Skip to main content
NCBI home page
Cell Stress & Chaperones logoLink to Cell Stress & Chaperones
. 2020 Mar 14;25(3):441–453. doi: 10.1007/s12192-020-01085-1

JNK signaling pathway regulates the development of ovaries and synthesis of vitellogenin (Vg) in the swimming crab Portunus trituberculatus

Hongling Wei 1, Zhiming Ren 1, Lei Tang 1, Hongzhi Yao 1, Xing Li 1, Chunlin Wang 1,2, Changkao Mu 1,2, Ce Shi 1,2, Huan Wang 1,2,✉
PMCID: PMC7193009  PMID: 32172493

Abstract

The development of Portunus trituberculatus egg cells is directly related to the nutritional status of the fertilized egg, which affects the key production stages of offspring hatching. Vitellogenin plays a key role in the nutrient supply required for the development of the egg cells. The c-Jun N-terminal kinase (JNK) is an important member of the mitogen-activated protein kinase (MAPK) superfamily and plays an important role in cell proliferation, transformation, differentiation, and apoptosis. At present, there are no reports on the involvement of the JNK signaling pathway in the reproductive regulation of P. trituberculatus. In this study, rapid amplification of complementary DNA ends amplification technology was used to clone the full length of JNK complementary DNA, which has a length of 2094 bp, including an open reading frame (ORF) of 1266 bp encoding a 421-amino acid protein. The protein includes the S_TKC conserved domain with a TPY phosphorylation site, which is a typical feature of the JNK gene family. Observing tissue sections found the oocytes in the inhibitor group developed slowly, while the oocytes in the activated group showed accelerated development. Meanwhile, Portunus trituberculatus JNK and vitellogenin (Vg) genes exhibited the same trend in the hepatopancreas and ovaries, and the expression of the SP600125 group was downregulated (P < 0.05), while the anisomycin group was upregulated (P < 0.05). In addition, JNK enzyme activity and vitellin (Vn) content in the ovarian tissue showed that the JNK activity of the SP600125 group decreased, while activity increased in the anisomycin group. The accumulation of Vn content in the SP600125 group decreased, and that in the anisomycin group increased. In summary, after injection with inhibitor or activator, the JNK signaling pathway of P. trituberculatus was inhibited or activated, the accumulation of Vn in the ovary was reduced or increased, and ovarian development was inhibited or accelerated, respectively. These results indicated that the JNK signaling pathway is involved in the regulation of Vg synthesis and ovarian development in P. trituberculatus. The results of this study further add to the knowledge of the breeding biology of P. trituberculatus and provide a theoretical reference for the optimization of breeding techniques in aquaculture production systems.

Electronic supplementary material

The online version of this article (10.1007/s12192-020-01085-1) contains supplementary material, which is available to authorized users.

Keywords: Portunus trituberculatus, JNK signaling pathway, Gene cloning, Vitellin, Ovary development

Introduction

The swimming crab, Portunus trituberculatus (Crustacea: Decapod: Portunidae), is one of the most important marine species in Japan, Korea, and China (Hamasaki et al. 2006). In China, the production of P. trituberculatus reached 119,777 t in 2017 (China Fisheries Statistical Yearbook 2018). Breeding is a critical part of all animal husbandry, and obtaining high quality seedlings is a prerequisite for aquaculture. The development of egg cells is directly related to the nutritional status of the fertilized eggs, which affects key aspects of production, such as offspring hatching. Vitellogenin (Vg) plays a key role in the nutrient supply required for egg cell development.

Vg is a female-specific protein that is ubiquitous in the blood of oviparous non-mammals and is the precursor of vitellin (Vn) in almost all egg vibrants (Utarabhand and Bunlipatanon 1996). Vn is the main component of the egg yolk in oviparous animals. In decapods, it mainly serves as a carrier protein, which enters the oocyte to provide essential nutrients for the embryo and early larval stages (Singh et al. 2013). The source of Vg is divided into endogenous and exogenous yolk synthesis, the former comes from the ovary, and the latter refers to tissues outside the ovary. Many studies have shown that Vg is synthesized in the hepatopancreas and ovarian tissue in many crustaceans, such as Marsupenaeus japonicus (Okumura et al. 2007), Penaeus vannamei (P. vannamei) (Tseng et al. 2002), Callinectes sapidus (Zmora et al. 2007), Eriocheir sinensis (Li et al. 2006), Scylla paramamosain (Jia et al. 2013), and Portunus trituberculatus (Yang et al. 2005). Vg protein has been widely researched in mammals and insects, with studies focusing on immunity, resistance, reproduction, and other aspects. However, in crustaceans, Vg gene cloning and spatiotemporal expression patterns are still under investigation, and there are few reports on reproductive-related molecular regulation.

Mitogen-activated protein kinase (MAPK) signal transduction pathways (signaling pathway) are important transmitters of transduction signals from cell surface receptors to nuclear internal targets and are significant pathways in eukaryotic signal transmission networks. They play a key role in the regulation of gene expression and cytoplasmic activity (Gu and Chen 2017). There are currently four MAPK signal transduction pathways in mammals. The c-Jun N-terminal kinase (JNK), also known as stress-activated protein kinase (SAPK) signaling pathway, is one of the MAPK signaling pathways. It is involved in the regulation of cell growth, differentiation, proliferation, migration, metabolism, and apoptosis (Sun and Nan 2016; Rosette and Karin 1996; Wang et al. 2018). The JNK signaling pathway has been investigated in many studies on mammalian reproductive regulation, as it participates in the induction of apoptosis of immature free sperm cells in mammals (Show et al. 2008) and is involved in regulating the viability of stalled sperm (García et al. 2012). However, in aquatic invertebrates, studies on the JNK signaling pathway have mainly focused on immune stress in animals such as Mytilus haemocytes (Betti et al. 2006) and Crassostrea ariakensis (Zhu and Wu 2008). Research on the role of the JNK signaling pathway in the reproductive regulation of ovarian development and Vn accumulation in aquatic crustaceans is extremely limited.

Yang et al. (2015) performed a differential analysis of mature and immature ovarian transcriptomes in P. trituberculatus. It has also been found that the JNK signaling pathway may be involved in the regulation of ovarian development of P. trituberculatus, as revealed by analyzing KEGG pathway participation in different genes. Therefore, in the current study, a full length of Portunus trituberculatus JNK gene (PtJNK) complementary DNA (cDNA) was successfully cloned by the rapid amplification of cDNA ends (RACE) technique, and the quantitative expression of PtJNK and Vg genes was detected by injection of the JNK inhibitor SP600125 and the activator anisomycin. JNK activity, Vn content and tissue section analysis of cell development, the potential relationship between JNK signaling pathway and ovarian development, and Vn accumulation were studied in order to provide a basic theoretical foundation for improving the breeding biology of P. trituberculatus and other crustaceans.

Materials and methods

Crab and tissue preparation

P. trituberculatus were collected from a crab farm in Xianxiang Town, Fenghua District, Ningbo City, Zhejiang Province, China. A total of 200 crabs (body weight 200 g ± 20 g) with attached appendages, exhibiting good vigor and with no mechanical damage, were kept in a cement pool (9 m × 4 m). Water quality conditions in the pool were maintained at a salinity of 24–27‰ and a temperature of ~ 20 °C, and the water was continuously oxygenated. After 1 week of acclimatization, ten crabs were randomly selected from the cement pool for living anatomy, and the hepatopancreas and ovaries were extracted and stored in liquid nitrogen for full-length cloning of the PtJNK gene. The degree of ovarian development of female crabs was also recorded. Female crabs (n = 180) with ovarian development at approximately stage III were selected for experimentation (Wu et al. 2007).

The JNK activator anisomycin was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. The JNK inhibitor SP600125 was purchased at MCE (MedChemExpress, USA). The drug was formulated with 1% sodium carboxymethyl cellulose (1% CMC-Na) as a co-solvent (Zhang et al. 2018). The activator anisomycin was injected at a dose of 2 mg/kg and 4 mg/kg, and the inhibitor SP600125 was injected at a dose of 15 mg/kg and 30 mg/kg (Wang et al. 2004). The mixture was ready for use before each injection, and the powder was stored at − 20 °C. Tissue fixation was with 4% paraformaldehyde (Solarbio, Shanghai, China) for tissue sections.

Injection experiments

The 180 selected crabs were divided equally into six groups (30 crabs per group). The six groups were as follows: blank group (no injection), control group (1% CMC-Na injection), inhibitor group (SP600125 15 mg/kg and SP600125 30 mg/kg), and activator group (anisomycin 2 mg/kg and anisomycin 4 mg/kg). The injection was made into the swimming base membrane of P. trituberculatus, and individuals were injected once a week over a period of 4 weeks (Hiromitsu et al. 2009). After breeding, the six groups of P. trituberculatus were dried and weighed. Dissection was performed under low-temperature anesthesia. Intact ovarian tissues were weighed and used to determine the ovarian coefficient (GSI = WG / W × 100%, where WG is ovarian weight (g) and W is body weight (g)). The ovarian and hepatopancreas tissues were then stored in liquid nitrogen prior to subsequent experiments. In addition, an appropriate amount of ovarian tissue was fixed in 4% paraformaldehyde for making subsequent paraffin sections and staining.

Total RNA extraction and RACE template synthesis

Total RNA was extracted via rapid extraction with the TRIzol reagent. The mass and concentration were measured using 1% agarose gel electrophoresis and UV spectrophotometry (NanoDrop 2000, Thermo). Following the manufacturer’s instructions, for each reverse transcription (RT) reaction, 2 ng of total RNA was subject to cDNA synthesis using a SMARTer RACE cDNA Amplification Kit (Clontech, USA) in a 20 μL volume. The 3′CDS-Primer was used as a 3′RACE RT primer to introduce an adaptor, and the 5′CDS-Primer and SMARTer Oligo were used to synthesize the 5′ ends of the full-length gene (Clontech, USA). The cDNA obtained by RT was stored at − 80 °C.

Amplification of the PtJNK nucleotide sequence

The primers were designed to amplify the ORF region of PtJNK according to the conserved sequence of the JNK gene of other crustaceans in the NCBI database, and then the 3′ and 5′ RACE–specific primers were designed (Table 1). According to the manufacturer’s instructions, PCR was performed in a 50 μL reaction volume. The PCR product was separated by 1% agarose gel electrophoresis and purified using a PCR purification kit (Omega, USA). The cDNA was then cloned into the pMD19-T vector (TaKaRa) and transformed into DH5α competent cells (Novagen). Positive recombinants were selected using ampicillin, and colonies were screened by PCR. Three positive clones were identified for sequencing (Youkang Biological Company, Hangzhou, China). After removal of the vector sequence, the complete sequence of the PtJNK cDNA was spliced by DNAMAN software.

Table 1.

The gene-specific primers used in this study

Primer names Primer sequences (5′–3′) Sequence information
GSP1 GCGTAGGATAGTGAAGCGGGTGTC For JNK-5′ race RACE
GSP2 TACCCATGCTCCACCCTCAGCTGCCACC For JNK-3′ race RACE
GSP3 (forward) TGAGGCACCTTGCTGATTGGG For JNK gene cloning
GSP4 (reverse) CCAGGGTAGCGAGGACGGTTT For JNK gene cloning
GSP5 (forward) AAACCCAGCAACATTGTGGTGAAA For JNK gene cloning
GSP6 (reverse) GGGACCAAGGTAGGGCGGAGA For JNK gene cloning
GSP7 (forward) CCGTGCTCCTGAGGTGATTCTTG For JNK gene Real-time PCR
GSP9 (reverse) TTGGCTTGCTTTTAGGCGATTGT For JNK gene real-time PCR
Vg (forward) TGCTGCCAAACTATCCTTCATCC For real-time PCR
Vg (reverse) CAACTTATCGGAGCCAGGCAATC For real-time PCR
18S (forward) TCCAGTTCGCAGCTTCTTCTT For real-time PCR
18S (reverse) AACATCTAAGGGCATCACAGACC For real-time PCR
Open in a new tab

Sequence analysis of PtJNK

The spliced cDNA sequence and deduced amino acid sequence of PtJNK were analyzed using the BLAST algorithm (http://www.ncbi.nlm.nih.gov/blast) and the Expert Protein Analysis System (http://www.expasy.org/). The signal peptide was predicted with the SignalP 4.1 server (http://www.cbs.dtu.dk/service/SignalP). Protein domains were revealed by the PROSITE program (http://www.kr.expasy.org/prosite/) and SMART (version 4.0) (http://www.smart.emblheidelberg.de/). In addition, the ProtParam program (http://www.expasy.ch/tools/protparam.html) was used to compute the physical and chemical parameters of the deduced amino acid sequence. The ClustalW program was used to perform multiple sequence alignment. The phylogenetic tree was constructed with the neighbor-joining method using MEGA5.0 software (Tamura et al. 2011).

Quantitative histology

Ovarian tissues of five crabs from each experimental group were removed and fixed with 4% paraformaldehyde for 24 h. The ovarian tissue was then set in paraffin and sliced into sections up to 5–7 μm thick. The sections were de-waxed using xylene and rehydrated in an ethanol series. The sections were stained with eosin and HE purchased from Invitrogen (Carlsbad, CA, USA). A Nikon optical microscope was used for microscope photography. The diameter of the oocyte was measured under the microscope using a micrometer (Medina et al. 1996), and the diameter of 50 oocytes was used for calculations.

Quantitative real-time PCR analysis

The extracted total RNA was reverse transcribed using M-MLV reverse transcriptase (Promega, USA). Quantitative RT-PCR using a LightCycler 480 SYBR Green I Master (Roche, USA) was performed to determine the expression of PtJNK and Vg (GenBank Accession No. DQ000638) in different tissues of P. trituberculatus after injection with inhibitor and activator. The 18S gene (GenBank Accession No. FJ392026) was amplified with primers 18S-F and 18S-R (Table 1) as an internal control. RT-PCR was performed using a final volume of 20 μL containing 3 μL of PCR-grade water, 10 μL of 2× master mix, 1 μL of each primer (10 mmol L−1) for 18S, PtJNK or Vg, and 5 μL of cDNA mix. The relative expression levels of PtJNK and Vg were calculated using the 2−ΔΔCt method (Livak and Schmittgen 2001). The genes and primers used for quantitative RT-PCR are listed in Table 1.

Enzyme-linked immunosorbent assay for detection of JNK activity

A crab JNK ELISA kit was purchased from Shanghai Bridge Du Biotechnology Co., Ltd. Six groups of ovary samples that were stored at − 80 °C were thawed on ice and rinsed with normal saline solution. The samples were then blotted dry with filter paper. Then, 1 ml of physiological saline was added to the samples, which were cut out and weighed 0.1 g. The tissue was homogenized with a homogenizer and centrifuged at 3000 r/min for 10 min. The supernatant was carefully collected in a new centrifuge tube to obtain a sample solution for testing. The experiment was then carried out according to the kit procedure. Finally, the absorbance (OD value) was measured at 450 nm using a microplate reader to calculate the sample activity.

Enzyme-linked immunosorbent assay for detection of Vn content

The Vn ELISA kit for P. trituberculatus was purchased from Jiangsu Kete Biological Co., Ltd. The ovary samples from the experimental group were taken out of the − 80 °C freezer, thawed on ice, and placed in a refrigerator at 4 °C for 12 h. The samples were then placed at room temperature for 1 h and rinsed with physiological saline, and 9 ml of 1× PBS was added to the samples, which were cut out and weighed 1 g. The samples were homogenized with a homogenizer and centrifuged at 5000 r/min for 15 min. The supernatant was carefully collected in a new centrifuge tube to obtain a sample solution for testing. Then, the experiment was carried out according to the kit procedure, and then the absorbance (OD value) was measured at 450 nm using a microplate reader to calculate the content of the sample.

Statistical analysis

Statistical analysis was performed using IBM SPSS Statistics 22 software. All data are the mean relative mRNA expression ± SE. Statistical significance was determined by one-way ANOVA and post hoc Duncan’s multiple range tests. A P value < 0.05 was considered significant.

Results

The cDNA cloning and sequence analysis of PtJNK

After serial splicing, a full-length sequence of the JNK gene of P. trituberculatus was 2094 bp cDNA (GenBank Accession No. MN188054). The gene comprised a 5′ non-coding region of 326 bp and a 3′ non-coding region of 502 bp. Its ORF was 1266 bp and encoded 421 amino acids. It has a predicted molecular mass of 47.45 kDa and a theoretical isoelectric point of 6.31. Analysis of the amino acid sequence did not indicate the presence of a signal peptide (Fig. 1). According to SMART software, PtJNK has a S_TKC conserved domain with a TPY phosphorylation site. Analysis revealed that PtJNK, Scylla paramamosain JNK gene (SpJNK), Eriocheir sinensis JNK gene (EsJNK), PvJNK, PjJNK, AvJNK, CsJNK, ZnJNK, LsJNK, and PnJNK from different species were highly evolutionarily conserved, with almost identical amino acid sequences (Fig. 2). BLASTP searches of the non-redundant protein database in GenBank showed that PtJNK shared the highest sequence identity of 100% with SpJNK (Scylla paramamosain, AYK28495.1) and the sequence identity of 98% with EsJNK (Eriocheir sinensis, AHG95993.1). To make a thorough inquiry about the evolutionary relationships of PtJNK, sequences of JNKs from vertebrates and invertebrates were used to construct a phylogenetic tree (Fig. 3). The results showed that P. trituberculatus were grouped with S. paramamosain and E. sinensis, and the second ones were grouped with P. vannamei (XP_027218684.1) and Penaeus japonicus (P. japonicus, BAI87826.1). These results showed that PtJNK was clustered into the JNK family.

Fig. 1.

Fig. 1

Open in a new tab

Nucleotide and deduced amino acid sequence of PtJNK from Portunus trituberculatus. The revelation codon (ATG) and the stop codon (TAG) are double underlined. TPY phosphorylation sites are indicated by boxes and the S_TKC domain is shaded gray

Fig. 2.

Fig. 2

Open in a new tab

Multiple sequence alignment of Portunus trituberculatus JNK and JNK of other invertebrates. The conserved amino acid residues are shaded black. The sequences are as follows: Scylla paramamosain (S. paramamosain, AYK28495.1), Eriocheir sinensis (E. sinensis, AHG95993.1), Penaeus vannamei (P. vannamei, XP_027218684.1), Penaeus japonicus (P. japonicus, BAI87826.1), Armadillidium vulgare (A. vulgare, RXG56898.1), Cryptotermes secundus (C. secundus, PNF21055.1), Zootermopsis nevadensis (Z. nevadensis, KDR18179.1), Laodelphax striatellus (L. striatellus, ATE51288.1), and Paracyclopina nana (P. nana, APS85778.1)

Fig. 3.

Fig. 3

Open in a new tab

Phylogenetic tree based on Portunus trituberculatus JNK and JNK of other invertebrates. The tree is constructed by the neighbor-joining (NJ) algorithm using the MEGA 5.0 program. Bootstrap trails are replicated 1000 times to derive the confidence value. The protein sequences used for phylogenetic analysis are as follows: Scylla paramamosain (S. paramamosain, AYK28495.1), Eriocheir sinensis (E. sinensis, AHG95993.1), Penaeus vannamei (P. vannamei, XP_027218684.1), Penaeus japonicus (P. japonicus, BAI87826.1), Armadillidium vulgare (A. vulgare, RXG56898.1), Cryptotermes secundus (C. secundus, PNF21055.1), Zootermopsis nevadensis (Z. nevadensis, KDR18179.1), Laodelphax striatellus (L. striatellus, ATE51288.1), Paracyclopina nana (P. nana, APS85778.1), Nilaparvata lugens (N. lugens, XP_022189790.1), Wasmannia auropunctata (W. auropunctata, XP_011695730.1), Acyrthosiphon pisum (A. pisum, XP_001945460.2), Stegodyphus mimosarum (S. mimosarum, KFM65023.1), Parasteatoda tepidariorum (P. tepidariorum, XP_015907694.2), Eufriesea mexicana (E. mexicana, OAD57006.1), Onthophagus taurus (O. taurus, XP_022916514.1), Trichomalopsis sarcophagae (T. sarcophagae, OXU22231.1), and Nasonia vitripennis (N. vitripennis, XP_016837523.1)

Ovary development

In the six experimental groups, the GSI of the SP600125 15 mg/kg group decreased by19% (blank group, 16.16; control group, 16.03; SP600125 15 mg/kg group, 12.96) compared with the blank group and the control group, and the GSI of the SP600125 30 mg/kg group decreased by 17% following injection with inhibitor and activator. This indicated that SP600125 may inhibit the development of crab ovaries. There was no significant difference in the ovarian index of the anisomycin group (Table 2).

Table 2.

Comparative results of the ovarian index for the six experimental groups

Group Gonad index
Blank group 16.16a
Control group 16.03a
SP600125 15 mg/kg group 12.96b
SP600125 30 mg/kg group 13.35b
Anisomycin 2 mg/kg group 15.75a
Anisomycin 4 mg/kg group 15.01a
Open in a new tab

The gonad index was transformed by the formula [=DEGREES (ASIN (SQRT (A1)))]. Significant differences (P < 0.05) among the injected, blank, and control groups are indicated with different letters

Histology analysis

Observation of the tissue sections found that the blank group and the control group were mainly at the oocyte and near-mature oocytes in the exogenous yolk synthesis stages, and the egg diameters were 234–287 μm and 246–284 μm, respectively. A large amount of yolk was observed in the oocytes. There were no significant differences between the oocytes in the two groups. In the SP600125 15 mg/kg and SP600125 30 mg/kg groups, the oocytes were loose and the yolk granules were small. The egg diameter of the oocytes in the two groups was 131-232 μm and 142-239 μm, respectively. The cells developed slowly in comparison with the anisomycin group. The oocytes in the anisomycin group were extruded into a polygonal shape, and the follicular cells were tight around the oocyte and turned into a thin line. A large number of yolk granules were visible in the oocyte, and they almost filled the entire oocyte. The egg diameters of the anisomycin 2 mg/kg group and the anisomycin 4 mg/kg group oocytes were 285–366 μm and 285–384 μm, respectively (Table S1). In particular, the yolk granules in the anisomycin 4 mg/kg section began to fuse (Fig. 4), showing that the cells developed faster than those in the inhibitor group.

Fig. 4.

Fig. 4

Open in a new tab

Microscopic images of histological sections of Portunus trituberculatus ovaries. a Blank group. b Control group. c SP600125 15 mg/kg group. d SP600125 30 mg/kg group. e Anisomycin 2 mg/kg group. f Anisomycin 4 mg/kg group (100×). PR, pre-oval oocyte synthesis; EX, exogenous yolk synthesis oocyte; FC, follicular cell; Y, yolk granule; N, nucleus, NO, near mature oocyte; Oo, egg mother cell

Expression analysis of PtJNK and Vg

In this study, the expression levels of JNK and Vg genes in the hepatopancreas and ovaries were examined after injection with inhibitor and activator. In comparison with the blank group and the control group, PtJNK and Vg genes exhibited the same trend in the hepatopancreas and ovaries. In the hepatopancreas and ovaries, the expression of the PtJNK gene in the SP600125 15 mg/kg group decreased by 55% and 41%, respectively (P < 0.05), and that in the SP600125 30 mg/kg group decreased by 55% and 50%, respectively (Fig. 5a, c). Meanwhile, the expression of the Vg gene in the hepatopancreas and ovaries of the SP600125 15 mg/kg group decreased by 59% and 54%, respectively, and that of the SP600125 30 mg/kg group decreased by 58% and 52%, respectively (Fig. 5b, d). However, the anisomycin group was upregulated (P < 0.05). The PtJNK gene in the hepatopancreas and ovaries increased by 90% and 1.1 times in the anisomycin 2 mg/kg group, respectively, and increased by 98% and 1.1 times in the anisomycin 4 mg/kg group, respectively (Fig. 5a, c). The Vg gene in the anisomycin 2 mg/kg group increased by 4.9 and 1.2 times in the hepatopancreas and ovaries, respectively. The anisomycin 4 mg/kg group increased by 4.6 and 1.2 times, respectively (Fig. 5b, d).

Fig. 5.

Fig. 5

Open in a new tab

a–d Tissue distribution of the PtJNK transcription detected by quantitative real-time PCR. Each bar represents the mean ± SE (n = 3). Significant differences (P < 0.05) among the injected, blank, and control groups are indicated with different letters

Detection of JNK activity and Vn content

ELISA results showed that JNK enzyme activity in the SP600125 15 mg/kg group decreased by 26% compared with the blank group and the control group, and the SP600125 30 mg/kg group decreased by 25%. However, the anisomycin 2 mg/kg and the anisomycin 4 mg/kg group increased by 13% and 11%, respectively (Fig. 6a). The Vn content of the SP600125 15 mg/kg and SP600125 30 mg/kg group decreased by 29% and 27%, respectively. The anisomycin 2 mg/kg and the anisomycin 4 mg/kg group increased by 52% and 59%, respectively (Fig. 6b). This indicated that SP600125 may inhibit the accumulation of Vn, while anisomycin may promote the accumulation of Vn.

Fig. 6.

Fig. 6

Open in a new tab

c-Jun N-terminal kinase (JNK) activity and Vn content in the ovaries. a JNK activity. b Vn content. Each bar represents the mean ± SE (n = 3). Significant differences (P < 0.05) among the injected, blank, and control groups are indicated with different letters

Discussion

JNK is one of the four major MAPK subfamilies that have been found in eukaryotic cells. The JNK signaling pathway is activated by extracellular signaling to phosphorylate upstream kinases and is involved in the regulation of cell growth, differentiation, proliferation, migration, metabolism, and apoptosis (Sun and Nan 2016; Rosette and Karin 1996). There have been many studies on the involvement of the JNK pathway in mammalian reproductive regulation, but knowledge of the role of the JNK signaling pathway in the regulation of crustacean reproduction is extremely limited. To study the role of the JNK pathway in the reproductive regulation of Vg synthesis, a full-length 2094 bp cDNA of the PtJNK gene was obtained by cloning. Bioinformatic analysis of the PtJNK gene revealed that the PtJNK gene had no signal peptide; it had a S_TKC conserved domain containing a TPY phosphorylation site and was a typical domain of JNK gene family. The amino acid sequence alignment showed that the PtJNK amino acid sequence was highly conserved with other species. The results of the phylogenetic tree indicated that the PtJNK gene of P. trituberculatus was clustered with S. paramamosain and E. sinensis. In summary, the sequence was identified as the JNK gene of the swimming crab and was highly conserved in evolution.

A large number of studies have confirmed that the MPAK/JNK signaling pathway can respond to various environmental stimuli, such as growth factors, tumor necrosis factor and other cytokines (Sabio and Davis 2014; Zheng et al. 2014), ultraviolet radiation, and heat shock by participating in the regulation of cell proliferation, apoptosis and DNA damage repair, and other physiological and biochemical reactions. It is well known that the proliferation of cells is mainly through mitosis, and JNK kinase plays an important role in regulating the cell cycle during mitosis (Davis 2000; Lin 2003). The JNK inhibitor SP600125 is a small molecule that acts as a reversible ATP competitive inhibitor of JNK1/2 (Yeste-Velasco et al. 2009) by competing with ATP to obtain relevant binding sites on JNK to inhibit JNK activity (He et al. 2016). Studies have shown that the JNK inhibitor SP600125 can inhibit the induction of cancer cell apoptosis and arrest cancer cells in the C2/M phase (Mingo-Sion et al. 2004; Hills et al. 2006; Wang et al. 2009; Kim et al. 2010). The role of SP600125 in the JNK pathway in the P. trituberculatus was investigated in the current study. The tissue expression patterns of PtJNK and Vg genes were detected by RT-PCR. The JNK enzyme activity and Vn content were determined by ELISA. The oocytes in the ovary were observed in tissue sections. The results showed that the expression patterns of these two genes were similar in the ovary and hepatopancreas. The SP600125 group was downregulated. JNK enzyme activity in the ovary was decreased compared with the blank group and the control group, and the accumulation of Vn was lower. Observation of tissue sections revealed that the oocytes developed slowly. It is speculated that the JNK-specific inhibitor SP600125 may reversibly compete for ATP to inhibit JNK enzyme activity, downregulate the phosphorylation level of c-Jun, and inhibit the synthesis of transcriptional activator AP-1 by c-Jun and c-Fos binding, thereby regulating the synthesis of Vg, resulting in reduced accumulation of Vn in the oocytes, and inhibiting the ovarian development of the swimming crab.

Anisomycin is a bacterial component isolated from Streptomyces griseus that binds to the 60S ribosomal subunit and prevents peptide chain elongation from exerting its role in inhibiting protein synthesis (Kochi and Collier 1993; Condorelli 2002). Anisomycin is reported to induce apoptosis in a variety of cells, including promyelocytic leukemia cells, Jurkat cells, cardiomyocytes, and colon adenocarcinoma cells (Lunghi et al. 2001; Caricchio et al. 2002; Yang et al. 2009; You et al. 2013). Previous studies have found that anisomycin can activate P38 and JNK of the MAPK family (Cano et al. 1995; Eguchi et al. 2007). Anisomycin is often used as an activator, and as a potential signaling agonist, and can produce a strong and long-lasting nuclear response like epidermal growth factors and phorbol esters, while also synergizing with growth factors and phorbol esters to induce activation of the proto-oncogenes c-Fos and c-Jun (Hazzalin et al. 1998). This study investigated the role of anisomycin in the development of crab ovaries. Tissue expression analysis showed that the expression patterns of PtJNK and Vg genes were downregulated in the ovary and hepatopancreas. JNK enzyme activity in the ovary was increased, while the accumulation of Vn in the ovary was increased compared with the blank group and the control group. Observation of tissue sections revealed that the oocytes developed faster than the blank group and the control group. Therefore, we infer that the activation of the proto-oncogenes c-Fos and c-Jun, the activator of anisomycin in the JNK pathway, can upregulate the synthesis of the activator AP-1, thereby regulating the synthesis of Vg, resulting in the accumulation of Vn in the oocytes and promoting ovarian development in the swimming crab.

Conclusion

In this study, the full length of the PtJNK gene was successfully cloned, and its amino acid sequence was biologically analyzed. Tissue expression patterns of PtJNK and Vg genes were detected by RT-PCR following injection with the JNK inhibitor SP600125 and the activator anisomycin. JNK enzyme activity and Vn content were determined by ELISA. The development of oocytes in the ovarian tissue was observed. The results showed that JNK gene expression was significantly downregulated, enzyme activity decreased, oocyte development was inhibited, and the accumulation of Vn in the ovary was significantly reduced after the inhibition of the JNK signaling pathway of the crab. The pathway was found to be activated by activator. The expression of the JNK gene was significantly upregulated, the development of oocytes was accelerated, and the accumulation of Vn in the ovary was significantly increased. The results of this study indicate that the JNK signaling pathway is involved in ovarian development and accumulation of Vn in P. trituberculatus. This research has added to the knowledge of the breeding biology of P. trituberculatus and other crustaceans and provides an important theoretical reference for the optimization of breeding in aquaculture production systems.

Electronic supplementary material

ESM 1 (17.7KB, docx)

(DOCX 17 kb).

Acknowledgments

We are grateful to the anonymous reviewers for their professional review of the manuscript.

Abbreviations

AvJNK

Armadillidium vulgare JNK gene

CsJNK

Cryptotermes secundus JNK gene

E. sinensis

Eriocheir sinensis

EsJNK

Eriocheir sinensis JNK gene

LsJNK

Laodelphax striatellus JNK gene

P. japonicus

Penaeus japonicus

PjJNK

Penaeus japonicus JNK gene

PnJNK

Paracyclopina nana JNK gene

PtJNK

Portunus trituberculatus JNK gene

P. trituberculatus

Portunus trituberculatus

P. vannamei

Penaeus vannamei

PvJNK

Penaeus vannamei JNK gene

S. paramamosain

Scylla paramamosain

SpJNK

Scylla paramamosain JNK gene

Vg

Vitellogenin

Vn

Vitellin

ZnJNK

Zootermopsis nevadensis JNK gene

Authors’ contributions

H Wang conceived and designed this study. HL Wei and ZM Ren cultivated the experimental animals. HL Wei, ZM Ren, L Tang, HZ Yao, X Li, CL Wang, CK Mu, C Shi, and H Wang performed and analyzed all experiments. HL Wei and H Wang wrote the manuscript with support from all authors. All authors read and approved the final manuscript.

Funding information

This study was sponsored by the National Natural Science Foundation of China (41806184), China Postdoctoral Science Foundation (2018M632439), Major Agriculture Program of Ningbo (2017C110007), Major Science & Technology Special Project of Zhejiang Province (no. 2016C02055-8), Ministry of Agriculture of China & China Agriculture Research System (no. CARS-48), Ningbo University Research Fund (XYL18013), and K.C. Wong Magna Fund at Ningbo University.

Availability of data and materials

All data generated or analyzed during this study are included in this published article and its supplementary information files.

Compliance with ethical standards

Ethics approval and consent to participate

The animal subjects used in the present study are crabs, which are invertebrates and are exempt from this requirement.

Competing interests

The authors declare that they have no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Hongling Wei, Email: 1357501364@qq.com.

Zhiming Ren, Email: 578163611@qq.com.

Lei Tang, Email: 791888694@qq.com.

Hongzhi Yao, Email: 1025801555@qq.com.

Xing Li, Email: 2780443420@qq.com.

Chunlin Wang, Email: wangchunlin@nbu.edu.cn.

Changkao Mu, Email: 757793866@qq.com.

Ce Shi, Email: shice@nbu.edu.cn.

Huan Wang, Email: wanghuan1@nbu.edu.cn.

References

  1. Betti M, Ciacci C, Lorusso LC, Canonico B, Falcioni T, Gallo G, Canesi L. Effects of tumour necrosis factor alpha (TNFalpha) on Mytilus haemocytes: role of stress-activated mitogen-activated protein kinases (MAPKs) Biol Cell. 2006;98(4):233–244. doi: 10.1042/BC20050049. [DOI] [PubMed] [Google Scholar]
  2. Cano E, Hazzalin CA, Kardalinou E, et al. Neither ERK nor JNK/SAPK MAP kinase subtypes are essential for histone H3/lHMG-14 phosphorylation or c-fos and c-jun induction. J Cell Sci. 1995;108:3599–3609. doi: 10.1242/jcs.108.11.3599. [DOI] [PubMed] [Google Scholar]
  3. Caricchio R, D’Adamio L, Cohen PL. Fas, ceramide and serum withdrawal induce apoptosis via a common pathway in a type II Jurkat cell line. Cell Death Differ. 2002;9(5):574–580. doi: 10.1038/sj.cdd.4400996. [DOI] [PubMed] [Google Scholar]
  4. Condorelli G. Multiple members of the mitogen-activated protein kinase family are necessary for PED/PEA-15 anti-apoptotic function. J Biol Chem. 2002;277(13):11013–11018. doi: 10.1074/jbc.M110934200. [DOI] [PubMed] [Google Scholar]
  5. Davis RJ. Signal transduction by the JNK group of MAP kinases. Cell. 2000;103(2):239–252. doi: 10.1016/s0092-8674(00)00116-1. [DOI] [PubMed] [Google Scholar]
  6. Eguchi R, Suzuki A, Miyakaze S, Kaji K, Ohta T. Hypoxia induces apoptosis of HUVECs in an in vitro capillary model by activating proapoptotic signal p38 through suppression of ERK1/2. Cell Signal. 2007;19(6):1121–1131. doi: 10.1016/j.cellsig.2006.12.004. [DOI] [PubMed] [Google Scholar]
  7. Fishery Bureau, Ministry of Agriculture, China (2018) China Fisheries Statistical Yearbook 2018. Chinese Agriculture Express, Beijing
  8. García BM, Moran AM, Fernández LG, Ferrusola CO, Rodriguez AM, Bolaños JM, da Silva CM, Martínez HR, Tapia JA, Peña FJ. The mitochondria of stallion spermatozoa are more sensitive than the plasmalemma to osmotic-induced stress: role of c-Jun N-terminal kinase (JNK) pathway. J Androl. 2012;33(1):105–113. doi: 10.2164/jandrol.110.011957. [DOI] [PubMed] [Google Scholar]
  9. Gu SH, Chen CH. Injury-induced rapid activation of MAPK signaling in dechorionated eggs and larvae of the silkworm Bombyx mori. Insect Sci. 2017;24(2):248–258. doi: 10.1111/1744-7917.12301. [DOI] [PubMed] [Google Scholar]
  10. Hamasaki K, Fukunaga K, Kitada S. Batch fecundity of the swimming crab Portunus trituberculatus (Brachyura: Portunidae) Aquaculture. 2006;253(1–4):0–365. [Google Scholar]
  11. Hazzalin CA, Le Panse R, Cano E, et al. Anisomycin selectively desensitizes signalling components involved in stress kinase activation and fos and jun induction. Mol Cell Biol. 1998;18(4):1844–1854. doi: 10.1128/mcb.18.4.1844. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. He Y, Cai C, Sun S, Wang X, Li W, Li H. Effect of JNK inhibitor SP600125 on hair cell regeneration in zebrafish (Danio rerio) larvae. Oncotarget. 2016;7(32):51640–51650. doi: 10.18632/oncotarget.10540. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hills FA, Abrahams VM, Gonzalez-Timon B, et al. Heparin prevents programmed cell death in human trophoblast. Mol Hum Reprod. 2006;12(4):237–243. doi: 10.1093/molehr/gal026. [DOI] [PubMed] [Google Scholar]
  14. Hiromitsu N, Etsuro H, Masaharu T, et al. Inhibition of c-Jun NH2-terminal kinase switches Smad3 signaling from oncogenesis to tumor-suppression in rat hepatocellular carcinoma. Hepatology. 2009;49(6):1944–1953. doi: 10.1002/hep.22860. [DOI] [PubMed] [Google Scholar]
  15. Jia X, Chen Y, Zou Z, Lin P, Wang Y, Zhang Z. Characterization and expression profile of Vitellogenin gene from Scylla paramamosain. Gene. 2013;520(2):119–130. doi: 10.1016/j.gene.2013.02.035. [DOI] [PubMed] [Google Scholar]
  16. Kim JA, Lee J, Margolis RL, et al. SP600125 suppresses Cdk1 and induces endoreplication directly from G2 phase, independent of JNK inhibition. Oncogene. 2010;29(11):1702–1716. doi: 10.1038/onc.2009.464. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kochi SK, Collier RJ. DNA fragmentation and cytolysis in U937 cells treated with diphtheria toxin or other inhibitor of protein synthesis. Exp Cell Res. 1993;208(1):296–302. doi: 10.1006/excr.1993.1249. [DOI] [PubMed] [Google Scholar]
  18. Li K, Chen L, Zhou Z, et al. The site of vitellogenin synthesis in Chinese mitten-handed crab Eriocheir sinensis. Comp Biochem Physiol B Biochem Mol Biol. 2006;143(4):453–458. doi: 10.1016/j.cbpb.2005.12.019. [DOI] [PubMed] [Google Scholar]
  19. Lin A. Activation of the JNK signaling pathway: breaking the brake on apoptosis. Bioessays. 2003;25(1):17–24. doi: 10.1002/bies.10204. [DOI] [PubMed] [Google Scholar]
  20. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆CT method. Methods. 2001;25:402–428. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  21. Lunghi P, Tabilio A, Pinelli S, Valmadre G, Ridolo E, Albertini R, Carlo-Stella C, Dall’Aglio PP, Pelicci PG, Bonati A. Expression and activation of SHC/MAP kinase pathway in primary acute myeloid leukemia blasts. Hematol J. 2001;2(2):70–80. doi: 10.1038/sj/thj/6200095. [DOI] [PubMed] [Google Scholar]
  22. Medina A, Vila Y, Mourente G, et al. A comparative study of the ovarian development in wild and pond-reared shrimp, Penaeus kerathurus (Forskål, 1775) Aquaculture. 1996;148(1):63–75. [Google Scholar]
  23. Mingo-Sion AM, Marietta PM, Koller E, Wolf DM, van den Berg C. Inhibition of JNK reduces G2/M transit independent of p53, leading to endoreduplication, decreased proliferation, and apoptosis in breast cancer cells. Oncogene. 2004;23(2):596–604. doi: 10.1038/sj.onc.1207147. [DOI] [PubMed] [Google Scholar]
  24. Okumura T, Yamano K, Sakiyama K. Vitellogenin gene expression and hemolymph vitellogenin during vitellogenesis, final maturation, and oviposition in female kuruma prawn, Marsupenaeus japonicus. Comp Biochem Physiol A Mol Integr Physiol. 2007;147(4):1028–1037. doi: 10.1016/j.cbpa.2007.03.011. [DOI] [PubMed] [Google Scholar]
  25. Rosette C, Karin M. Ultraviolet light and osmoticstress: activation of JNK cascade through multiple growth factor and cytokine receptors. Science. 1996;274:1194–1197. doi: 10.1126/science.274.5290.1194. [DOI] [PubMed] [Google Scholar]
  26. Sabio G, Davis RJ. TNF and MAP kinase signalling pathways. Semin Immunol. 2014;26(3):237–245. doi: 10.1016/j.smim.2014.02.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Show MD, Hill CM, Anway MD, Wright WW, Zirkin BR. Phosphorylation of mitogen-activated protein kinase 8 (MAPK8) is associated with germ cell apoptosis and redistribution of the Bcl2-modifying factor (BMF) J Androl. 2008;29(3):338–344. doi: 10.2164/jandrol.107.003558. [DOI] [PubMed] [Google Scholar]
  28. Singh NK, Pakkianathan BC, Kumar M, et al. Vitellogenin from the silkworm, Bombyx mori: an effective anti-bacterial agent. PLoS One. 2013;8(9):e73005. doi: 10.1371/journal.pone.0073005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Sun J, Nan G. Erratum to: erratum to: the mitogen-activated protein kinase (MAPK) signaling pathway as a discovery target in stroke. J Mol Neurosci. 2016;59(3):430. doi: 10.1007/s12031-016-0767-y. [DOI] [PubMed] [Google Scholar]
  30. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011;28(10):2731–2739. doi: 10.1093/molbev/msr121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Tseng DY, Chen YN, Liu KF, et al. Hepatopancreas and ovary are sites of vitellogenin synthesis as determined from partial cDNA encoding of vitellogenin in the marine shrimp, Penaeus vannamei. Invertebr Reprod Dev. 2002;42(2–3):137–143. [Google Scholar]
  32. Utarabhand P, Bunlipatanon P. Plasma vitellogenin of grouper (Epinephelus malabaricus): isolation and propertie. Comp Biochem Physiol C Pharmacol Toxicol Endocrinol. 1996;115(2):101–110. doi: 10.1016/s0742-8413(96)00055-2. [DOI] [PubMed] [Google Scholar]
  33. Wang W, Shi L, Xie Y, Ma C, Li W, Su X, Huang S, Chen R, Zhu Z, Mao Z, Han Y, Li M. SP600125, a new JNK inhibitor, protects dopaminergic neurons in the MPTP model of Parkinson’s disease. Neurosci Res. 2004;48(2):195–202. doi: 10.1016/j.neures.2003.10.012. [DOI] [PubMed] [Google Scholar]
  34. Wang M, Atayar C, Rosati S, Bosga-Bouwer A, Kluin P, Visser L. JNK is constitutively active in mantle cell lymphoma: cell cycle deregulation and polyploidy by JNK inhibitor SP600125. J Pathol. 2009;218(1):95–103. doi: 10.1002/path.2521. [DOI] [PubMed] [Google Scholar]
  35. Wang H, Shi C, Kong M, et al. Cloning and expression of a transcription factor activator protein-1 member identified from the swimming crab Portunus trituberculatus. Cell Stress Chaperones. 2018;23(6):1275–1282. doi: 10.1007/s12192-018-0935-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Wu XG, Yao GG, Yang YZ et al (2007) A study on the ovarian development of Portunus trituberculatus in East China Sea during the first reproductive cycle. Acta Oceanol Sin(04):120–127 (in Chinese)
  37. Yang F, Xu HT, Dai ZM, Yang WJ. Molecular characterization and expression analysis of vitellogenin in the marine crab Portunus trituberculatus. Comp Biochem Physiol B Biochem Mol Biol. 2005;142(4):456–464. doi: 10.1016/j.cbpb.2005.09.011. [DOI] [PubMed] [Google Scholar]
  38. Yang H, Choi HJ, Park SH, Kim JS, Moon Y. Macrophage inhibitory cytokine-1 (MIC-1) and subsequent urokinase-type plasminogen activator mediate cell death responses by ribotoxic anisomycin in HCT-116 colon cancer cells. Biochem Pharmacol. 2009;78(9):1205–1213. doi: 10.1016/j.bcp.2009.06.012. [DOI] [PubMed] [Google Scholar]
  39. Yang Y, Wang J, Han T, et al. Ovarian transcriptome analysis of Portunus trituberculatus provides insights into genes expressed during phase III and IV development. PLoS One. 2015;10(10):e0138862. doi: 10.1371/journal.pone.0138862. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Yeste-Velasco M, Folch J, Casadesús G, Smith MA, Pallàs M, Camins A. Neuroprotection by c-Jun NH2-terminal kinase inhibitor SP600125 against potassium deprivation-induced apoptosis involves the Akt pathway and inhibition of cell cycle reentry. Neuroscience. 2009;159(3):1135–1147. doi: 10.1016/j.neuroscience.2009.01.035. [DOI] [PubMed] [Google Scholar]
  41. You P, Xing F, Huo J, Wang B, di J, Zeng S, Liu J. In vitro and in vivo evaluation of anisomycin against Ehrlich ascites carcinoma. Oncol Rep. 2013;29(6):2227–2236. doi: 10.3892/or.2013.2355. [DOI] [PubMed] [Google Scholar]
  42. Zhang H, Liu X, Zhou S, Jia Y, Li Y, Song Y, Wang J, Wu H. SP600125 suppresses Keap1 expression and results in NRF2-mediated prevention of diabetic nephropathy. J Mol Endocrinol. 2018;60(2):145–157. doi: 10.1530/JME-17-0260. [DOI] [PubMed] [Google Scholar]
  43. Zheng Y, Zhang M, Zhao Y, Chen J, Li B, Cai W. JNK inhibitor SP600125 protects against lipopolysaccharide-induced acute lung injury via upregulation of claudin-4. Exp Ther Med. 2014;8(1):153–158. doi: 10.3892/etm.2014.1684. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Zhu B, Wu X. Identification of outer membrane protein ompR from rickettsia-like organism and induction of immune response in Crassostrea ariakensis. Mol Immunol. 2008;45(11):3198–3204. doi: 10.1016/j.molimm.2008.02.026. [DOI] [PubMed] [Google Scholar]
  45. Zmora N, Trant J, Chan SM, et al. Vitellogenin and its messenger RNA during ovarian development in the female blue crab, Callinectes sapidus: gene expression, synthesis, transport, and cleavage. Biol Reprod. 2007;77(1):138–146. doi: 10.1095/biolreprod.106.055483. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

ESM 1 (17.7KB, docx)

(DOCX 17 kb).

Data Availability Statement

All data generated or analyzed during this study are included in this published article and its supplementary information files.

Articles from Cell Stress & Chaperones are provided here courtesy of Elsevier

RESOURCES