Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 May 1.
Published in final edited form as: J Immunol. 2020 Mar 23;204(9):2503–2513. doi: 10.4049/jimmunol.1901263

Epigenetic Regulation of TLR4 in Diabetic Macrophages Modulates Immunometabolism and Wound Repair

Frank M Davis *, Aaron denDekker *, Andrew Kimball †, Amrita D Joshi *, Mahmoud El Azzouny ‡, Sonya J Wolf *, Andrea T Obi *, Jay Lipinski §, Johann E Gudjonsson , Xianying Xing , Olesya Plazyo , Christopher Audu *, William J Melvin *, Kanakadurga Singer ||, Peter K Henke *, Bethany B Moore #,**, Charles Burant #, Steven L Kunkel §, Katherine A Gallagher *,**
PMCID: PMC7443363  NIHMSID: NIHMS1598810  PMID: 32205424

Abstract

Macrophages are critical for the initiation and resolution of the inflammatory phase of wound healing. In diabetes, macrophages display a prolonged inflammatory phenotype preventing tissue repair. Toll-like receptors (TLRs), particularly TLR4, have been shown to regulate myeloid-mediated inflammation in wounds. We examined macrophages isolated from wounds of patients afflicted with diabetes and healthy controls as well as a murine diabetic model demonstrating dynamic expression of TLR4 results in altered metabolic pathways in diabetic macrophages. Further, using a myeloid-specific Mixed-lineage leukemia 1 (MLL1) knockout (Mll1f/fLyz2Cre+) we determined that MLL1 drives Tlr4 expression in diabetic macrophages by regulating levels of histone H3 lysine 4 trimethylation on the Tlr4 promoter. Mechanistically, MLL1-mediated epigenetic alterations influence diabetic macrophages responsiveness to TLR4 stimulation and inhibit tissue repair. Pharmacological inhibition of the TLR4 pathway using a small molecule inhibitor (TAK-242) as well as genetic depletion of either Tlr4 (Tlr4−/−) or myeloid-specific Tlr4 (Tlr4f/fLyz2Cre+) resulted in improved diabetic wound healing. These results define an important role for MLL1-mediated epigenetic regulation of TLR4 in pathologic diabetic wound repair and suggest a target for therapeutic manipulation.

Keywords: Diabetes, macrophage, toll-like receptor, epigenetics, wound, mechanism, inflammation

INTRODUCTION

The failure of wound healing in type 2 diabetes (T2D) represents the most common cause of amputation in the US and has an associated 5-year mortality rate of 50% (1, 2). Chronic dysregulated inflammation is a hallmark of diabetic wounds and prevents tissue repair. Although our understanding of the pathophysiology of wound healing remains incomplete, it is clear that macrophage plasticity, allowing the transition of macrophages from an inflammatory to a reparative phenotype, is critical for normal wound healing. The molecular mechanisms that program and sustain these macrophage phenotypes in wounds have not been completely identified.

Wound repair is a complex process that occurs in overlapping stages of coagulation, inflammation, proliferation and remodeling (2, 3). During the inflammatory phase, macrophage plasticity is essential for the repair and remodeling of wounds. Specifically, infiltrating blood monocyte-derived macrophages (monocyte/macrophages) are critical for the initial inflammatory phase of wound healing (4–6). Blood monocytes originate from macrophage–dendritic cell (DC) precursors in the bone marrow and ultimately differentiate into macrophages and DCs in the tissues (7, 8). Although there is some literature on the role of resident macrophages (F4/80+) and DCs in wound healing, there is growing evidence that infiltrating monocyte/macrophages provide the mandatory drive for acute inflammation, recruiting additional leukocytes, and promoting tissue/pathogen destruction (4, 6, 9, 10). After this early inflammatory phase, macrophages undergo a phenotypic switch producing transforming growth factor (TGF)-β, interleukin (IL)-10 and other mediators important in the transition from the inflammatory to the proliferative phase of wound healing. The predominance of these phenotypically distinct macrophages at specific times during healing, facilitates the development of a tailored macrophage-dependent response. Prior studies in diabetic murine models have demonstrated that the proinflammatory-to-anti-inflammatory macrophage phenotype switch is impaired resulting in a persistent hyperinflammatory macrophage phenotype (11–14). Thus, the examination of the molecular mechanisms underlying macrophage plasticity in wounds is necessary to address the pathology seen in diabetes.

Epigenetic regulation of gene expression plays a major role in the phenotype and function of immune cells in both normal and pathologic conditions by controlling downstream protein expression patterns (13–16). We and others have shown that histone methylation regulates immune-mediator expression in in vitro and in vivo macrophages (17, 18). Histone methylation is important in maintaining active or suppressed gene expression depending on the specific methylation site. Methylation of lysine 4 (K4) on histone 3 (H3) keeps the chromatin in a confirmation such that the promoter for specific genes is available for transcription and thus, genes are actively transcribed (17). Histone H3K4 can be methylated by several different members of the SET domain-containing family of methyltransferaase. In particular, the histone methyltransferase, Mixed-lineage leukemia 1 (MLL1), promotes expression of inflammatory genes in a NFkB-dependent manner (19–21). We have recently identified that MLL1 regulates macrophage cytokine expression, however the role of MLL1 in regulating upstream signaling pathways in macrophages and inflammatory immune cells remains poorly defined (14).

One upstream receptor-signaling pathway that is instrumental in the regulation of innate immunity, specifically macrophages, are the Toll-like receptors (TLRs). TLRs are a family of evolutionarily conserved receptors, which have a key role in host defense by regulating both innate and adaptive immune responses (22). TLR2 recognizes the peptidoglycan and lipopeptide in the cell walls of Gram-positive bacteria, while TLR4 recognizes lipopolysaccharide (LPS), which is an integral component of the outer membranes of Gram-negative bacteria. Importantly, Gram negative bacteria are common organisms found in diabetic wounds (23). Further, the TLR4 receptor is also activated by other ligands, such as saturated fatty acids, which are abundantly presented in diabetic patients (24). Recent studies suggest that TLR4 plays an important role in sterile inflammation, tissue repair, and response to a variety of injuries (15, 25). Similarly within diabetes, TLR4 expression and signaling are significantly increased in diabetic patients and db/db mice (26). Yet the mechanism of this hyperresponsiveness to TLR4 stimulation in diabetic inflammatory cells remains undefined. Further, despite the importance of TLR4 in the regulation of cytokines, there remains a paucity of data on the role of TLR4 in cutaneous wound healing. Of the limited literature, it focuses primarily on early wound healing in keratinocytes (27) and thus the in vivo role of TLR4 in myeloid cells during the course of healing remains unknown.

Given the importance of TLR4 on immune cell function, particularly macrophage function, we investigated the role MLL1 in regulating TLR4 expression in diabetic wound macrophages. Here, we show TLR4 expression is significantly elevated in macrophages in a murine model of diet-induced insulin resistance resulting in altered inflammation and metabolism. Further we demonstrate using a myeloid-specific MLL1 knockout murine model (Mll1f/fLyz2Cre+) that this increase in Tlr4 expression is driven by the epigenetic enzyme MLL1, and its corresponding H3K4 trimethylation on the Tlr4 promoter in diabetic bone marrow and wound myeloid cells. Lastly, genetic depletion (Tlr4−/− + DIO) or small molecule pharmacological inhibition (TAK-242) of TLR4 as well as myeloid-specific TLR4 deficiency (Tlr4f/fLyz2Cre+) decreased the inflammatory macrophage response and improved diabetic wound healing. Taken together, our findings suggest that MLL1 regulates myeloid-specific Tlr4 expression and renders diabetic macrophages hyperinflammatory in response to the TLR4 pathway. Importantly we demonstrate that TLR4 signaling plays an integral role in prolonged myeloid cell-mediated inflammation during aberrant diabetic wound repair. This work identifies practical therapeutic targets for abrogating dysregulated inflammation in diabetic wounds.

MATERIALS AND METHODS

Mice

Mice were maintained in the University of Michigan pathogen-free animal facility, and all protocols were approved by and in accordance with the guidelines established by the Institutional Animal Care and Use Committee (UCUCA). Male C57BL/6 (Tlr4+/+) and Tlr4−/− mice purchased from The Jackson Laboratory (Bar Harbor, ME) were maintained on a normal chow diet (13.5% kcal fat; LabDiet) or high-fat diet (60% kcal fat; Research Diets) for 12 weeks to generate the DIO model of glucose intolerance/insulin resistance. Mice with the Mll1 or Tlr4 gene deleted in myeloid cells were generated by mating Mll1f/f (16) or Tlr4f/f (kind gift from Timothy Billiar University of Pittsburgh) mice with LysM-Cre mice (The Jackson Laboratory). Of note, only male mice were used for all studies as female mice fail to develop glucose intolerance/insulin resistance following high-fat diet administration. Animals underwent all procedures at 20–24 weeks of age. Body weights were determined prior to experimentation.

Human Wound Isolation

All experiments using human samples were approved by the IRB at the University of Michigan and were conducted in accordance with the principles in the Declaration of Helsinki. Briefly, wounds were isolated from male age-matched patients with or without T2D who were undergoing amputation for medical reasons. For description of patient cohort see Supplemental Table I. Co-morbid conditions were not statistically different between the groups. Wounds were obtained from the lateral edge of wound specimens using an 8 mm punch biopsy tool.

Murine Wound Healing Assessment

Before wounding, mice were anesthetized, hair was removed with Veet (Reckitt Benckiser), and skin was cleaned with sterile water. Full-thickness back wounds were created by 4-mm punch biopsy as previously described (13). Initial wound surface area was recorded and digital photographs were obtained daily using an Olympus digital camera. Photographs contained an internal scale to allow for standard measurement calibration. Wound area was quantified using ImageJ software (National Institutes of Health, Bethesda, MD) and was expressed as the percentage of original wound size over time.

Reagents

TAK-242 (13871, Cayman Chemical, USA) was dissolved in dimethyl sulfoxide (DMSO) according to manufacture instructions and stored at −20°C until use. For in vivo studies, the dissolved TAK-242 was prepared daily and injected I.P. (3 mg/kg body weight). TAK-242 injections started two days prior to creation of subcutaneous wound as described above and continued daily throughout wound healing experiment.

Wound Digestion

Following sacrifice, wounds were collected from the backs of the mice postmortem following CO2 asphyxiation using a 6 mm wound biopsy. Sharp scissors were used to excise the full thickness dermis with a 1–2mm margin around the wound ensuring collection of granulation tissue and wounds were placed in RPMI. Wounds were then carefully minced with sharp scissors and digested by incubating in a 50 mg/ml Liberase TM (Roche) and 20U/ml DNaseI (Sigma-Aldrich) solution. Wound cell suspensions were then gently plunged and filtered through a 100μm filter to yield a single cell suspension. Cells were then either magnetic-activated cell sorted (MACs) for RNA studies or cultured ex-vivo for application of GolgiStop and subsequent staining for intracellular flow cytometry (28).

Magnetic-Activated Cell Sorting (MACs) of Murine Wound and Human Monocyte Cell Isolates.

Wounds were digested as described above. Single cell suspensions were incubated with fluorescein isothiocyanate–labeled anti-CD3, anti-CD19, and anti-Ly6G (BioLegend) followed by anti–fluorescein isothiocyanate microbeads (Miltenyi Biotec). Flow-through was then incubated with anti-CD11b microbeads (Miltenyi Biotec) to isolate the non-neutrophil, non-lymphocyte, CD11b+ cells. Cells were saved in Trizol (Invitrogen) for quantitative RT-PCR analyses. For human monocyte isolation, peripheral blood was collected and subjected to RBC lysis and Ficoll separation (GE healthcare). Cell suspensions were then treated with anti-human CD14 microbeads. Magnetic separation yielded 95% purity by flow cytometry.

Histology

Whole wounds were excised from humans using a 6–8 mm punch biopsy. Wound sections were fixed in 10% formalin overnight before embedding in paraffin. 5 μM sections were stained with Mason’s Trichrome for evaluation of reepithelialization, granulation and collagen deposition. For immunohistochemistry, paraffin embedded tissue sections were heated at 60C for 30 minutes, de-paraffinized, and rehydrated. Slides were placed in Ph 9 antigen retrieval buffer and heated at 95C for 20 minutes in a hot water bath. After cooling, slides were treated with 3% H2O2 (5 minutes) and blocked using 10% goat serum (30 minutes). Overnight incubation (4C) was then performed using first antibody at a working concentration. Slides were then washed, treated with secondary antibody, peroxidase (30 minutes) and diaminobenzidine substrate. Antibodies used were Human anti-TLR4 (Fisher Scientific Cat No. AF1478; 2.5 μg/ml). Images were quantified ImageScope software and Image J at 20 X magnification. For immunofluorescence, tissue sections were heated at 65°C to remove parafilm and clarified in a clearing agent. Following rehydration in an ethanol gradient, antigen retrieval was performed using a citrate buffer (pH 6.0). After blocking with serum at room temperature for 30 min, the slides were incubated with the primary antibodies, rabbit anti-human TLR4 (1:50, Abcam ab13556) and mouse anti-human CD163 (1:200, Leica NCL-L-CD163), at 4°C overnight. The sections were washed in PBS containing 0.05% Tween-20 and incubated with the secondary antibodies, TRITC-conjugated donkey anti-rabbit IgG (1:50, Immunoresearch 711-025-152) and AF488-conjugated donkey anti-mouse IgG (1:100, Immunoresearch 715-545-151), at room temperature for 30 min. After a second wash, the slides were mounted with DAPI mounting medium and coverslipped for imaging under a fluorescence microscope (Axio Observer, Zeiss).

ChIP Assay

Chromatin immunoprecipitation (ChIP) assay was performed as described previously (29). Briefly, cells fixed in paraformaldehyde were lysed and sonicated to generate 100–300bp fragments. To immunoprecipitate, samples were incubated in anti-H3K4trimethyl antibody (Abcam) or isotype control (rabbit polyclonal IgG) (Millipore) in parallel samples overnight followed by addition of proteinA Sepharose beads (Thermo-Fisher). Bound DNA was eluted and purified using Phenol:Chloroform:Isoamyl alcohol extraction and ethanol precipitation. Primers were designed using the Ensembl genome browser to search the TLR4, IL1β, and TNFα promoter and then NCBI Primer-BLAST was used to design primers that flank this site. TLR4 Forward primer: 5’-CCAAGCCCAGAGGTCAGATG-3’ and TLR4 reverse primer: 5’-CCGTCGCAGGAGGGAAGTTA-3’. IL1β forward primer: 5’ ACCTTTGTTCCGCACATC 3’ and IL1β reverse primer: 5’ GGGATTATTTCCCCCTGG 3’. TNFα forward: 5’ TCCTGATTGGCCCCAGATTG 3’ and TNFα reverse primer: 5’ TAGTGGCCCTACACCTCTGT 3’.

Flow Cytometry

Single cell suspensions were collected and washed two times with cold PBS and filtered into a 96-well plate for surface staining. Cells were initially stained with pacific orange LIVE/DEAD fixable viability dye (Thermofisher) and then washed two times with cold PBS. Cells were then resuspended in Flow Buffer (PBS, FBS, NaN3, and Hepes Buffer) and Fc-Receptors were blocked with anti-CD16/32 (Biolegend) prior to surface staining. Monoclonal antibodies for surface staining included: Anti-CD3 (Biolegend, Cat No. 100304, 1:400 dilution), Anti-CD19 (Biolegend, Cat No. 115504, 1:400 dilution), Anti-Ter-119 (Biolegend, Cat No. 116204, 1:400 dilution), Anti-NK1.1 (Cat No. 108704, 1:400 dilution), Anti-Ly6G (Biolegend, Cat No. 127604, 1:400 dilution), Anti-CD11b (Biolegend, Cat No. 101230, 1:400 dilution), Anti-TLR4 (Biolegend, Cat No. 145406, 1:400 dilution), Anti-Ter119 (Biolegend, Cat No.116204, 1:200 dilution), Anti-GR.1 (Biolegend, Cat No.108404, 1:200 dilution), Anti-B220 (Biolegend, Cat No.103204, 1:200 dilution), Anti-cKit (Biolegend, Cat No. 105812, 1:200 dilution, ), Anti-Sca (eBiosciences, Cat No.56-5981-82, 1:200 dilution), Anti-FcgRIII (Biolegend, Cat No.101308, 1:200 dilution), Anti-CD105 (Biolegend, Cat No.120410, 1:1000 dilution), and Anti-CD150 (Biolegend, Cat No.115922, 1:200 dilution). Following surface staining, cells were washed twice, and biotinylated antibodies were labeled with streptavidin APC-Cy7 or streptavidin Pacific Orange. Next, cells were either washed and acquired for surface-only flow cytometry or were fixed with 2% formaldehyde and then washed/permeabilized with BD perm/wash buffer (BD Biosciences) for intra-cellular flow cytometry. After permeablilization, intra-cellular stains included: anti-H3K4me3 (abcam), anti-IL1β (mature IL1β, BD Biosciences), and anti-TNF-α (Biolegend). For intracellular histone methylation, a secondary FITC anti-rabbit IgG (R&D) was used. After washing, samples were then acquired on a 3-Laser Novocyte Flow Cytometer (Acea Biosciences, Inc.). Data were analyzed using FlowJo software version 10.0 (Treestar, Inc.). To verify gating and purity, all populations were routinely back-gated.

Cell Culture and Cytokine Analysis

Bone marrow (BM) cells were collected by flushing mouse femurs and tibias with RPMI. BM-derived macrophages (BMDMs) were cultured as previously detailed (29). On day 6, the cells were replated, and after resting for 24 h, they were incubated with or without LPS (100 ng/mL; Sigma (L2880) purified by phenol extraction <3% impurities) for 2–6 hours after which cells were processed for metabolite analysis or placed in Trizol (Invitrogen) for RNA analysis. For human monocyte-derived macrophages, CD14+ monocytes were cultures in complete media supplemented with 50ng/ml of M-CSF (R & D Systems) for 1 week. Adherent cells were washed and harvested with trypsin/EDTA (Lonza).

Metabolite Measurement

Following stimulation with media or LPS+IFNγ to provide maximal generation ‘M1’ macrophage phenotype, bone marrow derived macrophage (BMDM) plates were rinsed, metabolism quenched, and metabolites were extracted and analyzed using a procedure described previously (30–34). Briefly, cell plates were rapidly rinsed with water and quenched with liquid nitrogen. Metabolites were extracted with 8:1:1 methanol: chloroform: water and assayed by high performance liquid chromatography with quadrupole time-of-flight mass spectrometry (HPLC-QTOF-MS). Chromatographic separations were performed with an Agilent Technologies (Santa Clara, CA) 1200 HPLC system equipped with a Phenomenex (Torrance, CA) Luna NH2 HPLC column (1.0 mm inner bore × 150 mm long and packed with 3 μm particles) and a 1.0 × 4 mm guard column. Mobile phase A was 100% acetonitrile (ACN) and mobile phase B (MPB) was 100% 5 mM ammonium acetate adjusted to pH 9.9 with ammonium hydroxide. The gradient started at 20% MPB and ramped till 100% MPB over 20 min., was held at 100% MPB for 5 minutes, and then returned to 20% MPB for an additional 7 min. Detection was performed using a 6520 Agilent Technologies QTOF system equipped with a dual electrospray ionization (ESI) source operated in negative-ion mode for polar metabolites. Raw results present in supplemental table II. For heat map analysis, metabolite levels are expressed as a fold change over wild type control BMDM stimulated for 2hr with media.

RNA Analysis

Total RNA extraction was performed using Trizol (Invitrogen) according to manufacturer’s instructions. RNA was then reversed transcribed to cDNA using iScript (Biorad). PCR was performed with 2X Taqman PCR mix using the 7500 Real-Time PCR System. Primers for Il1b (Mm00434228_m10), Tnfa (Mm00443258_m1), Tlr4 (Mm00445273_m1), Mll1 (Mm01179235_m1), and Human Tlr4 (Hs00152939_m1) were purchased (Applied Biosystems). 18S was used as the internal control. Data were then analyzed relative to 18s ribosomal RNA (2ΔCt) and expressed as a fold change in comparison to control group. All samples were assayed in triplicate. The threshold cycle values were used to plot a standard curve. Data were compiled in Microsoft Excel and presented using Prism software (GraphPad).

QUANTIFICATION AND STATISTICAL ANALYSIS

GraphPad Prism software (RRID:SCR_002798) version 6.0 was used to analyze the data. All the data were assessed for normality and equal variance using Shapiro-Wilk test and Levene test, respectively. Unpaired two-tailed Student’s t test was used to determine statistical difference between two groups for normally distributed continuous variables. For comparison of multiple groups, one-way analysis of variance test followed by Newman-Keuls post hoc test. For data with small sample size or non-normally distributed data non-parametric Mann-Whitney test or Kruskal-Wallis test were used for analysis. All data are representative of at least two independent experiments as detailed in the figure legends. A P-value of less than or equal to 0.05 was significant.

RESULTS

Diabetic macrophages are predisposed toward a proinflammatory phenotype and exhibit metabolic derangements

Chronic inflammation is a hallmark of impaired diabetic wound healing. Bone marrow derived macrophages (BMDMs) from diet-induced obese (DIO) mice exhibited increased proinflammatory inflammatory cytokine production as compared with controls, shown by increased Il1b, Tnfa, Il12, and Il23 expression (Figure 1A and Supplemental Figure 1A–E). This suggests that diabetic BMDMs are primed toward a proinflammatory phenotype. Recent evidence suggests that intermediary metabolism alters gene expression, and thus phenotype in macrophages, providing a molecular link between metabolism and innate immunity (35–37). Given the hyperinflammatory phenotype in diabetic BMDMs, we sought to examine the variation in intermediary metabolism from DIO and control BMDMs. As such, BMDMs were stimulated and analyzed using targeted liquid chromatography–mass spectroscopy (LC/MS) for ~65 metabolites representing central carbon metabolism, including acyl-CoAs, acylcarnitines, and amino acids, as well as metabolites in glycolysis, the pentose phosphate pathway, and the TCA cycle. Several glycolytic metabolites were upregulated in the DIO BMDMs, including the glucose 6-phosphate and fructose-1,6-bisphosphate (Figure 1B). Likewise, many TCA cycle and nucleotide intermediates were increased in DIO BMDMs. Specifically, itaconate and malonyl-CoA were the two most highly upregulated TCA cycle intermediates in DIO BMDMs following stimulation. Prior metabolomic analysis by ourselves and others has demonstrated that dysregulation in itaconate production results in metabolic remodeling in macrophages toward an inflammatory state (33, 35, 38, 39). Within nucleotide metabolism, multiple nucleotide intermediates were aberrantly expressed in DIO BMDMs compared to wild type BMDMs. Interestingly, NAD+, which has been recently linked to innate immune cell dysfunction and inflammation (40), was found to be significantly elevated in DIO BMDMs. For amino acids, there was less discrepancy between wild type and DIO BMDMs compared to other metabolic pathways, however aspartate, taurine, and alanine were three of the most highly upregulated amino acids in DIO BMDMs in both unstimulated and LPS stimulated cells. Lastly, within this analysis one of the most highly upregulated metabolites was S-adenosylmethionine (SAM). Additional analysis of SAM levels in normal and DIO BMDMs demonstrated that SAM was significantly upregulated in DIO BMDMs at both baseline and following stimulation (Figure 1C).

Figure 1. Diabetic macrophages are predisposed toward a proinflammatory phenotype with aberrant metabolite expression.

Figure 1.

A: Bone marrow derived macrophages (BMDMs) harvested from control and DIO mice were stimulated with LPS (100 ng/mL) for 6 hours after which they were collected for analysis. Il1b and Tnfa gene expression was quantified by qPCR and expressed as fold comparison to control without LPS (n=5/group). *p< 0.05, **p< 0.01 by ANOVA followed by Newman–Keuls post hoc test. B: The heat map is showing the metabolite levels in control and DIO BMDMs expressed as a fold change over wild-type control BMDM stimulated for 2hr with media. For the heat maps, asterisk indicates significant difference in peak area when comparing DIO BMDM and wild-type BMDM for similar treatment conditions and duration with p< 0.05 by analysis of variance using Tukey’s post hoc analysis. C: S-adenosylmethionine levels analyzed by LC-MS in control and DIO BMDMs before and after stimulation with LPS+IFNγ (100 ng/mL) for 6 hours expressed as area under the curve normalized arginine (n=5/group). **p< 0.01 by ANOVA followed by Newman–Keuls post hoc test. Data are presented as the mean±SEM. All data are representative of 2–3 independent experiments.

It has recently been established that SAM is instrumental to changes in the epigenetic methylation status of histones and nucleic acids, via the actions of methyltransferase enzymes (41–44). SAM serves as the universal methyl donor for these enzymes resulting in the transfer its methyl group to yield S-adenosylhomocysteine (SAH) and a methylated substrate. Genes that encode these enzymes are frequently altered in pathological states, such as T2D (14, 45, 46) leading to alterations in methylation providing a link between the metabolism that regulates SAM and SAH and the epigenetic status of cells. Taken together, this data identifies that DIO BMDM display increased responsiveness to inflammatory stimuli and altered metabolic pathways.

MLL1-mediated H3K4 trimethylation upregulates Tlr4 expression in diabetic macrophages

Evidence suggests that epigenetic regulation via histone methylation of gene expression plays a key role in influencing inflammatory phenotypes (14, 45, 46). Given the markedly elevated SAM levels in diabetic BMDMs, we examined if prolonged diet-induced insulin resistance results in alterations in histone methylation. As such, we examined several histone methylation marks associated with gene activation by flow cytometry. We found that H3K4 trimethylation (H3K4me3) was increased in diabetic bone marrow progenitor cells (lineage−[CD3−CD19−Ly6G−], c-kit+/sca−, CD41low, FcRγIIIlow, CD105−, H3K4me3+) in comparison to controls (Figure 2A, B). Histone methylation, particularly H3K4me3, influences immune cell phenotypes through the regulation of downstream inflammatory mediator expression in monocyte-derived macrophages (13–16). TLR4 is a major receptor that initiates a downstream signaling cascade that promotes inflammation, mostly through MyD88-dependent pathway and NF-κB expression. To evaluate if altered histone methylation impacted Tlr4 expression, BMDMs from DIO and control mice were isolated and analyzed for H3K4me3 on the promoter of the Tlr4 gene. We found that DIO BMDMs demonstrated increased H3K4me3 on NFκB binding sites of the Tlr4 promoter (Figure 2C). The H3K4me3 methylation mark maintains the chromatin in a conformation so specific genes are effectively activated. This was demonstrated with DIO BMDMs displaying upregulation of Tlr4 expression (Figure 2D).

Figure 2. MLL1-mediated H3K4 trimethylation upregulates Tlr4 expression in diabetic macrophages.

Figure 2.

A: DIO and control bone marrow were processed for intracellular flow cytometry. The gating strategy used for intracellular flow cytometry selecting single, lineage−, c-kit+/sca−, CD41low, FcRγIIIlow, CD105−, H3K4me3+ cells is shown. B: Flow cytometry quantification of H3K4me3 in DIO and control macrophages (n = 10 per group, repeated for two independent experiments). *p<0.05 by Student’s t test. C: ChIP analysis for H3K4me3 at the NF-kB binding site of the Tlr4 promoter in DIO and control BMDMs (n =5 per group, repeated two times in triplicate). **p<0.01 by ANOVA followed by Newman–Keuls post hoc. D: BMDMs were isolated from DIO and control mice and analyzed for Tlr4 expression by qPCR (n=3 per group, repeated in triplicate). *p<0.05 by Mann-Whitney U test. E: BMDMs were isolated DIO and control mice and analyzed for Mll1 expression by qPCR (n=3 per group, repeated in triplicate). *p<0.05 by Mann-Whitney U test. F: BMDMs were isolated in DIO Mll1f/fLyz2Cre+ and littermate controls and analyzed for Tlr4 expression by qPCR (n=3 per group, repeated in triplicate). **p<0.01 by Mann-Whitney U test. G: ChIP analysis for H3K4me3 at the NF-kB binding site of the Tlr4 promoter in from DIO Mll1f/fLyz2Cre+ and DIO Mll1f/fLyz2Cre- BMDMs (n =5 per group, repeated two times in triplicate). **p<0.01 by ANOVA followed by Newman–Keuls post hoc. Data are presented as the mean±SEM.

Previous investigations have demonstrated that the methyltransferase, MLL1, has site specificity for H3K4 (12, 31). Since H3K4me3 was increased on the Tlr4 promoter and we have previously identified MLL1 to influence macrophage phenotype (14), we examined MLL1 expression in ND and DIO BMDMs. MLL1 was significantly increased in DIO BMDMs compared to controls corresponding to the increased TLR4 receptor on diabetic macrophages (Figure 2E). To evaluate the ability of MLL1 to regulate Tlr4 expression, we generated mice deficient in Mll1 in cells of the myeloid lineage with lysosomes by using the Cre-lox system. Myeloid-specific depletion of Mll1 was confirmed in vivo by examining sorted splenic monocytes from Mll1f/fLyz2Cre+ mice and littermate controls (Mll1f/fLyz2Cre-) (14). These mice were then placed on a high fat diet to induce insulin resistance (DIO Mll1f/fLyz2Cre+ or DIO Mll1f/fLyz2Cre-). Following confirmation of hyperglycemia (data not shown), BMDMs were isolated from DIO Mll1f/fLyz2Cre+ mice and littermate controls to determine whether Mll1 alters Tlr4 expression. Mll1-deficient myeloid cells demonstrated a significant decrease in H3K4me3 on the Tlr4 promoter as well as a corresponding decrease in Tlr4 expression in the DIO Mll1f/fLyz2Cre+ compared to littermate controls but no significant decrease in expression of the majority of other Tlr receptors (Figure 2F, G and Supplemental Figure 1F–H). Taken together, these results suggest that DIO bone marrow myeloid cells exhibit increased H3K4me3 at the Tlr4 promoter that primes cells toward increased Tlr4 receptor expression.

MLL1-mediated H3K4me3 regulates TLR4 receptor levels in diabetic peripheral blood monocytes and wound macrophages

Proper wound healing requires the establishment of a regulated inflammatory response mediated by macrophages and persistent macrophage inflammation results in poorly healing diabetic wounds (8, 27, 28). The mechanism(s) responsible for the persistent macrophage-inflammatory phenotype in diabetic wound repair are incompletely understood. Given the increased Tlr4 expression exhibited in DIO BMDMs, we next sought to determine if aberrant Tlr4 expression was also present in diabetic wounds. In order to evaluate the role of TLR4 in vivo in wounds, peripheral monocytes and wound macrophages (CD11b+[CD3−CD19−Ly6G−]) were examined for TLR4 receptors by flow cytometry. In comparison to normal diet controls, DIO peripheral blood monocytes and wound macrophages display significantly increased levels of TLR4 receptor (Figure 3A). As a translational corollary, human wound tissue was also examined from patients with non-healing wounds and T2D and found markedly increased TLR4 transcript and TLR4 on histologic assessment in wounds from T2D patients compared to controls (Figure 3B, C).

Figure 3. MLL1-mediated H3K4me3 regulates TLR4 receptor levels in diabetic peripheral blood monocytes and wound macrophages.

Figure 3.

A: DIO and control peripheral blood and wound cell isolates were processed for flow cytometry using the following gating strategy selecting for single cells, live, lineage−, Ly6G−, CD11b+, TLR4+ cells. Flow cytometry quantification of TLR4 in peripheral blood and wounds (n = 10 per group, repeated twice). *p<0.05 by Student’s t test. B: Peripheral blood (30 mL) was collected from patients with T2D and control subjects without diabetes. Peripheral blood mononuclear cells underwent Ficoll separation. CD14+ monocytes were then positively selected by MACS and underwent ex vivo stimulation with media for 2 hrs. TLR4 gene expression was measured by qPCR (n=3 non-diabetic and 7 diabetic). *p<0.05 by Mann-Whitney U test. C: Immunohistochemistry and immunofluorescence performed on human wounds from T2D and non-T2D patients for TLR4 and CD163 at 10X and 40X. D: Wound macrophages were isolated from DIO and control on post-injury day 3 and ChIP analysis for H3K4me3 was performed at the NF-kB binding site of the Tlr4 promoter (n =5 per group, repeated two times in triplicate). Dotted line represents IgG control level. **p<0.01 by Mann-Whitney U test. E: Wound macrophages were isolated from DIO and control macrophages on post-injury day 3 and analyzed for Tlr4 expression by qPCR (n=3 per group, repeated in triplicate). **p<0.01 by Mann-Whitney U test. F: Wound macrophages were isolated from DIO and control macrophages on post-injury day 3 and analyzed for Mll1 expression by qPCR (n=3 per group, repeated in triplicate). **p<0.01 by Mann-Whitney U test. G: Wound macrophages were isolated from Mll1f/fLyz2Cre- and Mll1f/fLyz2Cre+ on a high fat diet on post-injury day 3 and analyzed for Tlr4 expression by qPCR (n=3 per group, repeated in triplicate). **p<0.01 by Mann-Whitney U test. H: Wound macrophages were isolated from Mll1f/fLyz2Cre- and Mll1f/fLyz2Cre+ on a high fat diet on post-injury day 3 and ChIP analysis for H3K4me3 was performed at the NF-kB binding site of the Tlr4 promoter (n =5 per group, repeated two times in triplicate). **p<0.01 by ANOVA followed by Newman–Keuls post hoc. Data are presented as the mean±SEM.

To evaluate if the increased TLR4 in wound myeloid cells is due to epigenetic regulation of the Tlr4 gene in vivo consistent with that seen in vitro, we examined several histone methylation marks associated with gene activation. We sorted macrophages from DIO and control mice on day 3 post-wounding and found that H3K4me3 was significantly increased on the Tlr4 promoter in DIO wound myeloid cells in comparison to controls resulting in a marked upregulation of Tlr4 mRNA expression (Figure 3D, E). Since the methyltransferase, MLL1, specifically methylates H3K4 (12, 31) we examined the expression of Mll1 in wound macrophages and found it significantly increased at day 3 following tissue injury which corresponds to the increased TLR4 levels (Figure 3F). Lastly, to determine whether Mll1 alters Tlr4 expression, wound macrophages were isolated on day 5 from DIO Mll1f/fLyz2Cre+ mice and littermate controls. Mll1-deficient (Mll1f/fLyz2Cre+) wound macrophages demonstrated a significant decrease in H3K4 trimethylation on the Tlr4 promoter and a corresponding decrease in Tlr4 expression compared to littermate controls (Figure 3G, H). Additionally, the macrophage specific depletion of Mll1 resulted in a significant reduction of H3K4me3 on the promoters of inflammatory cytokines with a reciprocal increase in anti-inflammatory gene expression (Supplemental Figure 2A–D). These data suggest that TLR4 is significantly upregulated in human and murine diabetic wound tissue. Further, MLL1-derived H3K4me3 methylation increases Tlr4 gene expression in murine wound myeloid cells and that may control, at least in part, the increased inflammatory response of diabetic myeloid cells seen during tissue repair.

Genetic depletion or pharmacological inhibition of TLR4 improves diabetic wound healing

Given the increased TLR4 expression in diabetic bone marrow and wound macrophages we examined if TLR4 expression was detrimental for cutaneous wound repair in diabetes. Mice with a TLR4 deficiency (Tlr4−/−) were placed on a high fat diet for 12 weeks to induce insulin resistance and diet induced obesity. We then wounded these mice and monitored the course of wound healing daily. DIO mice with TLR4 deficiency (DIO Tlr4−/−) demonstrated improved healing throughout the entire wound course compared with controls (Figure 4A). Since DIO Tlr4−/− showed improved wound healing, we examined if this was due to changes in wound macrophage phenotype. This is important as it is well established that regulated inflammation is necessary for tissue repair (34, 35). Wound macrophages (CD11b+[CD3-CD19-Ly6G-]) were thereby isolated on day 3 from ND and DIO mice with or without a TLR4 deficiency. Consistent with previous reports (9, 13), diabetic wound macrophages had increased expression of proinflammatory cytokines. However, this diabetic proinflammatory phenotype was negated in DIO Tlr4−/− mice indicated by a reduction in inflammatory cytokines and increased anti-inflammatory cytokine expression (Figure 4B and Supplemental Figure 2E–G). Genetic depletion of Tlr4 did not affect histone methylation on the Tlr4 promoter (Supplemental Figure 2H). To further confirm the detrimental role of the TLR4 overexpression in diabetic wound macrophages we performed pharmacological inhibition of the TLR4 pathway in DIO mice and examined wound healing. Diabetic mice were treated with daily injections of either a TLR4 inhibitor, TAK-242 (3 mg/kg), or PBS control starting 2 days prior to wound creation and continued daily throughout the wound healing course. TAK-242 administration markedly improved diabetic wound healing as well as decreased wound macrophages inflammation (Figure 4C, D). Lastly, in order to confirm the importance of myeloid-specific TLR4 in cutaneous wound healing, we generated mice deficient in Tlr4 in cells of the myeloid lineage with lysosomes (monocytes, macrophages, granulocytes) by using the Cre-lox system (Tlr4f/fLyz2Cre+). These Tlr4f/fLyz2Cre+ mice and littermate controls (Tlr4f/fLyz2Cre-) were then placed on a high fat diet to induce insulin resistance/glucose intolerance. Following confirmation of glucose intolerance (data not shown), wounds were created in DIO mice with Tlr4f/fLyz2Cre+ (DIO Tlr4f/fLyz2Cre+) mice and controls (DIO Tlr4f/fLyz2Cre-) and wound closure was analyzed daily. Wound closure was markedly improved in DIO Tlr4f/fLyz2Cre+ mice compared to controls (Figure 4E). These findings suggest that upregulation of the TLR4 signaling pathway in diabetic wound myeloid cells is detrimental to wound closure and local inhibition of the pathway may improve diabetic tissue repair.

Figure 4. Genetic depletion or pharmacological inhibition of TLR4 improves diabetic wound healing.

Figure 4.

A: Wounds were created in DIO Tlr4−/− and DIO Tlr4+/+ mice. Representative photographs of the wounds of DIO Tlr4−/− and DIO Tlr4+/+ on days 0 and 4 post injury are shown. The change in wound area was recorded daily by blinded observer and analyzed with ImageJ software (n = 5). *p<0.05 by Mann-Whitney U test. B: Wound myeloid cells CD11b+[CD3−CD19−Ly6G−] were isolated on day 5 in DIO Tlr4−/−, ND Tlr4−/−, DIO Tlr4+/+, and ND Tlr4+/+ and Il1b and Tnfa expression was quantified using qPCR (n=5 per group, replicated in triplicate). **p<0.01 by ANOVA followed by Newman–Keuls post hoc. C: Wounds were created in DIO mice and treated with daily injections of TAK-242 (3 mg/kg) or PBS control injection (n = 5). Wound size was measured by blinded observed in Image J NIH. Representative photographs of the wounds of DIO mice with PBS injection and DIO mice with TAK-242 injection on days 0 and 4 post injury are shown (n=4 per group). The arrow denotes the first day of pharmaceutical injection prior to wound creation. *p<0.05; **p<0.01 by Mann-Whitney U test. D: Wound myeloid cells CD11b+[CD3−CD19−Ly6G−] were isolated on day 3 in DIO+PBS and DIO+ TAK-242 and Il1b and Tnfa expression was quantified using qPCR (n=3 per group, replicated in triplicate). **p<0.01 by Mann-Whitney U test. E: Wounds were created in DIO Tlr4f/fLyz2Cre+ and DIO Tlr4f/fLyz2Cre- mice. Representative photographs of the wounds of DIO Tlr4f/fLyz2Cre+ and DIO Tlr4f/fLyz2Cre- on days 0 and 6 post injury are shown. The change in wound area was recorded daily by blinded observer and analyzed with ImageJ software (n = 5 per group). All data are representative of 2–3 independent experiments. Data are presented as the mean±SEM.

DISCUSSION

It is well established that macrophages drive increased inflammation in obesity and T2D contributing to the chronic inflammation seen in diabetic wounds; however, the etiology of this increased inflammatory state is unclear (13, 28, 47–49). Herein, we identify TLR4 expression is significantly elevated in macrophages in human diabetic patients and a murine model of diet-induced insulin resistance resulting in altered inflammation and metabolism. This increased TLR4 receptor expression is in part due to increased expression of the histone methyltransferase, MLL1 in DIO macrophages, and its resulting H3K4me3 on the Tlr4 promoter. Myeloid-specific deletion of MLL1 (Mll1f/fLyz2Cre+) resulted in significant reduction in H3K4me3 on the Tlr4 promoter and decreased Tlr4 expression. Diabetic wound healing was improved with either genetic depletion (Tlr4−/− + DIO) or pharmacological inhibition (TAK-242) of TLR4 as well as myeloid-specific TLR4 deficiency (Tlr4f/fLyz2Cre+) resulting in a reduction in macrophage-mediated inflammation. Taken together, our findings suggest that MLL1 regulates Tlr4 expression in diabetic myeloid cells and that TLR4 signaling plays an integral role in prolonged macrophage-mediated inflammation during wound repair (Figure 5). Further, these findings define a potential therapeutic target to correct impairments in the inflammatory program in diabetic wound macrophages that contribute to dysregulated inflammation.

Figure 5.

Figure 5.

Schematic of Epigenetic Modifications that Hyperpolarize Diabetic Wound Macrophages.

The role of TLR4 in wound healing has previously been investigated in multiple disease states. Within the context of thermal burn injury, TLR4 signaling provides an important role in leukocyte adhesion and cytokine release (43). Further, upregulation of the TLR4 is known to be detrimental following renal, cardiac, or cerebral ischemia reperfusion (50–52). Within the context of non-pathologic wound healing, previous work demonstrates that wounds in Tlr2−/−, Tlr4−/−, and double-knockout Tlr2−/−/Tlr4−/− mice, exhibit attenuated healing and decreased global wound Tgfβ and Ccl5 expression relative to wild-type animals (53). We recently expanded upon this understanding by demonstrating that in non-pathologic wound healing TLR4-MyD88 signaling is an important for regulated tissue repair as it is instrumental in the initial inflammatory response following tissue injury (15). In contrast to the beneficial effects of TLR4 signaling in normal tissue repair, within diabetic wound healing, prolonged signaling through the TLR4 pathway likely has a detrimental impact (44). Within murine investigations, knockdown of TLR4 in a streptozotocin model of type I diabetes resulted in decreased circulating chemokines (54). Further investigations using a diet induced obesity model demonstrated that TLR4 deficiency reduces adipose tissue inflammation concomitant with a shift in adipose tissue macrophage polarization toward an alternatively activated state (55). The importance of TLR4 regulation and signaling likely has relevance to other secondary complications of diabetes as recent studies have shown that overexpression of TLR4 in the human diabetic kidney correlates with CD68+ macrophage cell infiltration, suggesting a possible role for TLR4 in mediating monocyte/macrophage recruitment and tubulointerstitial inflammation in diabetic nephropathy (56).

Although these prior studies have provided insight on the role of TLR4 in diabetes and wound healing, they have been limited by several factors. First, in the study by Dasu et al.(57), a murine model of type 1 diabetes, the streptozotocin model is used; however this model does not recapitulate the clinical characteristics observed in type 2 diabetes. In fact, animals actually lose weight during the streptozotocin-induced model which is contrast to the obesity-induced type 2 diabetes model, and hence, this could impact wound healing physiology (58). Additionally, the streptozotocin-induced type 1 diabetes model has previously been demonstrated to alter immune function separately from the induction of hyperglycemia (59). Thereby any conclusions on the role of innate immune cell biology in diabetic wound healing may be clouded by the chemical effect of streptozotocin. Separately, multiple studies investigating the relation between TLR4 deficiency and diabetes analyzed either adipose tissue macrophages (55) or peritoneal macrophages (54) to draw their conclusions. Macrophage phenotypes can vary depending their environmental niche and thereby drawing correlations about diabetic wound macrophages from other macrophage populations may be inadequate (60). Lastly, prior studies that have investigated the impact of TLR4 deficiency on diabetes and wound healing (57, 61) have mostly been observational where wound healing is observed in a whole body TLR4 deficient murine model and not an in vivo cell specific depletion model. Given that TLR4 can be expressed in multiple cell types including inflammatory cells, keratinocytes and fibroblasts it is important to identify which cell-type is most impacted by TLR4 deficiency and hence, may be the most influential in diabetic wound healing (27). Since many of these earlier studies failed to identify regulators of TLR4 expression in diabetic macrophages, clinical translation will depend on identifying the mechanisms behind these alterations in TLR4 expression in diabetic wound macrophage. In our study, we use a myeloid-specific TLR4 deficient murine strain to demonstrate in vivo improvement in diabetic wound healing and identify the mechanisms that regulate TLR4 expression in diabetic wound macrophages. We demonstrate that epigenetic upregulation of myeloid-specific TLR4 signaling drives macrophages toward increased inflammatory cytokines and altered metabolism.

The current study supports the theory that the diabetic milieu alters immune cell phenotypes through epigenetics. Accumulating evidence suggests that epigenetic regulation of gene expression influences immune cell phenotypes in both disease states as well as during the normal response to injury (8, 26, 32). Further, a link between metabolic derangements and the epigenetic status of cellular pathways has recently been demonstrated. Specifically, Mentch et al. show that modulation of methionine metabolism regulates SAM and SAH levels to drive specific histone methylation at H3K4 thereby affecting gene expression (43). Hence, we demonstrate that diabetic macrophages display increased SAM levels and MLL-mediated H3K4 trimethylation of the TLR4 promoter resulting in upregulated TLR4 expression in diabetic wound macrophages. The dependence of TLR4 on histone methylation via MLL1 was further supported when analyzing mice with myeloid-specific MLL1 depletion (Mll1f/fLyz2Cre+) where wound macrophages from these mice showed significantly decreased Tlr4 expression. The dynamic epigenetic regulation of TLR4 is important as previous studies have shown that immune cell phenotypes are continuing to evolve during the course of wound healing and aberrances in this process can lead to delayed tissue repair (41). Additional studies demonstrate that epigenetic regulation of other TLRs occur in diabetic wound healing, such as TLR2 where altered CpG promoter methylation correlated with diabetic foot ulcer severity (62). However, to date no studies have shown a role of epigenetic modification of the TLR4 promoter as a mechanism for regulate macrophages in diabetes and diabetic wound repair.

Although this study produces insight into the mechanism(s) behind diabetic myeloid-mediated inflammation in cutaneous wound healing, some limitations must be addressed. Myeloid cells play an important role in tissue repair following injury however, there is evidence that TLR4 is also expressed in keratinocytes, fibroblasts, and B cells (63, 64). Additionally, although H3K4 trimethylation suggests a potential mechanism for increased TLR4 expression in diabetic wound macrophages, we acknowledge that other epigenetic modifications may play a role in macrophage Tlr4 expression and downstream NFκB mediate cytokine production. Indeed, other epigenetic enzymes have been shown to play a role in aberrant myeloid cell function in pathological states (13, 14). Thus, further studies assessing the role of other specific epigenetic enzymes in the regulation of TLR4 signaling and other pathways in macrophage-mediated inflammation would be useful.

In summary, we have established that alterations in MLL1-mediated H3K4me3 on the Tlr4 promoter in macrophages are instrumental in the dysregulated inflammation and impaired wound healing in diabetes. Further, we have shown that elevated TLR4 levels in diabetic myeloid cells alters macrophage metabolism through hyperresponsiveness to TLR4 ligands. These findings suggest that MLL1 plays a significant role in dictating wound macrophage phenotype; furthermore, it may have significant relevance to macrophage-mediated inflammation in other secondary complications of diabetes (65–67). Pharmacological inhibition of the TLR4 pathway may be a reasonable therapeutic strategy for regulating the inflammatory response in diabetic repair.

Supplementary Material

1

Key Points.

  • Human and murine diabetic macrophages demonstrate dynamic TLR4 expression

  • MLL1, regulates diabetic macrophage TLR4 expression during pathologic wound healing

  • Myeloid depletion of TLR4 or pharmaceutical inhibition improves diabetic wound repair

Acknowledgements:

We thank Robin Kunkel for her assistance with the graphical illustrations.

Funding Sources: This work is supported in part by National Institutes of Health grants R01-HL137919 (KG), K08-DK102357 (KG), F32-DK117545 (FD), Doris Duke Foundation (KG) American College of Surgeons Resident Fellowship (FD), T32-HL076123 (AK) and the Taubman Institute.

Footnotes

Disclosures: The authors have no conflicts of interest

REFERENCES

  • 1.Faglia E, Favales F, and Morabito A. 2001. New ulceration, new major amputation, and survival rates in diabetic subjects hospitalized for foot ulceration from 1990 to 1993: a 6.5-year follow-up. Diabetes Care 24: 78–83. [DOI] [PubMed] [Google Scholar]
  • 2.Izumi Y, Satterfield K, Lee S, Harkless LB, and Lavery LA. 2009. Mortality of first-time amputees in diabetics: A 10-year observation. Diabetes Res. Clin. Pract 83: 126–131. [DOI] [PubMed] [Google Scholar]
  • 3.Okuno Y, Nakamura-Ishizu A, Kishi K, Suda T, and Kubota Y. 2011. Bone marrow-derived cells serve as proangiogenic macrophages but not endothelial cells in wound healing. Blood 117: 5264–5272. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Willenborg S, Lucas T, van Loo G, Knipper JA, Krieg T, Haase I, Brachvogel B, Hammerschmidt M, Nagy A, Ferrara N, Pasparakis M, and Eming SA. 2012. CCR2 recruits an inflammatory macrophage subpopulation critical for angiogenesis in tissue repair. Blood 120: 613–25. [DOI] [PubMed] [Google Scholar]
  • 5.Auffray C, Sieweke MH, and Geissmann F. 2009. Blood monocytes: development, heterogeneity, and relationship with dendritic cells. Annu. Rev. Immunol 27: 669–92. [DOI] [PubMed] [Google Scholar]
  • 6.Italiani P, and Boraschi D. 2014. From Monocytes to M1/M2 Macrophages: Phenotypical vs. Functional Differentiation. Front. Immunol 5: 514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.van Furth R, and Cohn ZA. 1968. The origin and kinetics of mononuclear phagocytes. J. Exp. Med 128: 415–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Taylor PR, and Gordon S. 2003. Monocyte Heterogeneity and Innate Immunity. Immunity 19: 2–4. [DOI] [PubMed] [Google Scholar]
  • 9.Kimball A, Schaller M, Joshi A, Davis FM, denDekker A, Boniakowski A, Bermick J, Obi A, Moore B, Henke PK, Kunkel SL, and Gallagher KA. 2018. Ly6CHi Blood Monocyte/Macrophage Drive Chronic Inflammation and Impair Wound Healing in Diabetes Mellitus. Arterioscler. Thromb. Vasc. Biol 38: 1102–1114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Wynn TA, and Vannella KM. 2016. Macrophages in Tissue Repair, Regeneration, and Fibrosis. Immunity 44: 450–462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Wood S, Jayaraman V, Huelsmann EJ, Bonish B, Burgad D, Sivaramakrishnan G, Qin S, DiPietro LA, Zloza A, Zhang C, and Shafikhani SH. 2014. Pro-inflammatory chemokine CCL2 (MCP-1) promotes healing in diabetic wounds by restoring the macrophage response. PLoS One 9: e91574. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Maruyama K, Asai J, Ii M, Thorne T, Losordo DW, and D’Amore PA. 2007. Decreased macrophage number and activation lead to reduced lymphatic vessel formation and contribute to impaired diabetic wound healing. Am. J. Pathol 170: 1178–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Gallagher KA, Joshi A, Carson WF, Schaller M, Allen R, Mukerjee S, Kittan N, Feldman EL, Henke PK, Hogaboam C, Burant CF, and Kunkel SL. 2015. Epigenetic changes in bone marrow progenitor cells influence the inflammatory phenotype and alter wound healing in type 2 diabetes. Diabetes 64: 1420–30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Kimball AS, Joshi A, Carson WF, Boniakowski AE, Schaller M, Allen R, Bermick J, Davis FM, Henke PK, Burant CF, Kunkel SL, and Gallagher KA. 2017. The Histone Methyltransferase MLL1 Directs Macrophage-Mediated Inflammation in Wound Healing and Is Altered in a Murine Model of Obesity and Type 2 Diabetes. Diabetes 66: 2459–2471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Davis FM, Kimball A, denDekker A, Joshi AD, Boniakowski AE, Nysz D, Allen RM, Obi A, Singer K, Henke PK, Moore BB, Kunkel SL, and Gallagher KA. 2019. Histone Methylation Directs Myeloid TLR4 Expression and Regulates Wound Healing following Cutaneous Tissue Injury. J. Immunol 202: 1777–1785. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Ishii M, Wen H, Corsa CAS, Liu T, Coelho AL, Allen RM, Carson WF, Cavassani KA, Li X, Lukacs NW, Hogaboam CM, Dou Y, and Kunkel SL. 2009. Epigenetic regulation of the alternatively activated macrophage phenotype. Blood 114: 3244–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Jaenisch R, and Bird A. 2003. Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nat. Genet 33 Suppl: 245–54. [DOI] [PubMed] [Google Scholar]
  • 18.Schlesinger Y, Straussman R, Keshet I, Farkash S, Hecht M, Zimmerman J, Eden E, Yakhini Z, Ben-Shushan E, Reubinoff BE, Bergman Y, Simon I, and Cedar H. 2007. Polycomb-mediated methylation on Lys27 of histone H3 pre-marks genes for de novo methylation in cancer. Nat. Genet 39: 232–6. [DOI] [PubMed] [Google Scholar]
  • 19.Robert I, Aussems M, Keutgens A, Zhang X, Hennuy B, Viatour P, Vanstraelen G, Merville M-P, Chapelle J-P, de Leval L, Lambert F, Dejardin E, Gothot A, and Chariot A. 2009. Matrix Metalloproteinase-9 gene induction by a truncated oncogenic NF-kappaB2 protein involves the recruitment of MLL1 and MLL2 H3K4 histone methyltransferase complexes. Oncogene 28: 1626–38. [DOI] [PubMed] [Google Scholar]
  • 20.Carson WF, Cavassani KA, Soares EM, Hirai S, Kittan NA, Schaller MA, Scola MM, Joshi A, Matsukawa A, Aronoff DM, Johnson CN, Dou Y, Gallagher KA, and Kunkel SL. 2017. The STAT4/MLL1 Epigenetic Axis Regulates the Antimicrobial Functions of Murine Macrophages. J. Immunol 199: 1865–1874. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Wang X, Zhu K, Li S, Liao Y, Du R, Zhang X, Shu H-B, Guo A-Y, Li L, and Wu M. 2012. MLL1, a H3K4 methyltransferase, regulates the TNFα-stimulated activation of genes downstream of NF-κB. J. Cell Sci 125: 4058–4066. [DOI] [PubMed] [Google Scholar]
  • 22.Janeway CA, and Medzhitov R. 2002. I NNATE I MMUNE R ECOGNITION. Annu. Rev. Immunol 20: 197–216. [DOI] [PubMed] [Google Scholar]
  • 23.Rastogi A, Sukumar S, Hajela A, Mukherjee S, Dutta P, Bhadada SK, and Bhansali A. 2017. The microbiology of diabetic foot infections in patients recently treated with antibiotic therapy: A prospective study from India. J. Diabetes Complications 31: 407–412. [DOI] [PubMed] [Google Scholar]
  • 24.Staaf J, Ubhayasekera SJKA, Sargsyan E, Chowdhury A, Kristinsson H, Manell H, Bergquist J, Forslund A, and Bergsten P. 2016. Initial hyperinsulinemia and subsequent β-cell dysfunction is associated with elevated palmitate levels. Pediatr. Res 80: 267–74. [DOI] [PubMed] [Google Scholar]
  • 25.Breslin JW, Wu MH, Guo M, Reynoso R, and Yuan SY. 2008. Toll-like receptor 4 contributes to microvascular inflammation and barrier dysfunction in thermal injury. Shock 29: 349–55. [DOI] [PubMed] [Google Scholar]
  • 26.Rosa Ramirez S, and Ravi Krishna Dasu M. 2012. Toll-like receptors and diabetes complications: recent advances. Curr. Diabetes Rev 8: 480–8. [DOI] [PubMed] [Google Scholar]
  • 27.Chen L, Guo S, Ranzer MJ, and DiPietro LA. 2013. Toll-Like Receptor 4 Has an Essential Role in Early Skin Wound Healing. J. Invest. Dermatol 133: 258–267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Mirza RE, Fang MM, Ennis WJ, and Koh TJ. 2013. Blocking Interleukin-1 Induces a Healing-Associated Wound Macrophage Phenotype and Improves Healing in Type 2 Diabetes. Diabetes 62: 2579–2587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Ishii M, Wen H, Corsa CAS, Liu T, Coelho AL, Allen RM, Carson WF, Cavassani KA, Li X, Lukacs NW, Hogaboam CM, Dou Y, and Kunkel SL. 2009. Epigenetic regulation of the alternatively activated macrophage phenotype. Blood 114: 3244–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.El Azzouny M, Longacre MJ, Ansari I-UH, Kennedy RT, Burant CF, and MacDonald MJ. 2016. Knockdown of ATP citrate lyase in pancreatic beta cells does not inhibit insulin secretion or glucose flux and implicates the acetoacetate pathway in insulin secretion. Mol. Metab 5: 980–987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.El-Azzouny M, Evans CR, Treutelaar MK, Kennedy RT, and Burant CF. 2014. Increased glucose metabolism and glycerolipid formation by fatty acids and GPR40 receptor signaling underlies the fatty acid potentiation of insulin secretion. J. Biol. Chem 289: 13575–88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Lorenz MA, El Azzouny MA, Kennedy RT, and Burant CF. 2013. Metabolome response to glucose in the β-cell line INS-1 832/13. J. Biol. Chem 288: 10923–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.ElAzzouny M, Tom CTMB, Evans CR, Olson LL, Tanga MJ, Gallagher KA, Martin BR, and Burant CF. 2017. Dimethyl Itaconate Is Not Metabolized into Itaconate Intracellularly. J. Biol. Chem 292: 4766–4769. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.ElAzzouny MA, Evans CR, Burant CF, and Kennedy RT. 2015. Metabolomics Analysis Reveals that AICAR Affects Glycerolipid, Ceramide and Nucleotide Synthesis Pathways in INS-1 Cells. PLoS One 10: e0129029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Tannahill GM, Curtis AM, Adamik J, Palsson-McDermott EM, McGettrick AF, Goel G, Frezza C, Bernard NJ, Kelly B, Foley NH, Zheng L, Gardet A, Tong Z, Jany SS, Corr SC, Haneklaus M, Caffrey BE, Pierce K, Walmsley S, Beasley FC, Cummins E, Nizet V, Whyte M, Taylor CT, Lin H, Masters SL, Gottlieb E, Kelly VP, Clish C, Auron PE, Xavier RJ, and O’Neill LAJ. 2013. Succinate is an inflammatory signal that induces IL-1β through HIF-1α. Nature 496: 238–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Christ A, Lauterbach M, and Latz E. 2019. Western Diet and the Immune System: An Inflammatory Connection. Immunity 51: 794–811. [DOI] [PubMed] [Google Scholar]
  • 37.Lancaster GI, Langley KG, Berglund NA, Kammoun HL, Reibe S, Estevez E, Weir J, Mellett NA, Pernes G, Conway JRW, Lee MKS, Timpson P, Murphy AJ, Masters SL, Gerondakis S, Bartonicek N, Kaczorowski DC, Dinger ME, Meikle PJ, Bond PJ, and Febbraio MA. 2018. Evidence that TLR4 Is Not a Receptor for Saturated Fatty Acids but Mediates Lipid-Induced Inflammation by Reprogramming Macrophage Metabolism. Cell Metab. 27: 1096–1110.e5. [DOI] [PubMed] [Google Scholar]
  • 38.O’Neill LAJ, and Artyomov MN. 2019. Itaconate: the poster child of metabolic reprogramming in macrophage function. Nat. Rev. Immunol 19: 273–281. [DOI] [PubMed] [Google Scholar]
  • 39.Jha AK, Huang SC-C, Sergushichev A, Lampropoulou V, Ivanova Y, Loginicheva E, Chmielewski K, Stewart KM, Ashall J, Everts B, Pearce EJ, Driggers EM, and Artyomov MN. 2015. Network integration of parallel metabolic and transcriptional data reveals metabolic modules that regulate macrophage polarization. Immunity 42: 419–30. [DOI] [PubMed] [Google Scholar]
  • 40.Minhas PS, Liu L, Moon PK, Joshi AU, Dove C, Mhatre S, Contrepois K, Wang Q, Lee BA, Coronado M, Bernstein D, Snyder MP, Migaud M, Majeti R, Mochly-Rosen D, Rabinowitz JD, and Andreasson KI. 2019. Macrophage de novo NAD+ synthesis specifies immune function in aging and inflammation. Nat. Immunol 20: 50–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Yu W, Wang Z, Zhang K, Chi Z, Xu T, Jiang D, Chen S, Li W, Yang X, Zhang X, Wu Y, and Wang D. 2019. One-Carbon Metabolism Supports S-Adenosylmethionine and Histone Methylation to Drive Inflammatory Macrophages. 75: 1147–1160.e5. [DOI] [PubMed] [Google Scholar]
  • 42.Serefidou M, Venkatasubramani AV, and Imhof A. 2019. The Impact of One Carbon Metabolism on Histone Methylation. Front. Genet 10: 764. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Mentch SJ, Mehrmohamadi M, Huang L, Liu X, Gupta D, Mattocks D, Gómez Padilla P, Ables G, Bamman MM, Thalacker-Mercer AE, Nichenametla SN, and Locasale JW. 2015. Histone Methylation Dynamics and Gene Regulation Occur through the Sensing of One-Carbon Metabolism. Cell Metab. 22: 861–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Teperino R, Schoonjans K, and Auwerx J. 2010. Histone methyl transferases and demethylases; can they link metabolism and transcription? Cell Metab. 12: 321–327. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Kimball AS, Davis FM, denDekker A, Joshi AD, Schaller MA, Bermick J, Xing X, Burant CF, Obi AT, Nysz D, Robinson S, Allen R, Lukacs NW, Henke PK, Gudjonsson JE, Moore BB, Kunkel SL, and Gallagher KA. 2019. The Histone Methyltransferase Setdb2 Modulates Macrophage Phenotype and Uric Acid Production in Diabetic Wound Repair. Immunity 51: 258–271.e5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Kaikkonen MU, Spann NJ, Heinz S, Romanoski CE, Allison KA, Stender JD, Chun HB, Tough DF, Prinjha RK, Benner C, and Glass CK. 2013. Remodeling of the enhancer landscape during macrophage activation is coupled to enhancer transcription. Mol. Cell 51: 310–25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Falanga V 2005. Wound healing and its impairment in the diabetic foot. Lancet (London, England) 366: 1736–43. [DOI] [PubMed] [Google Scholar]
  • 48.Mirza RE, Fang MM, Weinheimer-Haus EM, Ennis WJ, and Koh TJ. 2014. Sustained inflammasome activity in macrophages impairs wound healing in type 2 diabetic humans and mice. Diabetes 63: 1103–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Mirza RE, Fang MM, Novak ML, Urao N, Sui A, Ennis WJ, and Koh TJ. 2015. Macrophage PPARγ and impaired wound healing in type 2 diabetes. J. Pathol 236: 433–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Wu H, Chen G, Wyburn KR, Yin J, Bertolino P, Eris JM, Alexander SI, Sharland AF, and Chadban SJ. 2007. TLR4 activation mediates kidney ischemia/reperfusion injury. J. Clin. Invest 117: 2847–59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Tang S-C, Arumugam TV, Xu X, Cheng A, Mughal MR, Jo DG, Lathia JD, Siler DA, Chigurupati S, Ouyang X, Magnus T, Camandola S, and Mattson MP. 2007. Pivotal role for neuronal Toll-like receptors in ischemic brain injury and functional deficits. Proc. Natl. Acad. Sci 104: 13798–13803. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Oyama J, Blais C, Liu X, Pu M, Kobzik L, Kelly RA, and Bourcier T. 2004. Reduced myocardial ischemia-reperfusion injury in toll-like receptor 4-deficient mice. Circulation 109: 784–9. [DOI] [PubMed] [Google Scholar]
  • 53.Suga H, Sugaya M, Fujita H, Asano Y, Tada Y, Kadono T, and Sato S. 2014. TLR4, rather than TLR2, regulates wound healing through TGF-β and CCL5 expression. J. Dermatol. Sci 73: 117–24. [DOI] [PubMed] [Google Scholar]
  • 54.Devaraj S, Tobias P, and Jialal I. 2011. Knockout of toll-like receptor-4 attenuates the pro-inflammatory state of diabetes. Cytokine 55: 441–5. [DOI] [PubMed] [Google Scholar]
  • 55.Orr JS, Puglisi MJ, Ellacott KLJ, Lumeng CN, Wasserman DH, and Hasty AH. 2012. Toll-like Receptor 4 Deficiency Promotes the Alternative Activation of Adipose Tissue Macrophages. Diabetes 61: 2718–2727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Lin M, Yiu WH, Wu HJ, Chan LYY, Leung JCK, Au WS, Chan KW, Lai KN, and Tang SCW. 2012. Toll-like receptor 4 promotes tubular inflammation in diabetic nephropathy. J. Am. Soc. Nephrol 23: 86–102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Dasu MR, and Jialal I. 2013. Amelioration in wound healing in diabetic toll-like receptor-4 knockout mice. J. Diabetes Complications 27: 417–421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Greenhalgh DG 2003. Tissue repair in models of diabetes mellitus. A review. Methods Mol. Med 78: 181–9. [DOI] [PubMed] [Google Scholar]
  • 59.Muller YD, Golshayan D, Ehirchiou D, Wyss JC, Giovannoni L, Meier R, Serre-Beinier V, Puga Yung G, Morel P, Bühler LH, and Seebach JD. 2011. Immunosuppressive effects of streptozotocin-induced diabetes result in absolute lymphopenia and a relative increase of T regulatory cells. Diabetes 60: 2331–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Komegae EN, Fonseca MT, da Silveira Cruz-Machado S, Turato WM, Filgueiras LR, Markus RP, and Steiner AA. 2019. Site-Specific Reprogramming of Macrophage Responsiveness to Bacterial Lipopolysaccharide in Obesity. Front. Immunol 10: 1496. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Devaraj S, Tobias P, and Jialal I. 2011. Knockout of toll-like receptor-4 attenuates the pro-inflammatory state of diabetes. Cytokine 55: 441–5. [DOI] [PubMed] [Google Scholar]
  • 62.Singh KK, Agrawal NK, Gupta SK, Mohan G, Chaturvedi S, and Singh KK. 2015. Genetic and epigenetic alterations in Toll like receptor 2 and wound healing impairment in type 2 diabetes patients. J. Diabetes Complications 29: 222–9. [DOI] [PubMed] [Google Scholar]
  • 63.Cheng T-L, Lai C-H, Chen P-K, Cho C-F, Hsu Y-Y, Wang K-C, Lin W-L, Chang B-I, Liu S-K, Wu Y-T, Hsu C-K, Shi G-Y, and Wu H-L. 2015. Thrombomodulin promotes diabetic wound healing by regulating toll-like receptor 4 expression. J. Invest. Dermatol 135: 1668–1675. [DOI] [PubMed] [Google Scholar]
  • 64.Iwata Y, Yoshizaki A, Komura K, Shimizu K, Ogawa F, Hara T, Muroi E, Bae S, Takenaka M, Yukami T, Hasegawa M, Fujimoto M, Tomita Y, Tedder TF, and Sato S. 2009. CD19, a response regulator of B lymphocytes, regulates wound healing through hyaluronan-induced TLR4 signaling. Am. J. Pathol 175: 649–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.El-Osta A, Brasacchio D, Yao D, Pocai A, Jones PL, Roeder RG, Cooper ME, and Brownlee M. 2008. Transient high glucose causes persistent epigenetic changes and altered gene expression during subsequent normoglycemia. J. Exp. Med 205: 2409–2417. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Parathath S, Grauer L, Huang L-S, Sanson M, Distel E, Goldberg IJ, and Fisher EA. 2011. Diabetes adversely affects macrophages during atherosclerotic plaque regression in mice. Diabetes 60: 1759–69. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Reddy MA, Zhang E, and Natarajan R. 2015. Epigenetic mechanisms in diabetic complications and metabolic memory. Diabetologia 58: 443–55. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

RESOURCES