a ^b	7.8^b	0.19	0.02	0.04	0.16
n3 FA	2.67	2.67	2.46	2.82	2.45	2.62	0.05	0.76	0.10	0.24
n6/n3 ratio	3.77^a	2.95^a ^b	3.56^a ^b	3.03^b	3.47^a ^b	3.14^a ^b	0.10	0.26	0.69	0.02
MCFA^k	37.7^b	40.3^a	38.5^b	35.8^c	35.5^b ^c	34.3^c	0.32	<0.01	0.08	0.04
LCFA^l	61.7^b ^c	59.4^c	61.3^b ^c	64.0^a	64.1^a ^b	65.0^a	0.32	<0.01	0.11	0.11

Open in a new tab

Within each row, means with lower case superscripts (a–c) indicate significant differences at P < 0.05; SEM, standard error of the mean.

^a Control non-infected (CN); Mix 1 non-infected (Mix1N); Mix2 non-infected (Mix2N); Control infected (CI); Mix1 infected (Mix1I); Mix 2 infected (Mix2I); I, infected; G, group.

^b ALA, [α]-Linolenic acid.

^c RA/CLA, Rumenic acid/Conjugated linoleic acid.

^d EPA, Eicosapentaenoic acid.

^e DPA, Docosapentaenoic acid.

^f DHA, Docosahexaenoic acid.

^g SFA, Saturated fatty acids.

^h UFA, Unsaturated fatty acids.

ⁱ MUFA, Monounsaturated fatty acids.

^j PUFA, Polyunsaturated fatty acids.

^k MCFA, Medium chain fatty acids.

^l LCFA, Long chain fatty acids.

In vivo experiment

There were no significant differences (P > 0.05) among the groups for ruminal fermentation characteristics in lambs (Table 4). The bacteria population (B. fibrisolvens, R. albus and F. succinogenes) of the infected lambs fed with control diet as well as infected lambs treated with Mix1 and Mix2 diets increased (P < 0.01); however other bacterial populations did not differ among the treatment groups except B. proteoclasticus, which had higher relative abundance in the infected M2I group (P < 0.01). The population of Holotricha was higher in the CI than other groups (P < 0.01).

Table 4. The effect of herbal mixtures on rumen fermentation and microbial populations in lambs with H. contortus infection.

Item	CN^a	CI^a	M1I^a	M2I^a	SEM	P value
pH	6.75	6.49	6.62	6.85	0.06	0.17
NH₃, mM	9.44	8.40	8.81	8.79	0.22	0.39
CH₄, mM	0.39	0.40	0.42	0.40	0.01	0.96
CH₄ production, mM	19.2	19.6	21.2	19.5	0.69	0.73
H₂ production, mM	126	137	137	127	4.12	0.71
H₂ utilization, mM	114	123	123	114	3.71	0.71
Total VFA, mM	63.8	70.2	68.7	64.6	2.06	0.68
Acetate, mol/100 mol	68.8	64.2	69.8	69.2	0.80	0.06
Propionate, mol/100 mol	18.1	20.8	17.0	17.5	0.82	0.43
Isobutyrate, mol/100 mol	0.44	0.40	0.30	0.43	0.05	0.81
Butyrate, mol/100 mol	10.5	11.3	10.7	10.4	0.38	0.88
Isovalerate, mol/100 mol	0.80	0.79	0.47	0.69	0.08	0.47
Valerate, mol/100 mol	1.26	2.31	1.69	1.61	0.14	0.08
Caproate, mol/100 mol	0.14	0.28	0.17	0.18	0.03	0.30
A:P ratio	3.97	3.40	4.16	4.13	0.19	0.53
Archaea, 10⁷/ ml	1.03	0.96	0.70	0.94	0.07	0.96
Total bacteria, 10⁸/ml	4.65^b	5.95^a	6.06^a	5.98^a	0.20	<0.01
*B. fibrisolvens, AU* ^b	0.03	0.02	0.01	0.06	0.01	0.08
*B. proteoclasticus, AU*	0.06^b	0.08^b	0.04^b	0.57^a	0.07	<0.01
*R. albus, AU*	0.02	0.03	0.05	0.05	0.01	0.10
*F. succinogenes, AU*	0.20	0.40	0.45	0.33	0.07	0.64
Total protozoa, 10⁴/ml	45.7	40.2	66.5	71.0	5.00	0.07
Entodiniomorpha, 10⁴/ml	45.3	39.7	66.2	70.6	5.01	0.07
Holotricha, 10⁴/ml	0.34^b	0.51^a	0.29^b	0.32^b	0.02	<0.01

Open in a new tab

Within each row, means with lower case superscripts (a,b) indicate significant differences at P < 0.05; SEM, standard error of the mean.

^aControl non-infected (CN); Control infected (CI); Mix1 infected (M1I); Mix2 infected (M2I).

^bAU, The relative 16S rRNA gene copy abundance expressed as an arbitrary unit relative the total bacterial gene copy abundance of the control.

The FA proportions in the ruminal fluid, blood, as well as in the liver, subcutaneous fat and m. longissimus dorsi varied. The proportions of C15:0 and C17:0 in the rumen were higher in M2I lambs compared with the CI lambs whereas the proportions of C14:1 and C17:1 in the rumen were higher in M2I lambs compared with the CI and CN lambs (P < 0.05; Table 5). The ruminal MCFA proportion of CI was lower than the M2I (P = 0.03). By contrast, ruminal LCFA proportion was higher in the CI lambs than in the M2I lambs (P = 0.03).

Table 5. The effect of herbal mixtures on fatty acid proportions in ruminal fluid (g/100 g FA) in lambs with H. contortus infection.

Fatty acids, g/100 g FA	CN^a	CI^a	M1I^a	M2I^a	SEM	P value
Saturated
C8:0	0.05	0.04	0.04	0.05	0.00	0.64
C10:0	0.03	0.03	0.04	0.04	0.01	0.91
C12:0	0.65^a	0.43^b	0.42^b	0.49^a ^b	0.03	0.02
C13:0	3.36	2.89	4.64	6.05	0.63	0.18
C14:0	1.10	0.95	0.88	1.06	0.08	0.82
C15:0	1.62^a ^b	1.18^b	1.70^a ^b	2.19^a	0.13	0.02
C16:0	24.9	23.0	22.8	24.7	0.86	0.32
C17:0	0.78^a ^b	0.74^b	0.86^a ^b	0.93^a	0.03	0.04
C18:0	27.5	30.1	29.7	26.4	1.08	0.62
Monounsaturated
C14:1	0.94^b	0.72^b	1.03^b	1.39^a	0.07	<0.01
C15:1	1.34	1.11	1.05	1.40	0.07	0.22
C16:1	0.45	0.33	0.34	0.40	0.02	0.20
C17:1	0.22^b	0.23^b	0.24^a ^b	0.31^a	0.01	0.02
*C18:1 trans-6-8*	0.32	0.55	0.45	0.25	0.08	0.57
*C18:1 trans-9*	0.38	0.56	0.43	0.30	0.05	0.35
*C18:1 trans-10*	0.66	0.71	0.83	0.49	0.68	0.19
*C18:1 trans-11*	2.96	2.88	3.64	2.77	0.17	0.29
*C18:1 cis- 9*	9.38	9.30	8.01	7.51	0.46	0.42
*C18:1 cis-11*	1.05	1.30	1.04	0.93	0.08	0.36
Polyunsaturated
*C18:2 cis-9 cis-12*	11.5	11.3	11.8	10.7	0.37	0.78
*C18:3 cis-9 cis-12 cis-15 (ALA)*^a	0.52	0.10	0.28	1.44	0.21	0.46
*C18:2 cis-9 trans-11(RA/CLA)*^b	1.84	3.41	1.73	1.96	0.59	0.72
*C18:2 trans-10 cis-12*	0.20	0.24	0.19	0.18	0.01	0.36
C18:3n6	0.10	0.08	0.06	0.11	0.01	0.32
C20:2	0.21	0.07	0.01	0.14	0.04	0.42
C20:3n6	0.66	0.68	0.83	1.14	0.08	0.15
C20:4n6	0.08	0.09	0.06	0.08	0.01	0.58
C20:5n3 (EPA)^d	0.08	0.07	0.06	0.03	0.01	0.30
C22:2	0.07	0.05	0.08	0.05	0.00	0.16
C22:5n3 (DPA)^e	0.19	0.17	0.22	0.15	0.03	0.84
C22:6n3 (DHA)^f	2.51	2.13	2.19	2.81	0.13	0.21
SFA^g	61.4	61.2	62.6	63.5	1.27	0.43
UFA^h	38.6	38.8	37.4	36.5	1.27	0.43
MUFAⁱ	20.3	20.0	19.6	17.7	0.99	0.24
PUFA^l	18.3	18.8	17.8	18.8	0.66	0.96
n6 FA	12.7	12.6	13.3	12.4	0.36	0.86
n3 FA	3.61	2.90	3.06	4.43	0.23	0.07
n6/n3	3.79	4.76	4.38	2.84	0.33	0.19
MCFA^k	34.4^a ^b	28.1^b	32.8^a ^b	37.7^a	1.29	0.03
LCFA^l	65.5^a ^b	71.8^a	67.1^a ^b	62.2^b	1.30	0.03

Open in a new tab

Within each row, means with lower case superscripts (a–c) indicate significant differences at P < 0.05; SEM, standard error of the mean.

^a Control non-infected, CN; Control infected, CI; Mix1 infected, M1I; Mix2 infected, M2I.

^b ALA, [α]-Linolenic acid.

^c RA/CLA, Rumenic acid/Conjugated linoleic acid.

^d EPA, Eicosapentaenoic acid.

^e DPA, Docosapentaenoic acid.

^f DHA, Docosahexaenoic acid.

^g SFA, Saturated fatty acids.

^h UFA, Unsaturated fatty acids.

ⁱ MUFA, Monounsaturated fatty acids.

^j PUFA, Polyunsaturated fatty acids.

^k MCFA, Medium chain fatty acids.

^l LCFA, Long chain fatty acids.

In the serum from lambs fed Mix2, C15:0, C16:0, C16:1, C18:1 trans-6-8, ALA, C18:2 trans-10 cis-12, and MCFA proportions were higher compared to the CI group (Table 6). The M2I had lower proportions of C18:1 cis-11 and C18:2 cis-9 cis-12 in serum compared to other groups, which led to the lowered PUFA and LCFA proportions. The serum from lambs fed Mix1 and Mix2 had the lowest n6/n3 FA ratio compared to the CI (P < 0.001).

Table 6. The effect of herbal mixture on fatty acid proportions (g/100 g FA) in the serum of lambs with H. contortus infection.

Fatty acids, g/100 g FA	CN^a	CI^a	M1I^a	M2I^a	SEM	P value
Saturated
C8:0	0.11	0.06	0.11	0.22	0.02	0.14
C10:0	0.31	0.35	0.41	0.39	0.04	0.86
C12:0	0.18	0.14	0.37	0.52	0.07	0.18
C14:0	0.49	0.28	0.40	0.65	0.06	0.14
C15:0	0.56^a ^b	0.45^b	0.69^a ^b	1.11^a	0.09	0.03
C16:0	13.4^b	12.0^b	11.0^b	17.5^a	0.65	<0.01
C17:0	0.59	0.42	0.44	0.85	0.07	0.13
C18:0	12.8	15.3	15.7	13.5	0.66	0.36
Monounsaturated
C14:1	0.24	0.20	0.39	0.43	0.05	0.28
C15:1	0.19	0.10	0.19	0.34	0.03	0.09
C16:1	1.35^a ^b	0.97^b	0.39^b	1.68^a	0.13	<0.01
C17:1	0.52	0.49	0.45	0.58	0.04	0.71
*C18:1 trans- 6–8*	0.16^b	0.10^b	0.20^b	0.47^a	0.04	<0.01
*C18:1 trans- 9*	0.07	0.09	0.10	0.16	0.01	0.13
*C18:1 trans- 10*	0.18	0.35	0.24	0.46	0.06	0.45
*C18:1 trans- 11*	0.48	0.74	0.91	0.92	0.08	0.13
*C18:1 cis-9*	20.0^a ^b	17.6^a ^b	15.9^b	20.4^a	0.64	0.02
*C18:1 cis-11*	3.26^a	3.49^a	2.49^a	1.17^b	0.24	<0.01
*C18:1 cis-12*	0.58	0.67	0.54	0.35	0.05	0.19
*C18:1 cis-13*	0.13	0.16	0.13	0.12	0.02	0.95
*C18:1 cis-14*	0.21	0.17	0.21	0.31	0.03	0.52
Polyunsaturated
*C18:2 cis-9 cis-12*	31.1^a	34.3^a	33.1^a	22.5^b	1.29	<0.01
*C18:3 cis-9 cis-12 cis-15 (ALA)*^b	2.50^b ^c	1.95^c	3.14^a ^b	3.50^a	0.17	<0.01
*C18:2 cis-9 trans-11(RA/CLA)*^c	0.09	0.10	0.09	0.16	0.01	0.41
*C18:2 trans-10 cis-12*	0.14^a ^b	0.11^b	0.20^a ^b	0.29^a	0.02	0.02
C18:3n6	0.10	0.09	0.11	0.19	0.02	0.05
C20:2	0.17	0.13	0.21	0.12	0.02	0.14
C20:3n6	4.33	4.28	5.41	4.53	0.21	0.15
C20:4n6	0.31	0.14	0.20	0.23	0.05	0.72
C20:5n3 (EPA)^d	0.29	0.29	0.35	0.25	0.03	0.72
C22:2	0.25	0.15	0.19	0.22	0.03	0.70
C22:5n3 (DPA)^e	1.06	1.04	1.54	1.35	0.08	0.04
C22:6n3 (DHA)^f	0.27	0.33	0.29	0.30	0.04	0.98
SFA^g	30.3	30.4	30.6	36.6	1.04	0.07
UFA^h	69.7	69.6	69.4	63.4	1.04	0.07
MUFAⁱ	29.0^a	26.7^a ^b	24.5^b	29.8^a	0.68	0.01
PUFA^j	40.7^a ^b	42.9^a	44.9^a	33.6^b	1.32	<0.01
n6 FA	36.7^a	39.6^a	39.6^a	28.0^b	1.39	<0.01
n3 FA	4.12^a ^b	3.61^b	5.32^a	5.40^a	0.23	<0.01
n6/n3	9.15^a ^b	11.2^a	7.59^b ^c	5.32^c	0.57	<0.01
MCFA^k	16.4^b	14.1^b	13.4^b	22.2^a	0.88	<0.01
LCFA^l	83.2^a	85.4^a	86.1^a	77.2^b	0.89	<0.01
Desaturation index
DI (16:1/16)	0.09^a	0.07^a	0.03^b	0.09^a	0.01	<0.01
DI (18:1/18)	0.38	0.46	0.50	0.40	0.02	0.03
DI (MUFA/SFA)	0.49	0.47	0.44	0.45	0.01	0.25
DI(20:4n6/20:3n6)	0.06	0.04	0.04	0.05	0.01	0.74
DI (20:4n6/18:3n6)	0.63	0.59	0.62	0.55	0.04	0.90
DI (22:6n3/22:5n3)	0.19	0.23	0.15	0.18	0.02	0.66
Thrombogenic index	0.61	0.64	0.57	0.70	0.03	0.36
Atherogenicity index	0.42	0.41	0.41	0.54	0.02	0.12

Open in a new tab

Within each row, means with lower case superscripts (a–c) indicate significant differences at P < 0.05; SEM, standard error of the mean.

^a Control non-infected, CN; Control infected, CI; Mix1 infected, M1I; Mix2 infected, M2I.

^b ALA, [α]-Linolenic acid.

^c RA/CLA, Rumenic acid/Conjugated linoleic acid.

^d EPA, Eicosapentaenoic acid.

^e DPA, Docosapentaenoic acid.

^f DHA, Docosahexaenoic acid.

^g SFA, Saturated fatty acids.

^h UFA, Unsaturated fatty acids.

ⁱ MUFA, Monounsaturated fatty acids.

^j PUFA, Polyunsaturated fatty acids.

^k MCFA, Medium chain fatty acids.

^l LCFA, Long chain fatty acids.

In the liver of animals fed both herbal mixtures, proportions of C16:0, C16:1, and MCFA, and DI (16:1/16) decreased compared to CN and CI (Table 7). However, the increased ALA, n3 FA, LCFA proportions (P < 0.01) in M1I and M2I compared to the CI group were observed.

Table 7. The effect of herbal mixture on fatty acid proportions (g/100 g FA) in the liver of lambs with H. contortus infection.

Fatty acids, g/100 g FA	CN^a	CI^a	M1I^a	M2I^a	SEM	P value
Saturated
C8:0	0.06	0.07	0.05	0.05	0.01	0.78
C10:0	0.06	0.11	0.06	0.04	0.01	0.10
C12:0	0.21	0.24	0.17	0.14	0.02	0.45
C13:0	0.16	0.11	0.12	0.13	0.02	0.80
C14:0	0.66^a	0.51^a ^b	0.33^b	0.42^a ^b	0.04	0.01
C15:0	0.56	0.43	0.47	0.52	0.03	0.36
C16:0	13.1^a	13.6^a	11.1^b	11.1^b	0.34	<0.01
C17:0	1.55	1.45	1.32	1.36	0.05	0.44
C18:0	18.9^c	19.3^b ^c	21.7^a ^b	21.9^a	0.43	0.01
Monounsaturated
C14:1	0.16	0.11	0.15	0.16	0.02	0.62
C15:1	0.17	0.13	0.19	0.19	0.01	0.36
C16:1	1.52^a	1.49^a	0.39^b	0.49^b	0.15	<0.01
C17:1	0.78^a ^b	0.82^a	0.47^b	0.51^a ^b	0.05	0.01
*C18:1 trans-6-8*	0.24^b	0.39^a	0.27^a ^b	0.19^b	0.02	0.01
*C18:1 trans-9*	0.29	0.35	0.24	0.24	0.02	0.10
*C18:1 trans-10*	0.25	1.13	0.42	0.20	0.14	0.05
*C18:1 trans-11*	0.61	0.70	1.05	0.85	0.08	0.21
*C18:1 cis-9*	16.6	17.1	13.3	15.0	0.56	0.06
*C18:1 cis-11*	1.45^a ^b	1.67^a	1.02^b	1.05^b	0.08	<0.01
*C18:1 cis-12*	0.14	0.14	0.17	0.18	0.02	0.82
*C18:1 cis-13*	0.07	0.27	0.06	0.05	0.04	0.14
*C18:1 cis-14*	0.22	0.25	0.25	0.24	0.02	0.94
Polyunsaturated
*C18:2 cis-9 cis-12*	10.7	10.1	11.1	9.94	0.27	0.46
*C18:3 cis-9 cis-12 cis-15 (ALA)*^b	1.04^a ^b	0.64^b	1.26^a	1.97^a	0.15	0.01
*C18:2 cis-9 trans-11(RA/CLA)*^c	0.32	0.25	0.35	0.31	0.02	0.40
*C18:2 trans-10 cis-12*	0.26^a	0.23^a ^b	0.17^a ^b	0.14^b	0.02	0.03
C18:3n6	0.08	0.14	0.09	0.07	0.01	0.22
C20:2	1.88^a	1.79^a ^b	1.10^b	1.32^a ^b	0.11	0.03
C20:3n6	8.71	9.02	10.5	9.61	0.27	0.09
C20:4n6	0.50^a	0.33^a ^b	0.19^b	0.19^b	0.04	0.02
C20:5n3 (EPA)^d	1.57	1.84	1.75	1.52	0.07	0.30
C22:2	0.39	0.39	0.22	0.25	0.03	0.06
C22:5n3 (DPA)^e	4.65	4.28	6.10	5.42	0.30	0.14
C22:6n3 (DHA)^f	0.14	0.13	0.15	0.18	0.01	0.27
SFA^g	40.2	39.7	39.6	40.4	0.31	0.83
UFA^h	59.8	60.3	60.4	59.6	0.31	0.83
MUFAⁱ	29.6	31.1	27.4	28.7	0.53	0.08
PUFA^j	30.2	29.2	32.9	30.9	0.61	0.17
n6 FA	20.5	20.1	22.2	20.2	0.43	0.28
n3 FA	7.39^a ^b	6.90^b	9.25^a	9.08^a	0.37	0.04
n6/n3	2.84^a ^b	3.03^a	2.40^a ^b	2.26^b	0.11	0.03
MCFA^k	16.5^a	16.6^a	12.9^b	13.2^b	0.51	<0.01
LCFA^l	83.4^b	83.2^b	87.0^a	86.7^a	0.51	<0.01
Desaturation index
DI (16:1/16)	0.10^a	0.10^a	0.03^b	0.04^b	0.01	<0.01
DI (18:1/18)	0.54^b	0.53^b	0.62^a	0.59^a ^b	0.01	0.01
DI (MUFA/SFA)	0.42	0.44	0.41	0.42	0.01	0.13
DI (20:4n6/20:3n6)	0.64	0.50	0.65	0.73	0.03	0.09
DI (20:4n6/18:3n6)	0.86	0.68	0.70	0.72	0.03	0.23
DI (22:6n3/22:5n3)	0.03	0.03	0.02	0.04	0.00	0.51
Thrombogenic index	0.03	0.02	0.01	0.02	0.00	0.28
Atherogenicity index	0.29^a	0.27^a ^b	0.22^b	0.23^a ^b	0.01	0.02

Open in a new tab

Within each row, means with lower case superscripts (a–c) indicate significant differences at P < 0.05; SEM, standard error of the mean.

^a Control non-infected, CN; Control infected, CI; Mix1 infected, M1I; Mix2 infected, M2I.

^b ALA, [α]-Linolenic acid.

^c RA/CLA, Rumenic acid/Conjugated linoleic acid.

^d EPA, Eicosapentaenoic acid.

^e DPA, Docosapentaenoic acid.

^f DHA, Docosahexaenoic acid.

^g SFA, Saturated fatty acids.

^h UFA, Unsaturated fatty acids.

ⁱ MUFA, Monounsaturated fatty acids.

^j PUFA, Polyunsaturated fatty acids.

^k MCFA, Medium chain fatty acids.

^l LCFA, Long chain fatty acids.

Among the various FA profiles in the longissimus dorsi muscle, significant (P < 0.03) changes in C16:0 in M2I and C20:5 n-3 in M1I compared to CN were noticed. The MCFA significantly decreased (P < 0.01) compared to CN and CI and LCFA significantly increased (P < 0.02) in the M1I and M2I compared to CI (Table 8).

Table 8. The effect of herbal mixture on fatty acid proportions (g/100 g FA) in the longissimus dorsi muscle of lambs with H. contortus infection.

Fatty acids, g/100 g FA	CN^a	CI^a	M1I^a	M2I^a	SEM	P value
Saturated
C8:0	0.10	0.12	0.15	0.25	0.02	0.08
C10:0	0.10	0.19	0.15	0.32	0.04	0.20
C12:0	0.61	0.85	0.65	0.71	0.07	0.64
C13:0	0.26	0.90	0.29	0.78	0.13	0.16
C14:0	1.05	1.00	0.68	0.62	0.09	0.28
C15:0	0.32	0.19	0.18	0.17	0.03	0.22
C16:0	17.7^a	16.5^a ^b	14.2^a ^b	13.7^b	0.58	0.03
C17:0	0.87	0.54	0.46	0.43	0.08	0.13
C18:0	18.1	15.5	15.5	14.4	0.76	0.36
Monounsaturated
C14:1	0.19	0.25	0.12	0.13	0.03	0.31
C15:1	0.98	1.01	1.05	1.58	0.11	0.17
C16:1	1.01	0.97	0.85	0.79	0.05	0.41
C17:1	1.05	0.89	0.93	1.37	0.08	0.16
*C18:1 trans-6-8*	0.45	0.38	0.40	0.44	0.05	0.95
*C18:1 trans-9*	0.66	0.76	0.61	0.87	0.06	0.44
*C18:1 trans-10*	0.76	0.79	0.51	0.53	0.08	0.46
*C18:1 trans-11*	0.62	0.62	0.66	0.47	0.07	0.81
*C18:1 cis-9*	24.2	21.4	20.5	22.5	0.86	0.50
*C18:1 cis-11*	1.49	1.52	1.53	1.44	0.04	0.89
*C18:1 cis-12*	0.16	0.15	0.19	0.17	0.03	0.97
*C18:1 cis-13*	0.12	0.10	0.12	0.12	0.01	0.93
*C18:1 cis-14*	0.13	0.25	0.17	0.16	0.03	0.57
Polyunsaturated
C18:2c9c12	13.4	13.8	16.3	15.2	0.84	0.63
*C18:3 cis-9 cis-12 cis-15 (ALA)*^b	1.26	1.24	1.47	1.16	0.08	0.67
*C18:2 cis-9 trans-11(RA/CLA)*^c	0.11	0.10	0.10	0.11	0.02	0.98
*C18:2 trans-10 cis-12*	0.25	0.24	0.33	0.25	0.02	0.52
C18:3n6	0.16	0.15	0.09	0.16	0.02	0.36
C20:2	0.43	0.36	0.40	0.69	0.05	0.08
C20:3n6	3.47	3.20	4.42	5.04	0.30	0.09
C20:4n6	0.09	0.09	0.10	0.12	0.01	0.82
C20:5n3 (EPA)^d	0.59^b	0.65^a ^b	1.11^a	0.98^a ^b	0.07	0.02
C22:2	0.13	0.20	0.28	0.28	0.03	0.20
C22:5n3 (DPA)^e	0.68	1.62	1.52	2.17	0.25	0.18
C22:6n3 (DHA)^f	0.30	0.42	0.25	0.37	0.03	0.19
SFA^g	44.7	46.5	43.4	39.7	1.16	0.22
UFA^h	55.2	53.5	56.6	60.3	1.16	0.22
MUFAⁱ	34.4	31.4	30.3	33.7	0.86	0.30
PUFA^j	20.8	22.1	26.4	26.6	1.14	0.18
n6 FA	17.4	17.6	21.4	21.0	1.00	0.36
n3 FA	2.83	3.94	4.35	4.68	0.29	0.09
n6/n3	5.99	5.01	5.12	4.59	0.33	0.52
MCFA^k	22.1^a	21.6^a	18.1^b	18.5^b	0.60	0.01
LCFA^l	77.7^a ^b	78.1^b	81.6^a	80.9^a	0.58	0.02
Desaturation index
DI (16:1/16)	0.06	0.06	0.06	0.05	0.00	1.00
DI (18:1/18)	0.43	0.42	0.43	0.39	0.01	0.70
DI (MUFA/SFA)	0.44	0.40	0.41	0.46	0.01	0.26
DI (20:4 n6/20:3 n6)	0.66	0.75	0.73	0.66	0.03	0.43
DI (20:4 n6/18:3 n6)	0.33^b	0.40^a ^b	0.58^a	0.38^b	0.03	0.03
DI (22:6 n3/22:5 n3)	0.45	0.43	0.21	0.20	0.05	0.14
Thrombogenic index	0.15	0.28	0.26	0.19	0.03	0.38
Atherogenicity index	0.69	1.07	0.96	0.72	0.08	0.31

Open in a new tab

Within each row, means with lower case superscripts (a–c) indicate significant differences at P < 0.05; SEM, standard error of the mean.

^a Control non-infected, CN; Control infected, CI; Mix1 infected, M1I; Mix2 infected, M2I.

^b ALA, [α]-Linolenic acid.

^c RA/CLA, Rumenic acid/Conjugated linoleic acid.

^d EPA, Eicosapentaenoic acid.

^e DPA, Docosapentaenoic acid.

^f DHA, Docosahexaenoic acid.

^g SFA, Saturated fatty acids.

^h UFA, Unsaturated fatty acids.

ⁱ MUFA, Monounsaturated fatty acids.

^j PUFA, Polyunsaturated fatty acids.

^k MCFA, Medium chain fatty acids.

^l LCFA, Long chain fatty acids.

The subcutaneous fat from M2I group was characterized by higher proportions of C15:0, C14:1, C18:1 cis-12, and C18:1 cis-14 compared to the CN and CI (Table 9). The M1I group had higher proportions of C18:0 compared only to the CI (P < 0.05). Both herbal mixture groups had higher proportions of C18:1 cis-14 and α-linolenic acid (ALA) in the subcutaneous fat. The M2I group had decreased MUFA proportion and CI (MUFA/SFA), and M1I group had decreased n6/n3 ratio compared to the CI group.

Table 9. Effect of herbal mixture on fatty acid proportions (g/100 g FA) in the subcutaneous fat of lambs with H. contortus infection.

Fatty acids, g/100 g FA	CN^a	CI^a	M1I^a	M2I^a	SEM	P value
Saturated
C8:0	0.02	0.04	0.03	0.04	0.00	0.25
C10:0	0.02	0.02	0.02	0.02	0.00	0.30
C12:0	0.09	0.12	0.12	0.12	0.01	0.41
C13:0	0.02	0.01	0.03	0.02	0.00	0.33
C14:0	1.48	1.45	1.48	1.75	0.06	0.34
C15:0	0.58^b	0.50^b	0.61^b	0.93^a	0.05	0.01
C16:0	17.8	17.7	18.0	18.9	0.25	0.38
C17:0	2.19	2.26	1.97	2.14	0.06	0.48
C18:0	36.9^a ^b	33.6^b	39.5^a	38.7^a ^b	0.81	0.05
Monounsaturated
C14:1	0.33^b	0.22^b	0.34^b	0.46^a	0.03	<0.01
C15:1	0.36	0.36	0.42	0.49	0.03	0.30
C16:1	0.70	0.85	0.56	0.54	0.05	0.09
C17:1	0.52	0.58	0.36	0.42	0.03	0.08
*C18:1 trans-6-8*	0.45	0.44	0.30	0.33	0.03	0.27
*C18:1 trans-9*	0.50	0.49	0.32	0.33	0.04	0.23
*C18:1 trans-10*	2.81	3.55	0.73	0.68	0.55	0.16
*C18:1 trans-11*	2.02	3.82	1.90	2.13	0.32	0.15
*C18:1 cis-9*	21.6	22.1	22.0	20.0	0.53	0.50
*C18:1 cis-11*	1.34	1.58	1.21	1.31	0.05	0.10
*C18:1 cis-12*	0.22^b	0.22^b	0.25^a ^b	0.28^a	0.01	0.01
*C18:1 cis-13*	0.03	0.05	0.03	0.03	0.01	0.36
*C18:1 cis-14*	0.32^b	0.30^b	0.42^a	0.41^a	0.02	<0.01
Polyunsaturated
*C18:2 cis-9 cis-12*	5.66	6.08	5.27	5.27	0.26	0.73
*C18:3 cis-9 cis-12 cis-15 (ALA)*^b	0.84^a ^b	0.72^b	1.02^a	1.00^a	0.04	0.04
*C18:2 cis-9 trans-11(RA/CLA)*^c	0.26	0.28	0.28	0.28	0.01	0.94
*C18:2 trans-10 cis-12*	0.16	0.19	0.12	0.13	0.01	0.13
C18:3n6	0.04	0.04	0.04	0.04	0.00	1.00
C20:2	0.03	0.06	0.05	0.03	0.01	0.27
C20:3n6	0.17	0.32	0.21	0.38	0.04	0.36
C20:4n6	0.03	0.05	0.03	0.04	0.00	0.17
C20:5n3 (EPA)^d	0.04	0.06	0.05	0.07	0.01	0.66
C22:2	0.13	0.10	0.12	0.16	0.01	0.23
C22:5n3 (DPA)^e	0.10	0.08	0.14	0.16	0.03	0.78
C22:6n3 (DHA)^f	0.27	0.28	0.22	0.21	0.02	0.42
SFA^g	59.8	56.3	62.3	63.3	0.99	0.06
UFA^h	40.2	43.7	37.7	36.7	0.99	0.06
MUFAⁱ	32.4^a ^b	35.4^a	30.2^a ^b	28.9^b	0.85	0.03
PUFA^j	7.74	8.27	7.54	7.76	0.31	0.91
n6 FA	6.25	6.81	5.93	6.16	0.27	0.79
n3 FA	1.25	1.15	1.42	1.43	0.06	0.29
n6/n3	5.00^a ^b	5.93^a	4.14^b	4.38^a ^b	0.24	0.03
MCFA^k	21.4	21.3	21.5	23.2	0.32	0.08
LCFA^l	78.6	78.7	78.4	76.8	0.31	0.07
Desaturation index
DI (16:1/16)	0.04	0.05	0.03	0.03	0.00	0.07
DI (18:1/18)	0.63	0.60	0.64	0.66	0.01	0.07
DI (MUFA/SFA)	0.35^a ^b	0.39^a	0.33^a ^b	0.31^b	0.01	0.03
DI (20:4 n6/20:3 n6)	0.86	0.86	0.84	0.83	0.01	0.77
DI (20:4 n6/18:3 n6)	0.42	0.54	0.40	0.46	0.04	0.64
DI (22:6 n3/22:5 n3)	4.26	3.45	3.52	1.95	0.54	0.51
Thrombogenic index	0.03	0.02	0.02	0.03	0.00	0.84
Atherogenicity index	0.50	0.44	0.51	0.55	0.02	0.27

Open in a new tab

Within each row, means with lower case superscripts (a–c) indicate significant differences at P < 0.05; SEM, standard error of the mean.

^a Control non-infected, CN; Control infected, CI; Mix1 infected, M1I; Mix2 infected, M2I.

^b ALA, [α]-Linolenic acid.

^c RA/CLA, Rumenic acid/Conjugated linoleic acid.

^d EPA, Eicosapentaenoic acid.

^e DPA, Docosapentaenoic acid.

^f DHA, Docosahexaenoic acid.

^g SFA, Saturated fatty acids.

^h UFA, Unsaturated fatty acids.

ⁱ MUFA, Monounsaturated fatty acids.

^j PUFA, Polyunsaturated fatty acids.

^k MCFA, Medium chain fatty acids.

^l LCFA, Long chain fatty acids.

The CN and M2I groups had lower relative transcript abundances of LPL compared with the CI group (P = 0.01) (Table 10). Lower relative transcript abundances of FASN in the CN lambs compared to the M2I lambs (P = 0.03) and lower relative transcript abundances of SCD in the CN lambs compared with the M1I lambs (P = 0.04) were observed. Also, lower relative transcript abundances of FADS1 in the M2I group compared to the M1I group (P < 0.01) were detected. The gene expression of ELOVL5 was not changed in any group.

Table 10. The effect of herbal mixture treatment on expression of five genes (lipoprotein lipase (LPL), fatty acid synthase (FASN), stearoyl-CoA desaturase (SCD), fatty acid desaturase 1 (FADS1), fatty acid elongase 5 (ELOVL5), relative transcript abundance) in the m. longissimus dorsi of lambs with H. contortus infection.

Item	CN^a	CI^a	M1I^a	M2I^a	SEM	P value
LPL	0.86^b	2.39^a	1.14^a^b	0.72^b	0.21	0.01
FASN	1.15^b	2.89^a^b	1.54^a^b	3.10^a	0.30	0.03
SCD	1.64^b	6.62^a^b	10.3^a	1.56^b	1.37	0.04
FADS1	3.04^bc	8.59^a^b	11.7^a	0.87^c	1.28	<0.01
ELOVL5	6.26	7.93	10.4	5.15	1.04	0.26

Open in a new tab

Within each row, means with lower case superscripts (a–c) indicate significant differences at P < 0.05; SEM, standard error of the mean.

^aControl non-infected, CN; Control infected, CI; Mix1 infected, M1I; Mix2 infected, M2I.

The TBARS level in serum was influenced by time (P < 0.001), with significantly higher values after 70 days post-infection in the CI lambs compared with the CN lambs (Table 11). The TBARS levels in the meat were also affected by the time of storage (P < 0.001) and by the groups, which was higher in the CI group compared to CN and M1I groups (P < 0.05).

Table 11. Lipid peroxidation in serum and oxidative stability of meat in lambs with H. contortus infection.

Parameter	Day	Dietary treatment group^a				SEM	P value
Parameter	Day	CN	CI	M1I	M2I	SEM	G^b	Time	G × Time
Serum TBARS ^c	22	0.24	0.24	0.19	0.27	0.013	0.099	<0.001	0.059
(μmol/l)	37	0.28	0.26	0.35	0.35	0.016
	51	0.30	0.36	0.31	0.33	0.016
	70	0.22^a	0.33^b	0.30^a ^b	0.28^a ^b	0.014
Muscle TBARS	0	0.45	0.53	0.48	0.56	0.018	0.037	<0.001	0.770
(mg MDA ^d/kg)	1	0.51	0.54	0.52	0.58	0.019
	7	0.64^b	0.83^a	0.63^b	0.77^a ^b	0.043

Open in a new tab

Within each row, means with lower case superscripts (a–c) indicate significant differences at P < 0.05; SEM, standard error of the mean.

^aControl non-infected, CN; Control infected, CI; Mix1 infected, M1I; Mix2 infected, M2I.

^bG, Group.

^cTBARS, Thiobarbituric acid reactive substances.

^dMDA, Malondialdehyde.

Discussion

It is well known that gastrointestinal endoparasites increase metabolic and nutritional demand of the host, which is manifested by impaired growth, productivity, reproductive ability and reduction in feed intake up to 20–25% [41]. Limited research is available on the effect of the GIN infection affecting ruminal fermentation and lipid metabolism profile in small ruminants. Also, periparturient parasitism in sheep may increase greenhouse gas emission [3]. A recent study showed that parasite infections in lambs can increase in methane yield (g CH₄/kg) by 33% compared to the free-parasites lambs [42]. Thus, parasite control in ewes can improve production efficiency and may decrease the adverse environmental impacts of sheep production systems. In the present study, methane production was not affected by parasitism. Archaea plays a crucial role in methanogenesis, but although the Archaea population in vitro was slightly diminished, it did not affect methane production. No differences were found both in vitro and in vivo as the effect of Mix1 or Mix2, could be due to the relatively low content of the anti-methanogenic compounds in the herbal mixtures [43,44,45]. The methane production which showed no differences both in in vitro and in vivo by Mix1 or Mix2 confirmed the results of the previous study, which presented the interaction of S. officinalis basic components and phytochemical compounds causing the reduced antimethanogenic activity due to lower availability of substances for microorganisms [46]. The reduction of the Archaea population was not noted in vivo, suggesting a lower dose of the herbal mixtures or adaptation of the Archaea [47]. Total bacteria and B. proteoclastus in the M2I group in in vivo study increased. This indicates low concentrations of PSM may stimulate some bacterial populations, while high concentrations of PSM are inhibitory to ruminal microbial populations [48,49]. Holotricha population of the CI group was higher compared to the CN group. It may be due to higher susceptibility of Entodinia to H. contortus infection. H. contortus infection alters microbial community composition and diversity, which facilitates the parasite survival and reproduction [50]. Variations in ruminal microbiota composition response and adaptation to anti-methanogenic compounds, fermentation kinetics, and diet composition are among the major factors contributing to the inconsistent efficacy [51]. The concentrations of total VFA increased in the groups supplemented with herbal mixtures in vitro, compared to CN and CI. Observed changes were associated with the increased in vitro digestibility in the herbal mixture groups. These results indicated that herbal mixtures perhaps affected the ruminal cellulolytic bacterial activity to increased digestibility (R. albus, R. flavefaciens, and F. succinogenes). Lower concentrations of PSM sometimes may be stimulatory to certain bacterial populations increasing digestibility of feeds. However, significant effects of herbal mixtures on pH, ammonia N and VFA have not been observed in vivo, neither in this nor other studies [52], perhaps due to the use of a lower dose of herbal mixture allowing metabolic redundancy of the ruminal ecosystem [49].

Results of in vitro FA analyses showed that the infection of H. contortus and herbal mixes can modulate the ruminal FA proportion. The infection increased the C18:0 proportion in all infected groups. We hypothesized that the infection increased ruminal microbial lipase activity, the main factor for ruminal BH process [53]. On the other hand, the oxidative stress caused by parasitic infection can stimulate the rumen metabolism of the lambs to fight against the pathogens [54] and hence, the rumen microbial population increased leading to more effective BH process. The decreased effectiveness of BH might be the effect of the antimicrobial properties of PSM against biohydrogenating bacteria [13].

The rumen FA proportion measured in the rumen of lambs did not reflect the results obtained in the in vitro experiment. The C14:1 and C17:1 proportion of M2I group slightly increased compared to the CN and CI. The C15:0, C17:0 and total MCFA proportion also increased compared to the CI group. Rumen microbes synthesize odd-chain saturated FA by different pathways, which remove the α-carbon through the conversion of end products of de novo lipogenesis (C16:0 and C18:0) to a hydroxyl FA, subsequently by decarboxylation to produce C15:0 and C17:0, respectively [55], or elongation of propionate carbon chain [56]. After absorption, FA proportions were modulated and a numerically higher UFA and lower SFA proportions were found in the blood (Table 6) and liver (Table 7). The PUFA and MUFA proportions in serum were higher than in the rumen, which occurs due to desaturation of FA after absorption from the gastrointestinal tract. Previous studies also showed higher proportion of UFA compared to SFA in ruminants’ blood [35], however rumen fluid was characterized with a higher content of SFA [13]. The final values of plasma FA proportions are dependent on the dietary FA source, de novo FA synthesis in tissues, and bacterial synthesis of FA including FA biohydrogenation in the rumen [57,58].

The MUFA proportion in the serum of infected Mix1 group was lower compared to the CN group. The reduced PUFA proportion of infected Mix2 was caused by lower linoleic acid (LA; C18:2n6) content in serum. Moreover, the C16:0; C16:1, C18:1 cis-11, conjugated linoleic acid (CLA; C18:2 cis-9 trans-11) and C20:4n6 proportions in the liver were reduced, while C18:0 and linolenic acid (ALA; C18:3n3) proportions were improved in the herbal mixtures groups. But, no major effect of infection associated with FA proportion was observed in serum and liver of the CN and CI, which were fed a similar type of diet. Therefore, it seems that the bioactive compounds in both herbal mixtures affected the enzymatic lipolysis process, leading to modulation of FA proportions [59]. The C18:3 cis-9, cis-12, cis-15 can be converted to C20:4n-6 in the liver by desaturases and elongases, however in the present, study we noticed a lower proportion on C20:4n-6 in the liver of lambs fed herbal mixtures, which may suggest the other possible mode of action. In the liver of lambs, the positive effect of M2I was obtained on C18:3 cis-9, cis-12, cis-15, n3 FA, and n6/n3 ration. On the other hand, herbal mixtures both M1I and M12 groups were able to decrease MCFA and increase LCFA, which are also considered favorable within lipid metabolism.

Several studies indicated that diets strongly affected the deposition of intramuscular fat and the proportion of SFA and PUFA [60], as well as the activity of enzymes involved in fatty acids synthesis such as Δ-9 desaturase (converts SFA into cis-9 MUFA), elongase (converts C16:0 into C18:0) and Δ-4, Δ-5 and Δ-6 desaturase (convert C18 PUFA into C20-C22 PUFA) [61–64]. A lower biosynthesis of MUFA in the subcutaneous fat of infected Mix2 group was supported by a lower LPL in the infected Mix2 group and a higher SCD activity in the Mix1 group. The SCD is responsible for biosynthesis of cis-9, trans-11 CLA from trans-vaccenic acid (C18:1 trans-11 CLA) [65]. Therefore, lower LPL activity suggests that biosynthesis of MUFA by the insertion of a double bond between carbon C9 and C10 of SFA, such as stearic acid (C18:0) into oleic acid (C18:1 cis-9), is low. In addition, preferential oxidation of FA or competition for desaturation and elongation enzymes by ALA and LA could affect conversion of ALA into a product of metabolites [64]. Moreover, catalytic process for cis double bonds into hydrocarbon chains for biosynthesis of UFA increases the n-3 long-chain PUFA, i.e. C20:5 n-3 [66]. Therefore, the C20:5 n-3 was higher in the M1I supported by the FADS1 abundance in muscle, but was lower in the M2I group. Although FADS1 gene expressions in the M2I group decreased, it seems that there is a different mode of action between herbal mixtures groups. Therefore, the results of the present study and those of other researchers suggest that varying FA levels, phytochemical compounds in ruminant diets and varying degree of unsaturation of dietary FA could affect the expression of these lipogenic genes in different ways.

The effects of GIN parasite on the meat quality in sheep had received little attention [26]. Infections with GIN alter energy metabolism to cope with the extra energy required for tackling infection and decrease the body weight of animals [41], which may in turn change FA metabolism. However, in this study, infection did not generally induce major changes in the FA profiles in the tissues, which may be associated with energy utilization by the animal itself. The infection also did not decrease body weight gain in lambs [17]. It has been recognized that the nematode infection induces the production of reactive oxygen, causing oxidative stress in the hosts [67,68]. The concentration of TBARS in meat in the present study showed a constant increase during storage, which indicated that secondary products of lipid oxidation were accumulated during storage. The addition of Mix1, but not Mix2, to the diet of infected lambs exhibited antioxidant potential resulting in a decrease in lipid oxidation in meat by reducing the TBARS level on day 7 of storage as compared to the infected animals. Mix2 herbal mixture had lower concentrations of phenolic and flavonoids compounds than in the Mix1, which was not effective to affect lipid peroxidation in meat. Herbs or forages containing PSM with antioxidative properties also improved meat quality such as chemical composition, colour and lipid stability [69,70].

Conclusion

Infection did not elicit major impacts on the ruminal fermentation characteristics and FA profiles in tissues, but it increased TBARS in serum and meat after storage. Herbal mixtures supplementation had no effect on the ruminal fermentation characteristics including the ruminal methane production, but increased total VFA concentrations and DM digestibility in vitro. Supplementation of herbal mixtures to the diets of GIN parasite infected-lambs decreased MCFA and increased LCFA in liver and meat, and decreased lipid oxidation in meat due to their inhibitory effects on the ruminal biohydrogenation. From this result and previous results [17], it can be concluded that Mix1 may reduce parasitic burdens as well as improve LCFA proportion and oxidative stability in meat, which may prove win-win situations in ruminant production.

Supporting information

S1 File

(ZIP)

Click here for additional data file.^{(3MB, zip)}

Acknowledgments

The authors are grateful to Magda Bryszak, Haihao Huang, Yulianri Rizki Yanza and Pawel Kolodziejski for technical assistance.

Abbreviations

ADF: acid detergent fiber
AU: arbitrary unit
CLA: conjugated linoleic acid
CI: control infected
CN: control non-infected
CP: crude protein
DI: desaturation index
DM: dry matter
ELOVL5: fatty acid elongase 5 (elongase 5)
FA: fatty acids
FADS1: fatty acid desaturase 1 (Δ5-desaturase)
FAME: fatty acids methyl ester
FASN: fatty acid synthase
GIN: gastrointestinal nematode
IVDMD: in vitro dry matter digestibility
LA: linoleic acid
LCFA: long chain fatty acids
LPL: lipoprotein lipase
M1I: Mix1 infected
M2I: Mix2 infected
MCFA: medium chain fatty acids
MDA: malondialdehyde
Mix1: infected
Mix1: herbal mixture 1
Mix1N: Mix 1 non-infected
Mix2: herbal mixture 2
Mix2I: Mix 2 infected
Mix2N: Mix2 non-infected
MUFA: monounsaturated fatty acids
NDF: neutral detergent fiber
PCR: polymerase chain reaction
PSM: plant secondary metabolites
PUFA: polyunsaturated fatty acids
RA: rumenic acid
RNA: ribonucleic acid
RT: reverse transcription
SCD: stearoyl-CoA desaturase (Δ9-desaturase)
SFA: saturated fatty acids
TBARS: thiobarbituric acid reactive substances
UFA: unsaturated fatty acids
VA: vaccenic acid
VFA: volatile fatty acids

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

This study was supported by funds from the Slovak Research and Development Agency (APVV 18-0131, APVV 17-0297) and by the framework of the Ministry of Science and Higher Education, Poland, programme "Regional Initiative Excellence" in years 2019-2022, Project No. 005/RID/2018/19. PSz is a PhD scholarship holder of the grant 2016/23/B/NZ9/03427 funded by National Science Center, Poland. LS has been awarded a full master degree by Ignacy Lukasiewicz scholarship from the Polish National Agency for Academic Exchange (NAWA). AC acknowledges the SAIA, n.o. (Slovak Academy Information Agency) for Academy Mobility Scholarship.

References

1.Selemon M. Review on control of Haemonchus contortus in sheep and goat. J. Vet. Med. Res. 2018; 5(5): 1139 Available from: http://agris.fao.org/agrissearch/search.do?recordID=US2019V00205 [Google Scholar]
2.Sinnathamby G, Henderson G, Umair S, Janssen P, Bland R, Simpson H. The bacterial community associated with the sheep gastrointestinal nematode parasite Haemonchus contortus. PLoS One. 2018;13: 1–25. 10.1371/journal.pone.0192164 [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Houdijk JGM, Tolkamp BJ, Rooke JA, Hutchings MR. Animal health and greenhouse gas intensity: the paradox of periparturient parasitism. Int J Parasitol. 2017;47: 633–641. 10.1016/j.ijpara.2017.03.006 [DOI] [PubMed] [Google Scholar]
4.Wolstenholme AJ, Fairweather I, Prichard R, Von Samson-Himmelstjerna G, Sangster NC. Drug resistance in veterinary helminths. Trends Parasitol. 2004;20: 469–476. 10.1016/j.pt.2004.07.010 [DOI] [PubMed] [Google Scholar]
5.Hoste H, Torres-Acosta JFJ, Quijada J, Chan-Perez I, Dakheel MM, Kommuru DS, et al. Interactions between nutrition and infections with Haemonchus contortus and related gastrointestinal nematodes in small ruminants. Adv Parasitol. 2016;93:239–351. 10.1016/bs.apar.2016.02.025 [DOI] [PubMed] [Google Scholar]
6.Spiegler V, Liebau E, Hensel A. Medicinal plant extracts and plant-derived polyphenols with anthelmintic activity against intestinal nematodes. Nat Prod Rep. 2017;34: 627–643. 10.1039/c6np00126b [DOI] [PubMed] [Google Scholar]
7.Hoste H, Torres-Acosta JFJ, Sandoval-Castro CA, Mueller-Harvey I, Sotiraki S, Louvandini H, et al. Tannin containing legumes as a model for nutraceuticals against digestive parasites in livestock. Vet Parasitol. 2015;212: 5–17. 10.1016/j.vetpar.2015.06.026 [DOI] [PubMed] [Google Scholar]
8.Lans C, Turner N, Khan T, Brauer G, Boepple W. Ethnoveterinary medicines used for ruminants in British Columbia, Canada. J Ethnobiol Ethnomed. 2007;3: 1–22. 10.1186/1746-4269-3-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.David AVD, Arulmoli R, Parasuraman S. Overviews of biological importance of quercetin: a bioactive flavonoid. Pharmacogn Rev. 2016;10(20):84–9. 10.4103/0973-7847.194044 [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Oskoueian E, Abdullah N, Oskoueian A. Effects of flavonoids on rumen fermentation activity, methane production, and microbial population. BioMed research international. 2013;2013: 1–8. 10.1155/2013/349129 [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Pietta P, Minoggio M, Bramati L. Plant polyphenols: Structure, occurrence and bioactivity. InStudies in Natural Products Chemistry. 2003; 28: 257–312. 10.1016/S1572-5995(03)80143-6 [DOI] [Google Scholar]
12.Wencelová M, Váradyová Z, Mihaliková K, Čobanová K, Plachá I, Pristaš P, et al. Rumen fermentation pattern, lipid metabolism and the microbial community of sheep fed a high-concentrate diet supplemented with a mix of medicinal plants. Small Rumin Res. 2015;125: 64–72. 10.1016/j.smallrumres.2015.01.028 [DOI] [Google Scholar]
13.Szczechowiak J, Szumacher-Strabel M, El-Sherbiny M, Pers-Kamczyc E, Pawlak P, Cieslak A. Rumen fermentation, methane concentration and fatty acid proportion in the rumen and milk of dairy cows fed condensed tannin and/or fish-soybean oils blend. Anim Feed Sci Technol. 2016;216: 93–107. 10.1016/j.anifeedsci.2016.03.014 [DOI] [Google Scholar]
14.Patra AK, Saxena J. Exploitation of dietary tannins to improve rumen metabolism and ruminant nutrition. J Sci Food Agric. 2011;91: 24–37. 10.1002/jsfa.4152 [DOI] [PubMed] [Google Scholar]
15.Cieslak A, Stanisz M, Wojtowski J, Pers-Kamczyc E, Szczechowiak J, El-Sherbiny M, et al. Camelina sativa affects the fatty acid contents in M. longissimus muscle of lambs. Eur J Lipid Sci Technol. 2013;115: 1258–1265. 10.1002/ejlt.201200119 [DOI] [Google Scholar]
16.Jenkins TC, Wallace RJ, Moate PJ, Mosley EE. Board-Invited Review: Recent advances in biohydrogenation of unsaturated fatty acids within the rumen microbial ecosystem. J Anim Sci. 2008;86: 397–412. 10.2527/jas.2007-0588 [DOI] [PubMed] [Google Scholar]
17.Mravčáková D, Váradyová Z, Kopčáková A, Čobanová K, Grešáková Ľ, Kišidayová S, et al. Natural chemotherapeutic alternatives for controlling of haemonchosis in sheep. BMC Vet Res. 2019;15: 1–13. 10.1186/s12917-018-1758-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Lightbody JH, Stevenson LM, Jackson F, Donaldson K, Jones DG. Comparative aspects of plasma antioxidant status in sheep and goats, and the influence of experimental abomasal nematode infection. J Comp Pathol. 2001;124: 192–199. 10.1053/jcpa.2000.0453 [DOI] [PubMed] [Google Scholar]
19.Bryszak M, Szumacher-Strabel M, El-Sherbiny M, Stochmal A, Oleszek W, Roj E, et al. Effects of berry seed residues on ruminal fermentation, methane concentration, milk production, and fatty acid proportions in the rumen and milk of dairy cows. J Dairy Sci. 2019;102: 1257–1273. 10.3168/jds.2018-15322 [DOI] [PubMed] [Google Scholar]
20.Horwitz et al. Official methods of analysis. 18th ed Gaithersburg, MD; 2007. [Google Scholar]
21.Van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J Dairy Sci. 1991;74: 3583–3597. 10.3168/jds.S0022-0302(91)78551-2 [DOI] [PubMed] [Google Scholar]
22.Váradyová Z, Kišidayová S, Čobanová K, Grešáková, Babják M, Königová A, et al. The impact of a mixture of medicinal herbs on ruminal fermentation, parasitological status and hematological parameters of the lambs experimentally infected with Haemonchus contortus. Small Rumin Res. 2017;151: 124–132. 10.1016/j.smallrumres.2017.04.023 [DOI] [Google Scholar]
23.Wolin MJ. A Theoretical Rumen Fermentation Balance. J Dairy Sci. 1960;43: 1452–1459. 10.3168/jds.S0022-0302(60)90348-9 [DOI] [Google Scholar]
24.Broderick GA, Kang JH. Automated simultaneous determination of ammonia and total amino acids in ruminal fluid and in vitro media. J Dairy Sci. 1980;63: 64–75. 10.3168/jds.S0022-0302(80)82888-8 [DOI] [PubMed] [Google Scholar]
25.Michalowski T, Harmeyer J, Breves G. The passage of protozoa from the reticulo-rumen through the omasum of sheep. Br J Nutr. 1986;56: 625–634. 10.1079/bjn19860143 [DOI] [PubMed] [Google Scholar]
26.Zhong RZ, Li HY, Fang Y, Sun HX, Zhou DW. Effects of dietary supplementation with green tea polyphenols on digestion and meat quality in lambs infected with Haemonchus contortus. Meat Sci. 2015;105: 1–7. 10.1016/j.meatsci.2015.02.003 [DOI] [PubMed] [Google Scholar]
27.Potu RB, AbuGhazaleh AA, Hastings D, Jones K, Ibrahim SA. The effect of lipid supplements on ruminal bacteria in continuous culture fermenters varies with the fatty acid composition. J Microbiol. 2011;49: 216–223. 10.1007/s12275-011-0365-1 [DOI] [PubMed] [Google Scholar]
28.Li M, Penner GB, Hernandez-Sanabria E, Oba M, Guan LL. Effects of sampling location and time, and host animal on assessment of bacterial diversity and fermentation parameters in the bovine rumen. J Appl Microbiol. 2009;107: 1924–1934. 10.1111/j.1365-2672.2009.04376.x [DOI] [PubMed] [Google Scholar]
29.Denman SE, McSweeney CS. Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen. FEMS Microbiol Ecol. 2006;58: 572–582. 10.1111/j.1574-6941.2006.00190.x [DOI] [PubMed] [Google Scholar]
30.Wang RF, Beggs ML, Erickson BD, Cerniglia CE. DNA microarray analysis of predominant human intestinal bacteria in fecal samples. Mol Cell Probes. 2004;18: 223–234. 10.1016/j.mcp.2004.03.002 [DOI] [PubMed] [Google Scholar]
31.Maeda H, Fujimoto C, Haruki Y, Maeda T, Kokeguchi S, Petelin M, et al. Quantitative real-time PCR using TaqMan and SYBR Green for Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, tetQ gene and total bacteria. FEMS Immunol Med Microbiol. 2003;39: 81–86. 10.1016/S0928-8244(03)00224-4 [DOI] [PubMed] [Google Scholar]
32.Józefiak D, Kierończyk B, Juśkiewicz J, Zduńczyk Z, Rawski M, Długosz J, et al. Dietary nisin modulates the gastrointestinal microbial ecology and enhances growth performance of the broiler chickens. PLoS One. 2013;8: 1–11. 10.1371/journal.pone.0085347 [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Soliva CR, Meile L, Cieślak A, Kreuzer M, Machmüller A. Rumen simulation technique study on the interactions of dietary lauric and myristic acid supplementation in suppressing ruminal methanogenesis. Br J Nutr. 2004;92: 689–700. 10.1079/bjn20041250 [DOI] [PubMed] [Google Scholar]
34.Głogowski R, Czauderna M, Rozbicka A, Krajewska KA, Clauss M. Fatty acid profile of hind leg muscle in female and male nutria (Myocastor coypus Mol.), fed green forage diet. Meat Sci. 2010;85: 577–579. 10.1016/j.meatsci.2010.03.008 [DOI] [PubMed] [Google Scholar]
35.Szczechowiak J, Szkudelska K, Szumacher-Strabel M, Sadkowski S, Gwozdz K, El-Sherbiny M, et al. Blood hormones, metabolic parameters and fatty acid proportion in dairy cows fed condensed tannins and oils blend. Ann Anim Sci. 2018;18: 155–166. 10.1515/aoas-2017-0039 [DOI] [Google Scholar]
36.Vahmani P, Glover KE, Fredeen AH. Effects of pasture versus confinement and marine oil supplementation on the expression of genes involved in lipid metabolism in mammary, liver, and adipose tissues of lactating dairy cows. J Dairy Sci. 2014;97: 4174–4183. 10.3168/jds.2013-7290 [DOI] [PubMed] [Google Scholar]
37.Jo C, Ahn DU. Fluorometric Analysis of 2-Thiobarbituric Acid Reactive Substances in Turkey. Poult Sci. 1998;77: 475–480. 10.1093/ps/77.3.475 [DOI] [PubMed] [Google Scholar]
38.Brogna DMR, Nasri S, Salem H Ben, Mele M, Serra A, Bella M, et al. Effect of dietary saponins from Quillaja saponaria L. on fatty acid composition and cholesterol content in muscle Longissimus dorsi of lambs. Animal. 2011;5: 1124–1130. 10.1017/S1751731111000048 [DOI] [PubMed] [Google Scholar]
39.Chilliard Y, Ferlay A, Rouel J, Lamberet G. A review of nutritional and physiological factors affecting goat milk lipid synthesis and lipolysis. J Dairy Sci. 2003;86: 1751–1770. 10.3168/jds.S0022-0302(03)73761-8 [DOI] [PubMed] [Google Scholar]
40.SAS Institute Inc. SASOnlineDoc Version 9.3.SAS Institute Inc, Cary, NC: 2014. [Google Scholar]
41.Sykes AR, Coop RL. Intake and utilization of food by growing lambs with parasitic damage to the small intestine caused by daily dosing with Trichostrongylus colubriformis larvae. J Agric Sci. 1976;86: 507–515. 10.1017/S0021859600061049 [DOI] [Google Scholar]
42.Fox NJ, Smith LA, Houdijk JGM, Athanasiadou S, Hutchings MR. Ubiquitous parasites drive a 33% increase in methane yield from livestock. Int J Parasitol. 2018;48: 1017–1021. 10.1016/j.ijpara.2018.06.001 [DOI] [PubMed] [Google Scholar]
43.Bodas R, Prieto N, García-González R, Andrés S, Giráldez FJ, López S. Manipulation of rumen fermentation and methane production with plant secondary metabolites. Anim Feed Sci Technol. 2012;176: 78–93. 10.1016/j.anifeedsci.2012.07.010 [DOI] [Google Scholar]
44.García-González R, López S, Fernández M, Bodas R, González JS. Screening the activity of plants and spices for decreasing ruminal methane production in vitro. Anim Feed Sci Technol. 2008;147: 36–52. 10.1016/j.anifeedsci.2007.09.008 [DOI] [Google Scholar]
45.Patra AK, Saxena J. A new perspective on the use of plant secondary metabolites to inhibit methanogenesis in the rumen. Phytochemistry. 2010;71: 1198–1222. 10.1016/j.phytochem.2010.05.010 [DOI] [PubMed] [Google Scholar]
46.Cieslak A, Zmora P, Stochmal A, Pecio L, Oleszek W, Pers-Kamczyc E, et al. Rumen antimethanogenic effect of Saponaria officinalis L. phytochemicals in vitro. J Agric Sci. 2014;152: 981–993. 10.1017/S0021859614000239 [DOI] [Google Scholar]
47.Patra AK, Yu Z. Effects of adaptation of in vitro rumen culture to garlic oil, nitrate, and saponin and their combinations on methanogenesis, fermentation, and abundances and diversity of microbial populations. Front Microbiol. 2015;6: 1–11. 10.3389/fmicb.2015.00001 [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Patra AK. Recent advances in measurement and dietary mitigation of enteric methane emissions in ruminants. Front Vet Sci. 2016;3: 1–17. 10.3389/fvets.2016.00001 [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Patra AK, Park T, Braun H-S, Geiger S, Pieper R, Yu Z, et al. Dietary bioactive lipid compounds rich in menthol alter interactions among members of ruminal microbiota in sheep. Front Microbiol. 2019;10: 1–18. 10.3389/fmicb.2019.00001 [DOI] [PMC free article] [PubMed] [Google Scholar]
50.El-Ashram S, Al Nasr I, Abouhajer F, El-Kemary M, Huang G, Dinçel G, et al. Microbial community and ovine host response varies with early and late stages of Haemonchus contortus infection. Vet Res Commun. 2017;41: 263–277. 10.1007/s11259-017-9698-5 [DOI] [PubMed] [Google Scholar]
51.Patra A, Park T, Kim M, Yu Z. Rumen methanogens and mitigation of methane emission by anti-methanogenic compounds and substances. J Anim Sci Biotechnol. 2017;8: 1–18. 10.1186/s40104-016-0130-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Váradyová Z, Mravčáková D, Holodová M, Grešáková Ľ, Pisarčíková J, Barszcz M, et al. Modulation of ruminal and intestinal fermentation by medicinal plants and zinc from different sources. J Anim Physiol Anim Nutr (Berl). 2018;102: 1131–1145. 10.1111/jpn.12940 [DOI] [PubMed] [Google Scholar]
53.Lanier SJ, Corl BA. Challenges in enriching milk fat with polyunsaturated fatty acids. J Anim Sci Biotechnol. 2015;6: 1–9. 10.1186/2049-1891-6-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Mcrae KM, Stear MJ, Good B, Keane OM. The host immune response to gastrointestinal nematode infection in sheep. Parasite Immunol. 2015;37: 605–613. 10.1111/pim.12290 [DOI] [PMC free article] [PubMed] [Google Scholar]
55.Berthelot V, Bas P, Pottier E, Normand J. The effect of maternal linseed supplementation and/or lamb linseed supplementation on muscle and subcutaneous adipose tissue fatty acid composition of indoor lambs. Meat Sci. 2012;90: 548–557. 10.1016/j.meatsci.2011.09.014 [DOI] [PubMed] [Google Scholar]
56.Emmanuel B. The relative contribution of propionate, and long-chain even-numbered fatty acids to the production of long-chain odd-numbered fatty acids in rumen bacteria. Biochim. Biophys. Acta 1978;528: 239–246. 10.1016/0005-2760(78)90198-4 [DOI] [PubMed] [Google Scholar]
57.Doreau M, Ferlay A. Digestion and utilisation of fatty acids by ruminants. Anim Feed Sci Technol. 1994;45: 379–396. 10.1016/0377-8401(94)90039-6 [DOI] [Google Scholar]
58.Sinclair LA, Cooper SL, Chikunya S, Wilkinson RG, Hallett KG, Enser M, et al. Biohydrogenation of n-3 polyunsaturated fatty acids in the rumen and their effects on microbial metabolism and plasma fatty acid concentrations in sheep. Anim Sci. 2005;81: 239–248. 10.1079/ASC50040239 [DOI] [Google Scholar]
59.Smith SB, Lunt DK, Chung KY, Choi CB, Tume RK, Zembayashi M. Adiposity, fatty acid composition, and delta-9 desaturase activity during growth in beef cattle. Anim Sci J. 2006;77: 478–486. 10.1111/j.1740-0929.2006.00375.x [DOI] [Google Scholar]
60.Raes K, De Smet S, Demeyer D. Effect of dietary fatty acids on incorporation of long chain polyunsaturated fatty acids and conjugated linoleic acid in lamb, beef and pork meat: A review. Anim Feed Sci Technol. 2004;113: 199–221. 10.1016/j.anifeedsci.2003.09.001 [DOI] [Google Scholar]
61.Bressan MC, Rossato L V., Rodrigues EC, Alves SP, Bessa RJB, Ramos EM, et al. Genotype × environment interactions for fatty acid profiles in Bos indicus and Bos taurus finished on pasture or grain. J Anim Sci. 2011;89: 221–232. 10.2527/jas.2009-2672 [DOI] [PubMed] [Google Scholar]
62.Malau-Aduli AEO, Siebert BD, Bottema CDK, Pitchford WS. Breed comparison of the fatty acid composition of muscle phospholipids in Jersey and Limousin cattle. J Anim Sci. 1998;76: 766–773. 10.2527/1998.763766x [DOI] [PubMed] [Google Scholar]
63.Warren HE, Scollan ND, Enser M, Hughes SI, Richardson RI, Wood JD. Effects of breed and a concentrate or grass silage diet on beef quality in cattle of 3 ages. I: Animal performance, carcass quality and muscle fatty acid composition. Meat Sci. 2008;78: 256–269. 10.1016/j.meatsci.2007.06.008 [DOI] [PubMed] [Google Scholar]
64.Wood JD, Enser M, Fisher A V., Nute GR, Sheard PR, Richardson RI, et al. Fat deposition, fatty acid composition and meat quality: A review. Meat Sci. 2008;78: 343–358. 10.1016/j.meatsci.2007.07.019 [DOI] [PubMed] [Google Scholar]
65.Enoch HG, Catala A, Strittmatter P. Mechanism of rat liver microsomal stearyl-CoA desaturase. Studies of the substrate specificity, enzyme-substrate interactions, and the function of lipid. J Biol Chem. 1976;251: 5095–5103. [PubMed] [Google Scholar]
66.Park WJ, Kothapalli KSD, Lawrence P, Tyburczy C, Brenna JT. An alternate pathway to long-chain polyunsaturates: The FADS2 gene product Δ8-desaturates 20:2n-6 and 20:3n-3. J Lipid Res. 2009;50: 1195–1202. 10.1194/jlr.M800630-JLR200 [DOI] [PMC free article] [PubMed] [Google Scholar]
67.Machado V, Da Silva AS, Schafer AS, Aires AR, Tonin AA, Oliveira CB, et al. Relationship between oxidative stress and pathological findings in abomasum of infected lambs by Haemonchus contortus. Pathol Res Pract. 2014;210: 812–817. 10.1016/j.prp.2014.09.006 [DOI] [PubMed] [Google Scholar]
68.Váradyová Z, Mravčáková D, Babják M, Bryszak M, Grešáková Ľ, Čobanová K, et al. Effects of herbal nutraceuticals and/or zinc against Haemonchus contortus in lambs experimentally infected. BMC Vet Res. 2018;14: 1–12. 10.1186/s12917-017-1323-x [DOI] [PMC free article] [PubMed] [Google Scholar]
69.Kumar P, Patra AK, Mandal GP, Debnath BC. Carcass characteristics, chemical and fatty acid composition and oxidative stability of meat from broiler chickens fed black cumin (Nigella sativa) seeds. J Anim Physiol Anim Nutr (Berl). 2018;102: 769–779. 10.1111/jpn.12880 [DOI] [PubMed] [Google Scholar]
70.Qwele K, Hugo A, Oyedemi SO, Moyo B, Masika PJ, Muchenje V. Chemical composition, fatty acid content and antioxidant potential of meat from goats supplemented with moringa (Moringa oleifera) leaves, sunflower cake and grass hay. Meat Sci. 2013;93: 455–462. 10.1016/j.meatsci.2012.11.009 [DOI] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0231516.r001

Decision Letter 0

Simon Russell Clegg

24 Jan 2020

PONE-D-19-31838

Ruminal fermentation, microbial population and lipid metabolism in gastrointestinal nematode-infected lambs fed a diet supplemented with herbal mixtures

PLOS ONE

Dear Dr Cieslak

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Many thanks for submitting your manuscript to PLOS One

Your manuscript was reviewed by three experts in the field and they have suggested some changes be made prior to acceptance

If you could write a detailed response to reviewers that would help. For reviewer 3, most of the comments are minor typographical or grammatical issues, so just the word done for each one will be sufficient

the manuscript will be sent back to the same reviewers upon resubmission

I wish you the best of luck with your revision

We would appreciate receiving your revised manuscript by Mar 09 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Simon Russell Clegg, PhD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. In your Methods, please include details of the monitoring of experimental animals for adverse clinical signs.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

Reviewer #3: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Very interesting article covering functional food (herbal mix), H contortus infection and possible changes in rumen, liver and meat physiology. Innovative aspects of the work bringing new information in this complex interaction.

Reviewer #2: Comments and Suggestions for Authors

I reviewed the manuscript number: PONE-D-19-31838 “ Ruminal fermentation, microbial population and lipid metabolism in gastrointestinal nematode-infected lambs fed a diet supplemented with herbal mixtures”

Please, following some comments on the different sections, and few detailed comments referring to specific lines.

Introduction: The introduction present polyphenols affects but treatment’s herbal mixtures (Mix1 and Mix2) not show the data of polyphenols.

Line80: Fatty acid (FA), another line not uses FA please checks.

Line112: Please show the methods of herbal extract.

Line120: 9 different herbs mixed, that is difficult to separate the affect of herb.

Line122: Mix1 and Mix2 not combine with table 1 check, do you mean herbal mixed or diets?

Line126: Please add black ground of phenolic acids and flavonoids in the introduction.

Line145: Non-infection (CN), Control diet with infection (CI),- non-infected control group (CN), control diet (CI) please check.

Line169: Please delete --- (L3)

Line169: MHco1?

Line236: Please delete --- (PBS)

Discussion

generally, is not complete and discussion not follow the results.

Line553: Methane production was not influenced both in vitro and in vivo by Mix1 or Mix2--- please discussion why different levels of phenolic acids and flavonoids don’t have a affected.

Line555: Archaea population was not noted in vivo suggesting a lower dose of the herbal mixtures--- that convert to material and method, dose of 9 herbal not have a reference

Line556: “B. proteoclastus in the M2I group in in vivo increased, This indicates low concentrations of PSM “ --- I think Control non-infected (CN) and Control infected (CI) low concentrations of PSM more than M2I, please check

Line559: Holotricha population of the CI group was higher compared to the CN group---How different between CI and CN please explain?

Line562:” Interaction of infection… inconsistent efficacy” not relate with the result.

Line 568: non-infected and infected control groups---please change to CN and CI

Line 570: Please add specific name of ruminal cellulolytic bacterial to increased digestibility (R. albus, R. flavefaciens, F. succinogenes)

Line 576: Please check in Line80” The reduced degree of ruminal fatty acid (FA) saturation affects FA composition in ruminant products such as meat and milk”

Line612: Phenolic acids and flavonoids, decreased MCFA and increased LCFA--- what the effect of phenolic acids and flavonoids? please add

Line658: Please delete reference

Table

Table1: CP of Mixed herb --- Why is very high?

Reviewer #3: This is an interesting, well written paper which offers an interesting insight into the use of herbal treatments for disease with gastrointestinal nematodes.

I have made a few comments, mostly minor. I was left asking why and how quite a bit within the methodology, so maybe some additions in here would prove useful.

Although it looks like a lot of comments, most are minor. I am likely to get this back to re-review I would expect, so please don’t bother with a rebuttal to minor comments if you have done them. Only those where you feel a comment is needed is enough for me.

There are also a number of places where it is pretty much constant acronyms, which make it a bit difficult to follow. Is it possible to trim some of these out maybe? (I understand if not)

Line 24- with the gastrointestinal nematode

Line 24- Parallel in vitro ….

Line 34- I think Archaea should not be capitalised

Line 40- 7 should be written in words

Line 61- Maybe better to remove the from the start of the sentence and start, ‘Gastrointestinal parasitic infections ….’

Line 64, comma between production and resulting

Line 69- remove the

Line 71- you mention feeding of plant secondary metabolites to animals- is this as a treatment to those already infected or as more of a prophylaxis to prevent infection?

Line 75- you mention mixed medicinal herbs- a few examples would be nice

Line 76-81- this is a bit repetitive. Consider rewording?

You mention FA composition in meat and milk- is that a good or bad thing? Particularly with the marbelling of waguu beef for example making it highly prized?

Line 85- maybe remove GIN

Line 85- in the present study

Line 87- you choose the musculus longissimus dorsi muscle- is this the best one to choose or is this as a proxy for other muscles?

Line 92- space between profile and have

Line 9- comma between Sciences and in accordance

Line 102- here you talk about the lambs but it would be nice to have some more details, breed, age, sex, weights etc

Line 122-133- I think your mixes of herbs may be clearer in a table, or bullet pointed in a list?

Line 138- was the sample taken from anywhere specific in the rumen as this may affect endothelial cell associated bacterial collection?

Line 138- 139- 6 should be in words

Line 139- how soon post slaughter were the samples taken? And how?

Line 140- observing may sound better than finding out

Line 143- you mention taking samples from different parts of the rumen, again, where and how?

Line 164- again more detail on the lambs, age and sex

Line 166- was the water sterilised or just tap water?

Line 169- infected how? And how do you know that they were viable nematodes?

Line 170- remove GIN

Line 173- I think it should read ‘commercial concentrate was composed of….’

Line 176- DM needs defining

Line 177- you mention animals were housed on a sheep farm. in or outdoors, bedding? With other animals? Biosecurity employed etc?

Line 193- Manufacturer for hot air oven- also what is the method number referring to- it means nothing to the reader

Line 194- manufacturer for muffle furnace

Line 202- define ADF

Line 205- gas production was recorded- how? Using what?

Line 208- space between methanogens). For the ….

Line 213- measuring the molar proportion of ….- how was this done? Using what?

Line 221- space between count and in

Line 238- transferred onto a cellulose disk

I have never heard of an ethanol serie- is it meant to be series? Or does it need a manufacturer?

Line 247- To distinguish

Line 255- lyophilised how?

Line 258- fatty acids were identified- how?

Line 266- space between nitrogen and relative

Line 266- abundance of genes- which genes? How chosen?

Line 268- guessing this is tripure reagent but could be wrong?

Line 269- RNA extraction was performed following manufacturers instructions- which manufacturer?

Manufacturers for:

chloroform (Line 269)

Isopropanol (Line 271)

Ethanol (Line 273)

Thermoblack (Line 274)

DEPC treated water (Line 274)

Line 284- you mention RT_ PCR – a bit more discussion about the genes amplified here would be useful

Line 290- what concentration were primers at?

Line 320- in vitro in italics

Line 322- in vivo in italics

Line 332- a few figures to show the pH decrease may be useful

Line 334- reword to ‘compared to either….’

I thought it a little odd that there was no assessment of the levels of parasite after feeding with the different diets. Is it possible to add that in?

Lines 354-357- as these are the first mention of the different bacterial species, it would be good to have them in full Line 386- ‘…with control diet, as well as ….

Line 389- Holotricha in italics I think

Line 403- by contrast or on the contrary

Line 544- space between nutritional and demand

Line 552- comma after diminished

Line 552- what is the significance, if any of the alteration of Archaea levels?

Line 555- comma after in vivo

Line 556- again, what is the importance of the increase in total bacteria and B. proteoclastus ?

Line 558- population to populations

Line 559- Holotricha in italics I think

Line 562- treatment groups

Line 568- Comma after in vitro

Line 571- sometimes be may sound better

Line 573- comma after in vivo

Line 573- study to studies

Line 574- the use of a lower dose of ….

Line 57—modulate the ruminal FA proportion.

Line 587- space between FA and by

Line 588- remove the α-carbon

Line 594- A previous study, or previous studies

Line 596- with a higher content

Line 606- comma after process

Line 607- space between 15 and can

Line 609- noticed a lower proportion

Line 609- which may suggest …. Sounds better than what can suggest

Line 611-613- this reads a bit unclear- consider rewording

Line 616- space between Δ9 desaturase

Line 621- space between C18:1 trans

Line 635- remove up

Line 636- decrease the body weight of animals

Line 638- attributed to less extent of changes in the energy- reads unclearly- please reword

Line 639- the infection also did not decrease ….

Line 640- nematode infection

Line 658- previous results

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #3: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 Apr 16;15(4):e0231516. doi: 10.1371/journal.pone.0231516.r002

Author response to Decision Letter 0

11 Feb 2020

Simon Russell Clegg, PhD

Academic Editor

PLOS ONE

Manuscript ID: PONE-D-19-31838 Ruminal fermentation, microbial population and lipid metabolism in gastrointestinal nematode-infected lambs fed a diet supplemented with herbal mixtures

PLOS ONE

Dear Editor

Dear Reviewers

Thank you very much for evaluating our manuscript and for all valuable suggestions. We follow your instruction and we marked our changes as follows:

- yellow marks words that have been changed, added, or moved to a better location

- the bold text was used for the comments of Referees

-AU: stands for our replies and comments

We would like to thank the Referees for all the valuable comments and suggestions that helped us to improve our manuscript.

We have introduced all changes indicated in the Editor and Reviewers’ comments and concerns.

We would like to thank very much for positive evaluation.

Reviewer #2: Comments and Suggestions for Authors

Please, following some comments on the different sections, and few detailed comments referring to specific lines.

Introduction: The introduction present polyphenols affects but treatment’s herbal mixtures (Mix1 and Mix2) not show the data of polyphenols.

AU: Our apologies for the misleading information, the main idea of this sentence was to show that feed contains phytochemical substances such as flavonoids or polyphenols can affect ruminal conditions. The proper words were added in line 78-84 to describe PSM that contains phytochemical substances.

The phytochemical substances that we observed in our treatments were described in line 132-135 for Mix1 and 139-143 for Mix2; we added also a data of phytochemical substances in Table 1 (line 185). Hopefully, this helps for a better understanding as you expected.

Line80: Fatty acid (FA), another line not uses FA please checks.

AU: Thank you for your correction. We apologize for the mistakes. Based on our understanding the aim was to give the consistency of abbreviation after the sentence “Fatty acid (FA)” and for the next sentences that we used the same word was only used the abbreviation “FA”. We have already changed the “Fatty acid” to “FA” (line 37, 42), “volatile fatty acid” to volatile fatty acid (VFA) (line 33).

Line112: Please show the methods of herbal extract.

AU: we are sorry but it was not herbal extract. Mix1 and Mix2 were a mixtures of dry medicinal herbs obtained from commercial sources.

Line120: 9 different herbs mixed, that is difficult to separate the affect of herb.

AU: Thank you for your comment. The emphasis was placed on the phytochemical substances present in herbs mixed in the highest concentration. The effect can be confirmed based on the amount of the phytochemical substances or the mode of actions through the metabolism pathway changing the content of the observed parameters. We added also a data of phytochemical substances in Table 1 (line 186).

eg.

Item CI Mix1 Mix2 -

Phenolic acids - 57.3 22.2

EPA in meat 0.65 1.11 0.98

Line122: Mix1 and Mix2 not combine with table 1 check, do you mean herbal mixed or diets?

AU: Thank you for your correction. Mix1 and Mix 2 are herbal mixtures.

The abbreviations for dietary treatments In vivo are M1I (diet+supplementation of Mix1 + Infected animal ) and M2I (diet+ supplementation of Mix2 + Infected animal )

and for in vitro Control diet with non-infection (CN), Mix1 diet with non-infection (Mix1N), and Mix2 diet with non-infection (Mix2N), Control diet with infection (CI), Mix1 diet with infection (Mix1I), and Mix2 diet with infection (Mix2I).

Hopefully, we answer your question and clarified the issue.

Line126: Please add black ground of phenolic acids and flavonoids in the introduction.

AU: Thank you for the suggestion. We already added a background about phenolic acids and flavonoids in the introduction (line 78-84). We hope this matches your expectations.

Line145: Non-infection (CN), Control diet with infection (CI),- non-infected control group (CN), control diet (CI) please check.

AU: Thank you for your correction. We have already checked and introduced necessary changes (line 152-155) as follows: Control diet with non-infection (CN), Mix1 diet with non-infection (Mix1N), and Mix2 diet with non-infection (Mix2N), Control diet with infection (CI), Mix1 diet with infection (Mix1I), and Mix2 diet with infection (Mix2I).

Line169: Please delete --- (L3)

AU: We have already deleted. Thank you. (line 176)

Line169: MHco1?

AU: Our apologies for the unclear information. We have already emphasized using brackets to explain that it was the (strain of GIN H. contortus), which is susceptible to all main classes of anthelmintics. (line 177). The nomenclature comes from the system used within Moredun Research Institute, UK.

We hope the explanation is good enough.

Line236: Please delete --- (PBS)

AU: It was deleted. Thank you for the correction. (line 246)

Discussion

generally, is not complete and discussion not follow the results.

AU: We are very grateful for every suggestion and responses are given to improve our manuscript. We have revised the discussion part and edited, hopefully, it is better now.

Line553: Methane production was not influenced both in vitro and in vivo by Mix1 or Mix2--- please discussion why different levels of phenolic acids and flavonoids don’t have a affected.

AU: Thank you for this suggestion. We have already added information about the reason why the bioactive compounds did not affect methane production and we have written as follows: ”Archaea plays a crucial role in methanogenesis, but although the archaea population in vitro was slightly diminished, it did not affect methane production. Not found differences both in vitro and in vivo as the effect of Mix1 or Mix2, could be due to the relatively low content of the anti-methanogenic compounds in the herbal mixtures [43,44,45]. The methane production which showed no differences both in in vitro and in vivo by Mix1 or Mix2 confirmed the results of the previous study which presented the interaction of S. officinalis basic components and phytochemical compounds causing the reduced antimethanogenic activity due to lower availability of substances for microorganisms [46].” (line 569-577)

Line555: Archaea population was not noted in vivo suggesting a lower dose of the herbal mixtures--- that convert to material and method, dose of 9 herbal not have a reference

AU: Thank you for this comment, we have already provided the doses of herbal mixtures in material and methods part and in table 1 (line 186).

AU: Thank you for your specific comment. We have already checked it and it was correct. In in vivo study B. proteoclastus in the M2I group was the highest among all treatments. (line 579)

Line559: Holotricha population of the CI group was higher compared to the CN group---How different between CI and CN please explain?

AU: Holotricha population of the CI group was higher compared to the CN group. We can only speculate that it may be due to higher susceptibility of Entodinia to H. contortus infection. It is known that this parasite alters microbial community composition and diversity, which facilitates the parasite survival and reproduction. It may be the same with Holotricha. However, the mechanism of action is unknown. The above information was mentioned in Lines 581-585

Line562:” Interaction of infection… inconsistent efficacy” not relate with the result.

AU: We apologize for this misinterpretation. Yes, it was not related to our result and it was deleted.

Line 568: non-infected and infected control groups---please change to CN and CI

AU: Thank you for your correction. We did changes already (line 588)

Line 570: Please add specific name of ruminal cellulolytic bacterial to increased digestibility (R. albus, R. flavefaciens, F. succinogenes)

AU: Thank you for your suggestions. We added the name of cellulolytic bacteria as you advised (lines 590-591)

Line 576: Please check in Line80” The reduced degree of ruminal fatty acid (FA) saturation affects FA composition in ruminant products such as meat and milk”

AU: We have already checked it. Based on your doubts we removed the word ‘reduced’ from the sentence. We would like to highlight that fatty acid present in the rumen and degree of their saturation determine the fatty acid composition in milk and meat. We hope that the explanation is clear enough. Lines 84-85.

Line612: Phenolic acids and flavonoids, decreased MCFA and increased LCFA--- what the effect of phenolic acids and flavonoids? please add

AU: Decreased MCFA and increased LCFA may suggest positive effect of used herbal mixture on lipid metabolism in the liver. However, the precise mechanisms by which flavonoids and phenolic acids exert these actions are not yet fully established, although accumulated data indicated the ability of interaction with lipid metabolism. We have introduced the explanation in Lines 631-633.

Line658: Please delete reference

AU: We deleted reference, thank you.

Table

Table1: CP of Mixed herb --- Why is very high?

AU: CP of Mixed herbs is comparable with quality standards of Hay 1-Hay2

CP of Hay quality standards (g/kg DM)

Prime >190

Hay 1 170-190

Hay 2 140-160

Hay 3 110-130

Hay 4 80-100

Hay 5 < 80

Reviewer #3: This is an interesting, well written paper which offers an interesting insight into the use of herbal treatments for disease with gastrointestinal nematodes.

I have made a few comments, mostly minor. I was left asking why and how quite a bit within the methodology, so maybe some additions in here would prove useful.

There are also a number of places where it is pretty much constant acronyms, which make it a bit difficult to follow. Is it possible to trim some of these out maybe? (I understand if not)

AU: We are very grateful for every suggestion and comment we received because it will help to improve our manuscript. We hope that the improvements that we have done can be acceptable.

Line 24- with the gastrointestinal nematode

AU: Thank you for your correction. We fixed it already (line 24)

Line 24- Parallel in vitro ….

AU: Thank you for your correction. We fixed it already (line 24)

Line 34- I think Archaea should not be capitalized

AU: Thank you for your correction. We followed your suggestion (line 34)

Line 40- 7 should be written in words

AU: Thank you for your correction. We have written in words (line 40)

Line 61- Maybe better to remove the from the start of the sentence and start, ‘Gastrointestinal parasitic infections ….’

AU: Thank you for your correction that we followed. (line 61)

Line 64, comma between production and resulting

AU: Thank you for your correction that we followed. (line 64)

Line 69- remove the

AU: Thank you for your correction that we followed. (line 69)

Line 71- you mention feeding of plant secondary metabolites to animals- is this as a treatment to those already infected or as more of a prophylaxis to prevent infection?

AU: This feeding of plant secondary metabolites is dedicated to the animals that are already infected. (lines 71-73)

Line 75- you mention mixed medicinal herbs- a few examples would be nice

AU: Many thanks for your suggestion. We already added some examples which have an effect on reducing the burdens or GIN (line 75-77)

Line 76-81- this is a bit repetitive. Consider rewording?

AU: Thank you for your concern. Yes, we noticed that this was a bit repetitive. We have already rebuild the paragraph (line 79-84)

You mention FA composition in meat and milk- is that a good or bad thing? Particularly with the marbelling of waguu beef for example making it highly prized?

AU: Yes, we agree with the Reviewer but our experiment was done on infected sheep and was discussed taking under consideration the experimental factors used.

Line 85- maybe remove GIN

AU: We have already removed it (line 90)

Line 85- in the present study

AU: Thank you for the correction. We already added “the”. (line 90)

Line 87- you choose the musculus longissimus dorsi muscle- is this the best one to choose or is this as a proxy for other muscles?

AU: We have chosen the musculus longissimus dorsi muscle because intramuscular fat of this part is considered important for evaluating yield and quality of meat. For example, marbling can be defined by the ratio of fat content and muscle mass in this part. Marbling is also associated with physical quality such as tenderness, juice, taste and chemical quality including FA contents which several types are known to have health benefits for humans. On the other hand, it is considered a good part to investigate the protein synthesis increasing the muscle mass. So based on our knowledge, this part is the best one to be chosen (line 92)

Line 92- space between profile and have

AU: Thank you for your correction. We have already fixed it (line 97).

Line 99- comma between Sciences and in accordance

AU: Thank you for your correction. We have already fixed it (line 104)

Line 102- here you talk about the lambs but it would be nice to have some more details, breed, age, sex, weights etc

AU: Thank you for your suggestion. We have already followed your advice (line 107-108)

Line 122-133- I think your mixes of herbs may be clearer in a table, or bullet pointed in a list?

AU: We have added the necessary information in the text

Line 138- was the sample taken from anywhere specific in the rumen as this may affect endothelial cell associated bacterial collection?

AU: Thank you for your question. We have already added that ”The ruminal content was collected from the top, bottom and middle of the rumen of each lamb separately” (line 144-145)

Line 138- 139- 6 should be in words

AU: Thank you. We have already followed you advice (line 146-147)

Line 139- how soon post slaughter were the samples taken? And how?

AU: Thank you for the correction. We added ”Immediately transported to the laboratory in a 39°C preheated water bath” (line 157). Hopefully, this answers your question.

Line 140- observing may sound better than finding out

AU: Thank you. We have already followed you advice (line147)

Line 143- you mention taking samples from different parts of the rumen, again, where and how?

AU: Thank you for the correction. As we already added that rumen digesta was taken from different parts (top, bottom and middle) (line 150)

Line 164- again more detail on the lambs, age and sex

AU: Thank you for the suggestion, we have already added more details of the lambs “Twenty-four Improved Valachian female lambs with an initial mean body weight of 11.7 ± 1.23 kg and 3-4 months of age .”(line 171-173)

Line 166- was the water sterilised or just tap water?

AU: It was drinking tap water Line 174

Line 169- infected how? And how do you know that they were viable nematodes?

AU: Thank you for your question. As it was already written in the manuscript, infection was through the mouth (orally) with third-stage larvae and was confirmed by our previous experiment that affect the fecal egg counts and number of worms in the animal, which proved the nematodes were viable. (line 177-179)

Line 170- remove GIN

AU: Thank you. We have removed it as you suggested. (line 177)

Line 173- I think it should read ‘commercial concentrate was composed of….’

AU: Thank you, we have fixed it according to your advice (line181)

Line 176- DM needs defining

AU: Thank you, we have fixed it according to your advice (line184)

Line 177- you mention animals were housed on a sheep farm. in or outdoors, bedding? With other animals? Biosecurity employed etc?

AU: The lambs were housed in common stalls on a sheep farm without other animals and with biosecurity employed.

Line 193- Manufacturer for hot air oven- also what is the method number referring to- it means nothing to the reader

AU: Thank you for the suggestion. We have deleted it. Hopefully, it is an appropriate option (line 201)

Line 194- manufacturer for muffle furnace

AU: Thank you, we have added manufacturer for muffle furnace (line202)

Line 202- define ADF

AU: ADF, acid-detergent fiber was explained for the first time in line 206

Line 205- gas production was recorded- how? Using what?

AU: The volume of accumulated gas released from the batch culture was determined from the recorded pressure or the volume of gas produced after 24 h of fermentation using a mechanical manometer fitted to a transducer (Premagas, Stará Turá, Slovak Republic).

Analysis of gas production was carried out by gas chromatography using a PerkinElmer Clarus 500 gas chromatograph (Perkin Elmer, Inc., Shelton, CT, USA). Lines 213-217

Line 208- space between methanogens). For the ….

AU: Thank you, we have fixed it (line 220)

Line 213- measuring the molar proportion of ….- how was this done? Using what?

AU: Thank you for the correction. We have already added the information that methane production was calculated measuring the molar proportion of VFA in the rumen as follow: 57.5 mol glucose = 65 mol acetate + 20 mol propionate + 15 mol butyrate + 60 mol CO2 + 35 mol CH4 + 25 mol H2O based on Wolin’s equation; Wolin MJ. A Theoretical Rumen Fermentation Balance. J Dairy Sci. 1960;43: 1452–1459. doi:10.3168/jds.S0022-0302(60)90348-9 (line 222-224). Hopefully, we answered your question. Lines 224-227

Line 221- space between count and in

AU: Thank you, we have fixed it (line 234)

Line 238- transferred onto a cellulose disk

AU: Thank you, we have fixed it (line 251)

I have never heard of an ethanol serie- is it meant to be series? Or does it need a manufacturer?

AU: We apologize for the mistakes. It was dehydration in an ethanol concentration level at different levels (500, 800, and 900 ml/L) for 3 min (line 252)

Line 247- To distinguish

AU: Thank you, we have fixed it (line 260)

Line 255- lyophilised how?

AU: Thank you for the response. We have added “lyophilized by freezing, vacuuming and drying the samples (Epsilon 2-10D LSCplus, CHRIST, Germany)” (line 268-269)

Line 258- fatty acids were identified- how?

AU: FA were identified and quantified based on peaks and retention times by comparing FA sample target with appropriate fatty acids methyl ester (FAME) standards (37 FAME Mix, Sigma-Aldrich) and the concentrations of CLAs were determined using a CLA standard (a mixture of cis 9, trans 11 and trans 10, cis 12-octadecadienoic acid methyl esters; Sigma-Aldrich) using a Galaxie Work Station 10.1 (Varian, CA). We hope this gives a better explanation. (line 272-277).

Line 266- space between nitrogen and relative

AU: Thank you, we have fixed it (line 281)

Line 266- abundance of genes- which genes? How chosen?

AU: We apologize for unclear information. We changed to “Relative transcript abundances of five lipogenic genes such as lipoprotein lipase (LPL), fatty acid synthase (FASN), stearoyl-CoA desaturase (SCD), fatty acid desaturase 1 (FADS1), fatty acid elongase 5 (ELOVL5) were measured by real-time PCR method as described previously [10].” Hopefully, this phrase will be proper. (line 281-284)

Line 268- guessing this is tripure reagent but could be wrong?

AU: Thank you for the correction. We fix the words to TriPure reagent (line 284)

Line 269- RNA extraction was performed following manufacturers instructions- which manufacturer?

Manufacturers for:

AU: Chloroform (Line 287) (Sigma Aldrich, Hamburg, Germany)

Isopropanol (Line 289) (Sigma Aldrich, Hamburg, Germany)

Ethanol (Line 291) (POCH, Gliwice, Poland)

Thermoblock (Line 292) (Eppendorf, Hamburg, Germany)

DEPC treated water (Line 293) (Invitrogen, Carlsbad, USA)

TriPure reagent (Line 284) (Roche Diagnostics, Mannheim, Germany).

Line 284- you mention RT_ PCR – a bit more discussion about the genes amplified here would be useful

AU: Thank you for your suggestion. We have introduced necessary explanations (line 304-311)

Line 290- what concentration were primers at?

AU: The concentration was 2 µl of primers mix which was already written in (line 308).

Line 320- in vitro in italics

AU: Thank you for the correction, we have fixed it (line 338)

Line 322- in vivo in italics

AU: Thank you for the correction, we have fixed it (line 340)

Line 332- a few figures to show the pH decrease may be useful

AU: Thank you for the suggestion but we would like to ask the Reviewer to agree for not introducing new figures. The manuscript is already very long. We hope that existing data are clear enough. Please accept our request.

Line 334- reword to ‘compared to either….’

AU: Thank you for the correction, we have fixed the words to “compared to either” (line 352)

I thought it a little odd that there was no assessment of the levels of parasite after feeding with the different diets. Is it possible to add that in?

AU: We would be grateful for your agreement for not adding this information, especially that it was written in Mravčáková et al. (2019) that the anthelmintic potential of herbal mixtures was not sufficient for the primary elimination of parasites, but herbal treatment probably may affect the host over a longer term, reducing the parasitic infection in the host.

Lines 354-357- as these are the first mention of the different bacterial species, it would be good to have them in full Line 386- ‘…with control diet, as well as ….

AU: Thank you for the suggestion. We have already rebuilt the phrase to “The bacteria population (B. fibrisolvens, , R. albus and F. succinogenes) of the infected lambs fed with control diet as well as infected lambs treated with Mix1 and Mix2 diets increased (P < 0.01); however other bacterial populations did not differ among the treatment groups except B. proteoclasticus, which had higher relative abundance in the infected M2I group (P < 0.01)” (line 403-407)

Line 389- Holotricha in italics I think

AU: Thank you for the correction. We have changed to italic (line 407)

Line 403- by contrast or on the contrary

AU: Thank you for suggesting the proper word, we have fixed to “by contrast” (line 421)

Line 544- space between nutritional and demand

AU: Thank you for the correction, we have fixed it (line 561)

Line 552- comma after diminished

AU: Thank you for the correction, we have added comma after diminished (line 568)

Line 552- what is the significance, if any of the alteration of Archaea levels?

AU: Thank you for your question. We rebuild the phrases to follow your suggestion:” Archaea plays a crucial role in methanogenesis, but although the archaea population in vitro was slightly diminished, it did not affect methane production. Not found differences both in vitro and in vivo as the effect of Mix1 or Mix2, could be due to the relatively low content of the anti-methanogenic compounds in the herbal mixtures [43,44,45]. The methane production which showed no differences both in in vitro and in vivo by Mix1 or Mix2 confirmed the results of the previous study which presented the interaction of S. officinalis basic components and phytochemical compounds causing the reduced antimethanogenic activity due to lower availability of substances for microorganisms [46].” (line 569-577)

Line 555- comma after in vivo

AU: Thank you for the correction, we have added comma after in vivo (line 577)

Line 556- again, what is the importance of the increase in total bacteria and B. proteoclastus ?

AU: In our opinion we explained the Reviewer doubt in the next sentence – “This indicates low concentrations of PSM may stimulate some bacterial populations, while high concentrations of PSM are inhibitory to ruminal microbial populations [48,49]” Please accept our explanation (lines 579-581).

Line 558- population to populations

AU: Thank you for the correction, we have fixed it (line 580)

Line 559- Holotricha in italics I think

AU: Thank you for the correction, we have changed into italic (line 581)

Line 562- treatment groups

AU: Thank you for your correction, considering a suggestion from another Reviewer and the fact that it was not related to our results we decided to delete it as the most appropriate option. (It was in line 580)

Line 568- Comma after in vitro

AU: Thank you for your correction. We have added coma after in vitro (line 587)

Line 571- sometimes be may sound better

AU: Thank you for your correction. We have changed to “sometimes may be” (line 591)

Line 573- comma after in vivo

AU: Thank you for your correction. We have added comma after in vivo (line 593)

Line 573- study to studies

AU: Thank you for your correction. We have fixed it as you suggested (line 593)

Line 574- the use of a lower dose of ….

AU: Thank you for your correction. We have fixed it as you suggested (line 594)

Line 577—modulate the ruminal FA proportion.

AU: Thank you for your correction. We have added “the” as you suggested (line 597)

Line 587- space between FA and by

AU: Thank you for your correction. We have fixed it as you suggested (line 607)

Line 588- remove the α-carbon

AU: Thank you for your correction. We have added “the” as you suggested (line 608)

Line 594- A previous study, or previous studies

AU: Thank you for your correction. We have changed it considering plural form (line 614)

Line 596- with a higher content

AU: Thank you for your correction. We have fixed it (lines 615-616)

Line 606- comma after process

AU: Thank you for your correction. We have added comma after process (line 626)

Line 607- space between 15 and can

AU: Thank you for your correction. We have fixed it (line 627)

Line 609- noticed a lower proportion

AU: Thank you for your correction. We have added “a” between 15 and can (line 628)

Line 609- which may suggest …. Sounds better than what can suggest

AU: Thank you for your correction. We have fixed it as you suggested (line 629)

Line 611-613- this reads a bit unclear- consider rewording

AU: Thank you for your response. We rebuild the phrases to “In the liver of lambs, the positive effect of M2I was obtained on C18:3 cis-9, cis-12, cis-15, n3 FA, and n6/n3 ration. On the other hand, herbal mixtures both M1I and M12 groups were able to decrease MCFA and increase LCFA, which is also considered favorable within lipid metabolism” (line 630-633). We hope this version is better to understand.

Line 616- space between Δ9 desaturase

AU: Thank you for your correction. We have fixed it as you suggested (line 636)

Line 621- space between C18:1 trans

AU: Thank you for your correction. We have fixed it as you suggested (lines 640-641)

Line 635- remove up

AU: Thank you for your correction. We have removed “up” as you suggested (line 654)

Line 636- decrease the body weight of animals

AU: Thank you for your correction. We have added “the” as you suggested (line 655)

Line 638- attributed to less extent of changes in the energy- reads unclearly- please reword

AU: Thank you for your correction. We have reworded to “However, in this study, infection did not generally induce major changes in the FA profiles in the tissues, which may be associated with energy utilization by the animal itself” (lines 656-656)

We hope this more clear and better to understand.

Line 639- the infection also did not decrease ….

AU: Thank you for your correction. We have fixed it as you suggested (line 658)

Line 640- nematode infection

AU: Thank you for your correction. We have fixed it as you suggested (line 659)

Line 658- previous results

AU: Thank you for your correction. We have fixed it as you suggested (line 677)

We would like once more to thank very much the Editor and Reviewers for all the valuable comments and suggestions that helped us to improve our evaluated manuscript.

Attachment

Submitted filename: Answer to Editor and Reviewers- Herbmix-LS 1.2.20.doc

Click here for additional data file.^{(350.5KB, doc)}

PLoS One. doi: 10.1371/journal.pone.0231516.r003

Decision Letter 1

Simon Russell Clegg

10 Mar 2020

PONE-D-19-31838R1

Ruminal fermentation, microbial population and lipid metabolism in gastrointestinal nematode-infected lambs fed a diet supplemented with herbal mixtures

PLOS ONE

Dear Dr Cieslak

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we request that you make a few, very minor modifications to it as recommended by the reviewers prior to recommendation for publication. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

==============================

Many thanks for submitting your revised manuscript to PLOS One

It was reviewed by the same two experts in the field as the last submission, and both have suggested some very minor revisions should be made before it is accepted for publication.

If you could write a brief response to reviewer 2 comments that would be helpful. As reviewer 3comments are so minor, just a simple line saying these have been done will be enough.

I will then read the manuscript, and providing comments are addressed, I will recommend it for publication without the need to re-review

I wish you the best of luck with your revisions

Many thanks

Simon

==============================

We would appreciate receiving your revised manuscript by Apr 24 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

Please include the following items when submitting your revised manuscript:

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Simon Russell Clegg, PhD

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: All comments have been addressed

Reviewer #3: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #2: Partly

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #2: Yes

Reviewer #3: Yes

**********

6. Review Comments to the Author

Reviewer #2: Even though, authors have been revised accordingly to my comments, there are minor point need more address.

L82-83: provide detail mechanism how polyphenols inhibit the populations of microbes.

L143-144: what kind of feed was fed to lamb? Detail.

L671: Conclusion is too hard understand, please revise and make to related to hypothesis and objective study.

Reviewer #3: I wish to thank the authors for their detailed review response to the comments which I made on the last manuscript. I know many were very minor, and thank you for addressing them, and the comments to the others which are all acceptable to me (most were asked out of curiosity).

I have made a few very minor comments, which if addressed, I would not expect to see a revised version prior to publication.

Thanks once again, and best wishes

Line 107- remove were obtained from the same farm- as you say that twice

Line 173- after the adaptive period

Line 303- you may wish to say if any of these genes were sequenced as part of the PCR development

Line 571- not found differences doesn’t make sense- maybe no differences were found?

Line 575- comma after study may make this sentence a bit easier to read

Disucssion- I believe that Archaea needs capitalising throughout

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #3: No

PLoS One. 2020 Apr 16;15(4):e0231516. doi: 10.1371/journal.pone.0231516.r004

Author response to Decision Letter 1

11 Mar 2020

Poznan, 11.03.2020

Simon Russell Clegg, PhD

Academic Editor

PLOS ONE

Manuscript ID: PONE-D-19-31838 Ruminal fermentation, microbial population and lipid metabolism in gastrointestinal nematode-infected lambs fed a diet supplemented with herbal mixtures

PLOS ONE

Dear Editor

Dear Reviewers

Thank you very much for evaluating again our manuscript and minor suggestions. We follow your instruction and we marked our changes as follows:

- yellow marks words that have been changed, added, or moved to a better location

- the bold text was used for the comments of Referees

-AU: stands for our replies and comments

We would like to thank the Referees for all the valuable comments and suggestions that helped us to improve our manuscript.

We have introduced all changes indicated in the Editor and Reviewers’ comments and concerns.

Reviewer #2: Even though, authors have been revised accordingly to my comments, there are minor point need more address.

L82-83: provide detail mechanism how polyphenols inhibit the populations of microbes.

AU: Thank you for your suggestion. We added the following information L82-85:

Polyphenols inhibit the populations and/or activity of microbes responsible for methanogenesis and biohydrogenation by among others changing the rumen environment (pH value) and through the toxic effect on methanogens, consequently lowering methane emission and biohydrogenation rate of UFA in the rumen.

L143-144: what kind of feed was fed to lamb? Detail.

AU: In our opinion all detailed information regarding lambs feeding are located in L 118-121

Animals were fed a concentrate mixture (500 g dry matter (DM)/d), herbal mixtures (non-commercial mixtures - Mix1 and Mix2; 100 g DM/d) and meadow hay (ad libitum). The concentrate mixture was composed of 700 g/kg of barley, 220 g/kg of soybean meal, 48 g/kg of wheat bran, 5 g/kg of bicarbonate and 27 g/kg of mineral-vitamin premix.

Because of it we would like kindly to ask the Reviewer to keep as it is.

L671: Conclusion is too hard understand, please revise and make to related to hypothesis and objective study.

AU: Thank you for your suggestion. We improved our conclusion, and we hope you will accept it.

Now the conclusion is as follow:

L 674-683

Infection did not elicit major impacts on the ruminal fermentation characteristics and FA profiles in tissues, but it increased TBARS in serum and meat after storage. Herbal mixtures supplementation had no effect on the ruminal fermentation characteristics including the ruminal methane production, but increased total VFA concentrations and DM digestibility in vitro. Supplementation of herbal mixtures to the diets of GIN parasite infected-lambs decreased MCFA and increased LCFA in liver and meat, and decreased lipid oxidation in meat due to their inhibitory effects on the ruminal biohydrogenation. From this result and previous results [17], it can be concluded that Mix1 may reduce parasitic burdens as well as improve LCFA proportion and oxidative stability in meat, which may prove win-win situations in ruminant production.

I have made a few very minor comments, which if addressed, I would not expect to see a revised version prior to publication.

Thanks once again, and best wishes

Line 107- remove were obtained from the same farm- as you say that twice

AU: Thank you for your correction. It has been done.

Line 173- after the adaptive period

AU: It was corrected. Thank you.

Line 303- you may wish to say if any of these genes were sequenced as part of the PCR development

AU: We are sorry for misunderstanding. Transcript expression of the 5 genes investigated in this study was carried out with the RT-qPCR method. Any of the sequencing procedure has not been applied.

Line 571- not found differences doesn’t make sense- maybe no differences were found?

AU: It was improved. Thank you.

Line 575- comma after study may make this sentence a bit easier to read

AU: Thank you – you are right. We introduced necessary changes into the following sentence:

The methane production which showed no differences both in in vitro and in vivo by Mix1 or Mix2 confirmed the results of the previous study, which presented the interaction of S. officinalis basic components and phytochemical compounds causing the reduced antimethanogenic activity due to lower availability of substances for microorganisms [46].

Disucssion- I believe that Archaea needs capitalising throughout

AU: It was corrected. Thank you.

We would like once more to thank very much the Editor and Reviewers for all the valuable comments and suggestions that helped us to improve our evaluated manuscript.

Attachment

Submitted filename: Answer to Editor and Reviewers- Herbmix-LS 1.2.20 v2.doc

Click here for additional data file.^{(288.5KB, doc)}

PLoS One. doi: 10.1371/journal.pone.0231516.r005

Decision Letter 2

Simon Russell Clegg

26 Mar 2020

Ruminal fermentation, microbial population and lipid metabolism in gastrointestinal nematode-infected lambs fed a diet supplemented with herbal mixtures

PONE-D-19-31838R2

Dear Dr. Cieslak

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Simon Russell Clegg, PhD

Academic Editor

PLOS ONE

Additional Editor Comments:

Line 104- change animal to animals

Line 302- put a semi colon before the cycling conditions

Line 579- space after mention of reference 46

Line 631- comma after present study

Line 645- change bound to bond

Line 662- change induce to induces

Many thanks for resubmitting your manuscript to PLOS One and for addressing previous reviewers comments

I have reviewed the manuscript and recommended it for acceptance and publication

It has been a pleasure working with you, and I wish you all the best for your future research

Hope you are well and keeping safe in these difficult times

Best wishes and thanks

Simon

PLoS One. doi: 10.1371/journal.pone.0231516.r006

Acceptance letter

Simon Russell Clegg

30 Mar 2020

PONE-D-19-31838R2

Ruminal fermentation, microbial population and lipid metabolism in gastrointestinal nematode-infected lambs fed a diet supplemented with herbal mixtures

Dear Dr. Cieslak:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Simon Russell Clegg

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 File

(ZIP)

Click here for additional data file.^{(3MB, zip)}

Attachment

Submitted filename: Answer to Editor and Reviewers- Herbmix-LS 1.2.20.doc

Click here for additional data file.^{(350.5KB, doc)}

Attachment

Submitted filename: Answer to Editor and Reviewers- Herbmix-LS 1.2.20 v2.doc

Click here for additional data file.^{(288.5KB, doc)}

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.

[pone.0231516.ref001] 1.Selemon M. Review on control of Haemonchus contortus in sheep and goat. J. Vet. Med. Res. 2018; 5(5): 1139 Available from: http://agris.fao.org/agrissearch/search.do?recordID=US2019V00205 [Google Scholar]

[pone.0231516.ref002] 2.Sinnathamby G, Henderson G, Umair S, Janssen P, Bland R, Simpson H. The bacterial community associated with the sheep gastrointestinal nematode parasite Haemonchus contortus. PLoS One. 2018;13: 1–25. 10.1371/journal.pone.0192164 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231516.ref003] 3.Houdijk JGM, Tolkamp BJ, Rooke JA, Hutchings MR. Animal health and greenhouse gas intensity: the paradox of periparturient parasitism. Int J Parasitol. 2017;47: 633–641. 10.1016/j.ijpara.2017.03.006 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref004] 4.Wolstenholme AJ, Fairweather I, Prichard R, Von Samson-Himmelstjerna G, Sangster NC. Drug resistance in veterinary helminths. Trends Parasitol. 2004;20: 469–476. 10.1016/j.pt.2004.07.010 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref005] 5.Hoste H, Torres-Acosta JFJ, Quijada J, Chan-Perez I, Dakheel MM, Kommuru DS, et al. Interactions between nutrition and infections with Haemonchus contortus and related gastrointestinal nematodes in small ruminants. Adv Parasitol. 2016;93:239–351. 10.1016/bs.apar.2016.02.025 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref006] 6.Spiegler V, Liebau E, Hensel A. Medicinal plant extracts and plant-derived polyphenols with anthelmintic activity against intestinal nematodes. Nat Prod Rep. 2017;34: 627–643. 10.1039/c6np00126b [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref007] 7.Hoste H, Torres-Acosta JFJ, Sandoval-Castro CA, Mueller-Harvey I, Sotiraki S, Louvandini H, et al. Tannin containing legumes as a model for nutraceuticals against digestive parasites in livestock. Vet Parasitol. 2015;212: 5–17. 10.1016/j.vetpar.2015.06.026 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref008] 8.Lans C, Turner N, Khan T, Brauer G, Boepple W. Ethnoveterinary medicines used for ruminants in British Columbia, Canada. J Ethnobiol Ethnomed. 2007;3: 1–22. 10.1186/1746-4269-3-1 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231516.ref009] 9.David AVD, Arulmoli R, Parasuraman S. Overviews of biological importance of quercetin: a bioactive flavonoid. Pharmacogn Rev. 2016;10(20):84–9. 10.4103/0973-7847.194044 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231516.ref010] 10.Oskoueian E, Abdullah N, Oskoueian A. Effects of flavonoids on rumen fermentation activity, methane production, and microbial population. BioMed research international. 2013;2013: 1–8. 10.1155/2013/349129 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231516.ref011] 11.Pietta P, Minoggio M, Bramati L. Plant polyphenols: Structure, occurrence and bioactivity. InStudies in Natural Products Chemistry. 2003; 28: 257–312. 10.1016/S1572-5995(03)80143-6 [DOI] [Google Scholar]

[pone.0231516.ref012] 12.Wencelová M, Váradyová Z, Mihaliková K, Čobanová K, Plachá I, Pristaš P, et al. Rumen fermentation pattern, lipid metabolism and the microbial community of sheep fed a high-concentrate diet supplemented with a mix of medicinal plants. Small Rumin Res. 2015;125: 64–72. 10.1016/j.smallrumres.2015.01.028 [DOI] [Google Scholar]

[pone.0231516.ref013] 13.Szczechowiak J, Szumacher-Strabel M, El-Sherbiny M, Pers-Kamczyc E, Pawlak P, Cieslak A. Rumen fermentation, methane concentration and fatty acid proportion in the rumen and milk of dairy cows fed condensed tannin and/or fish-soybean oils blend. Anim Feed Sci Technol. 2016;216: 93–107. 10.1016/j.anifeedsci.2016.03.014 [DOI] [Google Scholar]

[pone.0231516.ref014] 14.Patra AK, Saxena J. Exploitation of dietary tannins to improve rumen metabolism and ruminant nutrition. J Sci Food Agric. 2011;91: 24–37. 10.1002/jsfa.4152 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref015] 15.Cieslak A, Stanisz M, Wojtowski J, Pers-Kamczyc E, Szczechowiak J, El-Sherbiny M, et al. Camelina sativa affects the fatty acid contents in M. longissimus muscle of lambs. Eur J Lipid Sci Technol. 2013;115: 1258–1265. 10.1002/ejlt.201200119 [DOI] [Google Scholar]

[pone.0231516.ref016] 16.Jenkins TC, Wallace RJ, Moate PJ, Mosley EE. Board-Invited Review: Recent advances in biohydrogenation of unsaturated fatty acids within the rumen microbial ecosystem. J Anim Sci. 2008;86: 397–412. 10.2527/jas.2007-0588 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref017] 17.Mravčáková D, Váradyová Z, Kopčáková A, Čobanová K, Grešáková Ľ, Kišidayová S, et al. Natural chemotherapeutic alternatives for controlling of haemonchosis in sheep. BMC Vet Res. 2019;15: 1–13. 10.1186/s12917-018-1758-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231516.ref018] 18.Lightbody JH, Stevenson LM, Jackson F, Donaldson K, Jones DG. Comparative aspects of plasma antioxidant status in sheep and goats, and the influence of experimental abomasal nematode infection. J Comp Pathol. 2001;124: 192–199. 10.1053/jcpa.2000.0453 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref019] 19.Bryszak M, Szumacher-Strabel M, El-Sherbiny M, Stochmal A, Oleszek W, Roj E, et al. Effects of berry seed residues on ruminal fermentation, methane concentration, milk production, and fatty acid proportions in the rumen and milk of dairy cows. J Dairy Sci. 2019;102: 1257–1273. 10.3168/jds.2018-15322 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref020] 20.Horwitz et al. Official methods of analysis. 18th ed Gaithersburg, MD; 2007. [Google Scholar]

[pone.0231516.ref021] 21.Van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J Dairy Sci. 1991;74: 3583–3597. 10.3168/jds.S0022-0302(91)78551-2 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref022] 22.Váradyová Z, Kišidayová S, Čobanová K, Grešáková, Babják M, Königová A, et al. The impact of a mixture of medicinal herbs on ruminal fermentation, parasitological status and hematological parameters of the lambs experimentally infected with Haemonchus contortus. Small Rumin Res. 2017;151: 124–132. 10.1016/j.smallrumres.2017.04.023 [DOI] [Google Scholar]

[pone.0231516.ref023] 23.Wolin MJ. A Theoretical Rumen Fermentation Balance. J Dairy Sci. 1960;43: 1452–1459. 10.3168/jds.S0022-0302(60)90348-9 [DOI] [Google Scholar]

[pone.0231516.ref024] 24.Broderick GA, Kang JH. Automated simultaneous determination of ammonia and total amino acids in ruminal fluid and in vitro media. J Dairy Sci. 1980;63: 64–75. 10.3168/jds.S0022-0302(80)82888-8 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref025] 25.Michalowski T, Harmeyer J, Breves G. The passage of protozoa from the reticulo-rumen through the omasum of sheep. Br J Nutr. 1986;56: 625–634. 10.1079/bjn19860143 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref026] 26.Zhong RZ, Li HY, Fang Y, Sun HX, Zhou DW. Effects of dietary supplementation with green tea polyphenols on digestion and meat quality in lambs infected with Haemonchus contortus. Meat Sci. 2015;105: 1–7. 10.1016/j.meatsci.2015.02.003 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref027] 27.Potu RB, AbuGhazaleh AA, Hastings D, Jones K, Ibrahim SA. The effect of lipid supplements on ruminal bacteria in continuous culture fermenters varies with the fatty acid composition. J Microbiol. 2011;49: 216–223. 10.1007/s12275-011-0365-1 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref028] 28.Li M, Penner GB, Hernandez-Sanabria E, Oba M, Guan LL. Effects of sampling location and time, and host animal on assessment of bacterial diversity and fermentation parameters in the bovine rumen. J Appl Microbiol. 2009;107: 1924–1934. 10.1111/j.1365-2672.2009.04376.x [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref029] 29.Denman SE, McSweeney CS. Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen. FEMS Microbiol Ecol. 2006;58: 572–582. 10.1111/j.1574-6941.2006.00190.x [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref030] 30.Wang RF, Beggs ML, Erickson BD, Cerniglia CE. DNA microarray analysis of predominant human intestinal bacteria in fecal samples. Mol Cell Probes. 2004;18: 223–234. 10.1016/j.mcp.2004.03.002 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref031] 31.Maeda H, Fujimoto C, Haruki Y, Maeda T, Kokeguchi S, Petelin M, et al. Quantitative real-time PCR using TaqMan and SYBR Green for Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, tetQ gene and total bacteria. FEMS Immunol Med Microbiol. 2003;39: 81–86. 10.1016/S0928-8244(03)00224-4 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref032] 32.Józefiak D, Kierończyk B, Juśkiewicz J, Zduńczyk Z, Rawski M, Długosz J, et al. Dietary nisin modulates the gastrointestinal microbial ecology and enhances growth performance of the broiler chickens. PLoS One. 2013;8: 1–11. 10.1371/journal.pone.0085347 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231516.ref033] 33.Soliva CR, Meile L, Cieślak A, Kreuzer M, Machmüller A. Rumen simulation technique study on the interactions of dietary lauric and myristic acid supplementation in suppressing ruminal methanogenesis. Br J Nutr. 2004;92: 689–700. 10.1079/bjn20041250 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref034] 34.Głogowski R, Czauderna M, Rozbicka A, Krajewska KA, Clauss M. Fatty acid profile of hind leg muscle in female and male nutria (Myocastor coypus Mol.), fed green forage diet. Meat Sci. 2010;85: 577–579. 10.1016/j.meatsci.2010.03.008 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref035] 35.Szczechowiak J, Szkudelska K, Szumacher-Strabel M, Sadkowski S, Gwozdz K, El-Sherbiny M, et al. Blood hormones, metabolic parameters and fatty acid proportion in dairy cows fed condensed tannins and oils blend. Ann Anim Sci. 2018;18: 155–166. 10.1515/aoas-2017-0039 [DOI] [Google Scholar]

[pone.0231516.ref036] 36.Vahmani P, Glover KE, Fredeen AH. Effects of pasture versus confinement and marine oil supplementation on the expression of genes involved in lipid metabolism in mammary, liver, and adipose tissues of lactating dairy cows. J Dairy Sci. 2014;97: 4174–4183. 10.3168/jds.2013-7290 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref037] 37.Jo C, Ahn DU. Fluorometric Analysis of 2-Thiobarbituric Acid Reactive Substances in Turkey. Poult Sci. 1998;77: 475–480. 10.1093/ps/77.3.475 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref038] 38.Brogna DMR, Nasri S, Salem H Ben, Mele M, Serra A, Bella M, et al. Effect of dietary saponins from Quillaja saponaria L. on fatty acid composition and cholesterol content in muscle Longissimus dorsi of lambs. Animal. 2011;5: 1124–1130. 10.1017/S1751731111000048 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref039] 39.Chilliard Y, Ferlay A, Rouel J, Lamberet G. A review of nutritional and physiological factors affecting goat milk lipid synthesis and lipolysis. J Dairy Sci. 2003;86: 1751–1770. 10.3168/jds.S0022-0302(03)73761-8 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref040] 40.SAS Institute Inc. SASOnlineDoc Version 9.3.SAS Institute Inc, Cary, NC: 2014. [Google Scholar]

[pone.0231516.ref041] 41.Sykes AR, Coop RL. Intake and utilization of food by growing lambs with parasitic damage to the small intestine caused by daily dosing with Trichostrongylus colubriformis larvae. J Agric Sci. 1976;86: 507–515. 10.1017/S0021859600061049 [DOI] [Google Scholar]

[pone.0231516.ref042] 42.Fox NJ, Smith LA, Houdijk JGM, Athanasiadou S, Hutchings MR. Ubiquitous parasites drive a 33% increase in methane yield from livestock. Int J Parasitol. 2018;48: 1017–1021. 10.1016/j.ijpara.2018.06.001 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref043] 43.Bodas R, Prieto N, García-González R, Andrés S, Giráldez FJ, López S. Manipulation of rumen fermentation and methane production with plant secondary metabolites. Anim Feed Sci Technol. 2012;176: 78–93. 10.1016/j.anifeedsci.2012.07.010 [DOI] [Google Scholar]

[pone.0231516.ref044] 44.García-González R, López S, Fernández M, Bodas R, González JS. Screening the activity of plants and spices for decreasing ruminal methane production in vitro. Anim Feed Sci Technol. 2008;147: 36–52. 10.1016/j.anifeedsci.2007.09.008 [DOI] [Google Scholar]

[pone.0231516.ref045] 45.Patra AK, Saxena J. A new perspective on the use of plant secondary metabolites to inhibit methanogenesis in the rumen. Phytochemistry. 2010;71: 1198–1222. 10.1016/j.phytochem.2010.05.010 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref046] 46.Cieslak A, Zmora P, Stochmal A, Pecio L, Oleszek W, Pers-Kamczyc E, et al. Rumen antimethanogenic effect of Saponaria officinalis L. phytochemicals in vitro. J Agric Sci. 2014;152: 981–993. 10.1017/S0021859614000239 [DOI] [Google Scholar]

[pone.0231516.ref047] 47.Patra AK, Yu Z. Effects of adaptation of in vitro rumen culture to garlic oil, nitrate, and saponin and their combinations on methanogenesis, fermentation, and abundances and diversity of microbial populations. Front Microbiol. 2015;6: 1–11. 10.3389/fmicb.2015.00001 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231516.ref048] 48.Patra AK. Recent advances in measurement and dietary mitigation of enteric methane emissions in ruminants. Front Vet Sci. 2016;3: 1–17. 10.3389/fvets.2016.00001 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231516.ref049] 49.Patra AK, Park T, Braun H-S, Geiger S, Pieper R, Yu Z, et al. Dietary bioactive lipid compounds rich in menthol alter interactions among members of ruminal microbiota in sheep. Front Microbiol. 2019;10: 1–18. 10.3389/fmicb.2019.00001 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231516.ref050] 50.El-Ashram S, Al Nasr I, Abouhajer F, El-Kemary M, Huang G, Dinçel G, et al. Microbial community and ovine host response varies with early and late stages of Haemonchus contortus infection. Vet Res Commun. 2017;41: 263–277. 10.1007/s11259-017-9698-5 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref051] 51.Patra A, Park T, Kim M, Yu Z. Rumen methanogens and mitigation of methane emission by anti-methanogenic compounds and substances. J Anim Sci Biotechnol. 2017;8: 1–18. 10.1186/s40104-016-0130-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231516.ref052] 52.Váradyová Z, Mravčáková D, Holodová M, Grešáková Ľ, Pisarčíková J, Barszcz M, et al. Modulation of ruminal and intestinal fermentation by medicinal plants and zinc from different sources. J Anim Physiol Anim Nutr (Berl). 2018;102: 1131–1145. 10.1111/jpn.12940 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref053] 53.Lanier SJ, Corl BA. Challenges in enriching milk fat with polyunsaturated fatty acids. J Anim Sci Biotechnol. 2015;6: 1–9. 10.1186/2049-1891-6-1 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231516.ref054] 54.Mcrae KM, Stear MJ, Good B, Keane OM. The host immune response to gastrointestinal nematode infection in sheep. Parasite Immunol. 2015;37: 605–613. 10.1111/pim.12290 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231516.ref055] 55.Berthelot V, Bas P, Pottier E, Normand J. The effect of maternal linseed supplementation and/or lamb linseed supplementation on muscle and subcutaneous adipose tissue fatty acid composition of indoor lambs. Meat Sci. 2012;90: 548–557. 10.1016/j.meatsci.2011.09.014 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref056] 56.Emmanuel B. The relative contribution of propionate, and long-chain even-numbered fatty acids to the production of long-chain odd-numbered fatty acids in rumen bacteria. Biochim. Biophys. Acta 1978;528: 239–246. 10.1016/0005-2760(78)90198-4 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref057] 57.Doreau M, Ferlay A. Digestion and utilisation of fatty acids by ruminants. Anim Feed Sci Technol. 1994;45: 379–396. 10.1016/0377-8401(94)90039-6 [DOI] [Google Scholar]

[pone.0231516.ref058] 58.Sinclair LA, Cooper SL, Chikunya S, Wilkinson RG, Hallett KG, Enser M, et al. Biohydrogenation of n-3 polyunsaturated fatty acids in the rumen and their effects on microbial metabolism and plasma fatty acid concentrations in sheep. Anim Sci. 2005;81: 239–248. 10.1079/ASC50040239 [DOI] [Google Scholar]

[pone.0231516.ref059] 59.Smith SB, Lunt DK, Chung KY, Choi CB, Tume RK, Zembayashi M. Adiposity, fatty acid composition, and delta-9 desaturase activity during growth in beef cattle. Anim Sci J. 2006;77: 478–486. 10.1111/j.1740-0929.2006.00375.x [DOI] [Google Scholar]

[pone.0231516.ref060] 60.Raes K, De Smet S, Demeyer D. Effect of dietary fatty acids on incorporation of long chain polyunsaturated fatty acids and conjugated linoleic acid in lamb, beef and pork meat: A review. Anim Feed Sci Technol. 2004;113: 199–221. 10.1016/j.anifeedsci.2003.09.001 [DOI] [Google Scholar]

[pone.0231516.ref061] 61.Bressan MC, Rossato L V., Rodrigues EC, Alves SP, Bessa RJB, Ramos EM, et al. Genotype × environment interactions for fatty acid profiles in Bos indicus and Bos taurus finished on pasture or grain. J Anim Sci. 2011;89: 221–232. 10.2527/jas.2009-2672 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref062] 62.Malau-Aduli AEO, Siebert BD, Bottema CDK, Pitchford WS. Breed comparison of the fatty acid composition of muscle phospholipids in Jersey and Limousin cattle. J Anim Sci. 1998;76: 766–773. 10.2527/1998.763766x [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref063] 63.Warren HE, Scollan ND, Enser M, Hughes SI, Richardson RI, Wood JD. Effects of breed and a concentrate or grass silage diet on beef quality in cattle of 3 ages. I: Animal performance, carcass quality and muscle fatty acid composition. Meat Sci. 2008;78: 256–269. 10.1016/j.meatsci.2007.06.008 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref064] 64.Wood JD, Enser M, Fisher A V., Nute GR, Sheard PR, Richardson RI, et al. Fat deposition, fatty acid composition and meat quality: A review. Meat Sci. 2008;78: 343–358. 10.1016/j.meatsci.2007.07.019 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref065] 65.Enoch HG, Catala A, Strittmatter P. Mechanism of rat liver microsomal stearyl-CoA desaturase. Studies of the substrate specificity, enzyme-substrate interactions, and the function of lipid. J Biol Chem. 1976;251: 5095–5103. [PubMed] [Google Scholar]

[pone.0231516.ref066] 66.Park WJ, Kothapalli KSD, Lawrence P, Tyburczy C, Brenna JT. An alternate pathway to long-chain polyunsaturates: The FADS2 gene product Δ8-desaturates 20:2n-6 and 20:3n-3. J Lipid Res. 2009;50: 1195–1202. 10.1194/jlr.M800630-JLR200 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231516.ref067] 67.Machado V, Da Silva AS, Schafer AS, Aires AR, Tonin AA, Oliveira CB, et al. Relationship between oxidative stress and pathological findings in abomasum of infected lambs by Haemonchus contortus. Pathol Res Pract. 2014;210: 812–817. 10.1016/j.prp.2014.09.006 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref068] 68.Váradyová Z, Mravčáková D, Babják M, Bryszak M, Grešáková Ľ, Čobanová K, et al. Effects of herbal nutraceuticals and/or zinc against Haemonchus contortus in lambs experimentally infected. BMC Vet Res. 2018;14: 1–12. 10.1186/s12917-017-1323-x [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231516.ref069] 69.Kumar P, Patra AK, Mandal GP, Debnath BC. Carcass characteristics, chemical and fatty acid composition and oxidative stability of meat from broiler chickens fed black cumin (Nigella sativa) seeds. J Anim Physiol Anim Nutr (Berl). 2018;102: 769–779. 10.1111/jpn.12880 [DOI] [PubMed] [Google Scholar]

[pone.0231516.ref070] 70.Qwele K, Hugo A, Oyedemi SO, Moyo B, Masika PJ, Muchenje V. Chemical composition, fatty acid content and antioxidant potential of meat from goats supplemented with moringa (Moringa oleifera) leaves, sunflower cake and grass hay. Meat Sci. 2013;93: 455–462. 10.1016/j.meatsci.2012.11.009 [DOI] [PubMed] [Google Scholar]

PERMALINK

Ruminal fermentation, microbial population and lipid metabolism in gastrointestinal nematode-infected lambs fed a diet supplemented with herbal mixtures

Paulina Szulc

Dominika Mravčáková

Malgorzata Szumacher-Strabel

Zora Váradyová

Marián Várady

Klaudia Čobanová

Linggawastu Syahrulawal

Amlan Kumar Patra

Adam Cieslak

Roles

Abstract

Introduction

Material and methods

Diet and supplements

Experimental design

In vitro experiment

In vivo experiment

Table 1. Chemical composition and fatty acid profile of the diets.

Sample analysis

Chemical composition of feed

Basic ruminal fermentation

Rumen microbial quantification

Fatty acids extraction and analysis

Gene expression with RT-qPCR

Blood analyses

Lipid oxidation

Calculations

Statistical analysis

Results

In vitro experiment

Table 2. The effect of herbal mixtures and infection on the rumen fermentation and microbial populations in vitro.

Table 3. The effect of herbal mixtures and infection on ruminal fatty acid proportions (g/100 g FA) in vitro.

In vivo experiment

Table 4. The effect of herbal mixtures on rumen fermentation and microbial populations in lambs with H. contortus infection.

Table 5. The effect of herbal mixtures on fatty acid proportions in ruminal fluid (g/100 g FA) in lambs with H. contortus infection.

Table 6. The effect of herbal mixture on fatty acid proportions (g/100 g FA) in the serum of lambs with H. contortus infection.

Table 7. The effect of herbal mixture on fatty acid proportions (g/100 g FA) in the liver of lambs with H. contortus infection.

Table 8. The effect of herbal mixture on fatty acid proportions (g/100 g FA) in the longissimus dorsi muscle of lambs with H. contortus infection.

Table 9. Effect of herbal mixture on fatty acid proportions (g/100 g FA) in the subcutaneous fat of lambs with H. contortus infection.

Table 11. Lipid peroxidation in serum and oxidative stability of meat in lambs with H. contortus infection.

Discussion

Conclusion

Supporting information

Acknowledgments

Abbreviations

Data Availability

Funding Statement

References

Decision Letter 0

Simon Russell Clegg

Roles

Author response to Decision Letter 0

Decision Letter 1

Simon Russell Clegg

Roles

Author response to Decision Letter 1

Decision Letter 2

Simon Russell Clegg

Roles

Acceptance letter

Simon Russell Clegg

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases