Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Oct 1.
Published in final edited form as: Clin Cancer Res. 2020 Jan 3;26(7):1690–1699. doi: 10.1158/1078-0432.CCR-19-2000

Restoration of Temozolomide Sensitivity by Poly(ADP-Ribose) Polymerase inhibitors in Mismatch Repair Deficient Glioblastoma is Independent of Base Excision Repair

Fumi Higuchi 1,2, Hiroaki Nagashima 1, Jianfang Ning 1,3, Mara VA Koerner 1, Hiroaki Wakimoto 1,*, Daniel P Cahill 1,*
PMCID: PMC7192178  NIHMSID: NIHMS1547504  PMID: 31900275

Abstract

Purpose:

Emergence of mismatch repair (MMR) deficiency is a frequent mechanism of acquired resistance to the alkylating chemotherapeutic temozolomide (TMZ) in gliomas. Poly(ADP-ribose) polymerase inhibitors (PARPi) have been shown to potentiate TMZ cytotoxicity in several cancer types, including gliomas. We tested whether PARP inhibition could re-sensitize MSH6-null MMR-deficient gliomas to TMZ, and assessed the role of the base excision repair (BER) DNA damage repair pathway in PARPi-mediated effects.

Methods:

Isogenic pairs of MSH6 wild-type and MSH6-inactivated human glioblastoma (GBM) cells (including both IDH1/2 wild-type and IDH1 mutant), as well as MSH6-null cells derived from a patient with recurrent GBM were treated with TMZ, the PARPi veliparib or olaparib, and combination thereof. Efficacy of PARPi combined with TMZ was assessed in vivo. We used genetic and pharmacological approaches to dissect the contribution of BER.

Results:

While having no detectable effect in MSH6 wild-type GBMs, PARPi selectively restored TMZ sensitivity in MSH6-deficient GBM cells. This genotype-specific restoration of activity translated in vivo, where combination treatment of veliparib and TMZ showed potent suppression of tumor growth of MSH6-inactivated orthotopic xenografts, compared with TMZ monotherapy. Unlike PARPi, genetic and pharmacological blockage of BER pathway did not re-sensitize MSH6-inactivated GBM cells to TMZ. Similarly, CRISPR PARP1 knockout did not re-sensitize MSH6-inactivated GBM cells to TMZ.

Conclusions:

PARPi restoration of TMZ chemosensitivity in MSH6-inactivated glioma represents a promising strategy to overcome acquired chemoresistance caused by MMR deficiency. Mechanistically, this PARPi-mediated synthetic phenotype was independent of BER blockage and was not recapitulated by loss of PARP1.

Keywords: Glioma, temozolomide, PARP inhibitor, Mismatch Repair, Base excision repair

Introduction

Mismatch repair (MMR) is one of the critical pathways responsible for repair of base-base mismatches arising during DNA replication or otherwise caused by DNA damage. MMR deficiency resulting from inactivating MMR gene mutations not only predisposes cells to tumorigenesis, but also affects a tumor cell’s response to DNA damaging agents. MMR deficiency causes drug resistance to alkylating agents that mediate the formation of O6 methylguanine-containing mismatches(1). Mechanistically, the recognition of alkylator-induced O6meG:T mismatches by the multiprotein complex MutSα (comprised of the heterodimer of MSH2 and MSH6) is thought to result in repeated replacement of the mispaired thymidine, rendering a futile cycle of replication/repair, and ultimately programmed cell death(2,3). In the absence of a functional MMR response, O6-meG:T is not targeted for this “futile repair” cycle, and the cells avoid programmed cell death and survive, albeit with the accumulation of a massive number of DNA mis-pairs, resulting in a characteristic cytidine-to-thymidine “hypermutator” phenotype(4).

Temozolomide (TMZ) is the most commonly used alkylator for gliomas, with significant clinical activity in both lower-grade tumors carrying isocitrate dehydrogenase 1 (IDH1) mutations(5,6), as well as primary IDH1-wild-type glioblastoma (GBM) exhibiting methylation of the O6-methyguanine DNA methyltransferase (MGMT) promoter(7,8). Unfortunately, prolonged treatment with TMZ is often followed by the development of acquired resistance to TMZ, contributing to malignant progression, tumor recurrence and mortality. Inactivation of mismatch repair (MMR) genes, i.e., MSH2, MSH6, MLH1 and PMS2, has been identified in both IDH mutant(9,10) and IDH wild-type(11,12) recurrent malignant gliomas that have been previously treated, whereas these alterations are extremely rare in primary tumors(13,14). Studies have identified MSH6 inactivation as a key molecular mechanism of acquired TMZ resistance in glioma cells(15), and strong association between TMZ treatment and the development of MMR deficiency in patient tumors(16). Furthermore, MMR alterations after TMZ treatment of low-grade gliomas are considered a driver for malignant progression to higher grade and a post-TMZ hypermutator phenotype(14).

To potentiate TMZ cytotoxicity, combination therapies that modulate DNA repair pathways have been evaluated as a potential strategy to overcome TMZ resistance. TMZ induces not only Ome6G but also large numbers of N3-methyladenine and N7-methylguanine adducts that are rapidly processed by the base excision repair (BER) DNA repair pathway. N3-methyladenine and N7-methylguanine lesions activate the nuclear enzyme poly (ADP-ribose) polymerases (PARPs) which synthesize poly(ADP-ribose) chains (PARylation) and facilitate the recruitment of XRCC1, pol-beta and DNA ligase to the DNA strand break sites, thus playing an critical role in the initiation of BER machinery. PARPi combinations have been shown to increase TMZ sensitivity in the treatment of various cancer cell types(17–20), and are under active investigation in IDH wild-type(21,22) and IDH mutant(23,24) gliomas. Because of the documented role of PARP in single-strand break repair and BER, PARP inhibitor (PARPi) mediated potentiation of TMZ sensitivity has been speculated to be due to its inhibition of BER, nevertheless direct evidence is lacking.

Here, we show that PARPis restore TMZ sensitivity in MSH6-inactivated, MMR-deficient TMZ resistant gliomas (both IDH wild-type and IDH mutant) in vitro and in vivo. Notably, this restoration effect is selectively observed in MSH6-inactivated cells, representing a genotype-specific synthetic phenotype. Furthermore, PARPi mediated restoration of TMZ sensitivity is independent of BER, as we show that genetic and pharmacological blockage of BER pathway enzymes and PARP1 knock-out fail to recapitulate this phenotype.

Materials and Methods

Cell and Compounds

Human glioblastoma cell line LN229 was obtained from the American Type Culture Collection (ATCC, Manassas, VA) and was authenticated in 2017 by comparison of STR profile to the ATCC public dataset. Gli36 was provided by Dr. Khalid Shah, Boston, MA. Normal Human Astrocyte (NHA) was purchased from ScienCell. LN229 and NHA were maintained in Delbecco’s modified Eagle medium (DMEM) with 4.5g/L glucose, L-glutamine and sodium pyruvate supplemented with 10% fetal bovine serum and 1% Penicillin/Streptomycin/Amphotericin. Patient-derived glioma neurosphere lines (MGG4, MGG123, MGG152) were established from patient tumors and cultured in serum-free neural stem cell medium as described previously.(25–27) Temozolomide and Methoxamine were purchased from Sigma. Veliparib was from APE-BIO, Olaparib was from Selleckchem and APE inhibitor was from EMD MILLIPORE.

Cell viability assay

Cells were seeded in 96-well plates at 1,000–2,000 cells per well. After overnight incubation, compounds were serially diluted and added to wells. Cell viability was evaluated on day 6 by Cell Titer Glo (Promega) according to the manufacturer’s instruction.

Western blot analysis

Cells were lysed in radioimmunoprecipitation (RIPA) buffer (Boston Bioproducts) with a cocktail of protease and phosphatase inhibitors (Roche). Protein (10–15 ug) was separated by 4–20% SDS-PAGE and transferred to polyvinylidene difluoride membranes by electroblotting. After blocking with 5% non-fat dry milk in TBS-T (20 mM Tris [pH,7.5] 150mM NaCl, 0.1% Tween20) for 1–2 hours at room temperature, membranes were incubated with primary antibody at 4°C overnight. Membranes were washed in TBS-T and incubated with appropriate peroxidase conjugated secondary antibodies for 1 hour at room temperature. Signals were visualized using the enhanced chemiluminescense (ECL) kit (Amersham Bioscience). Primary antibodies used were: MSH6 (#5425), XRCC1 (#2735) (Cell Signal Technology), PARP1 (sc-8007)(Santa Cruz) and β-actin (A1978)(Sigma).

MSH6-shRNA, XRCC1-shRNA and PARP1-knockout cell lines generation

Lentivirus vector plasmids containing shRNA sequences for MSH6 (TRCN0000286578 shMSH6no.1) and XRCC1 (TRCN0000007913 no.1, TRCN0000011211 no.2), and non-targeting shRNA sequence (SHC002 shNS) were obtained from Sigma. shMSH6no.2, a second shRNA for MSH6, was from Dharmacon (V3LHS 318784). For PARP1 knockout, lentivirus vector plasmids containing SpCas9 (pLentiCRISPR v2) with/without sgRNA sequences for PARP1 (No.1:TTCTAGTCGCCCATGTTTGA, No.2: CCCCTTGCACGTACTTCTGT) were obtained from GenScript. To generate lentiviral particles, 293T cells were transfected with a lentiviral plasmid, packaging plasmid (pCMV-dR8.2), and envelope plasmid (pCMV-VSV-G) with FuGene (Promega). Cells were infected with lentivirus in the presence of polybrene (8 μg/ml) for 8 hours. Three days later, cells were selected with puromycin (0.6 μg/ml for LN229, 0.2 μg/ml for Gli36, MGG4 and MGG152) for 3–4 days before use. Knockdown and knockout were confirmed by western blot.

Animal Study

Five million LN229-shNS cells and LN229-MSH6sh1 cells were implanted subcutaneously into the flank of 7-week-old female nude mice (NCI). When the maximum diameter of established tumors reached 5 mm, mice were randomized and treated with PBS (n=6), TMZ (n=6, 50mg/kg i.p.), Veliparib (n=6, 50mg/kg oral gavage), TMZ plus Veliparib (n=6) 5 consecutive days per week for 2 cycles with one week interval before the second treatment cycle. TMZ was dissolved in DMSO, diluted with PBS and injected intraperitoneally. Veliparib was dissolved in DMSO, diluted with 10% 2-hydroxyl-propul-β-dextrine/PBS and administrated orally. Tumor diameters were measured twice a week using a digital caliper. Tumor volumes were calculated using the formula: tumor volume (mm3) = tumor length × tumor width2 /2. Orthotopic model of MSH6-deficient glioblastoma was established by intracerebral implantation of 5×105 LN229-MSH6sh1 cells in 7-week-old female nude mice (NCI) as previously described.(26) Seven days later, mice were randomized and treated with PBS (n=5), TMZ (n=5), TMZ plus Veliparib (n=5) at the same doses and schedules as the flank model. Animals were euthanized when significant deterioration of neurological or general conditions was noted. All animal procedures were approved by Institutional Animal Care and Use Committee at Massachusetts General Hospital.

Statistical Methods

The Prism (GraphPad) software package was used for statistical analysis. Comparisons between 2 groups were done with Student t-test (unpaired). Differences of tumor volumes were analyzed by non-parametric Mann-Whitney test. Survival analysis was performed using the Kaplan-Meier method, and the log-rank test (two-sided) was used to compare survival differences between treatment arms. P values less than 0.05 were considered statistically significant.

RESULTS

PARP inhibitors restored TMZ sensitivity in MSH6-inactivated glioblastoma cell lines and patient-derived MSH6 deficient glioblastoma cells.

We used lentivirus vectors expressing MSH6 shRNA or control (non-targeting, NS) shRNA to establish an isogenic model system of MSH6 inactivation using GBM cell lines (LN229 and Gli36) and patient-derived GBM sphere lines, (MGG4, primary IDH1 wild-type GBM; and MGG152, recurrent, IDH1 mutant GBM)(28)(Figure 1A–C, Supplementary Fig.1D). As expected, these shMSH6 cell lines showed TMZ resistance across a wide range of TMZ doses (Supplementary Fig. 1A–D). MSH6 knockdown did not alter sensitivity to PARPi monotherapy in LN229 (Figure 1D). Combination treatment with TMZ and PARPi, at PARPi doses only marginally (<20%) cytotoxic as monotherapy, greatly restored TMZ sensitivity across shMSH6 GBM cell lines (Figure 1A–C, Supplementary Fig.1E). Importantly, PARPis had no, or only marginal, additional effects on TMZ-induced reduction of cell viability in MSH6 proficient control (shNS) GBM cells (Figure 1A–C, Supplementary Fig.1E). Testing of a second independent shRNA sequence targeting MSH6 in LN229 and Gli36 showed induction of TMZ resistance and similar restoration of TMZ sensitivity by PARPis, suggesting on-target effects of the two shRNAs (Supplementary Fig. 1F–I). The second shRNA for MSH6 also confirmed that MSH6 silencing did not meaningfully alter response to PARPis (Supplementary Fig. 1J). Next, we tested PARPis in a patient-derived GBM neurosphere line (MGG123) that was derived from a GBM that recurred after TMZ treatment. We confirmed that MGG123 had loss of MSH6 and exhibited high resistance to TMZ (Figure 1E). In accord with the results with MSH6 knockdown GBM cells, PARPi treatment restored response to TMZ in MSH6 deficient MGG123 even when PARPi monotherapy had a marginal effect (Figure 1F). The combination of TMZ and veliparib had only modest toxicity for proliferating human normal astrocytes compared with TMZ monotherapy (Figure 1G).

Figure 1. PARP inhibitors restore sensitivity to temozolomide in MSH6-inactivated, temozolomide resistant glioblastoma cells.

Figure 1.

(A-D) Glioblastoma (GBM) cell lines (LN229 and Gli36) and patient-derived GBM sphere lines (MGG152) were engineered with a non-targeting shRNA (shNS) or MSH6-directed shRNA (shMSH6no.1) lentivirus. Immunoblot confirmed MSH6 knockdown, with Actin as a loading control. Cells were treated with temozolomide (TMZ), Veliparib/Olaparib or TMZ combination with Veliparib/Olaparib, and cell viability was evaluated by Cell Titer Glo on day 6. A: LN229 (TMZ 200 uM, Veliparib 3 uM, Olaparib 1uM) B: Gli36 (TMZ 30 uM, Veliparib 1 uM, Olaparib 0.5uM) C: MGG152(TMZ 200 uM, Veliparib 3 uM, Olaparib 1uM). * P<0.05, **P<0.001, *** P<0.0001 (student t-test). (D) Cell viability assay for Veliparib(left)/Olaparib(right) dose response in LN229shNS and LN229shMSH6no.1. Cell viability was evaluated by Cell Titer Glo on day 6. (E) Immunoblot showing loss of MSH6 in MGG123 with MGG4 as a positive control. Cell viability assay to determine TMZ dose response in MGG123. Cells were treated with specified concentrations of TMZ, and cell viability was evaluated by Cell Titer Glo on day 6. (F) MGG123 cells were treated with TMZ, Veliparib/Olaparib, or TMZ combination with Veliparib/Olaparib, and cell viability was evaluated by Cell Titer Glo on day 6. ** P<0.005 (student t-test). (G) Cell viability assay for TMZ dose response with/without Veliparib (3.3 uM) in normal human astrocytes (NHA). Cell viability was evaluated by Cell Titer Glo on day 6.

Veliparib combination with TMZ inhibits tumor growth of MSH6-deficient glioblastoma compared with TMZ monotherapy

To assess the effects of veliparib combination with TMZ on MSH6-deficient GBM in vivo, we treated nude mice bearing LN229-shNS and LN229-shMSH6 flank tumors with vehicle, veliparib alone, TMZ alone, or TMZ combination with veliparib. Veliparib alone had no effect on tumor growth compared to vehicle in both LN229-shNS and LN229-shMSH6 tumor models, consistent with the results obtained in vitro. Both TMZ and combination showed potent inhibition of LN229-shNS tumor growth – adding veliparib to TMZ provided no significant therapeutic benefit to TMZ alone (Figure 2A). In the LN229-shMSH6 tumor model, however, the combination treatment of veliparib with TMZ significantly inhibited tumor outgrowth better than TMZ monotherapy. (*P=0.019, day32 TMZ vs TMZ + veliparib, student t-test), (Figure 2A). We further tested the effect of veliparib combination with TMZ in mice harboring intracerebral LN229 MSH6-knockdown GBM xenografts. We omitted the group of veliparib monotherapy given the lack of efficacy in flank tumor models. One week after intracerebral implantation, animals started receiving TMZ alone or TMZ combined with veliparib treatment. Veliparib combination with TMZ resulted in an extension of animal survival (P=0.02; long lank test), compared with TMZ alone that did not extend survival in this model (Figure 2B). During the treatment, animals receiving the regimens involving TMZ lost 10% body weight, however they recovered promptly after completion of treatment. Combining veliparib with TMZ did not confer additional toxicity as the body weights of TMZ and combination groups were comparable (Figure 2C).

Figure 2. Veliparib combination treatment with TMZ delays tumor growth of MSH6-deficient glioblastoma.

Figure 2.

(A) Tumor growth curves in the LN229shNS (left) and LN229shMSH6 (right) flank xenograft models. Animals were treated with PBS (n=6), Veliparib alone (50 mg/kg oral, 5 days/week × 2 cycles)(n=6), TMZ alone (50 mg/kg i.p., 5 days/week × 2 cycles) (n=6), and TMZ plus Veliparib (n=6). Data are presented as mean tumor volume and SEM in each group. (*P=0.019, TMZ vs TMZ + Veliparib on day 32, Student t- test) (B) Kaplan-Meier analysis of mice bearing LN229shMSH6 orthotopic glioblastoma that were treated with TMZ alone or TMZ combination with Veliparib. Animals were treated with PBS (n=5), TMZ alone (50 mg/kg i.p. 5 days/week × 2 cycles) (n=5), or TMZ plus Veliparib (50 mg/kg oral, 5 days/week × 2 cycles) (n=5). *P=0.02, TMZ vs TMZ + Veriparib (log-rank test). NS, non-significant. (C) Median body weights of mice with flank LN229shNS tumors for each treatment groups (same experiment as A). Bars are SD. Weight was measured daily during treatments) or every two days after treatment.

PARP inhibitor restoration of TMZ sensitivity is independent of BER signaling blockage.

PARPis including veliparib potentiate TMZ-induced cytotoxicity in diverse tumor types(17–20). A proposed mechanism of this PARPi effect is mediated via inhibition of DNA single-strand break (SSB) repair via interfering with BER pathway (Figure 3A). The BER inhibitors Methoxyamine (MeOX) and APE inhibitor (APEi) have been reported to potentiate the cytotoxicity of alkylating agents including TMZ by disrupting BER through an accumulation of mutagenic and toxic apurinic/apyrimidinic (AP) sites (APEi) or preventing AP endodeoxyribonuclease cleavage (MeOX)(29–32)(Figure 3A). Therefore, we tested APEi and MeOX to determine whether these BER pathway inhibitors could recapitulate the observed PARPi mediated re-sensitization to TMZ in LN229-shMSH6 and Gli36-shMSH6 cells. APEi alone was less cytotoxic to MSH6 silenced Gli36 cells as compared with control cells (Figure 3D). To our surprise, unlike PARPi, neither of these BER repair-modulating drugs re-sensitized MSH6 knockdown cells to TMZ, even at concentrations that displayed signs of toxicity as a single agent (Figure 3B–E).

Figure 3. PARP inhibitor restoration of TMZ sensitivity is not through BER signaling blockage.

Figure 3.

(A) A scheme of Base Excision Pathway showing PARPs, other key proteins and their inhibitors. (B, C) Non-targeting (shNS) and MSH6 knockdown (shMSH6no.1) LN229 cells were treated with TMZ (200 uM), APE inhibitor (1 uM, in B), MeOX (3 mM, in C), or TMZ combination with APE inhibitor (B) or MeOX (C). Cell viability was evaluated by Cell Titer Glo on day 6.(D,E) Same experiments as B and C using Gli36shNS and Gli36shMSH6no.1. TMZ (30 uM), APE inhibitor (1 uM, in D), MeOX (3 mM, in E) (F) LN229 cells were engineered with a non-targeting (shNS), MSH6-directed (shMSH6) or XRCC1-directed shRNA (shXRCC1–1, shXRCC1–2) lentivirus or both shMSH6 and shXRCC1. Immunoblot confirmed knockdown of MSH6 and XRCC1. Actin was used as a loading control. (G) LN229shNS, LN229shMSH6, LN229shXRCC1–1, LN229shMSH6/XRCC1–1 cells were treated with TMZ (200 uM), PARP inhibitor (veliparib, 3 uM, in E; olaparib, 1 uM, in F) or TMZ combination with PARP inhibitor. Cell viability was evaluated by Cell Titer Glo on day 6. (H) Same experiments as E and F using a second shRNA, XRCC1–2. *P<0.005, **P<0.0005, ***P<0.0001 (student t-test).

The scaffold protein XRCC1 plays a major role in coordinating BER by interacting with polymerase beta, PARP and DNA ligase III at sites of DNA damage (Figure 3A). XRCC1-deficient mouse embryonic fibroblasts have been shown to exhibit hyper-sensitivity to alkylating agents (33). We evaluated whether shRNA knockdown of XRCC1 altered TMZ sensitivity in our isogenic GBM cells with and without MSH6 knockdown (Figure 3F). XRCC1 knockdown did not alter the TMZ resistant phenotype of shMSH6 GBM cells and this was consistent with two independent shRNA constructs (Figure 3G,H, Supplementary Fig. 2A, B). With intact MSH6, XRCC1 silencing rendered GBM cells slightly but significantly less responsive to TMZ (Figure 3G,H, Supplementary Fig. 2A, B), unlike what was reported with Xrcc1−/− mouse embryonic fibroblasts (33,34). XRCC1 knockdown did not significantly alter response to PARPi in MSH6 wild-type and knockdown GBM cells. (Figure 3GH, Supplementary Fig. 2C). Notably however, both veliparib and olaparib retained the ability to restore TMZ sensitivity in GBM cells that had dual knockdown of MSH6 and XRCC1 (Figure 3G,H); we did not observe additional therapeutic benefit by silencing XRCC1. These results indicate that PARPi restoration of TMZ sensitivity in MSH6 inactivated GBM cells was not due to its blockage of BER signaling.

PARP inhibitor restoration of TMZ sensitivity is independent of PARP1

The biological effects mediated by PARPis are distinct from PARP knockdown, and PARPis often confer greater cytotoxicity than PARP1 knockdown when combined with TMZ (35,36). PARPis physically impair the dissociation of PARP from DNA, which is required for the proper progress of repair process, and this “PARP trapping” at DNA damage sites has been shown, in certain contexts, to be more cytotoxic than persistent SSBs in the absence of PARP(37). PARPi have varying degrees of “PARP trapping” (olaparib greater than veliparib), and the possible involvement of this mechanism motivated us to test whether PARP1 knockdown restores TMZ sensitivity in MSH6-deficient cells as was observed with PARPis.

We used CRISPR-Cas9 lentivirus to inactivate PARP1 in our isogenic LN229 cells with and without MSH6 inactivation (Figure 4A). Two independent sgRNAs for PARP1 consistently rendered shMSH6 GBM cells less responsive to PARPis, reflecting loss of their main target (Figure 4B). Strikingly, PARP1 knockout did not alter responsiveness to TMZ in both MSH6 intact and MSH6 deficient GBM cells (Figure 4C, D). Furthermore, analogous to what was observed with BER inhibitors, both veliparib and olaparib re-sensitized GBM cells with double silencing of MSH6/PARP1 to TMZ (Figure 4E, F). These results show that PARP1 knockout does not recapitulate the PARPi-mediated effect of TMZ re-sensitization in MSH6 deficient GBM cells.

Figure 4. PARP inhibitors restore TMZ sensitivity in MSH6-deficient, PARP1 knockout glioblastoma cells.

Figure 4.

(A) LN229 parental cells and LN229shMSH6 cells were engineered with a non-targeting CRISPR-Cas9 (control) or PARP1 CRISPR-Cas9 (PARP1 no.1, PARP1 no.2) lentivirus. Immunoblot confirmed PARP1 knockout (KO). Actin was used as a loading control. (B) Veliparib (left) or Olaparib (right) dose response in shMSH6LN229 cells with CRISPR-Cas9 control, and PARP1 KO no.1 and no.2. (C, D) TMZ dose response in MSH6 intact LN229 cells, with and without PARP1KO no.1 and no.2 (C) and in MSH6 intact LN229 cells, and shMSH6LN229 cells with and without PARP1KO no.1 and no.2 (D). (E, F) shMSH6LN229 cells with control (CRISPR-Cas9), and PARP1KO no.1 and no.2 were treated with TMZ (200 uM), PARP inhibitor or TMZ combination with PARP inhibitor. (E) Veliparib 3 uM. (F) Olaparib 3 uM. Cell viability was evaluated by Cell Titer Glo on day 6 in B-F. *P<0.005, **P<0.00 (student t-test).

DISCUSSION

Multiple National Cancer Institute (NCI) consortia sponsored trials are investigating the potential efficacy of PARPi in combination with TMZ in both newly-diagnosed (NCT02152982, NCT00770471) and recurrent (NCT01026493, NCT01390571) GBM (38). Notably, preclinical studies have shown that gliomas can have upfront variability to PARPi when combined with TMZ, with TMZ-sensitive MGMT promoter methylated GBMs noted to be responders(21,22,39). It is important to understand mechanisms underlying the potentiation effect by PARPi and to identify molecularly defined subsets of gliomas that likely benefit from this combination treatment.

We here show that PARPi restores TMZ cytotoxicity selectively in GBM cells characterized by MMR-mediated TMZ resistance, both in vitro and in vivo. MSH6 knockdown did not alter sensitivity to PARPi, and PARPi monotherapy itself had little effect in either MMR deficient or wild-type cells. Therefore, enhanced cytotoxicity was not the result of a traditional synthetic lethal interaction, as described previously for PARP inhibition and homologous recombination repair deficiency resulting from BRCA gene alterations(40) or IDH mutations(23,24). Our findings are consistent with reports showing that PARPi potentiation of TMZ cytotoxicity is limited to tumors that are intrinsically resistant to TMZ or have acquired resistance(41,42). Our studies conclusively demonstrate, in experiments using isogenic cell models across a large panel of GBM lines, and in an orthotopic model, that MMR deficiency arising in gliomas from MSH6 inactivation is a unique molecular alteration predicting PARPi restoration of TMZ chemosensitivity. Importantly, relatively low concentrations of PARPi were sufficient to re-sensitize MMR-deficient glioma cells to TMZ, contrasting to negligible combination effect seen in MMR-proficient control cells at the same PARPi concentrations. Together with significant in vivo efficacy and safety in our orthotopic mouse model, our results suggest a wide therapeutic window that could be clinically meaningful for dosing regimens that otherwise circumvent toxicity issues reported in early veliparib combination trials (43).

From a mechanistic standpoint, it is well-established that the majority of TMZ-induced adducts are N3-methyladenine and N7-methylguanine which are rapidly processed by BER machinery, whereas O6meG adducts, despite accounting for only 5% of total lesions, are responsible for TMZ cytotoxicity. In the combination treatment of PARPi with TMZ, PARPi has been postulated to impair BER by inhibiting PARP-mediated PARylation and cause cytotoxicity through increasing N3-methyladenine and N7-methylguanine-induced damages (44,45). In accord with this working hypothesis, alterations to BER enzymes result in cell death by an accumulation of toxic and mutagenic BER intermediates after treatment with alkylating agents(46). Disruption of BER via APE inhibition and XRCC1 inactivation might be expected to therefore lead to the restoration or potentiation of TMZ sensitivity. However, our results show that BER perturbation by APE inhibition and XRCC1 inactivation does not recapitulate the effects of PARPis in MMR deficient, TMZ-resistant glioma cells. Furthermore, PARPi restoration of TMZ responsiveness was not affected by XRCC1 genetic inactivation, and there was no benefit in combining PARPi and XRCC1 depletion, consistent with the combination effects of PARPi 4-AN and TMZ seen in Xrcc1−/− mouse embryonic fibroblasts(34). Together, these data strongly suggest that PARPi-mediated re-sensitization to TMZ in MMR-deficient glioma cells is independent of BER pathway inactivation.

PARPi exert anti-cancer effects via not only catalytic inhibition of PARPs but also trapping PARPs on sites of DNA damage, and these diverse PARPi functions explain why PARPi and PARP1 knockout often have different biological effects. Indeed, we observed a striking discrepancy between the phenotypes of PARPi when compared to genetic PARP1 knockout as only the former not the latter sensitized MSH6 deficient GBM cells to TMZ. We found that PARPi (particularly olaparib) combination therapy with TMZ for MMR deficient glioma does not appear to depend on the expression levels of PARP1, as a mediator of PARP-trapping damage signaling, further suggesting that PARP1 trapping may not play a major role in this phenotype. Notably, veliparib, which has a lesser trapping ability than olaparib, was still capable of restoring sensitivity to TMZ in the absence of PARP1. The known targets of veliparib and olaparib include PARP1 and 2 (47,48), but these inhibitors could cross-target other PARP enzymes, as has been reported for the ability of olaparib to inhibit PARP3 (49). Thus, while catalytic inhibition of PARP1 alone is not sufficient, catalytic inhibition and/or selective trapping of other PARP family members is necessary for producing chemo-sensitization of MMR-deficient glioma cells. Although the functions of many of seventeen known PARP family members have not been characterized, PARP2, 3 and 10 (50,51) have been shown to participate in DNA damage repair. These PARPs are potential candidate mediators of the observed PARPi-mediated restoration of TMZ sensitivity in MMR-deficient cells.

In summary, we demonstrate that PARPi combination with TMZ selectively restores chemosensitivity in MSH6-inactivated, MMR-deficient GBM cells. These results identify a genetically-defined subgroup of recurrent gliomas which may benefit from combination therapy of TMZ and PARPis. Our findings therefore support the assessment of TMZ combination with veliparib, or olaparib which is also brain penetrant(52), in glioma patients selected for MMR deficiency. From a mechanistic standpoint, we also show that this restoration effect does not require PARP1 and is independent of BER pathway, which has significant implications for our understanding of the pathways underlying the combination treatment effect. Further studies are needed to understand the precise mechanisms of PARPi chemo-restoration to dissect the functions of PARPs that are targeted by this PARPi effect.

Supplementary Material

1
2
3

Translational Relevance:

There is a keen interest to investigate the efficacy of PARPi combination with TMZ in gliomas, and multiple National Cancer Institute (NCI) consortia sponsored trials are underway. However, preclinical studies in gliomas have shown variable responses to the combination treatment, and molecular biomarkers to identify subgroups which benefit from PARPi combination with TMZ are still elusive. Meanwhile, multiple studies have identified MSH6 inactivation as a key molecular mechanism of acquired TMZ resistance in glioma cells in vitro, and the development of MMR deficiency in post-treatment gliomas in clinical tumor specimens. We here show MMR deficiency mediated by MSH6 inactivation is a unique molecular alteration predicting PARPi restoration of TMZ chemosensitivity. Furthermore, we demonstrate that the PARPi re-sensitization effect is independent of BER blockage, revealing a distinct therapeutic impact of PARPi.

Financial Support:

Burroughs Wellcome Fund Career Award (D. Cahill), NIH R01CA227821 (D. Cahill and H. Wakimoto), P50CA165962 (D. Cahill), Tawingo fund (D. Cahill), Loglio fund (D. Cahill), OligoNation fund (D. Cahill).

Footnotes

Conflicts of Interest: All authors have no conflicts of interest to report with regard to this manuscript.

Disclosures:

D. Cahill has received honoraria and travel reimbursement from Merck, and has served as a consultant for Lilly.

References

  • 1.Martin SA, Lord CJ, Ashworth A. Therapeutic targeting of the DNA mismatch repair pathway. Clin Cancer Res 2010;16(21):5107–13 doi 10.1158/1078-0432.CCR-10-0821. [DOI] [PubMed] [Google Scholar]
  • 2.Yoshioka K, Yoshioka Y, Hsieh P. ATR kinase activation mediated by MutSalpha and MutLalpha in response to cytotoxic O6-methylguanine adducts. Mol Cell 2006;22(4):501–10 doi S1097-2765(06)00291-7[pii] 10.1016/j.molcel.2006.04.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Wang JY, Edelmann W. Mismatch repair proteins as sensors of alkylation DNA damage. Cancer Cell 2006;9(6):417–8 doi S1535-6108(06)00150-4[pii] 10.1016/j.ccr.2006.05.013. [DOI] [PubMed] [Google Scholar]
  • 4.Branch P, Aquilina G, Bignami M, Karran P. Defective Mismatch Binding and a Mutator Phenotype in Cells Tolerant to DNA Damage. Nature 1993;362(6421):652–4. [DOI] [PubMed] [Google Scholar]
  • 5.van den Bent MJ, Baumert B, Erridge SC, Vogelbaum MA, Nowak AK, Sanson M, et al. Interim results from the CATNON trial (EORTC study 26053–22054) of treatment with concurrent and adjuvant temozolomide for 1p/19q non-co-deleted anaplastic glioma: a phase 3, randomised, open-label intergroup study. Lancet 2017;390(10103):1645–53 doi 10.1016/S0140-6736(17)31442-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Wahl M, Phillips JJ, Molinaro AM, Lin Y, Perry A, Haas-Kogan DA, et al. Chemotherapy for adult low-grade gliomas: clinical outcomes by molecular subtype in a phase II study of adjuvant temozolomide. Neuro Oncol 2017;19(2):242–51 doi 10.1093/neuonc/now176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Hegi ME, Diserens A, Gorlia T, Hamou M, de Tribolet N, Weller M, et al. MGMT gene silencing and benefit from temozolomide in glioblastoma. New England Journal of Medicine 2005;352(10):997–1003. [DOI] [PubMed] [Google Scholar]
  • 8.Stupp R, Hegi ME, Mason WP, van den Bent MJ, Taphoorn MJ, Janzer RC, et al. Effects of radiotherapy with concomitant and adjuvant temozolomide versus radiotherapy alone on survival in glioblastoma in a randomised phase III study: 5-year analysis of the EORTC-NCIC trial. Lancet Oncol 2009;10(5):459–66 doi S1470-2045(09)70025-7[pii] 10.1016/S1470-2045(09)70025-7. [DOI] [PubMed] [Google Scholar]
  • 9.Johnson BE, Mazor T, Hong C, Barnes M, Aihara K, McLean CY, et al. Mutational analysis reveals the origin and therapy-driven evolution of recurrent glioma. Science 2014;343(6167):189–93 doi 10.1126/science.1239947. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Choi S, Yu Y, Grimmer MR, Wahl M, Chang SM, Costello JF. Temozolomide-associated hypermutation in gliomas. Neuro Oncol 2018;20(10):1300–9 doi 10.1093/neuonc/noy016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Hunter C, Smith R, Cahill DP, Stephens P, Stevens C, Teague J, et al. A hypermutation phenotype and somatic MSH6 mutations in recurrent human malignant gliomas after alkylator chemotherapy. Cancer Res 2006;66(8):3987–91 doi 66/8/3987[pii] 10.1158/0008-5472.CAN-06-0127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.TCGA NCGAI. Comprehensive genomic characterization defines human glioblastoma genes and core pathways. Nature 2008;455(7216):1061–8 doi nature07385[pii] 10.1038/nature07385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Maxwell JA, Johnson SP, McLendon RE, Lister DW, Horne KS, Rasheed A, et al. Mismatch repair deficiency does not mediate clinical resistance to temozolomide in malignant glioma. Clin Cancer Res 2008;14(15):4859–68 doi 14/15/4859[pii] 10.1158/1078-0432.CCR-07-4807. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.van Thuijl HF, Mazor T, Johnson BE, Fouse SD, Aihara K, Hong C, et al. Evolution of DNA repair defects during malignant progression of low-grade gliomas after temozolomide treatment. Acta Neuropathol 2015;129(4):597–607 doi 10.1007/s00401-015-1403-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Yip S, Miao J, Cahill DP, Iafrate AJ, Aldape K, Nutt CL, et al. MSH6 mutations arise in glioblastomas during temozolomide therapy and mediate temozolomide resistance. Clin Cancer Res 2009;15(14):4622–9 doi 1078-0432.CCR-08-3012[pii] 10.1158/1078-0432.CCR-08-3012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Cahill DP, Levine KK, Betensky RA, Codd PJ, Romany CA, Reavie LB, et al. Loss of the mismatch repair protein MSH6 in human glioblastomas is associated with tumor progression during temozolomide treatment. Clin Cancer Res 2007;13(7):2038–45 doi 13/7/2038[pii] 10.1158/1078-0432.CCR-06-2149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Tentori L, Leonetti C, Scarsella M, D’Amati G, Vergati M, Portarena I, et al. Systemic administration of GPI 15427, a novel poly(ADP-ribose) polymerase-1 inhibitor, increases the antitumor activity of temozolomide against intracranial melanoma, glioma, lymphoma. Clin Cancer Res 2003;9(14):5370–9. [PubMed] [Google Scholar]
  • 18.Curtin NJ, Wang LZ, Yiakouvaki A, Kyle S, Arris CA, Canan-Koch S, et al. Novel poly(ADP-ribose) polymerase-1 inhibitor, AG14361, restores sensitivity to temozolomide in mismatch repair-deficient cells. Clinical Cancer Research 2004;10(3):881–9. [DOI] [PubMed] [Google Scholar]
  • 19.Delaney CA, Wang LZ, Kyle S, White AW, Calvert AH, Curtin NJ, et al. Potentiation of temozolomide and topotecan growth inhibition and cytotoxicity by novel poly(adenosine diphosphoribose) polymerase inhibitors in a panel of human tumor cell lines. Clin Cancer Res 2000;6(7):2860–7. [PubMed] [Google Scholar]
  • 20.Miknyoczki SJ, Jones-Bolin S, Pritchard S, Hunter K, Zhao H, Wan W, et al. Chemopotentiation of temozolomide, irinotecan, and cisplatin activity by CEP-6800, a poly(ADP-ribose) polymerase inhibitor. Molecular cancer therapeutics 2003;2(4):371–82. [PubMed] [Google Scholar]
  • 21.Clarke MJ, Mulligan EA, Grogan PT, Mladek AC, Carlson BL, Schroeder MA, et al. Effective sensitization of temozolomide by ABT-888 is lost with development of temozolomide resistance in glioblastoma xenograft lines. Molecular cancer therapeutics 2009;8(2):407–14 doi 10.1158/1535-7163.MCT-08-0854. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Gupta SK, Kizilbash SH, Carlson BL, Mladek AC, Boakye-Agyeman F, Bakken KK, et al. Delineation of MGMT Hypermethylation as a Biomarker for Veliparib-Mediated Temozolomide-Sensitizing Therapy of Glioblastoma. J Natl Cancer Inst 2016;108(5) doi 10.1093/jnci/djv369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Lu Y, Kwintkiewicz J, Liu Y, Tech K, Frady LN, Su YT, et al. Chemosensitivity of IDH1-Mutated Gliomas Due to an Impairment in PARP1- Mediated DNA Repair. Cancer Res 2017;77(7):1709–18 doi 10.1158/0008-5472.CAN-16-2773. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Sulkowski PL, Corso CD, Robinson ND, Scanlon SE, Purshouse KR, Bai H, et al. 2-Hydroxyglutarate produced by neomorphic IDH mutations suppresses homologous recombination and induces PARP inhibitor sensitivity. Science translational medicine 2017;9(375) doi 10.1126/scitranslmed.aal2463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Wakimoto H, Mohapatra G, Kanai R, Curry WT Jr., Yip S, Nitta M, et al. Maintenance of primary tumor phenotype and genotype in glioblastoma stem cells. Neuro Oncol 2012;14(2):132–44 doi 10.1093/neuonc/nor195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Wakimoto H, Kesari S, Farrell CJ, Curry WT Jr., Zaupa C, Aghi M, et al. Human glioblastoma-derived cancer stem cells: establishment of invasive glioma models and treatment with oncolytic herpes simplex virus vectors. Cancer Res 2009;69(8):3472–81 doi 10.1158/0008-5472.CAN-08-3886. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Wakimoto H, Tanaka S, Curry WT, Loebel F, Zhao D, Tateishi K, et al. Targetable Signaling Pathway Mutations Are Associated with Malignant Phenotype in IDH-Mutant Gliomas. Clin Cancer Res 2014;20(11):2898–909 doi 10.1158/1078-0432.CCR-13-3052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Higuchi F, Fink AL, Kiyokawa J, Miller JJ, Koerner MVA, Cahill DP, et al. PLK1 Inhibition Targets Myc-Activated Malignant Glioma Cells Irrespective of Mismatch Repair Deficiency-Mediated Acquired Resistance to Temozolomide. Molecular cancer therapeutics 2018;17(12):2551–63 doi 10.1158/1535-7163.MCT-18-0177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Rai G, Vyjayanti VN, Dorjsuren D, Simeonov A, Jadhav A, Wilson DM 3rd, et al. Synthesis, biological evaluation, and structure-activity relationships of a novel class of apurinic/apyrimidinic endonuclease 1 inhibitors. J Med Chem 2012;55(7):3101–12 doi 10.1021/jm201537d. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Montaldi AP, Sakamoto-Hojo ET. Methoxyamine sensitizes the resistant glioblastoma T98G cell line to the alkylating agent temozolomide. Clin Exp Med 2013;13(4):279–88 doi 10.1007/s10238-012-0201-x. [DOI] [PubMed] [Google Scholar]
  • 31.Liu L, Taverna P, Whitacre CM, Chatterjee S, Gerson SL. Pharmacologic disruption of base excision repair sensitizes mismatch repair-deficient and -proficient colon cancer cells to methylating agents. Clinical Cancer Research 1999;5(10):2908–17. [PubMed] [Google Scholar]
  • 32.Luo M, Kelley MR. Inhibition of the human apurinic/apyrimidinic endonuclease (APE1) repair activity and sensitization of breast cancer cells to DNA alkylating agents with lucanthone. Anticancer Res 2004;24(4):2127–34. [PubMed] [Google Scholar]
  • 33.Horton JK, Watson M, Stefanick DF, Shaughnessy DT, Taylor JA, Wilson SH. XRCC1 and DNA polymerase beta in cellular protection against cytotoxic DNA single-strand breaks. Cell Res 2008;18(1):48–63 doi 10.1038/cr.2008.7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Horton JK, Stefanick DF, Prasad R, Gassman NR, Kedar PS, Wilson SH. Base excision repair defects invoke hypersensitivity to PARP inhibition. Molecular cancer research : MCR 2014;12(8):1128–39 doi 10.1158/1541-7786.MCR-13-0502. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Murai J, Huang SY, Das BB, Renaud A, Zhang Y, Doroshow JH, et al. Trapping of PARP1 and PARP2 by Clinical PARP Inhibitors. Cancer Res 2012;72(21):5588–99 doi 10.1158/0008-5472.CAN-12-2753. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Murai J, Zhang Y, Morris J, Ji J, Takeda S, Doroshow JH, et al. Rationale for poly(ADP-ribose) polymerase (PARP) inhibitors in combination therapy with camptothecins or temozolomide based on PARP trapping versus catalytic inhibition. J Pharmacol Exp Ther 2014;349(3):408–16 doi 10.1124/jpet.113.210146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Pommier Y, O’Connor MJ, de Bono J. Laying a trap to kill cancer cells: PARP inhibitors and their mechanisms of action. Science translational medicine 2016;8(362):362ps17 doi 10.1126/scitranslmed.aaf9246. [DOI] [PubMed] [Google Scholar]
  • 38.Robins HI, Zhang P, Gilbert MR, Chakravarti A, de Groot JF, Grimm SA, et al. A randomized phase I/II study of ABT-888 in combination with temozolomide in recurrent temozolomide resistant glioblastoma: an NRG oncology RTOG group study. J Neurooncol 2016;126(2):309–16 doi 10.1007/s11060-015-1966-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Gupta SK, Mladek AC, Carlson BL, Boakye-Agyeman F, Bakken KK, Kizilbash SH, et al. Discordant in vitro and in vivo chemopotentiating effects of the PARP inhibitor veliparib in temozolomide-sensitive versus -resistant glioblastoma multiforme xenografts. Clin Cancer Res 2014;20(14):3730–41 doi 10.1158/1078-0432.CCR-13-3446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Farmer H, McCabe N, Lord CJ, Tutt AN, Johnson DA, Richardson TB, et al. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 2005;434(7035):917–21 doi 10.1038/nature03445. [DOI] [PubMed] [Google Scholar]
  • 41.Cheng CL, Johnson SP, Keir ST, Quinn JA, Ali-Osman F, Szabo C, et al. Poly(ADP-ribose) polymerase-1 inhibition reverses temozolomide resistance in a DNA mismatch repair-deficient malignant glioma xenograft. Molecular Cancer Therapeutics 2005;4(9):1364–8. [DOI] [PubMed] [Google Scholar]
  • 42.Yuan AL, Ricks CB, Bohm AK, Lun X, Maxwell L, Safdar S, et al. ABT-888 restores sensitivity in temozolomide resistant glioma cells and xenografts. PLoS One 2018;13(8):e0202860 doi 10.1371/journal.pone.0202860. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Kleinberg L, Supko JG, Mikkelsen T, Blakeley JON, Stevens G, Ye X, et al. Phase I adult brain tumor consortium (ABTC) trial of ABT-888 (veliparib), temozolomide (TMZ), and radiotherapy (RT) for newly diagnosed glioblastoma multiforme (GBM) including pharmacokinetic (PK) data. Journal of Clinical Oncology 2013;31(15_suppl):2065- doi 10.1200/jco.2013.31.15_suppl.2065.23650415 [DOI] [Google Scholar]
  • 44.Trivedi RN, Almeida KH, Fornsaglio JL, Schamus S, Sobol RW. The role of base excision repair in the sensitivity and resistance to temozolomide-mediated cell death. Cancer Research 2005;65(14):6394–400. [DOI] [PubMed] [Google Scholar]
  • 45.Goellner EM, Grimme B, Brown AR, Lin YC, Wang XH, Sugrue KF, et al. Overcoming temozolomide resistance in glioblastoma via dual inhibition of NAD+ biosynthesis and base excision repair. Cancer Res 2011;71(6):2308–17 doi 10.1158/0008-5472.CAN-10-3213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Fu D, Calvo JA, Samson LD. Balancing repair and tolerance of DNA damage caused by alkylating agents. Nat Rev Cancer 2012;12(2):104–20 doi 10.1038/nrc3185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Donawho CK, Luo Y, Luo Y, Penning TD, Bauch JL, Bouska JJ, et al. ABT-888, an orally active poly(ADP-ribose) polymerase inhibitor that potentiates DNA-damaging agents in preclinical tumor models. Clin Cancer Res 2007;13(9):2728–37 doi 10.1158/1078-0432.CCR-06-3039. [DOI] [PubMed] [Google Scholar]
  • 48.Menear KA, Adcock C, Boulter R, Cockcroft XL, Copsey L, Cranston A, et al. 4-[3-(4-cyclopropanecarbonylpiperazine-1-carbonyl)-4-fluorobenzyl]-2H-phthalazin- 1-one: a novel bioavailable inhibitor of poly(ADP-ribose) polymerase-1. J Med Chem 2008;51(20):6581–91 doi 10.1021/jm8001263. [DOI] [PubMed] [Google Scholar]
  • 49.Oplustil O’Connor L, Rulten SL, Cranston AN, Odedra R, Brown H, Jaspers JE, et al. The PARP Inhibitor AZD2461 Provides Insights into the Role of PARP3 Inhibition for Both Synthetic Lethality and Tolerability with Chemotherapy in Preclinical Models. Cancer Res 2016;76(20):6084–94 doi 10.1158/0008-5472.CAN-15-3240. [DOI] [PubMed] [Google Scholar]
  • 50.Nicolae CM, Aho ER, Vlahos AH, Choe KN, De S, Karras GI, et al. The ADP-ribosyltransferase PARP10/ARTD10 interacts with proliferating cell nuclear antigen (PCNA) and is required for DNA damage tolerance. J Biol Chem 2014;289(19):13627–37 doi 10.1074/jbc.M114.556340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Grundy GJ, Polo LM, Zeng Z, Rulten SL, Hoch NC, Paomephan P, et al. PARP3 is a sensor of nicked nucleosomes and monoribosylates histone H2B(Glu2). Nat Commun 2016;7:12404 doi 10.1038/ncomms12404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Ning J, Wakimoto H, Peters C, Martuza RL, Rabkin SD. Rad51 Degradation: Role in Oncolytic Virus-Poly(ADP-Ribose) Polymerase Inhibitor Combination Therapy in Glioblastoma. J Natl Cancer Inst 2017;109(3):1–13 doi 10.1093/jnci/djw229. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
2
3

RESOURCES