Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2020 Aug 3;86(16):e00588-20. doi: 10.1128/AEM.00588-20

Nitrogen Fixation in Pozol, a Traditional Fermented Beverage

Jocelin Rizo a, Marco A Rogel b, Daniel Guillén a, Carmen Wacher c, Esperanza Martinez-Romero b, Sergio Encarnación b, Sergio Sánchez a, Romina Rodríguez-Sanoja a,✉
Editor: Johanna Björkrothd
PMCID: PMC7414965  PMID: 32503911

Nitrogen-fixing bacteria are found in different niches, as symbionts in plants, in the intestinal microbiome of several insects, and as free-living microorganisms. Their use in agriculture for plant growth promotion via biological nitrogen fixation has been extensively reported. This work demonstrates the ecological and functional importance that these bacteria can have in food fermentations, reevaluating the presence of these genera as an element that enriches the nutritional value of the dough.

KEYWORDS: nitrogen fixation, diazotrophs, traditional fermentations, food fermentation, pozol

ABSTRACT

Traditional fermentations have been widely studied from the microbiological point of view, but little is known from the functional perspective. In this work, nitrogen fixation by free-living nitrogen-fixing bacteria was conclusively demonstrated in pozol, a traditional Mayan beverage prepared with nixtamalized and fermented maize dough. Three aspects of nitrogen fixation were investigated to ensure that fixation actually happens in the dough: (i) the detection of acetylene reduction activity directly in the substrate, (ii) the presence of potential diazotrophs, and (iii) an in situ increase in acetylene reduction by inoculation with one of the microorganisms isolated from the dough. Three genera were identified by sequencing the 16S rRNA and nifH genes as Kosakonia, Klebsiella, and Enterobacter, and their ability to fix nitrogen was confirmed.

IMPORTANCE Nitrogen-fixing bacteria are found in different niches, as symbionts in plants, in the intestinal microbiome of several insects, and as free-living microorganisms. Their use in agriculture for plant growth promotion via biological nitrogen fixation has been extensively reported. This work demonstrates the ecological and functional importance that these bacteria can have in food fermentations, reevaluating the presence of these genera as an element that enriches the nutritional value of the dough.

INTRODUCTION

Fermentation is the oldest and most economical method to produce and preserve food. The great variety of fermented foods is the result of traditional knowledge and experiences transmitted from generation to generation, as well as of cultural practices, ethnic preferences, geographical location, raw materials, etc.

Fermentation technology has an important role in food conservation, especially in areas with limited resources where preservation techniques, such as cold storage, cannot be used. For foodstuffs produced in this way, the presence of antimicrobial compounds (bacteriocins, organic acids, ethanol, etc.) reduces the risk of contamination and the proliferation of pathogens and spoilage microorganisms (1, 2). Other advantages of fermented foods include the removal of antinutritional compounds and digestibility improvement. Some microorganisms may degrade or reduce antinutritional compounds (cyanide, glycoside linamarin, phytic acid, tannins, and polyphenols), while others may produce enzymes to hydrolyze polysaccharides to simple carbohydrates (3–5). Moreover, fermentation plays a decisive role in human nutrition since during fermentation, a range of metabolites associated with health-promoting properties are produced: bioactive peptides, exopolysaccharides with significant antioxidant and free radical scavenging properties, folate production, improvement in the bioavailability of minerals, and fiber solubilization (6–8).

In cereal-based foods, the nutritional value is strongly influenced by the protein content as well as by the protein composition of the cereal; both characteristics can be improved by the fermentation process (9–11). Pozol is a refreshing, nonalcoholic acidic Mayan beverage made of fermented nixtamal (alkaline cooking of maize kernels, generating a nonsticky dough) (12–14). Pozol has been consumed since pre-Columbian times as a food or refreshment at any hour of the day and represents a staple food, especially for low-income persons. Ethnological studies have reported health benefits related to pozol consumption, such as the control of diarrhea and the reduction of fever (13).

A wide variety of microorganisms have already been described and isolated from this spontaneous fermentation; these microorganisms include fungi, yeasts, lactic acid bacteria (LAB), and non-lactic acid bacteria (non-LAB) (15–21). However, little is known about the nutritional value of pozol, and the only available study dates from the 1950s, showing that the fermentation process increases the content of some essential amino acids, vitamins, and protein (22), which are enrichments widely reported in other fermented foods (2, 23–27). Years later, Ulloa and collaborators (28) isolated several bacteria and fungi from pozol that were able to grow in nitrogen-free medium; therefore, the authors suggested that the protein increase could be due to nitrogen fixation during fermentation. From the isolated microorganisms, just one bacterium, identified as Agrobacterium azotophilum, was capable of reducing acetylene (29, 30). However, subsequent studies questioned the identity of the bacterium (31), and no other attempt to identify the phenomenon was made. What has been repeatedly reported is the nitrogen content increase in the fermented dough (32–34).

Despite the large number of niches where nitrogen-fixing bacteria are found (35–40), to our knowledge, there are no publications that demonstrate nitrogen fixation directly in a fermented food. Here, we explored the nitrogen fixation process during pozol fermentation through the acetylene reduction test; at the same time we isolated and identified the bacteria responsible for the phenomenon.

RESULTS

Pozol nitrogen fixation.

Pozol is an extraordinarily complex fermentation product in which a wide variety of microorganisms develop in great abundance. In an attempt to understand the dynamic of the system, first, a proximal analysis of the samples obtained at times 0, 9, 24 and 48 h of fermentation was performed since these times represent the period when most people consume it. The proximate analysis of pozol samples is presented in Table 1. During fermentation, total carbohydrates remain constant while fiber is consumed, and lipids increase. These modifications can be explained in terms of carbon metabolism in the fermentation. However, the nitrogen content showed an increased from 11.4 to 12.5 mg/g of dry pozol in the first 9 h of fermentation; this increment is not usually observed in food fermentations, and it may be attributed to nitrogen fixation.

TABLE 1.

Proximal analysis of pozol at different fermentation times

Fermentation time (h) Content in pozol (mg/g of dry dough)a
Nitrogen/ash ratio
(mg/mg)
Total carbohydrate Crude fiber Lipids Ash Nitrogen Protein
0 845 ± 9.9 24 ± 4.1 46 ± 4.2 13 ± 0.2 11.477 ± 0.2 A 71.7326 ± 1.2 A 0.88
9 839 ± 8 12 ± 0.5 57 ± 1.2 13 ± 4 12.56366 ± 0.0 B 78.5229 ± 0.3 B 0.97
24 841 ± 3 9 ± 1 64 ± 0.3 13 ± 0.9 12.4410 ± 0.1 B 77.75650 ± 0.5 B 0.96
48 832 ± 7 8 ± 1 68 ± 0.3 13 ± 0.2 12.525 ± 0.0 B 78.2828 ± 0.0 B 0.96
a

The results are expressed as the mean of three replicates ± standard deviation. Differences were evaluated by ANOVA followed by Tukey’s multicomparison test (P < 0.001). Different uppercase letters indicate statistically significant differences between samples.

Since in the fermentation process some percentage of carbon can be lost as CO2, we propose a simple mathematical framework that couples the nitrogen inputs with the carbon outputs through respiration to eliminate the bias that this loss could have on the increase in nitrogen observed. In this framework, the carbon content is considered the sum of carbohydrates, lipids, and fiber concentration in the different pozol samples. The initial carbon concentration was 915 mg/g dry pozol, and at 9 h of fermentation, a reduction of 1.4% was observed. Therefore, changes in the nitrogen and carbon content were considered to determine the amount of fixed nitrogen (Nfx) defined by the following equation: Nfx = Nf − Ni(Ci/Cf), where Nf is the final nitrogen concentration at a given fermentation time x, Ni is the initial nitrogen concentration in the unfermented dough, and Ci/Cf is the carbon concentration ratio between the unfermented and fermented doughs at fermentation time x. Figure 1 shows the general balance of carbon and nitrogen during the pozol fermentation. Input refers to the concentration of elements in pozol in the unfermented dough, and output refers to the concentrations of N and C at different fermentation times. Even considering the decrease in the mass of pozol during fermentation due to the loss of CO2 or considering the concentration of nitrogen as a function of ash concentration (minerals), we found an increase in the nitrogen of 8 to 9% at 9 h, which remained constant until the end of the fermentation.

FIG 1.

FIG 1

Balance of carbon and nitrogen during pozol fermentation. Carbon and nitrogen concentrations are given per gram of dry dough (Table 1). The calculation of the nitrogen increase was made relative to the concentrations in the unfermented dough. The results obtained for nitrogen take into account the carbon decrease, probably as CO2 (see text). The last column shows the nitrogen concentration normalized as a function of ash.

To determine if the increase in nitrogen concentration is the product of biological fixation, the nitrogenase activity was evaluated by an acetylene reduction assay (ARA) directly in the pozol dough inoculated in semisolid nitrogen-free minimal medium MMK or MMp/299 (see Materials and Methods). Interestingly, acetylene reduction was found from the beginning of the fermentation in both media, indicating the presence of active nitrogen-fixing bacteria in the dough even after nixtamalization. Regardless of the medium used, the maximum ethylene reduction was obtained in the samples with 24 h of fermentation; however, at 48 h, the activity dropped drastically (Fig. 2).

FIG 2.

FIG 2

Nitrogen-fixing activity in pozol samples. Ethylene was produced in samples at different fermentation times on semisolid media. The results are expressed as the means of three replicates ± standard deviations. Differences were evaluated by ANOVA followed by Tukey’s multicomparison test (*, P < 0.05; **, P < 0.001).

Nitrogen-fixing bacteria.

(i) Isolation and identification of nitrogen-fixing bacteria. Nitrogen-fixing bacteria were isolated from all fermentation times using solid agar medium without a nitrogen source. Based on colony characteristics, 28 CFU (bacterial isolates) were selected, and all of them were analyzed for nitrogenase activity by ARA.

Some strains once isolated had low activity; for example, strain 16 produced only 0.16 nmol C2H4 h−1; nonetheless these strains were considered positive since there was the formation of the characteristic ethylene peak, while in the negative controls and in two isolated bacteria, no ethylene was observed (data not shown). Interestingly, almost all isolates appeared to have a high capacity to fix nitrogen since they showed greater acetylene-reducing activity than that of the positive control, Klebsiella variicola ATCC BAA-830. Especially six isolates, numbers 2, 3, 4, 8, 10, and 21, showed more than 10-times-higher activity than that of the positive control (Fig. 3).

FIG 3.

FIG 3

Acetylene reduction assay in different bacteria isolated from pozol (blue, bacteria isolated from pozol inoculated on semisolid MMp/299 medium; red, bacteria isolated from pozol inoculated in semisolid MMK medium). Klebsiella variicola ATCC BAA-830 was used as the positive control. The results are expressed as the means of three replicates ± standard deviations.

From the 26 positive ARA isolates, 25 presented similar microscopic characteristics, with Gram-negative, rod-shaped bacteria and the presence of exopolysaccharide (Table 2).

TABLE 2.

Morphological characteristics of the isolated colonies

graphic file with name AEM.00588-20-f0007.jpg

(ii) 16S rRNA-based identification. Based on the acetylene reduction ability, 16 different isolates were selected for molecular identification by the 16S rRNA gene sequence. PCR amplification of genomic DNA led to the generation of partial 16S rRNA gene fragments of approximately 1,100 bp. The sequences were analyzed with the online blastn program using the NCBI database for 16S rRNA sequences from Bacteria and Archaea. The isolated bacteria have similarities with three members of the Enterobacteriaceae family (Klebsiella, Kosakonia, and Enterobacter). The bacterium with colony characteristics different from the others presented the highest identity, 99.90%, with Kosakonia oryzendophytica and a slightly lower identity with Enterobacter sp. (99.88%). Two additional colonies were identified as Kosakonia, with 99.80% and 99.70% identities. The rest of the isolates had greater than 99% identity with members of the genus Klebsiella (Table 3).

TABLE 3.

Identification of bacteria based on the 16S rRNA and dinitrogenase reductase genesa

Medium and isolate no. Fermentation time (h) 16S rRNA gene-based identification
nifH gene-based identification
Organism Total score Identity (%) Organism Total score Identity (%)
MMp/299
    2 0 Kosakonia radicincitans DSM 16656 1,495 99.63 Kosakonia oryzae R5-395 553 98.11
Kosakonia oryzae Ola51 1,489 99.51
    3 0 Klebsiella pneumoniae DSM 30104 1,500 99.76 Klebsiella sp. strain CRPV0611a 571 98.47
    5 9 Klebsiella variicola F2R9 1,513 99.88
    7 24 Klebsiella pneumoniae DSM 30104 1,465 99.02
Klebsiella variicola F2R9 1,454 98.78
    9 48 Klebsiella variicola F2R9 1,495 99.63
    10 48 Klebsiella pneumoniae DSM 30104 1,498 99.76 Klebsiella sp. strain CRLIQ728 569 99.37
Klebsiella pneumoniae subsp. rhinoscleromatis R-70 1,838 99.80 Klebsiella pneumoniae NG14 564 99.36
    11 48 Kosakonia oryzendophytica REICA 082 1,500 99.76 Enterobacter sp. strain BKA4 510 95.62
Enterobacter cloacae DSM30054, NBRC 13535, 279-56, and subsp. dissolvens LMG2683 1,469 99.02 Enterobacter oryzendophyticus REICA_082 462 94.95
    12 48 Klebsiella quasipneumoniae subsp. similipneumoniae 07A044 1,480 99.75
    13 48 Klebsiella quasipneumoniae subsp. similipneumoniae strain 07A044 1,504 99.76 Klebsiella sp. strain CRPV0611a 569 99.37
Klebsiella quasipneumoniae subsp. similipneumoniae ATCC 700603 564 99.36
MMK
    17 0 Kosakonia radicincitans DSM 16656 1,506 98.8 Klebsiella pneumoniae 468 100
Kosakonia radicincitans DSM 16656 468 98.08
Kosakonia oryzae R5-395 446 98.80
    21 24 Klebsiella variicola F2R9 1,463 99.50 Klebsiella variicola AJ29, E57-7, WCHKP19, GJ3, GJ2, GJ1, DX120E 490 100
    22 24 Klebsiella quasipneumoniae subsp. similipneumoniae strain 07A044 1,506 99.76 Klebsiella quasipneumoniae subsp. similipneumoniae ATCC 700603 490 100
    23 24 Klebsiella variicola F2R9 1,511 100 Klebsiella variicola gene for dinitrogenase reductase, partial CDS, strain NGB-FR96 490 100
    24 48 Klebsiella pneumoniae strain DSM 30104 1,498 99.76
Klebsiella pneumoniae subsp. rhinoscleromatis R-70 1,820 99.31
    25 48 Klebsiella quasipneumoniae subsp. similipneumoniae 07A044 1,827 98.46 Klebsiella quasipneumoniae subsp. similipneumoniae ATCC 700603 499 100
    26 48 Klebsiella quasipneumoniae subsp. similipneumoniae 07A044 1,493 99.51
a

Total score is the sum of alignment scores of all segments from the same database sequence that match the query sequence (calculated over all segments).

The phylogenetic relationship between isolated organisms was established by comparing the obtained 16S rRNA gene sequences with the corresponding reference sequences from different strains of Klebsiella pneumoniae, Klebsiella quasipneumoniae, Klebsiella variicola, Klebsiella oxytoca, Klebsiella michiganensis, Klebsiella aerogenes, Enterobacter cloacae, Enterobacter kobei, Enterobacter hormaechei, Enterobacter soli, Enterobacter asburiae, Kosakonia pseudosacchari, Kosakonia sacchari, Kosakonia radicincitans, Kosakonia arachidis, Kosakonia oryzae, and Kosakonia cowanii.

Based on these 16S rRNA gene sequences, bacterial isolates 5, 9, 21, and 23 grouped as expected with the cluster formed by Klebsiella variicola strain F2R9. Isolate number 7 grouped with Klebsiella variicola strain LX3, suggesting that the correct identification of the strain is Klebsiella variicola and not Klebsiella pneumoniae, as suggested by the highest similarity in the blast. The strains identified as Klebsiella quasipneumoniae clustered together (isolates 12, 13, 22, 25, and 26). The 16S rRNA gene sequence data of the reference strains K. pneumoniae strain ATCC 13883, K. pneumoniae strain DSM 30104, and K. quasipneumoniae subsp. quasipneumoniae strain 01A030 were phylogenetically intermixed and included bacterial isolates 3, 10, and 24. Finally, bacterial isolates 2, 11, and 17 formed a group with the Kosakonia genus (Fig. 4).

FIG 4.

FIG 4

Phylogenetic 16S rRNA analysis of nitrogen-fixing bacteria isolated from pozol. The final data set consisted of 730 positions. The analysis involved 45 nucleotide sequences. Study isolates are highlighted in color.

(iii) nifH-based identification. To support the identification of some strains or to group some other isolates that did not form a specific clade with any of the sequences of the reference strains, the nifH gene sequence was used. The sequences were analyzed in NCBI with the online blastn program in the database of the nucleotide collection (nr/nt). Table 3 shows the results of the identification; again, the genera Klebsiella, Enterobacter, and Kosakonia were identified.

For the phylogenetic analysis, the sequences of dinitrogenase reductases deposited in NCBI of the Klebsiella oxytoca, Klebsiella pneumoniae, Klebsiella variicola, Kosakonia sacchari, Kosakonia oryzae, Enterobacter oryziphilus, E. sacchari, E. oryzendophyticus, E. cloacae, and Enterobacter sp. were used. Enterobacter and Kosakonia strains were intermixed and formed cluster A and B. In clusters C, D, E, and F, all Klebsiella sequences were grouped. Supported by the high bootstrap value, strain 11 was closely related to Enterobacter oryzendophyticus. Cluster C contained the isolates 3, 13, 22, and 25; the reference strains Klebsiella variicola and Klebsiella pneumoniae formed clusters D, E, and F. Strain 21 formed a well-defined clade with Klebsiella variicola DX120E that was recovered in 86% of the bootstrap samples. Although strain 10 was identified as Klebsiella pneumoniae, in the phylogenetic analysis, it formed an outgroup (Fig. 5).

FIG 5.

FIG 5

Phylogenetic nifH gene analysis of nitrogen-fixing bacteria isolated from pozol. The final data set consisted of a total of 231 positions. The analysis involved 35 nucleotide sequences. Study isolates are highlighted in color.

Nitrogen-fixing ability in pozol.

To finally demonstrate nitrogen fixation directly in the pozol, the homogenized dough was directly transferred to vials containing only semisolid agar. As shown in Fig. 6, acetylene reduction was evident at all fermentation times although the maximum reduction was observed at 9 h of fermentation. Additionally, to determine whether the isolated bacteria can fix nitrogen in pozol, the microbe with the apparently highest nitrogenase activity, Klebsiella variicola (isolate 21), was inoculated directly into the homogenized dough and transferred to semisolid agar; K. variicola effectively increased the ethylene concentration in the samples with zero and 9 h of fermentation, reaching maximum activity at 9 h (Fig. 6).

FIG 6.

FIG 6

Nitrogen-fixing activity in inoculated pozol samples. Ethylene was produced in the samples at different fermentation times. Inocula consisted of 107 CFU/g of dough. Values represent means ± standard deviations from three replicates. Differences were evaluated by ANOVA followed by Tukey’s multicomparison test (*, P < 0.05; **, P < 0.001).

DISCUSSION

Nitrogen fixation in pozol.

Cereal-based foods are an essential component of the human diet. They are an important source of carbohydrates, lipids, fiber, vitamins, and minerals. However, the presence of antinutritional factors, poor digestibility, and deficiency in some basic compounds (essential amino acids) make them unattractive for consumption and even more so if their nutritional value is compared with that of milk, milk products, or animal-derived foods (41, 42). Cereal fermentation plays a key role in the production of cereal-based foods since it is a simple and economical process to improve sensory properties, functional qualities, and nutritional value, with a final positive effect on human health (42).

Since the nutritional value of cereal-based food is mainly determined by protein content, some authors have proposed its supplementation with protein of vegetable origin, with protein concentrates, or with other foods, by controlled fermentation with specific microorganisms or with the use of genetic engineering strategies (41, 43–46). One important condition is that these approaches should not affect the nutritional value of the food. In this study, we demonstrate the potential of fermentation to increase the content of nitrogen and protein in vegetal fermentation since the results showed that in pozol, the fermentation process produces an increase of 8 to 9% in nitrogen concentration after only 9 h of fermentation (Fig. 1; Table 1). This value is similar to that found by Loaeza (33) in pozol fermented for 9 to 10 days but much lower than values reported in other pozol studies, which reported increases in the nitrogen concentration between 20 and 40% (22, 28, 32, 34, 47).

The effect of fermentation on the protein and nitrogen content in cereal fermented foods is variable. For example, in togwa (maize and sorghum, cassava, or millet gruel), only a slight increase in the total protein content was reported when the sorghum flour was supplemented with malt, but no significant differences were observed in native togwa or togwa fermented with starter cultures (48). For lohoh (fermented millet for bread), no apparent changes in the protein content were observed during the first 24 h of fermentation, but after this period, a significant increase was reported (49). In contrast, fermentation decreased the crude protein content in traditionally fermented fufu (cassava and green plantain dough) and in cassava roots fermented with two strains of Lactobacillus plantarum (50). For ogi (maize, sorghum, or millet pudding), the increase in the protein content depends on the malting levels and not on the fermentation process (51). In kinema (soybean food), kombucha (fermented black or green tea), and amahewu (maize gruel), the same tendency observed in pozol of increased protein as a result of fermentation has been reported (52–54).

The decrease in protein content has been related to protein utilization by microorganisms during fermentation due to their metabolic activities (55). While the increase in the crude protein content has been attributed to a concentration effect by the loss of dry matter, mainly carbohydrates and lipids (48), or to the production of volatile compounds that produced a loss of weight (56), some authors have proposed that during fermentation, the microorganisms could synthesize proteins from metabolic intermediates, which may explain the increase in protein content (57, 58).

To demonstrate that the fermentation process produces the observed increases and to minimize the effects of weight change, all determinations were calculated in dry weight; in addition, to ponder the net nitrogen increase, the nitrogen concentration was related to the loss of carbon in the system, and also the nitrogen/ash ratio was obtained (Fig. 1; Table 1) (59). Both approaches confirm that the nitrogen content increases with the fermentation process, which points to nitrogen fixation as a possible mechanism.

To conclusively demonstrate the phenomenon, the ARA was performed. In a first approach, the pozol samples were directly inoculated in defined medium without a nitrogen source to promote the growth and activity of nitrogen-fixing bacteria (Fig. 2). Nitrogenase activity was positive for all the samples tested, proving the presence of diazotrophs in the dough. From this, 26 nitrogen-fixing bacteria were isolated with different levels of nitrogenase activity.

It is important to highlight that biological nitrogen fixation (BNF) can be an economical and simple method that has the potential to improve the nutritional value of fermented cereal-based foods. However, to increase the protein content via nitrogen fixation, it would be advisable to promote the growth of diazotrophic bacteria. We demonstrated that the inoculation of Klebsiella variicola (isolate 21) in the dough results in a high ethylene concentration during the first 9 h of pozol fermentation (Fig. 6). These results suggested that pozol dough is an environment with the necessary conditions for atmospheric nitrogen fixation.

The results at 24 and 48 h showed a significant decrease in the activity of nitrogenase, which could be related to the decrease in the concentration of enterobacteria as a result of the decrease in pH that occurs in the dough during fermentation (17, 18, 60). Furthermore, it is known that nitrogen fixation is a highly regulated, oxygen-sensitive, energy-dependent process and is inhibited by some amino acids (35, 61).

Nitrogen-fixing bacteria in pozol.

As previously mentioned, the bacteria isolated from pozol were identified as Klebsiella variicola, Klebsiella pneumoniae, Klebsiella quasipneumoniae, Kosakonia oryzae, Kosakonia radicincitans, and Kosakonia oryzendophytica/Enterobacter cloacae (Table 3). The phylogenetic analysis of 16S rRNA gene sequence data allowed us to form a defined clade for Klebsiella variicola, Klebsiella pneumoniae, and Klebsiella quasipneumoniae as well as Kosakonia. However, the Enterobacter genus resulted in a heterogeneous group, making it difficult to cluster it. However, it is important to consider that in closely related species, such as the Enterobacteriaceae family, the use of 16S rRNA gene sequences in bacterial detection or identification is not enough (62–67).

To overcome this problem, housekeeping gene sequencing has been used in phylogenetic studies and in enterobacterial species identification (68). For example, rpoB, gyrA, mdh, infB, phoE, and nifH genes allowed the identification of new Klebsiella species, such as Klebsiella variicola, from clinical and plant-associated isolates (69). In this study, the nifH gene was selected to support the identification of some strains. The results confirmed the identification of the genera Klebsiella, Enterobacter, and Kosakonia. With this approach, the species level was corroborated for isolates 2, 10, 21, 22, 23, and 25, while for isolate 11, only genus identification was possible (Table 3). The phylogenetic tree again showed that all species of the Klebsiella genus analyzed form a clade, while those of Enterobacter and Kosakonia genera form the mixed clades A and B. The use of other housekeeping genes for the new classification of some Enterobacter species has resulted in the same observation: a group composed of these two genera separated from other genera of the family Enterobacteriaceae (66, 67).

The nitrogen-fixing activity of free-living diazotrophs of the genera Klebsiella, Enterobacter, and Kosakonia has been widely documented. Enterobacter and Klebsiella increased the nitrogen content via BNF and promoted the growth and plant uptake of nitrogen in sugarcane plants (70–72). Klebsiella spp. and Enterobacter species isolated from fruit flies were able to grow in nitrogen-free medium and reduce acetylene to ethylene (35). Kosakonia radicincitans fixed atmospheric nitrogen and increased nitrogen uptake in young tomato plants and maize, showing higher nitrogenase activity than that of Azotobacter vinelandii under nitrogen-limited conditions (73, 74).

Although the changes in the composition of nitrogen-fixing bacteria during pozol fermentation were not evaluated, we observed that the bacteria isolated varied as a function of time. Kosakonia was isolated only in the unfermented dough (0 h), Enterobacter was isolated at only 48 h of fermentation, and Klebsiella strains were isolated at all fermentation times, which indicates that this bacterium is responsible for the fixation that we observe in the dough. The prevalence of enterobacteria in pozol fermentation has been studied by Giles (60), demonstrating that the Klebsiella pneumoniae isolated from pozol is capable of surviving under acidic conditions and with a concentration of lactic acid of 2.1 g/100 g, in contrast to the clinically isolated Klebsiella pneumoniae that, under the same conditions, is undetectable.

The relevance of enterobacteria in traditionally fermented food was previously demonstrated in tempeh, where the inoculation of Klebsiella pneumoniae and Citrobacter freundii increased the vitamin B12 content. The authors of that work also demonstrated that the two strains lacked genes that encode three different types of enterotoxins (75). Recently, metagenomic sequence data from a 30-h sample of cocoa bean fermentation demonstrated that the Enterobacteriaceae family is involved in the methylglyoxal detoxification pathway, pectinolysis, and bacteriocin production, implying a more important functional role during fermentation than previously assumed (76).

Our results confirmed an active nitrogen fixation process in pozol, representing the occurrence of this phenomenon directly in a fermented food. The BNF in pozol was supported by the ARA directly in the dough, as well as in the isolated bacteria, and by detection of the nifH gene in the tested strains. The importance of the existence of this phenomenon in food is accentuated if we consider that it improves the nutritional value of fermented beverages and foods.

Molecular methods resulted in identification of the genera Enterobacter, Klebsiella, and Kosakonia, the last being a genus not previously reported in pozol fermentation; Klebsiella was the most abundantly isolated bacterium at all fermentation times. However, we suggest a deeper analysis with other genes for corroboration and identification of the species, as well as to establish their safety.

Usually, the presence of enterobacteria is an indicator of poor quality and safety in food and beverages. However, although considered undesirable microorganisms, their potential as microorganisms that contribute to improving the quality of the substrate should be reconsidered, especially if the absence of virulence factors and lack of enterotoxin production are demonstrated.

MATERIALS AND METHODS

Sample description.

Freshly ground nixtamal dough samples were acquired from two producers at the Pino Suárez market in Tabasco, Mexico. Samples were mixed and shaped into 300-g balls, wrapped in banana leaves, and incubated in triplicate at 37°C. Sampling was performed at 0, 9, 24, and 48 h, with all practices performed under aseptic conditions.

Proximate composition of pozol.

For this analysis, dough samples (10 g) were frozen and ground in a mortar with solid CO2 until a homogenous powder was obtained. Ash, nitrogen, and crude protein (N × 6.25 [88]) contents were determined according to official method 992.23 of the Association of Official Analytical Chemists (AOAC) International (77) at the chemical analysis laboratory of the Department of Animal Nutrition and Biochemistry of the Faculty of Veterinary Medicine and Zootechnic of the Universidad Nacional Autónoma de México (UNAM). All determinations were performed in triplicate and analyzed with a one-way analysis of variance (ANOVA) using GraphPad Prism, version 4, software. The significant differences were estimated with a Tukey post hoc test.

Isolation of nitrogen-fixing bacteria.

For the isolation, pozol samples were serially diluted in 0.9% (wt/vol) NaCl, and the homogenate (100 μl) was streaked onto nitrogen-free MMK plates (2.2 g/liter Na2HPO4·H2O, 0.425 g/liter Na2H2PO4·H2O, 0.435 g/liter MgSO4·7H2O, 1 g/liter sucrose, and 15 g/liter agar) and MMp/299 plates (3.8 g/liter K2HPO4, 3 g/liter KH2PO4, 0.1 g/liter MgSO4·7H2O, 0.005 g/liter Fe(C6H5O7), 0.1 g/liter CaCl2, 1 g/liter sucrose, and 15 g/liter agar) and incubated at 29°C until colony growth was observed. The culture was used to inoculate the corresponding semisolid medium, and the ARA was performed. The positive colonies were characterized by Gram staining and their morphology. Pure cultures were stored in 20% glycerol as a cryoprotectant at –70°C until analysis. Bacterial isolates were deposited at the Institute of Biomedical Research (IIBM)-UNAM Culture Collection (World Data Centre for Microorganisms 48 [WDCM48]).

ARA.

Acetylene reduction assays (ARAs) were performed in 10-ml vials containing 5 ml of semisolid MMK or MMp/299 medium. The glass tubes were sealed with airtight rubber, and 0.6 ml of acetylene gas was injected by removing an equal volume of air from the tube. Ethylene production was detected in duplicate at 24 h in a gas chromatograph equipped with a flame ionization detector and a capillary column. The ethylene concentration in the headspace was measured by injecting 0.4 ml of the gas into a Bruker gas chromatograph, model GC 450, with a flame ionization detector (FID) and a Porapak-N column. The detector temperature was maintained at 105°C, and the injector and column temperature were maintained at 95°C. Nitrogen served as the carrier gas, with a flow rate of 35 ml min−1. The chromatograms were used to integrate the areas of the curves of acetylene (C2H2) and ethylene (C2H4) to estimate C2H4 production (78).

Test vials with equivalent volumes of uninoculated broth served as negative controls. Klebsiella variicola sp. nov. ATCC BAA-830, from the Center for Genomic Science collection (CCG, UNAM), was used as a positive control.

For ARA determination directly in the pozol samples, 150 g of the dough was homogenized in 100 ml of 0.9% (wt/vol) NaCl, and 100 μl of the solution was inoculated in semisolid MMK and MMp/299 medium. Data were analyzed with one-way ANOVA using GraphPad Prism, version 4, software. The significant differences were estimated with a Tukey post hoc test.

Pozol inoculation experiment.

To verify that previously isolated bacteria can fix nitrogen in the pozol dough, isolated bacteria were grown overnight in Luria-Bertani agar at 29°C. Bacteria at 107 CFU were inoculated aseptically in 1 g of pozol and homogenized by agitation. Then, 100 μl of suspension was added to vials containing only semisolid agar.

Two controls were used in this experiment. In the first control, the uninoculated pozol was resuspended and added to the vials with semisolid agar. In the second control, the isolated bacteria were directly inoculated (107 CFU) in semisolid MMK and semisolid agar. Finally, the ARA was performed 24 h later. Two biological replicates were performed for each experimental and control group.

DNA extraction.

Overnight cultures from the positive colonies were harvested by centrifugation (10 min, 10,000 × g, 4°C) and washed twice in sterile Milli-Q water. The cells were suspended in Tris-EDTA (TE) buffer (10 mM Tris-HCl, pH 8, 1 mM EDTA), treated with lysozyme (100 mg ml−1) for 30 min at 37°C, and centrifuged (10 min, 10,000 × g, 15°C). The resulting pellet was suspended in TE buffer, and the cell suspension was treated with TEN buffer (0.1 M NaCl, 10 mM Tris-HCl pH 8, 1 mM EDTA, pH 8) and 20% (wt/vol) SDS for 30 min at 37°C. Cellular debris was eliminated by adding 5 M NaCl for 2 h on ice followed by centrifugation (20 min, 10,000 × g, 15°C) (79). The extracted DNA was purified by the phenol-chloroform method as described by Green and Sambrook (80).

Amplification of 16S rRNA and nifH gene fragments.

Amplification of the 16S rRNA gene fragment was performed with the universal primers shown in Table 4 in a 25-μl reaction volume containing 50 ng of template DNA with 12.5 pmol of each primer, 0.2 mM deoxynucleoside triphosphates (dNTPs), 2.5 mM MgCl2, and 1.25 U of Taq DNA polymerase (Thermo Scientific). The PCR was conducted using the following conditions: preheating at 94°C for 2 min, followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 65°C for 1 min, and extension at 72°C for 1 min, with a final extension step at 72°C for 7 min.

TABLE 4.

Primers used in the amplification of the 16S rRNA and nifH genes

Gene Primer
Sequence position (nt)a Sequence Product
(bp)
Reference
Direction Name
16S rRNA gene Forward 8F or pA 9 AGAGTTTGATCCTGGCTCAG 1,100 87
Reverse 16R1093 1109 GTTGCGCTCGTTGCGGGACT
nifH Forward Polf 115 TGCGAYCCSAARGCBGACTC 360 69
Reverse Polr 457 ATSGCCATCATYTCRCCGGA
a

Sequence position is relative to that in Escherichia coli or A. vinelandii for the 16S rRNA gene or nifH coding sequence, respectively. nt, nucleotide.

Nitrogenase amplification primers are shown in Table 4. All reactions were performed in a 25-μl reaction volume containing 10 ng of DNA with 10 pmol of each primer, 0.2 mM dNTPs, 1.5 mM MgCl2, and 1 U Taq DNA polymerase (Thermo Scientific). The reaction mixture was incubated for 2 min at 94°C and then subjected to 30 cycles of denaturation at 94°C for 4 min, annealing at 65°C for 1 min, and extension at 72°C for 1 min, with a final extension step at 72°C for 5 min.

Amplified products were analyzed by electrophoresis in a 1% agarose gel.

Sequence analysis.

16S rRNA and nifH gene fragments were purified with a Wizard PCR Preps DNA purification system (Promega) according to the manufacturer’s instructions. The purified PCR products were sequenced at the Laboratorio de Secuenciación Genómica de la Biodiversidad y de la Salud, UNAM. The quality of the sequences was verified with the Chromas (version 2.6.6) program and then analyzed for bacterial identification in the NCBI (National Center for Biotechnology Information) database using the online BLAST program (81). The sequences were aligned using the MUSCLE program (multiple sequence comparison by log expectation) (82), edited to uniform length, and manually corrected.

For the phylogenetic relationships of the obtained 16S rRNA gene sequences, the reference sequences (RefSeq NCBI Database) from different strains of Klebsiella pneumoniae (ATCC 13883 and DSM30104), Klebsiella quasipneumoniae 01A030 and 07A044, Klebsiella variicola F2R9 and LX3, Klebsiella oxytoca ATCC 13182, Klebsiella michiganensis W14, Klebsiella aerogenes NCTC10006, Enterobacter cloacae LMG2683 and ATCC 13047, E. kobei JCM8580, E. hormaechei 10–17, E. soli ATCC BAA-2102, E. asburiae JM-458, Kosakonia pseudosacchari JM-387, Kosakonia sacchari SP1, Kosakonia radicincitans, Kosakonia arachidis Ah143, Kosakonia oryzae Ola51, and Kosakonia cowanii JCM10956 were used. The 16S rRNA gene sequences of A. vinelandii AB175657.1, Azotobacter chroococcum LMG8756, Azotobacter salinestris ATCC 49674, Paenibacillus polymyxa DSM36, Paenibacillus durus 6563-1, Clostridium pasteurianum ATCC 6013, and Clostridium acetobutylicum ATCC 824 were used as outgroups.

For the phylogenetic analysis of dinitrogenase reductase, the sequences deposited in NCBI of Klebsiella oxytoca CC1103A1, Klebsiella pneumoniae SnebYK, NG14, and NCTC9178, Klebsiella variicola SH-1, NGB-FR116, NGB-FR113, DX120E, NGB-FR96 and F2R9, Kosakonia sacchari R4-724, Kosakonia oryzae strain R4-323 and R5-397, Enterobacter oryziphilus REICA_142, E. sacchari SP1, and HX148S, E. oryzendophyticus REICA 082, E. cloacae RT-HRS-ADR-GRI, and Enterobacter sp. strain MTP 050512 17 were used. Clostridium sp. strain MK12, Clostridium sp. strain Kas106-4, Clostridium sp. strain MK31, A. chroococcum CGMCC, A. vinelandii ISSDS-428, and A. salinestris EF strains were used as outgroups.

Sequences were aligned with MEGA, version 7 (83), and the phylogenetic tree was constructed using the neighbor-joining method (84); evolutionary distances were computed using the maximum composite likelihood method (85) and are presented in units of the number of base substitutions per site. Statistical significance was evaluated by bootstrap analysis with 1,000 repeats (86).

Branches corresponding to partitions reproduced in less than 50% of bootstrap replicates are collapsed. The percentages of replicate trees in which the associated taxa clustered together in the bootstrap test (1,000 replicates) are shown next to the branches (86).

The rate variation among sites was modeled with a gamma distribution (shape parameter of 1). All positions with less than 95% site coverage were eliminated. That is, fewer than 5% alignment gaps, missing data, and ambiguous bases were allowed at any position.

ACKNOWLEDGMENTS

We thank Gloria Díaz-Ruiz for technical assistance, Beatriz Ruiz for her support with the phylogenetic analysis, and Patricia de la Torre for gene sequencing (LSGBS, UNAM).

Jocelin Rizo is a student in the Ph.D. program in Biological Sciences at UNAM and is supported by a fellowship from Consejo Nacional de Ciencia y Tecnología, Mexico. This work was supported by the UNAM-DGAPA grant IN223917 and IN216419.

REFERENCES

  • 1.Tamang JP, Shin DH, Jung SJ, Chae SW. 2016. Functional properties of microorganisms in fermented foods. Front Microbiol 7:578–513. doi: 10.3389/fmicb.2016.00578. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Marco ML, Heeney D, Binda S, Cifelli CJ, Cotter PD, Foligné B, Gänzle M, Kort R, Pasin G, Pihlanto A, Smid EJ, Hutkins R. 2017. Health benefits of fermented foods: microbiota and beyond. Curr Opin Biotechnol 44:94–102. doi: 10.1016/j.copbio.2016.11.010. [DOI] [PubMed] [Google Scholar]
  • 3.van Boekel M, Fogliano V, Pellegrini N, Stanton C, Scholz G, Lalljie S, Somoza V, Knorr D, Jasti PR, Eisenbrand G. 2010. A review on the beneficial aspects of food processing. Mol Nutr Food Res 54:1215–1247. doi: 10.1002/mnfr.200900608. [DOI] [PubMed] [Google Scholar]
  • 4.Poutanen K, Flander L, Katina K. 2009. Sourdough and cereal fermentation in a nutritional perspective. Food Microbiol 26:693–699. doi: 10.1016/j.fm.2009.07.011. [DOI] [PubMed] [Google Scholar]
  • 5.Charalampopoulos D, Wang R, Pandiella SS, Webb C. 2002. Application of cereals and cereal components in functional foods: a review. Int J Food Microbiol 79:131–141. doi: 10.1016/S0168-1605(02)00187-3. [DOI] [PubMed] [Google Scholar]
  • 6.Malaguti M, Dinelli G, Leoncini E, Bregola V, Bosi S, Cicero AF, Hrelia S. 2014. Bioactive peptides in cereals and legumes: agronomical, biochemical and clinical aspects. Int J Mol Sci 15:21120–21135. doi: 10.3390/ijms151121120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Ortiz-Martínez M, Winkler R, García-Lara S. 2014. Preventive and therapeutic potential of peptides from cereals against cancer. J Proteomics 111:165–183. doi: 10.1016/j.jprot.2014.03.044. [DOI] [PubMed] [Google Scholar]
  • 8.Kodali VP, Sen R. 2008. Antioxidant and free radical scavenging activities of an exopolysaccharide from a probiotic bacterium. Biotechnol J 3:245–251. doi: 10.1002/biot.200700208. [DOI] [PubMed] [Google Scholar]
  • 9.Kang HJ, Yang HJ, Kim MJ, Han E-S, Kim H-J, Kwon DY. 2011. Metabolomic analysis of meju during fermentation by ultra-performance liquid chromatography-quadrupole-time of flight mass spectrometry (UPLC-Q-TOF MS). Food Chem 127:1056–1064. doi: 10.1016/j.foodchem.2011.01.080. [DOI] [PubMed] [Google Scholar]
  • 10.Visessanguan W, Benjakul S, Potachareon W, Panya A, Riebroy S. 2005. Accelerated proteolysis of soy proteins during fermentation of thua-nao inoculated with Bacillus subtilis. J Food Biochem 29:349–366. doi: 10.1111/j.1745-4514.2005.00012.x. [DOI] [Google Scholar]
  • 11.Han BZ, Rombouts FM, Nout MJ. 2001. A Chinese fermented soybean food. Int J Food Microbiol 65:1–10. doi: 10.1016/S0168-1605(00)00523-7. [DOI] [PubMed] [Google Scholar]
  • 12.Cañas A, Barzana E, Owens JD, Wacher C. 1993. La elaboración de pozol en los altos de Chiapas. Ciencia 44:219–229. [Google Scholar]
  • 13.Ulloa M, Herrera T, Lappe P. 1987. Fermentaciones tradicionales indígenas de México. Serie de Investigaciones Sociales. Instituto Nacional Indigenista 16:13–20. [Google Scholar]
  • 14.Gómez-Castro CZ, Rodriguez JA, Cruz-Borbolla J, Quintanar-Guzman A, Sanchez-Ortega I, Santos EM. 2019. A theoretical and experimental approach to evaluate zein-calcium interaction in nixtamalization process. Food Chem 297:124995. doi: 10.1016/j.foodchem.2019.124995. [DOI] [PubMed] [Google Scholar]
  • 15.Nuraida L, Wacher MC, Owens JD. 1995. Microbiology of pozol, a Mexican fermented maize dough. World J Microbiol Biotechnol 11:567–571. doi: 10.1007/BF00286375. [DOI] [PubMed] [Google Scholar]
  • 16.Ampe F, Ben Omar N, Guyot JP. 1999. Culture-independent quantification of physiologically-active microbial groups in fermented foods using rRNA-targeted oligonucleotide probes: application to pozol, a Mexican lactic acid fermented maize dough. J Appl Microbiol 87:131–140. doi: 10.1046/j.1365-2672.1999.00803.x. [DOI] [PubMed] [Google Scholar]
  • 17.Ampe F, Ben Omar N, Moizan C, Wacher C, Guyot J-P. 1999. Polyphasic study of the spatial distribution of microorganism in Mexican pozol, a fermented maize dough, demonstrates the need for cultivation-independent methods to investigate traditional fermentations. Appl Environ Microbiol 65:5464–5473. doi: 10.1128/AEM.65.12.5464-5473.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Wacher C, Cañas A, Barzana E, Lappe P, Ulloa M, Owens JD. 2000. Microbiology of Indian and Mestizo pozol fermentation. Food Microbiol 17:252–256. [Google Scholar]
  • 19.Ben Omar N, Ampe F. 2000. Microbial community dynamics during production of the Mexican fermented maize dough pozol. Appl Environ Microbiol 66:3664–3673. doi: 10.1128/aem.66.9.3664-3673.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Escalante A, Wacher CM, Farrés A. 2001. Lactic acid bacterial diversity in the traditional Mexican fermented dough pozol as determined by 16S rDNA sequence analysis. Int J Food Microbiol 64:21–31. doi: 10.1016/S0168-1605(00)00428-1. [DOI] [PubMed] [Google Scholar]
  • 21.Díaz-Ruiz G, Guyot JP, Ruiz-Teran F, Morlon-Guyot J, Wacher C. 2003. Microbial and physiological characterization of weakly amylolytic but fast-growing lactic acid bacteria: a functional role in supporting microbial diversity in pozol, a Mexican fermented maize beverage. Appl Environ Microbiol 69:4367–4374. doi: 10.1128/aem.69.8.4367-4374.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Cravioto O, Cravioto G, Massieu H, Guzman J. 1955. El pozol, forma indígena de consumir el maíz en el sureste de México y su aporte de nutrientes a la dieta. Ciencia 15:27–30. [Google Scholar]
  • 23.Sarkar PK, Jone LJ, Craven GS, Somerset SM, Palmer C. 1997. Amino acid profiles of kinema, a soybean-fermented food. Food Chem 59:69–75. doi: 10.1016/S0308-8146(96)00118-5. [DOI] [Google Scholar]
  • 24.Di Cagno R, De Angelis M, Lavermicocca P, De Vincenzi M, Giovannini C, Faccia M, Gobbetti M. 2002. Proteolysis by sourdough lactic acid bacteria: effects on wheat flour protein fractions and gliadin peptides involved in human cereal intolerance. Appl Environ Microbiol 68:623–633. doi: 10.1128/aem.68.2.623-633.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Leroy F, Vuyst LD. 2004. Lactic acid bacteria as functional starter cultures for the food fermentation industry. Trends Food Sci Tech 15:67–78. doi: 10.1016/j.tifs.2003.09.004. [DOI] [Google Scholar]
  • 26.Patel A, Shah N, Prajapati JB. 2013. Biosynthesis of vitamins and enzymes in fermented foods by lactic acid bacteria and related genera—a promising approach. Croat J Food Sci Technol 5:85–91. [Google Scholar]
  • 27.Wang W, Xia W, Gao P, Xu Y, Jiang Q. 2017. Proteolysis during fermentation of Suanyu as a traditional fermented fish product of China. Int J Food Prop 20:166–176. [Google Scholar]
  • 28.Ulloa M, Herrera T, Lanza G. 1971. Fijación de nitrógeno atmosférico por microorganismos del pozol. Rev Lat Microbiol 13:113–124. [PubMed] [Google Scholar]
  • 29.Ulloa M, Herrera T. 1972. Descripción de dos especies nuevas de bacterias aisladas del pozol: Agrobacterium azotophilum y Achromobacter pozolis. Rev Lat Microbiol 14:15–21. [PubMed] [Google Scholar]
  • 30.Taboada J, Herrera T, Ulloa M. 1972. Prueba de la reducción de acetileno para la determinación de microorganismos fijadores de nitrógeno aislados del pozol. Rev Lat Quím 2:188–191. [Google Scholar]
  • 31.Ray P, Sanchez C, O'Sullivan DJ, McKay LL. 2000. Classification of a bacterial isolate, from pozol, exhibiting antimicrobial activity against several gram-positive and gram-negative bacteria, yeasts, and molds. J Food Prot 63:1123–1132. doi: 10.4315/0362-028x-63.8.1123. [DOI] [PubMed] [Google Scholar]
  • 32.Ramírez JF. 1987. Biochemical studies on a Mexican fermented food—pozol. PhD thesis. Cornell University, Ithaca, NY. [Google Scholar]
  • 33.Loaeza NM. 1991. Efecto de la nixtamalización en la fermentación del pozol. BA thesis. Universidad Nacional Autónoma de México, Mexico City, Mexico. [Google Scholar]
  • 34.Giles GM. 1995. Estudio sobre las interacciones microbianas importantes para el incremento de proteína durante la fermentación de pozol. BA thesis. Universidad Nacional Autónoma de México, Mexico City, Mexico. [Google Scholar]
  • 35.Behar A, Yuval B, Jurkevitch E. 2005. Enterobacteria-mediated nitrogen fixation in natural populations of the fruit fly Ceratitis capitata. Mol Ecol 14:2637–2643. doi: 10.1111/j.1365-294X.2005.02615.x. [DOI] [PubMed] [Google Scholar]
  • 36.Peng G, Zhang W, Luo H, Xie H, Lai W, Tan Z. 2009. Enterobacter oryzae sp. nov., a nitrogen-fixing bacterium isolated from the wild rice species Oryza latifolia. Int J Syst Evol Microbiol 59:1650–1655. doi: 10.1099/ijs.0.005967-0. [DOI] [PubMed] [Google Scholar]
  • 37.Orr CH, James A, Leifert C, Cooper JM, Cummings SP. 2011. Diversity and activity of free-living nitrogen-fixing bacteria and total bacteria in organic and conventionally managed soils. Appl Environ Microbiol 77:911–919. doi: 10.1128/AEM.01250-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Beneduzi A, Costa PB, Parma M, Melo IS, Bodanese-Zanettini MH, Passaglia MP. 2010. Paenibacillus riograndensis sp. nov., a nitrogen-fixing species isolated from the rhizosphere of Triticum aestivum. Int J Syst Evol Microbiol 60:128–133. doi: 10.1099/ijs.0.011973-0. [DOI] [PubMed] [Google Scholar]
  • 39.Santi C, Bogusz D, Franche C. 2013. Biological nitrogen fixation in non-legume plants. Ann Bot 111:743–767. doi: 10.1093/aob/mct048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Morales-Jiménez J, Vera-Ponce de León A, García-Domínguez A, Martínez-Romero E, Zúñiga G, Hernández-Rodríguez C. 2013. Nitrogen-Fixing and uricolytic bacteria associated with the gut of Dendroctonus rhizophagus and Dendroctonus valens (Curculionidae: Scolytinae). Microb Ecol 66:200–210. doi: 10.1007/s00248-013-0206-3. [DOI] [PubMed] [Google Scholar]
  • 41.Blandino A, Al-Aseeri ME, Pandiella SS, Cantero D, Webb C. 2003. Cereal-based fermented foods and beverages. Food Res Int 36:527–543. doi: 10.1016/S0963-9969(03)00009-7. [DOI] [Google Scholar]
  • 42.Ferri M, Serrazanetti DI, Tassoni A, Baldissarri M, Gianotti A. 2016. Improving the functional and sensorial profile of cereal-based fermented foods by selecting Lactobacillus plantarum strains via a metabolomics approach. Food Res Int 89:1095–1105. doi: 10.1016/j.foodres.2016.08.044. [DOI] [Google Scholar]
  • 43.Ekpenyong TE. 1980. The nutritional value of two cereal-based foods in Nigeria. Food Chem 5:315–323. doi: 10.1016/0308-8146(80)90053-9. [DOI] [Google Scholar]
  • 44.Ojo DO, Enujiugha VN. 2018. Comparative evaluation of ungerminated and germinated co-fermented instant ‘Ogi’ from blends of maize (Zea mays) and ground bean (Kerstingiella geocarpa). J Nutr Health Food Eng 8:68–73. doi: 10.15406/jnhfe.2018.08.00258. [DOI] [Google Scholar]
  • 45.Hong KJ, Lee CH, Kim SW. 2004. Aspergillus oryzae GB-107 fermentation improves nutritional quality of food soybeans and feed soybean meals. J Med Food 7:430–435. doi: 10.1089/jmf.2004.7.430. [DOI] [PubMed] [Google Scholar]
  • 46.Shewry PR. 2007. Improving the protein content and composition of cereal grain. J Cereal Sci 46:239–250. doi: 10.1016/j.jcs.2007.06.006. [DOI] [Google Scholar]
  • 47.Rizo J. 2015. Estudio proteómico de las hidrolasas del pozol. MA thesis. Universidad Nacional Autónoma de México, Mexico City, Mexico. [Google Scholar]
  • 48.Mugula JK, Sorhaug T, Stepaniak L. 2003. Proteolytic activities in togwa, a Tanzanian fermented food. Int J Food Microbiol 84:1–12. doi: 10.1016/S0168-1605(02)00387-2. [DOI] [PubMed] [Google Scholar]
  • 49.Osman MA. 2011. Effect of traditional fermentation process on the nutrient and antinutrient contents of pearl millet during preparation of lohoh. J Saudi Soc Agric 10:1–6. doi: 10.1016/j.jssas.2010.06.001. [DOI] [Google Scholar]
  • 50.Sobowale AO, Olurin TO, Oyewole OB. 2007. Effect of lactic acid bacteria starter culture fermentation of cassava on chemical and sensory characteristics of fufu flour. Afr J Biotechnol 6:1954–1958. doi: 10.5897/AJB2007.000-2297. [DOI] [Google Scholar]
  • 51.Inyang CU, Idoko CA. 2006. Assessment of the quality of ogi made from malted millet. Afr J Biotechnol 5:2334–2337. [Google Scholar]
  • 52.Sarkar PK, Tamang JP, Cook PE, Owens JD. 1994. Kinema—a traditional soybean fermented food: proximate composition and microflora. Food Microbiol 11:47–55. doi: 10.1006/fmic.1994.1007. [DOI] [Google Scholar]
  • 53.Jayabalan R, Malini K, Sathishkumar M, Swaminathan K, Yun SE. 2010. Biochemical characteristics of tea fungus produced during kombucha fermentation. Food Sci Biotechnol 19:843–847. doi: 10.1007/s10068-010-0119-6. [DOI] [Google Scholar]
  • 54.Chelule PK, Mbongwa HP, Carries S, Gqaleni N. 2010. Lactic acid fermentation improves the quality of amahewu, a traditional South African maize-based porridge. Food Chem 122:656–661. doi: 10.1016/j.foodchem.2010.03.026. [DOI] [Google Scholar]
  • 55.Elenga M, Massamba J, Kobawila S, Makoss V, Silou T. 2010. Evaluation et amelioration de la qualité nutritionnelle des pâtes et des bouillies de maïs fermente au Congo. Int J Biol Chem Sci 3:1274–1285. [Google Scholar]
  • 56.Wang DYY, Fields ML. 1978. Feasibility of home fermentation to improve the amino acid balance of corn meal. J Food Sci 43:1104. doi: 10.1111/j.1365-2621.1978.tb15244.x. [DOI] [Google Scholar]
  • 57.Elyas SHA, El Tinay AH, Yousif NE, Elsheikh EAE. 2002. Effect of natural fermentation on nutritive value and in vitro protein digestibility of pearl millet. Food Chem 78:75–79. doi: 10.1016/S0308-8146(01)00386-7. [DOI] [Google Scholar]
  • 58.Roger T, Léopold TN, Funtong M. 2015. Nutritional properties and antinutritional factors of corn paste (kutukutu) fermented by different strains of lactic acid bacteria. Int J Food Sci 2015:502910. doi: 10.1155/2015/502910. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Leal H, Wacher C, Álvarez E, Saint-Phard C. 1987. Estudio de cambios en el contenido proteico de subproductos agricolas por fermentacion con microfloras mixtas, p 289–304. In Memorias del Simposio latinoamericano de Biotecnología para la producción de biomasa y el tratamiento de desperdicios. ICAITI, Antigua, Guatemala. [Google Scholar]
  • 60.Giles GM. 2012. Estudio de la sobrevivencia de enterobacterias aisladas del pozol durante la fermentación láctica de masas y suspensiones de harina de maíz nixtamalizadas. MA thesis. Universidad Nacional Autónoma de México, Mexico City, Mexico. [Google Scholar]
  • 61.Dixon R, Kahn D. 2004. Genetic regulation of biological nitrogen fixation. Nat Rev Microbiol 2:621–631. doi: 10.1038/nrmicro954. [DOI] [PubMed] [Google Scholar]
  • 62.Delmas J, Breysse F, Devulder G, Flandrois JP, Chomarat M. 2006. Rapid identification of Enterobacteriaceae by sequencing DNA gyrase subunit B encoding gene. Diagn Microbiol Infect Dis 55:263–268. doi: 10.1016/j.diagmicrobio.2006.02.003. [DOI] [PubMed] [Google Scholar]
  • 63.Glaeser S, Kämpfer P. 2015. Multilocus sequence analysis (MLSA) in prokaryotic taxonomy. Syst Appl Microbiol 38:237–245. doi: 10.1016/j.syapm.2015.03.007. [DOI] [PubMed] [Google Scholar]
  • 64.Martens M, Dawyndt P, Coopman R, Gillis M, De Vos P, Willems A. 2008. Advantages of multilocus sequence analysis for taxonomic studies: a case study using 10 housekeeping genes in the genus Ensifer (including former Sinorhizobium). Int J Syst Evol Microbiol 58:200–214. doi: 10.1099/ijs.0.65392-0. [DOI] [PubMed] [Google Scholar]
  • 65.Stephan R, Van Trappen S, Cleenwerck I, Vancanneyt M, De Vos P, Lehner A. 2007. Enterobacter turicensis sp. nov. and Enterobacter helveticus sp. nov., isolated from fruit powder. Int J Syst Evol Microbiol 57:820–826. doi: 10.1099/ijs.0.64650-0. [DOI] [PubMed] [Google Scholar]
  • 66.Brady C, Cleenwerck I, Venter S, Coutinho T, De Vos P. 2013. Taxonomic evaluation of the genus Enterobacter based on multilocus sequence analysis (MLSA): proposal to reclassify E. nimipressuralis and E. amnigenus into Lelliottia gen. nov. as Lelliottia nimipressuralis comb. nov. and Lelliottia amnigena comb. nov., respectively, E. gergoviae and E. pyrinus into Pluralibacter gen. nov. as Pluralibacter gergoviae comb. nov. and Pluralibacter pyrinus comb. nov., respectively, E. cowanii, E. radicincitans, E. oryzae and E. arachidis into Kosakonia gen. nov. as Kosakonia cowanii comb. nov., Kosakonia radicincitans comb. nov., Kosakonia oryzae comb. nov. and Kosakonia arachidis comb. nov., respectively, and E. turicensis, E. helveticus and E. pulveris into Cronobacter as Cronobacter zurichensis nom. nov., Cronobacter helveticus comb. nov. and Cronobacter pulveris comb. nov., respectively, and emended description of the genera Enterobacter and Cronobacter. Syst Appl Microbiol 36:309–319. doi: 10.1016/j.syapm.2013.03.005. [DOI] [PubMed] [Google Scholar]
  • 67.Li CY, Zhou YL, Ji J, Gu CT. 2016. Reclassification of Enterobacter oryziphilus and Enterobacter oryzendophyticus as Kosakonia oryziphila comb. nov. and Kosakonia oryzendophytica comb. nov. Int J Syst Evol Microbiol 66:2780–2783. doi: 10.1099/ijsem.0.001054. [DOI] [PubMed] [Google Scholar]
  • 68.Nhung PH, Ohkusu K, Mishima N, Noda M, Shah MM, Sun X, Hayashi M, Ezaki T. 2007. Phylogeny and species identification of the family Enterobacteriaceae based on dnaJ sequences. Diagn Microbiol Infect Dis 58:153–161. doi: 10.1016/j.diagmicrobio.2006.12.019. [DOI] [PubMed] [Google Scholar]
  • 69.Rosenblueth M, Martínez L, Silva J, Martínez-Romero E. 2004. Klebsiella variicola, a novel species with clinical and plant-associated isolates. Syst Appl Microbiol 27:27–35. doi: 10.1078/0723-2020-00261. [DOI] [PubMed] [Google Scholar]
  • 70.Lin L, Li Z, Hu C, Zhang X, Chang S, Yang L, Li Y, An Q. 2012. Plant growth-promoting nitrogen-fixing enterobacteria are in association with sugarcane plants growing in Guangxi, China. Microbes Environ 27:391–398. doi: 10.1264/jsme2.me11275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Zhu B, Zhou Q, Lin L, Hu C, Shen P, Yang L, An Q, Xie G, Li Y. 2013. Enterobacter sacchari sp. nov., a nitrogen-fixing bacterium associated with sugar cane (Saccharum officinarum L.). Int J Syst Evol Microbiol 63:2577–2582. doi: 10.1099/ijs.0.045500-0. [DOI] [PubMed] [Google Scholar]
  • 72.Wei C-Y, Lin L, Luo L-J, Xing Y-X, Hu C-J, Yang L-T, Li Y-R, An Q. 2014. Endophytic nitrogen-fixing Klebsiella variicola strain DX120E promotes sugarcane growth. Biol Fertil Soils 50:657–666. doi: 10.1007/s00374-013-0878-3. [DOI] [Google Scholar]
  • 73.Berger B, Baldermann S, Ruppel S. 2017. The plant growth-promoting bacterium Kosakonia radicincitans improves fruit yield and quality of Solanum lycopersicum. J Sci Food Agric 97:4865–4871. doi: 10.1002/jsfa.8357. [DOI] [PubMed] [Google Scholar]
  • 74.Sun S, Chen Y, Chen J, Li Q, Zhang Z, Lan Z. 2018. Isolation, characterization, genomic sequencing, and GFP-marked insertional mutagenesis of a high-performance nitrogen-fixing bacterium, Kosakonia radicincitans GXGL-4A and visualization of bacterial colonization on cucumber roots. Folia Microbiol (Praha) 63:789–802. doi: 10.1007/s12223-018-0608-1. [DOI] [PubMed] [Google Scholar]
  • 75.Keuth S, Bisping B. 1994. Vitamin B12 production by Citrobacter freundii or Klebsiella pneumoniae during Tempeh fermentation and proof of enterotoxin absence by PCR. Appl Environ Microbiol 60:1495–1499. doi: 10.1128/AEM.60.5.1495-1499.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Illeghems K, Weckx S, De Vuyst L. 2015. Applying Meta-pathway analyses through metagenomics to identify the functional properties of the major bacterial communities of a single spontaneous cocoa bean fermentation process sample. Food Microbiol 50:54–63. doi: 10.1016/j.fm.2015.03.005. [DOI] [PubMed] [Google Scholar]
  • 77.Association of Official Analytical Chemists (AOAC). 2000. Official method 992.23: crude protein in cereal grains and oilseeds In Horwitz W. (ed), Official methods of analysis of AOAC International, 17th ed AOAC International, Gaithersburg, MD. [Google Scholar]
  • 78.Rogel MA, Hernández-Lucas I, Kuykendall LD, Balkwill DL, Martinez-Romero E. 2001. Nitrogen-fixing nodules with Ensifer adhaerens harboting Rhizobium tropici symbiotic plasmids. Appl Environ Microbiol 67:3264–3268. doi: 10.1128/AEM.67.7.3264-3268.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Gasson MJ, Davies FL. 1980. High-frequency conjugation associated with Streptococcus lactis donor cell aggregation. J Bacteriol 143:1260–1264. doi: 10.1128/JB.143.3.1260-1264.1980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Green MR, Sambrook J. 2012. Molecular coning: a laboratory manual, 4th ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [Google Scholar]
  • 81.Zheng Z, Scott D, Lukas W, Webb M. 2000. A greedy algorithm for aligning DNA sequences. J Comput Biol 7:203–214. doi: 10.1089/10665270050081478. [DOI] [PubMed] [Google Scholar]
  • 82.Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32:1792–1797. doi: 10.1093/nar/gkh340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Kumar S, Stecher G, Tamura K. 2016. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0. Mol Biol Evol 33:1870–1874. doi: 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Saitou N, Nei M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425. doi: 10.1093/oxfordjournals.molbev.a040454. [DOI] [PubMed] [Google Scholar]
  • 85.Tamura K, Nei M, Kumar S. 2004. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc Natl Acad Sci U S A 101:11030–11035. doi: 10.1073/pnas.0404206101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783–791. doi: 10.2307/2408678. [DOI] [PubMed] [Google Scholar]
  • 87.Ramírez-Chavarín N, Wacher-Rodarte C, Pérez-Chabela ML. 2010. Characterization and identification of thermotolerant lactic acid bacteria isolated from cooked sausages as bioprotective cultures. J Muscle Foods 21:585–596. doi: 10.1111/j.1745-4573.2009.00206.x. [DOI] [Google Scholar]
  • 88.Mariotti F, Tomé D, Mirand P. 2008. Converting nitrogen into protein—beyond 6.25 and Jones’ factors. Crit Rev Food Sci Nutr 48:177–184. doi: 10.1080/10408390701279749. [DOI] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES