Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2020 Jul 1;10:10766. doi: 10.1038/s41598-020-67627-w

Wheat Myo-inositol phosphate synthase influences plant growth and stress responses via ethylene mediated signaling

Naveen Sharma 1, Chanderkant Chaudhary 1, Paramjit Khurana 1,✉
PMCID: PMC7329911  PMID: 32612188

Abstract

L-myo-inositol phosphate synthase (MIPS; EC 5.5.1.4) is involved in abiotic stress tolerance, however its disruption and overexpression has also been associated with enhanced tolerance to pathogens. The molecular mechanism underlying the role of MIPS in growth, immunity and abiotic stress tolerance remains uncharacterized. We explore the molecular mechanism of MIPS action during growth and heat stress conditions. We raised and characterized the TaMIPS over-expressing rice transgenics which showed a reduced reproductive potential. Transcriptome analysis of overexpression transgenics revealed the activation of ET/JA dependent immune response. Pull-down analysis revealed the interaction of TaMIPS-B with ethylene related proteins. Our results suggest an essential requirement of MIPS for mediating the ethylene response and regulate the growth. A model is proposed outlining how fine tuning of MIPS regulate growth and stress tolerance of the plant.

Subject terms: Plant biotechnology, Plant stress responses

Introduction

L-myo-inositol phosphate synthase (MIPS; EC 5.5.1.4) is the sole enzyme for myo-inositol synthesis, a molecule of paramount importance during cell wall biogenesis1, auxin storage2, phytic acid synthesis3 and oligosaccharides synthesis4. Presence of MIPS in prokaryotes and eukaryotes, suggests its early existence during the course of evolution5. MIPS protein sequence has been under extensive conservation with existence of identical amino-acid stretches in the protein sequence such as (NGSPQN) and (SKSNV)6,7 and differential regulation of its activity by phosphorylation at serine residue. Phosphorylation of (NGSPQN) motif increases the enzyme activity, while that of the central serine residue of (SKSNV) motif inhibits its activity6. MIPS exist as an enzyme complex which is catered distinctly in different tissues depending upon the specific needs8.

Ectopic expression of MIPS results in enhanced tolerance towards cold, drought and salt stress in several plants9–15. Overexpression of MIPS also results in enhanced tolerance towards stem nematodes in transgenic sweet potato15. Interestingly, mutation of AtMIPS1 results in light intensity dependent programmed cell death (PCD) and enhanced basal immunity16,17. Transcriptome analysis of Atmips1 short-day and long-day grown plants reveals the up-regulation of defense related genes along with genes involved in salt stress and ozone stress17. Loss of function approach was used in different organism to reduce the expression of MIPS to develop low phytate plants. However, down-regulation of MIPS level results in pleiotropic effect like reduced apical dominance, enhanced leaf senescence, reduced yield18, reduced levels of ascorbate, inhibition of seed germination along with higher sensitivity to ABA in transgenics3,19. Therefore, a clarity on distinct role of MIPS during growth and immunity remains unclear.

To investigate the role of MIPS during growth and immunity, we analysed the TaMIPS gene family and characterized TaMIPS-B over-expressing rice transgenics. Our investigation suggests involvement of MIPS in ethylene synthesis and signaling response. An increase in expression of MIPS evokes ethylene response. Thus, we conclude that differential MIPS levels are required for normal growth, immunity and abiotic stress tolerance.

Results

Evolutionary conservation of MIPS

To determine the evolutionary conservation in diverse species, we identified MIPS gene family in chosen organisms which covers a wide range of classes like mammals, bryophytes, pteridophytes, algae, monocots and dicots by HMM search. We fished out same number of MIPS proteins sequences in Arabidopsis and Oryza20. Out of all the members from the gene family of respective organisms, primary enzyme coding sequence was used for multiple sequence alignment by ClustalOmega and phylogenetic tree was created using Neighbor-joining method (Fig. 1a). We found an extensive sequence conservation with presence of identical amino-acids in MIPS genes with two most conserved motifs i.e. (NGSPQN) and (SKSNV) in all the organism (Fig. 1b) (Fig. S1). We also performed a domain search in these sequences, identified the NAD_5_Binding (PF07994) and Inos-1-P_synth domain (PF01658). Overall this investigation suggests the significant evolutionary conservation of (NGSPQN) and (SKSNV) motifs in the NAD_5_binding and Inos-1-P_synth domain, respectively.

Figure 1.

Figure 1

Gene Family and Expression Analysis of MIPS. (a) Phylogenetic analysis of major MIPS using ClustalOmega. Phylogenetic tree was build by Neighbour-joining method. Number of genes present in the gene family are represented by red coloured digit and isoforms in green coloured digits. (b) Schematic representation of conserved domains and motifs present in the MIPS. NAD_binding_5 superfamily and inositol phosphate synthase are colour coded by blue and orange regions, respectively . TaM/PS-B domains were compared to Human and Arabidopsis MIPS protein. (c) Relative expression levels of TaMIPS-A, TaMIPS-B and TaMIPS-D in 10-day-old seedlings during various simulated abiotic stress treatment.

TaMIPS gene family, organization and expression analysis

We identified and isolated three MIPS transcript in wheat. All three TaMIPS gene are on wheat chromosome 4 of the A, B and D genome, so they were named TaMIPS-A, TaMIPS-B, TaMIPS-D according to their location. It was interesting to observe that MIPS gene family in Triticum aestivum consist of three genes only. Gene structure of MIPS homologues consist of 10, 9 and 10 exons in TaMIPS-A, TaMIPS-B and TaMIPS-D, respectively (Fig. S2). We further analysed the 2 Kb upstream sequence TaMIPS-B using PLACE database and found the regulatory elements related to light, SA and ET/JA responsive (Table S2). We also checked the homology between the TaMIPS transcripts and observed more than 99% homology between them. To investigate the differential expression of TaMIPSs homologs under various abiotic stresses, we carried out the quantitative RT-PCR in different stresses. We found elevated expression of TaMIPSs during heat stress which was prominent in TaMIPS-D (sixfold change) whereas TaMIPS-B and TaMIPS-D showed same expression compared to control condition (Fig. 1c). During cold stress, TaMIPS-D was found to have highest expression (fourfold change) among other members and followed by TaMIPS-B compared to control condition (Fig. 1c). We also investigated the expression of TaMIPS during salt stress and found that TaMIPS-A had highest expression amongst the three homologues followed by TaMIPS-B and TaMIPS-D. From this analysis, it appears that TaMIPS-A, TaMIPS-B and TaMIPS-D are stress inducible and TaMIPS-B was further characterized.

TaMIPS-B overexpression imparts thermotolerance in rice

To characterize the TaMIPS-B, we raised the TaMIPS-B over-expressing rice transgenics. Of the various regenerants; at least independent 46 transgenic plants were identified, and five lines were chosen for detailed characterization (Fig. 2a). Southern blot analysis was carried out which revealed that transgenic line L5, L9 and L2 had a single copy insertion, while transgenic line L4 and L3 possess 2 and 3 transgene copies, respectively (Fig. 2b). Subsequent, expression analysis of TaMIPS-B transgenic lines was carried out and expression was observed in L4, L9, L2 whereas no signal was observed in L3 and L5 (Fig. 2c). This study suggests the expression of transgene in transgenic line L4, L9, L2 and no expression in L3 and L5. Transgene expressing Lines (L4, L9, L2) and silenced line (L3, L5) were used for further analysis and thermotolerance assay.

Figure 2.

Figure 2

Phenotypic and molecular characterization of TaMIPS-B overexpression (OE) Rice T2 Transgenics. (a) Phenotype of 40-day-old TaMIPS-B overexpression rice T2 transgenics. (b) Southern blot analysis for gene copy number in TaMIPS-B overexpression rice T2 transgenics using hpt probe. (c) Northern blot analysis of TaMIPS-B overexpression transgenics plants using TaMIPS-B gene probe.

40-days old seeding were subjected to 45 °C ± 1 for 6 h consecutively for three days to assess the possible role of TaMIPS-B in heat stress. Control and treated plant samples of wild type and transgenics were collected to carry out the myo-inositol, MSI and MDA quantification. As expected, we found a significant increase in myo-inositol levels in the transgenic lines L9, L2, L4 as compared to the wild type with maximum levels in line no 2. Further, upon heat stress a similar profile was observed however, a decrease in levels of myo-inositol was seen in lines L9, L2, L4 during heat stress whereas an increase in line L3, L5 (Fig. 3a). Membrane stability index (MSI) was also measured and MSI was high in transgenic lines L3 (78%), L9 (77%), L2 (77%), L4 (78%) as compared to wild type (72%) under control condition (Fig. 3b). During heat stress, transgenics line L3 and L2 showed highest membrane stability followed by L4, L5. Wild type plants had least membrane stability upon heat stress. To determine the effect of heat stress, we checked the lipid peroxidation by quantifying the levels of MDA and found higher level of MDA in wild type plants upon heat stress as compared to the transgenic lines (Fig. 3c).

Figure 3.

Figure 3

Physiological and Phenotypic Analysis in TaM/PS-B OE Rice T2 Transgenics During Heat Stress (HS). (a) Quantitation of Myo-inositol, (b) Membrane stability index (MSI), (c) MDA levels in wild type and TaMIPS-B transgenics under control and heat stress conditions, respectively. Error bar represent the ± standard deviation of five biological samples. (d) Photosynthesis efficiency (Fv/Fm) analysis of TaMIPS-B rice transgenics. Graph panel with green bar represent the photosynthetic efficiency of overexpression TaM/PS-B transgenics and wild type under control condition, yellow bar during heat stress and blue bars during recovery. Error bar represent the ± standard deviation of five biological samples. (e–g) Phenotypic analysis of TaMIPS-B overexpression transgenic during heat stress. (e) Photograph of representative plants of each line (L3, L5, L9, L2, L4) under control conditions, (f) After 3 days of heat stress at 45°C ±1 for 6 h, and (g) After 5 days of recovery in green house.

Photosynthetic efficiency of transgenics was also investigated under control and heat stress conditions. For heat stress treatment, 40-days old plants were subjected to 3-days heat treatment at 45 °C ± 1 for 6 h and transferred to green house after every treatment. Under control condition, FV/FM values were higher in transgenics as compared to wild type plants (0.816) with maximum value in transgenic line L9 (0.823) followed by L2 (0.817), L4 (0.817) and L5 (0.812) whereas L3 showed least value (0.75) (Fig. 3d,e). During heat stress regime, FV/FM values were measured and a sharp decrease in wild type plants was observed whereas transgenic lines L9, L2, L4 showed consistent tolerance as correlated by high value of FV/FM. L3 showed decrease at day three with no change till second day of heat treatment whereas L5 showed continuous decrease after first day of heat treatment (Fig. 3d,f). After heat treatment, plants were shifted to green house and observed that transgenics recovered much faster than the wild type as FV/FM value of L2 reverted to 0.80 after three days followed by L4 (0.79) and L9 (0.78) (Fig. 3d,g). After 15 days of recovery, transgenic lines L9, L2, L4 recovered to their initial FV/FM ratio but transgenic lines L2 and L4 after recovery showed increase in FV/FM ratio compared to their control condition values.

Reduced grain yield upon overexpression of TaMIPS-B in rice

When the effect of TaMIPS-B overexpression on reproduction was analysed. The seed setting rate in panicle of TaMIPS-B transgenics and wild type (Fig. 4) was calculated. We observed a decrease in seed setting rate in all transgenic lines i.e. L9, L3, L4, L2 and a lowest percentage in L5 as compared to the wild type plant (Table 1). Reduced seed-setting rate suggest the negative effect of MIPS overexpression.

Figure 4.

Figure 4

Phenotype of panicles TaMIPS-B overexpression rice T2 transgenics.

Table 1.

Seed-setting rate of TaMIPS-B overexpression rice T2 transgenics compared with wild type.

Plant genotype Total floret Fertile florets Sterile florets Seed setting rate (%) % Decrease
WT 431 237 194 54.9 NA
L3 278 105 173 37.7 31
L5 424 75 349 17.6 67
L9 505 159 346 45.4 17
L2 382 106 276 27.7 49
L4 255 116 139 31.4 42

Gene expression analysis revealed enrichment defense pathway in TaMIPS-B transgenic

To understand the role of MIPS in reduced reproductive potential, we carried out the whole transcriptome analysis of TaMIPS-B over-expressing transgenic under control and heat stress condition using Illumina HiSeq 2,500 sequencer with PE100 which resulted in generation of 57 to 70 million reads per sample. Paired end reads were assembled into 178,134 transcripts and 66,106 genes in TaMIPS-B over-expressing transgenics with N50 of 2,249 by Trinity. Finally, a total of 5,879 transcripts were found to be differentially expressed in the TaMIPS-B transgenics. Interestingly, we observed that the up regulation of defense genes like chitinase3, WRKY transcription factor 6, Pathogenesis-related protein PRMS along with ERF1B in TaMIPS-B over-expressing transgenics (Fig. 5). We carried out the gene ontology (GO) term enrichment analysis using upregulating genes in the TaMIPS-B over-expressing rice transgenic. To reduce the GO terms, we used REduced VIsualize Gene Ontology (REVIGO)21. We found multiple GO term like “defense response”, “defense response to insect” and “regulation of salicylic acid metabolic process” (Fig. 6).

Figure 5.

Figure 5

Expression analysis of TaMIPS and HS induced genes in rice transgenics. Heat map displaying differentially expressed genes of overexpression TaMIPS-B rice T2 transgenic based on log ratio of FPKM data. Column corresponds to the experimental samples and row corresponds to gene. The color key represents FPKM normalized log10 transformed counts. Red color corresponds to high expression and green to low expression. Representative TaM/PS-mediated up and down-regulated genes are highlighted.

Figure 6.

Figure 6

REVIGO scatterplot for visualizing enriched GOs. Enriched GOs in TaMIPS-B transgenics. REVIGO (reduce and visualize GO) scatterplot comprehends the overrepresented GO biological process categories in Atmips1 and TaMIPS-B. GO enrichment analysis was performed by Trinotate at P value s 0.05. Bubble colour corresponds the p-value obtained from GO enrichment analysis, whereas the bubble size corresponds to the GO term prevalence in the UniProt-GOA database.

Identification of MIPS interacting protein in wheat

To gain insight into the mode of action of MIPS, we investigated the presence of interacting proteins of TaMIPS-B as previous reports suggest its dual nature. We therefore performed the far-western analysis using purified His-TaMIPS-B protein (Fig. 7a) and crude plant extract and found two interacting signals in the range of 35–48 kD (Fig. 7b). Further, we performed in-vitro pull down using recombinant His-tagged TaMIPS-B expressed in bacteria E. coli. The protein obtained were separated by SDS page and Coomassie stained. We found three more protein bands along with the recombinant His-TaMIPS-B in all the plant samples except four bands in grain_Z75 plant sample. Z75 plant sample was used for further analysis. Out of four bands, three were in size range of 48 kDa to 35 kDa (Fig. 7c).

Figure 7.

Figure 7

Identification of TaMIPS-B lnteractors. (a) Western blot analysis of His-TaMIPS-8 recombinant protein with anti-His antibody. (b) Far-western blot analysis was done using 50ug of purified recombinant protein. After extensive washes, interacting protein were detected using anti-His antibody and visualized with lmmobilonTM western (Millipore). (c) Isolation of TaMIPS-8 interacting proteins from plant lysates by in-vitro pull-down assay. SDS_PAGE (12%) demonstrating, a putative interactors of TaMIPS-8 protein.

We observed the presence of MIPS sequence in the first two bands which range in 48 kDa to 35 kDa (Table 2). This result suggests TaMIPS-B interacts with its homologs as molecular weight of TaMIPS-B and TaMIPS-D were in this range (Table S1). Further pull-down extract was subjected to LC–MS analysis to identity the interacting proteins. We found ethylene related proteins (Table 3).

Table 2.

Identification of MIPS proteins by MALDI-MS.

Band number Accession Id Protein name Peptide sequence
1 GI: 14548089, GI: 1040821086 MIPS VQQANYFGSLTQASTIR, DKVQQANYFGSLTQASTIR, VQQANYFGSLTKASTIR
2 GI: 14548089 MIPS VQQANYFGSLTQASTIR, DKVQQANYFGSLTQASTIR
3 No No MIPS hit NA
4 No protein identified No protein identified NA

Table 3.

List of probable interactors of TaMIPS-B identified by MS/MS.

Swiss-Prot accession number Protein name Theoretical mW (Da) PLGS score Sequence coverage (%)
G8HMZO Myo-inositol-1-phosphate synthase 56086 828 21.7
M7YZ59 1-aminocyclopropane-1-carboxylate oxidase 3 33023 201.3 11
M7ZRU2 Serine/threonine-protein kinase CTR1 133646 34.3 5
W5AA37 Peroxidase 36713 26.5 2.93

Discussion

Myo-inositol has been associated with numerous roles i.e. cell wall biogenesis1, auxin storage2, phytic acid synthesis3, and oligosaccharides synthesis4. In this study, we have proposed that MIPS acts as a molecular switch to control growth and immunity.

MIPS gene family analysis in organism included in this study indicates their less diversification due to the presence of a relatively small gene family which usually consist of 1–5 genes. We identified previously reported conserved motifs (NGSPQN) and (SKSNV) in all the major MIPS coding gene from all the organism studied. MIPS is a phosphoprotein and its activity is regulated by phosphorylation at serine residue. Phosphorylation of serine residue of (NGSPQN) is predicted via GSK-3 which increases the MIPS activity whereas phosphorylation of serine residue of (SKSNV) via PKC decreases the activity6. Conservation of above said motifs across species including Homo sapiens, suggests a common mechanism of MIPS enzyme regulation at post-translational level.

Expression analysis of TaMIPS in whole seedlings suggests differential expression of TaMIPS-B, TaMIPS-A, TaMIPS-D in wheat during induced stress conditions. TaMIPSs expression during stress revealed the stress inducible behavior of TaMIPS-A, TaMIPS-B and TaMIPS-D with highest expression of TaMIPS-D in thermal stress (heat and cold stress) whereas TaMIPS-A showed highest expression under salt stress. Similarly, high expression of AtMIPS2 in heat and AtMIPS3 in heat and drought has been seen in previous report where the AtMIPS1 showed less expression compared to AtMIPS2 and AtMIPS320. Differential expression of CaMIPS1 and CaMIPS2 also demonstrated the similar situation in which CaMIPS2 was induced by environmental stress with no effect on CaMIPS122.

We next carried out generation and physiological analysis of TaMIPS-B over-expressing rice transgenics. We observed two and three copy number of transgenes in L4 and L3, respectively. However, transgene expression was observed in transgenic lines L9, L2, L4 but no expression in L3 and L5. The probable reason could be the high copy number in case of L3 which led to the silencing whereas in L5 DNA methylation, position effect, trans-inactivation could be the reason of gene silencing. Previous report correlates high transgene copy number with transgene silencing in tobacco23. Moreover, a recent study also demonstrated the overexpression of AtMIPS2 resulting in co-suppression of all the three AtMIPS genes which leads to reduced root length, delayed or absence of flowering along with reduced fertility24. Further these transgenics were used for thermotolerance assay. As expected, we observed increase in myo-inositol in transgenic line L9, L2, L4 with maximum level in L2 in control condition. A similar pattern was observed during heat stress but with slight decrease as compared to control conditions. When MDA (malondialdehyde) levels were checked in transgenic and wild type, we found low MDA levels in all transgenic line except L5. During heat stress, MDA levels increased in all the lines but the level of MDA in transgenics was lower as compared to wild type. MSI too has been correlated with heat tolerance under heat stress regime in wheat25. We observed higher MSI in transgenic line L9, L2, L4 along with L3 during heat stress and control condition compared to wild type.

Heat stress also affects respiration and photosynthesis which results in decrease in plant productivity26. During heat stress regime, transgenic lines performed better especially transgenic line L2 which had the highest myo-inositol level at heat treatment day 3. High level of myo-inositol could be correlated to high photosynthetic efficiency of PSII. During recovery period after heat stress, transgenic lines recovered completely after 7 days whereas wildtype along with transgene silenced line L3 and L5 could not recover to control Fv/Fm ratio. Phenotypic analysis also showed a similar pattern; transgene silenced lines and wild type could not recover from the heat stress, even after 15 days of recovery whereas transgene expressing lines L9, L2, L4 showed growth and emergence of new leaves as early as 7 days of recovery in L2. Over-expression of SaINO1 showed significantly enhanced tolerance during salt stress in Arabidopsis9, whereas Ectopic expression of RINO1 in rice and overexpression of IbMIPS in sweet potato results in enhanced tolerance to salt and drought stress10,15. Previous report from our lab also demonstrated that overexpression of TaMIPS-B in Arabidopsis confers heat tolerance27 and the present data also supplements our assumption that over-expression of TaMIPS-B results in enhanced heat tolerance in this instance in rice.

AtMIPS1 has been reported as metabolic enzyme and a transcriptional regulator28. Previous study has also revealed the existence of human MIPS as an enzyme complex with its isoforms and these complexes are tailored according to the tissue specific needs8. Our Far western and pull-down data suggests TaMIPS-B interaction with its homologues as well as 1-aminocyclopropane-1-carboxylate oxidase 3, serine/threonine-protein kinase CTR1 and might affect their activity as well. Therefore, we conclude that TaMIPS-B interacts with these proteins and forms an enzyme complex to carry out its function in the cell. Moreover, our results are substantiated by Arabidopsis interactome study which has predicted the interaction of AtMIPS1 with AtMIPS2 along with peroxidase and AtMIPS2 with ACO329.

We also performed whole transcriptome analysis of TaMIPS-B transgenics and further gene ontology analysis which revealed activation of defense response. We observed the up-regulation of ERB1B in transgenics. ERF1B is considered as an integrating point for ethylene and jasmonate signals and activates the defense related gene like chitinase 3, 23 KDa jasmonate-induced protein, ß-glucosidase, peroxidase 2, WRKY transcription factor 6, glutathione S-transferase T3 and thaumatin-like protein which were reported to be upregulated in overexpression Col-0;35S:ERF1 transgenics30. Up-regulation of these genes in TaMIPS-B transgenic suggests the activation of ET/JA signaling. Overexpression of IbMIPS1 provides resistance to stem nematode15, presence of elements related in ET/JA in MIPS promoter and GO term “defense response to insect” supports the activation of ET/JA pathway. From this data, we can conclude that the up-regulation of MIPS results in activation of ET/JA–dependent defense pathway in TAMIPS over-expressing rice transgenics.

When we investigated TaMIPS-B over-expressing rice transgenic at reproductive stage and we observed a reduced in seed setting rate with maximum reduction in L2 which had highest level of MI. During heat stress, rate of evolution of ethylene in heat sensitive variety is higher than tolerant one, which is correlated to higher male sterility and results in reduced grain yield31,32. Decrease in seed setting rate in over-expressing TaMIPS-B transgenic might be because of over-production of ethylene which results in reduced fertility.

In conclusion, activation of SA defense response in Atmips1 and overexpression of IbMIPS1 provides resistance to stem nematode and salt stress15,17 suggests us that plants perceive altered levels of myo-inositol as a stress effector molecule and result in activation of defense response. We proposed the hypothesis that receptors like kinases might be phosphorylating the serine residue of (SKSNV) motif which result in rapid increase or decrease in activity of myo-inositol phosphate synthase6 and subsequent increase and decrease in level of MI is perceived as the stress condition. We can thus conclude that during normal conditions optimal level of MI are maintained and when the host encounters abiotic or biotic stress conditions, it increases or decreases MI level to activate ethylene response or SA-mediated defense responses depending upon the stress, type of stress and causative agents. It is therefore one of the important central regulators in balancing plant growth and immunity (Fig. 8).

Figure 8.

Figure 8

A model based on findings and published data. myo-inositol phosphate synthase (MIPS) in regulating the stress response. During normalconditions, optimal level of Ml are maintained and when the host encounters abiotic or biotic stress conditions, it increases or decreases Ml level to activate ethylene response or SA­mediated defense responses depending upon nature of stress, type of stress and causative agents.

Materials and methods

TaMIPS gene mining

Protein and nucleotide sequences were downloaded from ftp://ftp.ensemblgenomes.org/pub/plants/release22/fasta/triticum_aestivum/, https://www.ensembl.org/info/data/ftp/index.html and https://plants.ensembl.org/info/website/ftp/index.html. TaMIPS genes were identified in protein sequences by HMM search (https://hmmer.org) using inositol phosphate synthase (Inos-1-P_synth) domain hmm from Pfam database with default E-value of 10. Similarly, MIPS sequences from other organisms i.e. Aegilops tauschii, Arabidopsis thaliana, Brachypodium distachyon, Chlamydomonas reinhardtii, Hordeum vulgare, Medicago truncatula, Oryza sativa, Physcomitrella patens, Selaginella moellendorffii, Sorghum bicolor, Triticum urartu, Vitis vinifera and human were identified.

In-silico analysis of TaMIPS gene family

TaMIPS gene structure was predicted by Splign (https://www.ncbi.nlm.nih.gov/sutils/splign). Protein Sequences of TaMIPS were checked for the domains using NCBI Conserved Domain Database (NBCI-CDD)33 and motif search tool (https://www.genome.jp/tools/motif/). To deduce the phylogenetic relationship between the homologous TaMIPS, protein sequences were aligned by ClustalOmega (https://www.ebi.ac.uk/Tools/msa/clustalo/) and phylogenetic tree was made using Neighbour-joining method. Phylogenetic tree was drawn using FigTree program.

Plant sample, growth and stress conditions

Wheat (Triticum aestivum) seeds (PBW 343) were surface sterilized by sodium hypochlorite for 20 min and grown at 22 ± 1 with 16:8 light and dark cycle for 10 days. 10-day-old seedlings were used for expression analysis under different stress conditions. For temperature stress, seedlings were exposed to 42 °C and 4 °C for 4 and 24 h respectively. For salt stress, seedlings were transferred to 200 mM NaCl solution for 24 h.

Rice transgenics were raised using Oryza sativa ssp. Indica var. PB1. Sterilized seeds were used for callusing and transgenic generation was done according to protocol described by Nishimura et al.34. Regenerated plantlets were then transferred to a rooting media and subsequently to pots and raised to maturity.

RNA isolation and cDNA synthesis

RNA was isolated from the different plant tissues (TaMIPS-B over-expressing rice transgenic seedling, control and stressed sample) using RNeasy plant mini kit (Qiagen, Germany). Samples were ground with liquid nitrogen and further proceeded according to the kit manual. In-column DNase treatment was done to remove the genomic DNA contamination. Quality and quantity of RNA samples were done by gel electrophoresis and nanodrop. 2 μg of RNA was used to make the cDNA using High-Capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific) and SuperScrip III First-Strand Synthesis System for Full length cDNA synthesis.

Cloning of TaMIPS-B CDS

TaMIPS-B full length cDNA was amplified from cDNA (forward primer AAGGATCCATGTTCATCGAGAGCTT, reverse primer AAGGTACCTCACTTGTACTCCAGGAT) was cloned in pB4NU vector via restriction digestion by BamH1 and Kpn1. Clone was confirmed by restriction digestion and DNA sequencing and the confirmed clone was used to transform rice calli using EHA 105 strain of Agrobacterium tumefaciens harboring pB4NU-TaMIPS-B.

Promoter sequence analysis

Promoter sequence of TaMIPS-B was fetched from IWGSC chromosome assemblies using CLC genomic work bench. A 2 kb putative promoter sequence was searched against PLACE cis elements database35 using CLC genomic workbench.

Genomic DNA isolation and southern analysis

100 mg fresh leaves transgenics were homogenized in liquid nitrogen and mixed with 500 μl CTAB buffer (2% w/v CTAB, 0.3 M NaCl, 20 mM EDTA, 100 mM Tris–Cl (pH-8) 0.2% BME). Genomic DNA was isolated according to Murray and Thompson36. Quality and quantity of genomic DNA was checked by gel electrophoresis and nanodrop (GE, US), respectively.

Transgene copy number was checked using 10 μg of genomic DNA. DNA was digested with BamHI and separated by 0.8% agarose gel electrophoresis. DNA was blotted on Hybond-N Nylon membrane (Pharmacia) and fixed using UV cross linker (UVP HybriLinker, Analytik Jena, US). Blot was probed with hpt gene probe which was synthesized using PCR DIG probe synthesis kit (SIGMA-ALDRICH). Hybridization and detection were done using the non-radioactive method by DIG Luminescent Detection Kit as per the manufacturer guidelines (SIGMA-ALDRICH) with hybridization temperature 42 °C and washing 65 °C. Detection was carried out using CSPD solution and visualized by Fujifilm LAS4000 luminescence imager.

Northern analysis

Transgene TaMIPS-B expression was checked by Northern blot analysis in rice transgenics. Total RNA from leaves of selected transgenic lines was isolated. 15 μg of RNA was denatured at 65 °C for 5 min, separated on 1% formaldehyde agarose gel37 and probed with TaMIPS-B gene probe. Blotting, hybridization and detection was done as described above.

Total plant protein extraction

Total plant protein was isolated from five wheat samples (PBW343) named spike zadok 65, heat stressed spike zadok 65, drought stressed spike zadok65, grain zadok 71, and grain zadok 75. 100 mg of leaves were homogenized in liquid nitrogen and mixed with 1 ml extraction buffer 50 mM NaHPO4, 150 mM NaCl, 0.5% Triton-X-100, 10% glycerol, 0.5 mM PMSF and 25 mM imidazole (IDZ). Samples were vortexed thoroughly followed by centrifugation at 10,000 g at 4 °C for 5 min. Total protein was collected from Supernatant and estimation of protein was done by plotting standard curve of BSA.

Membrane stability index

The Membrane Stability Index (MSI) was determined as explained by Singh and Khurana38. TaMIPS-B over-expressing rice transgenics leaf tissue (control and stressed) were placed in MQ water and initial conductivity (C1) was measured after incubating for 30 min at RT. Samples were then autoclaved for 20 min under 120 psi pressure and C2 was measured. MSI was calculated according to MSI = (1-(C1/C2)).

Photosynthetic yield

Photosynthetic efficiency of TaMIPS-B over-expressing rice transgenics was measured using a PAM-210 (H.Waltz, Germany) under control, heat stress and recovery period. To measure the Fv/Fm, plants were dark adapted for 30 min and measuring beam was applied to leaf to measure F0 followed by application of saturating pulse using the Fv/Fm function to measure the Fm (maximum fluorescence). Fv/Fm value calculated by instrument (PAM-210) using the formula as following: Fv/Fm where Fv = Fm-Fo.

MDA quantification

Lipid peroxidation level in wild type and TaMIPS-B over-expressing rice transgenic plants was checked under control and stress conditions by quantifying the MDA content. 100 mg of tissue was homogenized by adding 500 μl of 0.1% (w/v) Trichloro acetic acid and centrifuged at max speed for 10 min and 500 μl of supernatant was mixed with 0.5% TBA (thiobarbituric acid) followed by incubated at 95 °C for 25 min. Reaction was stopped at incubating in ice and absorbance was measured at 532 and 600 nm.

Myo-inositol quantification

myo-inositol levels were quantified using myo-inositol assay kit (Megazyme, USA). TaMIPS-B over-expressing rice transgenics leaf tissue were homogenized in MQ water and centrifuged at max speed for 5 min and reaction was set as per the kit instructions. Absorbance of samples were measured at 492 nm and myo-inositol content was calculated by the formula: Myo-inositol = 0.2046 × ∆AInositol where ∆AInositol= Absorbance 2 – Absorbance1.

Transcriptome analysis

Whole transcriptome comparison of TaMIPS-B over-expressing rice transgenics was done against wild type. Paired-end cDNA library preparation was prepared from pooled RNA sample of three gene expressing chosen transgenic lines. RNA sequencing was carried out by SciGenom, India. De-novo assembly of Reads from each library was carried out using software package Trinity 2.0.6 with default parameters39,40. Generated transcripts were used for differential expression analysis. Transcript abundance estimation was done using the software RSEM 1.2.7 which outputs the expression-normalizing value FPKM. Differential expression was carried out using abundance matrix files generated by RSEM, by software EdgeR 2.1441 with the default parameters and TMM (Trimmed Mean of M-values) comparison was done across all the samples which resulted into a new matrix with normalized expression values across samples measured in FPKM. The expression patterns of the transcripts in the samples were restricted to the transcripts with significant differential expression (P-value 0.01, Fold change log2 scale).

Functional annotation and gene ontology (GO) enrichment analysis

Assembled transcripts were annotated using Trinotate pipeline (https://trinotate.github.io/). Assembled transcripts were compared against Swissprot-Uniprot database, using blastn with an E-value 10–5. Transdecoder v.2.0.1 (https://transdecoder.sourceforge.net/) was used to predict the longest ORF in assembled transcripts. Predicted ORFs were then annotated using blastp against the Swissprot-uniprot database with an E-value cut-off of 10−6. Further annotation was carried out using Trinotate as per the manual. REVIGO scatter plot was used to visualization of GO enrichment analysis (https://revigo.irb.hr).

Expression and purification of TaMIPS-B

TaMIPS-B gene was cloned into expression vector pET101/D-TOPO (ThermoFisherSCIENTIFIC). Cloning and transformation of cloned vector in BL21(DE3) was done as per the manufactural instructions (pET100/D-TOPO (ThermoFisherSCIENTIFIC). Large scale expression of recombinant protein was done at 16 °C by inducing the bacterial culture (0.5 OD) with 0.5 mM IPTG in BL21(DE3) cells. Bacterial pellet was lysed using lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 1 mM PMSF, 0.1% Tween-20, 10% glycerol, 10 mM imidazole) and sonicated. Crude extract was cleared by centrifugation at 10,000 rpm at 4 °C for 30 min and used immediately. TaMIPS-B-His was purified using Ni–NTA beads with a 10-ml bed volume and 10 mg of crude TaMIPS-B-His extract. TaMIPS-B-His crude extract was incubated with Ni–NTA beads at 4 °C for binding for 1 h and washed extensively by washing buffer (50 mM NaH2PO4, 150 mM NaCl, 1 mM PMSF, 20 mM imidazole) and bound protein were eluted with an equal bed volume of elution buffer (50 mM NaH2PO4, 300 mM NaCl, 1 mM PMSF, 70 mM Imidazole, 10% glycerol) in 2 ml fractions. Cell lysate supernatant, insoluble pellet, eluted fractions were checked for recombinant protein by 12% SDS PAGE with Coomassie blue staining. Purified TaMIPS-His protein was then confirmed by western blot analysis using anti-His antibody and MALDI-TOF.

Western and far-western assay

To check the TaMIPS-B protein interaction, Far-western analysis was carried out using purified TaMIPS-B-His recombinant protein as bait and plant crude extract (Zadok 65 spike stage) as prey according to Wu et al.42. 500 μg prey protein along with BSA (Bovine serum albumin) and purified His-TaMIPS-B as negative and positive control, respectively, were blotted on membrane in two sets and one of it was proceeded with western blot analysis and the other blot used for far-western analysis. Western blot was probed and detected by anti-His antibody whereas other was proceeded to denaturing/renaturing of blotted prey protein for 12–16 h. Blot was then blocked with 5% milk and washed with PBST (Phosphate buffered saline with Tween-20) buffer three times. Membrane was then incubated with bait protein (Purified His-TaMIPS-B protein) at 4 °C for 12 h. Bait protein bound to prey protein was detected on blot after stringent washing and incubating it with primary (anti-His) antibody followed by secondary antibody. Visualization was done by chemiluminescence using Immobilon Western Chemiluminescent HRP Substrate (MERCK) according to manufactural instructions using Fujifilm LAS4000 luminescence imager.

Pull-down assays

Pull-down assay was preformed using the 500 μg of purified TaMIPS-B-His recombinant protein with 2 mg of crude wheat extract. Wheat extracts were prepared by homogenizing control samples of spike at Zadok 65 (spike_Z65) stage along with treatments i.e. heat and drought and grain sample (grain_Z71, grain_Z75) total plant protein extraction buffer (50 mM NaH2PO4, 50 mM NaCl, 1 mM PMSF, 0.1% Triton X-100). Homogenate was centrifuge at 5,000 rpm for 5 min and supernatant transferred to fresh MCT. Purified recombinant protein, Ni–NTA beads and plant crude extract were incubated at 4 °C with gentle shaking for 12 h. Beads were then centrifuged and washed extensively with washing buffer (same as above) and bound protein eluted with equal bed volume of elution buffer (same as above). The eluted protein was then subjected to SDS-PAGE electrophoresis and protein bands isolated and given for MALDI-TOF Mass Spectrometry (CIF, Biotech Centre, UDSC). Pull-down extract was also given for Liquid Chromatography Mass Spectrometry (LC–MS) analysis to Sandor, India.

Statistical analyses

All values reported in this work are the average of at least two independent biological replicates having at least 15 seedlings. Error bars represent SE.

Supplementary information

Acknowledgements

This work is supported by grants from Department of Biotechnology, Government of India (Grant number—BT/PR8406/AGIII/103/879/2013). NS acknowledges the University Grant Commission, Government of India for the UGC fellowship. The infrastructure support of the department by DST-FIST and Purse programmes is also acknowledged.

Author contributions

N.S. and C.C. had performed the experiment. N.S. had prepared the all the figures. N.S. and P.K. had written the main manuscript. All authors reviewed the manuscript.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

is available for this paper at 10.1038/s41598-020-67627-w.

References

  • 1.Loewus FA, Kelly S, Neufeld EF. Metabolism of myo-inositol in plants: conversion to pectin, hemicellulose, D-xylose, and sugar acids. Proc. Natl. Acad. Sci. 1962;48:421–425. doi: 10.1073/pnas.48.3.421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Abreu EFM, Aragão FJL. Isolation and characterization of a myo-inositol-1-phosphate synthase gene from yellow passion fruit (Passiflora edulis F. Flavicarpai) expressed during seed development and environmental stress. Ann. Bot. 2007;99:285–292. doi: 10.1093/aob/mcl256. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ali N, Paul S, Gayen D, Sarkar SN, Datta SK, Datta K. RNAi mediated down regulation of myo-inositol-3-phosphate synthase to generate low phytate rice. Rice. 2013;6:1–12. doi: 10.1186/1939-8433-6-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Karner U, Peterbauer T, Raboy V, Jones DA, Hedley CL, Richter A. Myo-inositol and sucrose concentrations affect the accumulation of raffinose family oligosaccharides in seeds. J. Exp. Bot. 2004;55:1981. doi: 10.1093/jxb/erh216. [DOI] [PubMed] [Google Scholar]
  • 5.Bachhawat N, Mande SC. Complex evolution of the inositol-1-phosphate synthase gene among archaea and eubacteria. Trends Genet. 2000;16:111–113. doi: 10.1016/s0168-9525(99)01966-6. [DOI] [PubMed] [Google Scholar]
  • 6.Deranieh RM, He Q, Caruso JA, Greenberg ML. Phosphorylation regulates myo-inositol-3-phosphate synthase a novel regulatory mechanism of inositol biosynthesis. J. Biol. Chem. 2013;288:26822–26833. doi: 10.1074/jbc.M113.479121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Majumder AL, Johnson MD, Henry SA. 1L-myo-inositol-1-phosphate synthase. Biochim. Biophys. Acta Lipids Lipid Metab. 1997;1348:245–256. doi: 10.1016/s0005-2760(97)00122-7. [DOI] [PubMed] [Google Scholar]
  • 8.Seelan RS, Lakshmanan J, Casanova MF, Parthasarathy RN. Identification of myo-inositol-3-phosphate synthase isoforms: Characterization, expression, and putative role of a 16-kDa γc isoform. J. Biol. Chem. 2009;284:9443–9457. doi: 10.1074/jbc.M900206200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Joshi R, Ramanarao MV, Baisakh N. Arabidopsis plants constitutively overexpressing a myo-inositol 1-phosphate synthase gene (SaINO1) from the halophyte smooth cordgrass exhibits enhanced level of tolerance to salt stress. Plant Physiol. Biochem. 2013;65:61–66. doi: 10.1016/j.plaphy.2013.01.009. [DOI] [PubMed] [Google Scholar]
  • 10.Kusuda H, Koga W, Kusano M, Oikawa A, Saito K. Ectopic expression of myo-inositol 3-phosphate synthase induces a wide range of metabolic changes and confers salt tolerance in rice. Plant Sci. 2015;232:49–56. doi: 10.1016/j.plantsci.2014.12.009. [DOI] [PubMed] [Google Scholar]
  • 11.Majee M, Maitra S, Dastidar KG, Pattnaik S, Chatterjee A, Hait NC, Das KP, Majumder AL. A novel salt-tolerant L-myo-Inositol-1-phosphate synthase from Porteresia coarctata (Roxb.) tateoka, a halophytic wild rice. molecular cloning, bacterial overexpression, characterization, and functional introgression into tobacco-conferring salt tolerance. J. Biol. Chem. 2004;279:28539–28552. doi: 10.1074/jbc.M310138200. [DOI] [PubMed] [Google Scholar]
  • 12.Patra B, Ray S, Richter A. Enhanced salt tolerance of transgenic tobacco plants by co-expression of PcINO1 and McIMT1 is accompanied by increased level of myo-inositol and methylated inositol. Protoplasma. 2010;245:143–152. doi: 10.1007/s00709-010-0163-3. [DOI] [PubMed] [Google Scholar]
  • 13.Tan J, Wang C, Xiang B, Han R, Guo Z. Hydrogen peroxide and nitric oxide mediated cold- and dehydration-induced myo-inositol phosphate synthase that confers multiple resistances to abiotic stresses. Plant, Cell Environ. 2013;36:288–299. doi: 10.1111/j.1365-3040.2012.02573.x. [DOI] [PubMed] [Google Scholar]
  • 14.Wang FB, Zhai H, An YY, Si ZZ, He SZ, Liu QC. Overexpression of IbMIPS1 gene enhances salt tolerance in transgenic sweetpotato. J. Integr. Agric. 2016;15:271–281. [Google Scholar]
  • 15.Zhai H, Wang F, Si Z, Huo J, Xing L, An Y, He S, Liu Q. A myo-inositol-1-phosphate synthase gene, IbMIPS1, enhances salt and drought tolerance and stem nematode resistance in transgenic sweet potato. Plant Biotechnol. J. 2016;14:592–602. doi: 10.1111/pbi.12402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Donahue JL, Alford SR, Torabinejad J, Kerwin RE, Nourbakhsh A, Ray WK, Hernick M, Huang X, Lyons BM, Hein PP, Gillaspy GE. The Arabidopsis thaliana myo-inositol 1-phosphate synthase1 gene is required for myo-inositol synthesis and suppression of cell death. Plant Cell. 2010;22:888–903. doi: 10.1105/tpc.109.071779. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Meng PH, Raynaud C, Tcherkez G, Blanchet S, Massoud K, Domenichini S, Henry Y, Soubigou-Taconnat L, Lelarge-Trouverie C, Saindrenan P, Renou JP, Bergounioux C. Crosstalks between myo-inositol metabolism, programmed cell death and basal immunity in Arabidopsis. PLoS ONE. 2009;4:1–15. doi: 10.1371/journal.pone.0007364. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Brearley C, Trethewey RN, Keller R, Brearley CA, Trethewey RN, Mu B. Reduced inositol content and altered morphology in transgenic potato plants inhibited for 1 D-myo-inositol 3-phosphate synthase. Plant J. 1998;16:403–410. [Google Scholar]
  • 19.Nunes ACS, Vianna GR, Cuneo F, Amaya-farfan J, de Capdeville G, Elibio LR. RNAi-mediated silencing of the myo-inositol-1-phosphate synthase gene (GmMIPS1) in transgenic soybean inhibited seed development and reduced phytate content. Planta. 2006;224:125–132. doi: 10.1007/s00425-005-0201-0. [DOI] [PubMed] [Google Scholar]
  • 20.Khurana N, Chauhan H, Khurana P. Expression analysis of a heat-inducible, Myo-inositol-1-phosphate synthase (MIPS) gene from wheat and the alternatively spliced variants of rice and Arabidopsis. Plant Cell Rep. 2012;31:237–251. doi: 10.1007/s00299-011-1160-5. [DOI] [PubMed] [Google Scholar]
  • 21.Supek F, Bosnjak M, Skunca N, Smuc T. REVIGO summarizes and visualizes long lists of gene ontology terms. PLoS ONE. 2011;6:e21800. doi: 10.1371/journal.pone.0021800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kaur H, Shukla RK, Yadav G, Chattopadhyay D, Majee M. Two divergent genes encoding L-myo-inositol 1-phosphate synthase1 (CaMIPS1) and 2 (CaMIPS2) are differentially expressed in chickpea. Plant Cell Environ. 2008;31:1701–1716. doi: 10.1111/j.1365-3040.2008.01877.x. [DOI] [PubMed] [Google Scholar]
  • 23.Li X-G, Chen S-B, Lu Z-X, Chan T-J, Zeng Q-C, Zu Z. Impact of copy number on transgene expression in tobacco. Acta Bot. Sin. 2002;44:120–123. [Google Scholar]
  • 24.Fleet JY, Yen CM, Hill EA, Gillaspy GE. Co-suppression of AtMIPS demonstrates cooperation of MIPS1, MIPS2 and MIPS3 in maintaining myo-inositol synthesis. Plant Mol. Biol. 2018;97:253. doi: 10.1007/s11103-018-0737-6. [DOI] [PubMed] [Google Scholar]
  • 25.De S. Identification of heat tolerances in wheat at grain filling stage under heat stress environment. Environ. Ecol. 2014;4:1572–1577. [Google Scholar]
  • 26.Barnabás B, Jäger K, Fehér A. The effect of drought and heat stress on reproductive. Plant Cell Environ. 2008;31:11–38. doi: 10.1111/j.1365-3040.2007.01727.x. [DOI] [PubMed] [Google Scholar]
  • 27.Khurana N, Sharma N, Khurana P. Overexpression of a heat stress inducible, wheat myo-inositol-1-phosphate synthase 2 (TaMIPS2) confers tolerance to various abiotic stresses in Arabidopsis thaliana. Agri Gene. 2017;6:24–30. [Google Scholar]
  • 28.Latrasse D, Jégu T, Meng PH, Mazubert C, Hudik E, Delarue M, Charon C, Crespi M, Hirt H, Raynaud C, Bergounioux C, Benhamed M. Dual function of MIPS1 as a metabolic enzyme and transcriptional regulator. Nucleic Acids Res. 2013;41:2907–2917. doi: 10.1093/nar/gks1458. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Dreze M, et al. Evidence for network evolution in an Arabidopsis interactome map. Science. 2011;333:601–607. doi: 10.1126/science.1203877. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Lorenzo O. Ethylene response FACTOR1 1ntegrates signals from ethylene and jasmonate pathways in plant defense. Plant Cell. 2003;15:165–178. doi: 10.1105/tpc.007468. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Cao Y-Y, Duan H, Yang L-N, Wang Z-Q, Zhou S-C, Yang J-C. Effect of heat stress during meiosis on grain yield of rice cultivars differing in heat tolerance and its physiological mechanism. Acta Agron. Sin. 2008;34:2134–2142. [Google Scholar]
  • 32.Zhang JK, Zong XF, Yu GD, Li JN, Zhang W. Relationship between phytohormones and male sterility in thermo-photo-sensitive genic male sterile (TGMS) wheat. Euphytica. 2006;150:241–248. [Google Scholar]
  • 33.Marchler-Bauer A, et al. CDD/SPARCLE: Functional classification of proteins via subfamily domain architectures. Nucleic Acids Res. 2017;45:D200–D203. doi: 10.1093/nar/gkw1129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Nishimura A, Aichi I, Matsuoka M. A protocol for Agrobacterium-mediated transformation in rice. Nat. Protoc. 2007;1:2796–2802. doi: 10.1038/nprot.2006.469. [DOI] [PubMed] [Google Scholar]
  • 35.Higo K, Ugawa Y, Iwamoto M, Korenaga T. Plant cis-acting regulatory DNA elements (PLACE) database: 1999. Nucleic Acids Res. 1999;27:297–300. doi: 10.1093/nar/27.1.297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Murray MG, Thompson WF. Rapid isolation of higher weight. DNA. 1980;8:4321–4325. doi: 10.1093/nar/8.19.4321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Sambrook J, Russel DW. Molecular cloning: a laboratory manual. Chicago: The University of Chicago Press; 2001. [Google Scholar]
  • 38.Singh A, Khurana P. Molecular and functional characterization of a Wheat B2 protein imparting adverse temperature tolerance and influencing plant growth. Front. Plant Sci. 2016;7:1–19. doi: 10.3389/fpls.2016.00642. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Grabherr MG, et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 2011;29:644–652. doi: 10.1038/nbt.1883. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Haas BJ, et al. De novo transcript sequence reconstruction from RNA-seq using the trinity platform for reference generation and analysis. Nat. Protoc. 2013;8:1494–1512. doi: 10.1038/nprot.2013.084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Robinson MD, McCarthy DJ, Smyth GK. edgeR: A bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2009;26:139–140. doi: 10.1093/bioinformatics/btp616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Wu Y, Li Q, Chen XZ. Detecting protein-protein interaction by far western blotting. Nat. Protoc. 2007;2:3278–3284. doi: 10.1038/nprot.2007.459. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES