Abstract
There is a lack of evidence of genetic variation in the Helicobacter pylori cag-PAI in Thailand, a region with the low incidence of gastric cancer. To clarify this issue, variation in the H. pylori cag-PAI in strains detected in Thailand was characterized and simultaneously compared with strains isolated from a high-risk population in Korea. The presence of ten gene clusters within cag-PAI (cagA, cagE, cagG, cagH, cagL, cagM, cagT, orf13, virB11, and orf10) and IS605 was characterized in H. pylori strains detected from these two countries. The cagA genotypes and EPIYA motifs were analyzed by DNA sequencing. The overall proportion of the ten cag-PAI genes that were detected ranged between 66 and 79%; additionally, approximately 48% of the strains from Thai patients contained an intact cag-PAI structure, while a significantly higher proportion (80%) of the strains from Korean patients had an intact cag-PAI. A significantly higher proportion of IS605 was detected in strains from Thai patients (55%). Analysis of cagA genotypes and EPIYA motifs revealed a higher frequency of Western-type cagA in Thai patients (87%) relative to Korean patients (8%) who were predominately associated with the East Asian-type cagA (92%). Variations in the Western-type cagA in the Thai population, such as EPIYA-BC patterns and EPIYA-like sequences (EPIYT), were mainly detected as compared with the Korean population (p < 0.05). In summary, H. pylori strains that colonize the Thai population tend to be associated with low virulence due to distinctive cag-PAI variation, which may partially explain the Asian paradox phenomenon in Thailand.
Keywords: Helicobacter pylori, cag pathogenicity island, IS605, EPIYA motifs, Thailand
Introduction
Helicobacter pylori usually colonizes the stomach and is well recognized as an etiological factor of several gastroduodenal diseases, including chronic gastritis, peptic ulcer diseases, and especially gastric cancer [1]. This bacterium ordinarily causes chronic infections in more than half of the world’s population; however, the frequency of infection markedly differs geographically. Epidemiological surveys revealed that incidence of gastric cancer varies from region to region; in addition, it was found that H. pylori infection remarkably increases the risk of gastric cancer in East Asian countries, such as Japan, China, and Korea [2]. In contrast, Southeast Asian countries including Thailand also have high rates of H. pylori infection (54–76%) [3], but the gastric cancer age-standardized incidence rate (ASR) is quite low in the Thai population (3.1 per 100,000 people) [4]. Interestingly, Thailand is currently classified as part of the Asian paradox area (includes Malaysia, Bangladesh, India, and Pakistan) that has high rates of H. pylori infection, but gastric cancer incidence rates are extremely low [5]. However, ethnicities, host genetics, environmental factors, or genetic diversity of virulence genes in H. pylori strains may be supportive factors involved in gastric carcinogenesis [6].
Bacterial virulence components are one of several supportive factors that are responsible for H. pylori pathogenesis [7]. Notably, the cag pathogenicity island (cag-PAI), which is an approximate 40-kb cluster of genes, is well characterized as being the major marker of H. pylori virulence strains and is a predictable risk factor of gastric carcinogenesis [8]. According to the integration of insertion sequence elements (IS605), the cag-PAI may be divided into two regions termed cag I and cag II, which contain 14 and 16 open reading frames (ORFs), respectively [8]. This pathogenicity island contains approximately 32 genes that encode the type 4 secretion system (T4SS) syringe apparatus and cytotoxin-associated gene A (CagA) [9]. Translocation of CagA and/or bacterial peptidoglycan into gastric cells delivered by the T4SS interferes or triggers several signaling cascades leading to intracellular responses such as inflammatory cytokine production, cell polarity, and cell proliferation, which contribute to the development of gastric epithelial cell pathophysiology [6]. Several published studies demonstrated that more than 90% of H. pylori strains from East Asian populations carry the cagA gene [10, 11], but approximately 20–40% of strains from other regions are cagA negative. Based on the conserved five-amino acid repeat motif (EPIYA motif) at the carboxyl terminal, CagA is classified into two major genotypes: Western type and East Asian type; however, the genotype of East Asian CagA is closely linked with development of gastric cancer [12].
Some H. pylori strains exhibit a high rate of genetic heterogeneity caused by several processes such as gene rearrangements, gene mutations, gene insertions, or gene deletions [13]. Previous observations reported that partial deletion of cagA or other gene clusters located in the cag-PAI region is found in some H. pylori strains that leads to significantly decreased IL-8 production as compared with strains with intact cag-PAI [14]. Although cagA is closely associated with the risk of inflammation and gastric cancer development, other essential gene clusters within the cag-PAI region (T4SS) mediate mucosal inflammation. In Thailand, although the prevalence of cagA and cagE was previously reported [15], other important genes within cag-PAI, especially T4SS-encoding genes, still need to be explored for genetic variation and integrity [16, 17]. Therefore, additional clusters of gene within the cag-PAI region should be screened to evaluate the integrity of cag-PAI in H. pylori strains from the Thai population. Additionally, a mobile insertion sequence (IS) or IS605 (such as tnpA and tnpB) is located between the cag I and cag II regions in some H. pylori strains. The presence of these genes has been proposed to affect the virulence of H. pylori strains [18]. However, information regarding the prevalence of IS605 in H. pylori strains from Thai gastroduodenal patients is lacking.
Although the genetic variation of cag-PAI has been globally investigated, data from Thailand are lacking. In this study, we analyzed cag-PAI variants and cag-PAI integrity. The presence of 10 representative gene clusters located within cag-PAI that encode an effector oncoprotein (cagA) and T4SS components (cagM, cagL, cagH, cagG, cagE, virB11, cagT, orf10, orf13) and IS605 (tnpA and tnpB) in H. pylori strains detected from Thai gastroduodenal subjects was evaluated. Molecular analysis of cagA genotypes based on the EPIYA motif was also conducted. Additionally, H. pylori strains isolated from a Korean population were evaluated so that cag-PAI genetic diversity between strains associated with low and high risk of gastric cancer could be compared.
Materials and methods
Specimens and DNA extraction
Gastric tissue samples were collected from Thai patients with gastroduodenal disease who had undergone gastro-endoscopic examination at the Endoscopy Medicine Unit, Sunpasitthiprasong Hospital, which is located in Northeast Thailand. This study included 80 patients that were diagnosed as H. pylori infection positive using the commercial rapid urease test kit (RUT) (Pronto Dry®, Germany). The 80 patient cases included 50 cases of gastritis (GT), 20 cases of peptic ulcer diseases (PUD), and 10 cases of gastric cancer (GC).
A total of 90 H. pylori strains isolated from Korean patients corresponded to cases of gastritis (30 cases), PUD (30 cases), and gastric cancer (30 cases). These cultures were obtained from the H. pylori Culture Collection, Department of Microbiology, Gyeongsang Institute of Health Science, Gyeongsang National University College of Medicine, Republic of Korea. Prior to DNA extraction, H. pylori was cultured on Brucella agar containing 10% bovine serum and antibiotic supplements under microaerophilic conditions at 37 °C with 10% CO2 for 2 days. This research was approved by the Institutional Human Ethics Committee (MU-CIRB 2019/004.1501) of Mahidol University.
H. pylori genomic DNA was isolated from RUT positive of Thai gastric tissues and Korean H. pylori strains using a DNA extraction and purification kit (PureDireX, BIO-HELIX, Taiwan) following the manufacturer’s guidelines. Purified DNA was dissolved in TE buffer and was stored at − 20 °C until use.
Determination of gene clusters within cag-PAI and cagA sequencing
All DNA samples were performed polymerase chain reaction (PCR) using specific primers for H. pylori 16SrRNA prior to cag-PAI genotyping. A total of 10 gene clusters within the cag-PAI region (cagA, cagE, cagG, cagT, cagM, cagL, cagH, orf13, virB11, orf10) and IS605 (tnpA and tnpB) were identified by using PCR performed in a reaction volume of 20 μl that contained 1X ready-to-use PCR master mix (OnePCR™ Plus, GeneDireX, Taiwan), primers (0.2–0.5 μM), and 100 ng of genomic DNA. Primer sequences, primer concentrations, and PCR conditions (Table 1) were based on previous publications [14, 19–25]. Genomic DNA extracted from the reference strain of H. pylori 26695 was used as positive control, and the distilled water was also used as negative control. PCR amplification was conducted in an automated thermal cycler (BioRad T100, USA). PCR products were evaluated by 1.5% agarose gel electrophoresis and visualized with a UV illuminator. The integrity of cag-PAI was evaluated by determining the presence of several gene clusters within the cag-PAI region. The presence or absence of selected gene clusters was defined as an intact cag-PAI, a partially deleted cag-PAI, or complete absence of cag-PAI [26]. The complete absence of cag-PAI was confirmed by a PCR assay of cag-PAI empty site [26]. In order to analyze cagA genotypes, cagA amplicons corresponding to the 3′ variable region were purified and were then subjected to DNA sequencing. DNA sequences and corresponding amino acid sequences were analyzed to determine cagA genotypes and the patterns of EPIYA motif, respectively (https://www.expasy.org/).
Table 1.
Primer sequences used in this study
| Genes | Primer sequences | Size (bp) | Primer (μM) | PCR conditions | Ref |
|---|---|---|---|---|---|
| cagA | GATAACAGGCAAGCTTTTGAGG | 349 | 0.5 | 95 °C, 1 min; 52 °C, 1 min; 72 °C, 1 min (35 cycles) | [14] |
| CTGCAAAAGATTGTTTGGCAGA | |||||
| cagA (sequencing) | ACCCTAGTCGGTAATGGGTTA | 550–850 | 0.4 | 95 °C, 1 min; 56 °C, 1 min; 72 °C, 1 min (35 cycles) | [19] |
| GTAATTGTCTAGTTTCGC | |||||
| cagE | TTGAAAACTTCAAGGATAGGATAGAGC | 508 | 0.5 | 95 °C, 45 s; 53 °C, 45 s; 72 °C, 45 s (35 cycles) | [20] |
| GCCTAGCGTAATATCACCATTACCC | |||||
| cagT | CCATGTTTATACGCCTGTGT | 301 | 0.5 | 95 °C, 30 s; 52 °C, 30 s; 72 °C, 1 min (35 cycles) | [21] |
| CATCACCACACCCTTTTGAT | |||||
| cagM | ACAAATACAAAAAAGAAAAAGAGGC | 587 | 0.5 | 95 °C, 30 s; 52 °C, 30 s; 72 °C, 1 min (35 cycles) | [22] |
| ATTTTTCAACAAGTTAGAAAAAGCC | |||||
| cagL | AAAACACTCGTGAAAAATACCATATC | 263 | 0.2 | 95 °C, 45 s; 54 °C, 45 s; 72 °C, 45 s (35 cycles) | [23] |
| TCGCTTCAAAATTGGCTTTC | |||||
| cagH | ATGGCAGGTACACAAGCTAT | 1113 | 0.3 | 95 °C, 45 s; 52 °C, 45 s; 72 °C, 45 s (35 cycles) | [23] |
| TCACTTCACGATTATTTTAG | |||||
| cagG | TTATAAAATTAAATTACTATTTGC | 398 | 0.3 | 95 °C, 30 s; 50 °C, 30 s; 72 °C, 30 s (35 cycles) | [23] |
| GTGGTAAAAACGATGAATCTG | |||||
| virB11 | TTAAATCCTCTAAGGCATGCTAC | 491 | 0.3 | 95 °C, 45 s; 49 °C, 45 s; 72 °C, 45 s (35 cycles) | [24] |
| GATATAAGTCGTTTTACCGCTTC | |||||
| orf10 | AATAGTGCTTTCTTTAGGATTAGCG | 658 | 0.5 | 95 °C, 1 min; 54 °C, 1 min; 72 °C, 1 min (35 cycles) | [22] |
| CCGATTTAATCCTTTCGCTTATGTG | |||||
| orf13 | CGTTCATGTTCCATACATCTTTGGC | 617 | 0.5 | 95 °C, 1 min; 55 °C, 1 min; 72 °C, 1 min (35 cycles) | [22] |
| GATTTATAGCGATCTAAGAAACCGC | |||||
| tnpA | ATCAGTCCAAAAAGTTTTTTCTTTCC | 338 | 0.5 | 95 °C, 45 s; 55 °C, 30 s; 72 °C, 30 s (35 cycles) | [22] |
| TAAGGGGGTATATTTCAACCAACCG | |||||
| tnpB | CGCTCTCCCTAAATTCAAAGAGGGC | 578 | 0.5 | 95 °C, 45 s; 52 °C, 30 s; 72 °C, 30 s (35 cycles) | [22] |
| AGCTAGGGAAAAATCTGTCTATGCC | |||||
| cag-PAI (empty site) | ACATTTTGGCTAAATAAACGCTG | 550 | 0.5 | 95 °C, 1 min; 56 °C, 30 s; 72 °C, 45 s (35 cycles) | [25] |
| GGTTGCACGCATTTTCCCTTAATC |
Statistical analysis
The chi-square or Fisher’s exact tests were used to analyze gene differences between the two countries or associations between any gene and clinical presentation. A p value less than 0.05 was considered to be statistically significant.
Results
Prevalence of several gene clusters within the cag-PAI region of H. pylori
Using PCR amplification, H. pylori-specific 16SrRNA was successfully detected in all samples. The presence of 10 gene clusters in the cag-PAI region is shown in Fig. 1 and Table 2. The data show that the overall prevalence of cagA, cagE, cagT, cagM, cagG, cagL, cagH, virB11, orf10, and orf13 ranged between 66 and 79% and 86 and 99% in Thai and Korean gastroduodenal patients, respectively. Detection of these 10 gene clusters in strains from Korea was significantly higher than the strains from Thailand (p < 0.05). However, none of these genes was significantly associated with clinical outcomes in either Thai or Korean patients.
Fig. 1.
PCR amplification of selected gene clusters within the cag-PAI region and IS605. Lane M is the 100-bp plus DNA marker. Lanes 1–12 correspond to PCR amplicons of cagA (349 bp), cagE (508 bp), cagG (398 bp), cagH (1113 bp), cagL (263 bp), cagM (587 bp), cagT (301 bp), orf13 (617 bp), virB11 (491 bp), orf10 (658 bp), tnpA (338 bp), and tnpB (578 bp)
Table 2.
Prevalence of gene clusters within cag-PAI of H. pylori associated with Thai and Korean gastroduodenal patients
| Genes | H. pylori in Thai patients, n (%) | H. pylori in Korean patients, n (%) | p value | ||||||
|---|---|---|---|---|---|---|---|---|---|
| GT (n = 50) | PUD (n = 20) | GC (n = 10) | Total (n = 80) | GT (n = 30) | PUD (n = 30) | GC (n = 30) | Total (n = 90) | ||
| cagA | 38 (76%) | 17 (85%) | 8 (80%) | 63 (79%) | 30 (100%) | 29 (97%) | 27 (90%) | 86 (96%) | 0.001 |
| cagE | 37 (74%) | 15 (75%) | 8 (80%) | 60 (75%) | 25 (83%) | 22 (73%) | 30 (100%) | 77 (86%) | 0.0412 |
| cagT | 36 (72%) | 15 (75%) | 8 (80%) | 59 (74%) | 29 (97%) | 30 (100%) | 29 (97%) | 88 (98%) | < 0.0001 |
| cagM | 33 (66%) | 15 (75%) | 8 (80%) | 56 (70%) | 29 (97%) | 29 (97%) | 27 (90%) | 85 (94%) | < 0.0001 |
| cagG | 32 (64%) | 16 (80%) | 7 (70%) | 55 (69%) | 29 (97%) | 30 (100%) | 29 (97%) | 88 (98%) | < 0.0001 |
| cagL | 32 (64%) | 16 (80%) | 8 (80%) | 56 (70%) | 29 (97%) | 29 (97%) | 30 (100%) | 88 (98%) | < 0.0001 |
| cagH | 31 (62%) | 15 (75%) | 7 (70%) | 53 (66%) | 29 (97%) | 28 (93%) | 29 (97%) | 86 (96%) | < 0.0001 |
| virB11 | 36 (72%) | 16 (80%) | 8 (80%) | 60 (75%) | 29 (97%) | 30 (100%) | 30 (100%) | 89 (99%) | < 0.0001 |
| orf10 | 37 (74%) | 16 (80%) | 8 (80%) | 61 (76%) | 28 (93%) | 28 (93%) | 28 (93%) | 84 (93%) | < 0.0001 |
| orf13 | 37 (74%) | 16 (80%) | 8 (80%) | 61 (76%) | 28 (93%) | 28 (93%) | 28 (93%) | 84 (93%) | < 0.0001 |
| IS605* | 28 (56%) | 12 (60%) | 4 (40%) | 44 (55%) | 11 (37%) | 14 (47%) | 7 (23%) | 32 (36%) | 0.0135 |
GT, gastritis; PUD, peptic ulcer diseases; GC, gastric cancer
*IS605 refers to samples positive for tnpA or tnpB
p values less than 0.05 represent significant differences between Thai and Korean groups
The overall proportion of IS605 (tnpA or tnpB) was 55% and 36% in H. pylori strains isolated from Thai and Korean patients, respectively (Table 2). The presence of IS605 in Thai patients was significantly higher than that in Korean patients (p = 0.0135). Although our data show that detection of IS605 was higher in strains associated with gastritis and peptic ulcer groups as compared with Thai and Korean gastric cancer patients, there were no significant differences with three clinical outcomes.
In addition, as shown in Table 3, 72 of 90 (80%) H. pylori strains from Korean patients possessed an intact cag-PAI, which is significantly higher than strains from Thai patients (48%) (p < 0.0001). The rate of partially deleted cag-PAI (32%) or the complete absence of cag-PAI (20%) was significantly predominant among Thai patients (p < 0.05). Among Thai patients, an intact cag-PAI was found more frequently in gastric cancer patients as compared with gastritis or peptic ulcer patients, but differences were not statistically significant.
Table 3.
Prevalence of cag-PAI in H. pylori isolated from Thai and Korean gastroduodenal patients
| cag-PAI status | H. pylori in Thai patients, n (%) | H. pylori in Korean patients, n (%) | p value | ||||||
|---|---|---|---|---|---|---|---|---|---|
| GT (n = 50) | PUD (n = 20) | GC (n = 10) | Total (n = 80) | GT (n = 30) | PUD (n = 30) | GC (n = 30) | Total (n = 90) | ||
| Intact cag-PAI | 21 (42%) | 11 (55%) | 6 (60%) | 38 (48%) | 25 (83%) | 22 (73%) | 25 (83%) | 72 (80%) | < 0.0001 |
| Partially deleted cag-PAI | 17 (34%) | 6 (30%) | 3 (30%) | 26 (32%) | 5 (17%) | 8 (27%) | 5 (17%) | 18 (20%) | 0.0316 |
| Complete absence of cag-PAI | 12 (24%) | 3 (15%) | 1 (10%) | 16 (20%) | 0 (0%) | 0 (0%) | 0 (0%) | 0 (0%) | < 0.0001 |
GT, gastritis; PUD, peptic ulcer diseases; GC, gastric cancer
p values less than 0.05 represent significant differences between Thai and Korean groups
Analysis of H. pylori cagA genotypes and EPIYA motifs
Approximately 79% and 96% from Thai and Korean patients, respectively, were positive for cagA. We subsequently determined the genotypes of cagA by DNA sequencing (Table 4). Of H. pylori strains detected from Thai subjects, 55 of 63 (87%) harbored Western-type cagA, which was significantly higher than H. pylori strains isolated from Korean subjects (8%) (p < 0.0001). Conversely, H. pylori strains containing East Asian-type cagA were found at significantly higher levels in Korean subjects (92%) as compared to Thai subjects (13%) (p < 0.0001). However, the presence of Western-type or East Asian-type cagA did not correlate with any clinical manifestations in both Thai and Korean patient groups.
Table 4.
Analysis of cagA genotypes and EPIYA motif patterns of H. pylori strains detected from Thai and Korean gastroduodenal patients
| EPIYA motifs | No. of cagA positive in Thai patients, n (%) | No. of cagA positive in Korean patients, n (%) | p value | ||||||
|---|---|---|---|---|---|---|---|---|---|
| GT (n = 38) | PUD (n = 17) | GC (n = 8) | Total (n = 63) | GT (n = 30) | PUD (n = 29) | GC (n = 27) | Total (n = 86) | ||
| Western type | 33 (87%) | 15 (88%) | 7 (87%) | 55 (87%) | 4 (13%) | 2 (7%) | 1 (4%) | 7 (8%) | < 0.0001 |
| B-C | 11 (29%) | 5 (29%) | 1 (12%) | 17 (27%) | 1 (3%) | 0 (0%) | 0 (0%) | 1 (1%) | < 0.0001 |
| A-B-C | 21 (55%) | 9 (53%) | 6 (75%) | 36 (57%) | 2 (7%) | 2 (7%) | 1 (4%) | 5 (6%) | < 0.0001 |
| A-B-C-C | 1 (3%) | 1 (6%) | 0 (0%) | 2 (3%) | 1 (3%) | 0 (0%) | 0 (0%) | 1 (1%) | 0.5738 |
| East Asian type | 5 (13%) | 2 (12%) | 1 (12%) | 8 (13%) | 26 (87%) | 27 (93%) | 26 (96%) | 79 (92%) | < 0.0001 |
| B-D | 0 (0%) | 0 (0%) | 0 (0%) | 0 (0%) | 2 (7%) | 0 (0%) | 0 (0%) | 2 (2%) | 0.5086 |
| A-B-D | 5 (13%) | 2 (12%) | 1 (12%) | 8 (13%) | 24 (80%) | 26 (90%) | 25 (92%) | 75 (87%) | < 0.0001 |
| A-B-B-D | 0 (0%) | 0 (0%) | 0 (0%) | 0 (0%) | 0 (0%) | 1 (3%) | 1 (4%) | 2 (2%) | 0.5086 |
p values less than 0.05 represent significant differences between Thai and Korean groups
Diversity of H. pylori cagA EPIYA motif patterns distributed among Thai and Korean patients is shown in Table 4. In EPIYA motif patterns of Western-type cagA, ABC type was found predominantly in Thai patients (57%), followed by BC type (27%), but a low prevalence of ABC (6%) and BC (1%) was also detected in Korean patients. H. pylori strains containing multiple EPIYA motif patterns of Western-type cagA (ABCC) from both Thai (3%) and Korean (1%) subjects were also detected. Based on the EPIYA motif patterns of East Asian-type cagA, the ABD type was predominantly detected in H. pylori from Korean patients (87%), followed by BD (2%); however, a low frequency was detected in H. pylori from Thai patients (13% ABD). Two H. pylori strains (2%) from Korean subjects were found to contain multiple EPIYA motifs of East Asian-type cagA (ABBD), but this EPIYA motif pattern was not detected in Thai subjects. However, EPIYA motif patterns of Western or East Asian type did not correlate with any clinical outcomes in either Thai or Korean patient groups.
Based on EPIYA motif analysis, amino acid modifications of EPIYA sequences for all motifs (A, B, and C or D) were determined (Table 5). The overall prevalence of common EPIYA sequences was significantly higher in H. pylori strains isolated from Korean patients (90%) as compared with Thai patients (60%) (p < 0.0001). Only amino acid modifications associated with the EPIYA-B motif of Western-type or East Asian-type cagA were detected in H. pylori strains from both countries. The EPIYA-like sequences with amino acid modifications were found at significantly higher levels in H. pylori strains detected from Thai patients (40%) as compared with Korean patients (10%), such as EPIYT (35%) followed by ESIYA (5%). However, low-frequency EPIYA-like sequences, including EPIYT (8%), ESIYA (1%), and ELIYA (1%), were also found in H. pylori strains from Korean subjects. In particular, we observed that the Western-type cagA tended to be more variable, especially in the Thai population.
Table 5.
Frequency of common EPIYA and EPIYA-like sequences of cagA detected in H. pylori strains from Thai and Korean gastroduodenal patients
| EPIYA sequences | Thai patients (n = 63) | Korean patients (n = 86) | p value |
|---|---|---|---|
| Common EPIYA sequencesa | 38 (60%) | 77 (90%) | < 0.0001 |
| EPIYA-like sequencesb | 25 (40%) | 9 (10%) | < 0.0001 |
| EPIYTc | 22 (35%) | 7 (8%) | < 0.0001 |
| ESIYAd | 3 (5%) | 1 (1%) | 0.3111 |
| ELIYAe | 0 (0%) | 1 (1%) | 1.0000 |
aNumber of H. pylori strains carrying conserved common EPIYA sequences at all positions of A, B, and C/D motifs
bNumber of H. pylori strains carrying EPIYA-like sequences at position A, or B, or C/D motifs
cEPIYT was detected only at B-motif of Western-type cagA (20 samples) or East Asian-type cagA (2 samples) from Thai strains, and Western-type cagA (6 samples) or East Asian-type cagA (1 sample) from Korean strains
dESIYA was detected only at B-motif of East Asian-type cagA in strains from both Thai (3 samples) and Korean samples (1 sample)
eELIYA was detected only in one sample of East Asian-type cagA from a Korean strain
p values less than 0.05 represent significant differences between Thai and Korean groups
Discussion
It is well recognized that the cag-PAI region is the major virulence factor of H. pylori pathogenesis that is linked to duodenal ulcers and gastric cancer [8]. A previous study suggested that H. pylori strains that lack cag-PAI are probably classified as non-pathogenic forms of low pathogenicity [8]. In fact, almost all H. pylori strains detected in East Asian countries harbor cag-PAI but are found in approximately 50–70% of strains in Western countries. The cagA gene is located at the downstream end of the cag-PAI region and is suggested to be a crucial risk factor for PUD and gastric cancer [27]. In addition to cagA, it has been reported that other gene clusters within cag-PAI are also essential components that encode functions of the T4SS apparatus, which leads to oncoprotein CagA and/or peptidoglycan translocation into the host cells during H. pylori-gastric epithelial cell interactions [28]. H. pylori is believed to be one of the most genetically diverse bacteria, in which distinct H. pylori strains may be distributed between different ethnic groups or geographic regions. Herein, we attempted to determine the presence of several gene clusters (cagA, cagM, cagL, cagH, cagG, cagE, virB11, cagT, orf10, orf13) located within the cag I and cag II regions that are representative genes that encoded for the effector oncoprotein, T4SS core structure, T4SS pilus structure, and the ATPase energy producing enzyme [29]. As compared with Korean patients, a low proportion of these ten gene clusters in the cag-PAI region of H. pylori strains was detected in Thai patients. Regarding the presence of several gene clusters, the cag-PAI region exists in three possible forms, including intact, partially deleted cag-PAI, or completely absent cag-PAI [26]. H. pylori strains with partial deletions of several gene clusters within the cag-PAI region have been identified in different geographic regions globally [14, 30], but cag-PAI intactness is likely conserved among H. pylori strains distributed in East Asian countries, including Japan [31]. Our results concur with previous studies mentioned above that showed that almost all H. pylori strains from Korean patients possess cag-PAI genes that are more intact as compared with the those from Thai population, and none of the strains from Korean patients possessed an entire deletion of cag-PAI. It is interesting that partially deleted cag-PAI was mostly found in H. pylori strains isolated from Thai patients; in addition, approximately 20% of H. pylori strains from Thai patients were identified as having a complete absence of cag-PAI. cagA or cagE was proposed to be a precise marker of cag-PAI intactness in the population studied [21]. Conversely, it should be noted that none of the specific gene clusters within cag-PAI may be able to be used as an accurate marker for cag-PAI intactness of H. pylori strains of this study. Some genes within the cag-PAI region that encode the T4SS, such as cagE and cagL, are associated with cytokine production and related inflammation in gastric cells [32, 33]. Also, infection with the H. pylori ∆virB11 strain in an in vitro study significantly decreased IL-8 secretion in various gastric cell lines [34]. Together, partial deletion of one or more gene clusters within cag-PAI may possibly result in a defective T4SS structure, leading to the inability of delivering CagA into gastric cells, which suggests that the intact cag-PAI may facilitate with severity of inflammation and clinical outcome [35, 36].
In some H. pylori strains, cag-PAI may be separated into two regions caused by integration of the mobile element IS605 transposases, including tnpA and tnpB [8]. For the past decade, the presence of IS605 has been found a global distribution which vary from region to region [22, 37, 38]. Interestingly, frequencies of H. pylori strains that harbor IS605 in Thai patients was higher than the frequencies associated with Korean patients. Among Thai or Korean patients, the association of IS605 with gastritis or peptic ulcer diseases was found to be greater than that with gastric cancer; however, their distribution among these clinical outcomes was not significantly different. Our findings were in contrast to the previous study that showed that the high prevalence of IS605 was detected in gastric cancer patients as compared with other clinical manifestations [39]. The association between IS605 and cag-PAI variation is unknown. In our study, it is noteworthy that the status of partially deleted or intact cag-PAI could not be predicted by the presence of IS605 in either tnpA or tnpB (data not shown). Although the biological function of IS605 remains unclear, these two determinants have been suggested to mediate cag-PAI disruption and influence H. pylori virulence [8]. To clarify this issue, it is necessary to assess the exact roles of IS605 in genetic variation of cag-PAI or H. pylori pathogenesis.
CagA is the major virulence protein of H. pylori pathogenic strains that induces more inflammation-related carcinogenesis of gastric cells. The divergence of CagA genotypes is due to a five-amino acid repeat, the EPIYA motif (Glu-Pro-Ile-Tyr-Ala). The EPIYA motif is a conserved potential target of tyrosine phosphorylation by Src family kinases. There are four distinct EPIYA motifs observed by the amino acid sequences surrounding the EPIYA motif: EPIYA-A, -B, -C, and -D [40]. EPIYA-ABC or EPIYA-ABD has been designated as Western-type cagA or East Asian-type cagA, respectively. CagA specifically binds the Src homology 2-containing tyrosine phosphatase (SHP2) domain that induces phosphatase activity and subsequent morphological transformation of cells [41]. East Asian-type cagA is more virulent than Western-type cagA due to its stronger binding affinity for SHP2 and morphological transforming activities [41]. In agreement with Yuan et al., mucosal inflammation was significantly higher in patients infected with East Asian-type cagA strains in in vitro and in vivo studies, and East Asian-type cagA strains appear to be a major contributor to clinical severity and gastric carcinogenesis as compared with Western-type cagA [12]. Our findings are supported by a previous study that showed that H. pylori cagA sequences from a Korean population were associated with East Asian-type cagA (ABD) [42], while most of the cagA sequences from Thai patients were identified as Western-type cagA (ABC). Our results are similar to a previous data that found a significant association between cagA-type ABC and South Asian and Southeast Asian populations [10, 25, 43] and were also similar to the neighboring country of Myanmar [4]. We hypothesized that distinct cagA genotypes may depend on differences between ethnic groups or geographical regions. Although Western-type cagA was found at extremely high frequencies in the Thai population of this study, previous reports suggested that East Asian-type cagA was also found in the Thai population that is probably specific to the ethnic Thai-Chinese population [44, 45]. However, H. pylori strains harboring East Asian cagA in the Thai population were predicted to be less virulent due to recombination that caused a transition from East Asian to South Asian genotypes [45]. Of the Western-type cagA strains of Thai subjects, nearly 27% were BC-type cagA, but this genotype was very low in Korean subjects (1%). It was previously speculated that low levels of inflammation (IL-8 production) may associate to infect with H. pylori strains containing partially deleted EPIYA motifs, such as the BC-type cagA [46].
In addition to cagA genotypes, we analyzed amino acid substitutions of EPIYA motifs, termed EPIYA-like sequences. Only the EPIYA-B motif of Western or East Asian cagA contained modified amino acids among either Thai or Korean patients. In this study, EPIYA-like sequences were predominately detected in Thai patients, and EPIYT was mostly found in Western-type cagA strains. Our findings are supported by a previous study that showed that the EPIYA-B motifs of Western-type cagA contained a greater number of modified EPIYA sequences (such as EPIYT, ESIYA, ESIYT) and that EPITY is predominant as compared with East Asian-type cagA [47], which suggests that H. pylori strains containing Western-type cagA are highly variable. Notably, Zhang et al. demonstrated that the EPIYT sequences of B-motifs were significantly less associated with gastric cancer patients as compared with the common EPIYA sequences and were also associated with significant attenuation of IL-8 production and hummingbird phenotype in an in vitro study [47]. These data assumed that the amino acid substitution of EPIYA-B motifs (EPIYT) may be involved with different types of pathophysiology.
Thailand is located in southeastern Asia, which contains multi-ethnic populations due to the cultural cross-roads between East and South Asia [45]; this may be one hypothesis that contributes to genetic variation of H. pylori strains distributed in this area. High frequencies of the insertion element IS605, partial deletion or complete absence of cag-PAI and Western-type cagA, and instability of EPIYA motifs are more apparent in H. pylori strains isolated from Thai populations. Obviously, H. pylori strains harboring intact cag-PAI or East Asian-type cagA show favorable colonization of Korean patients, which possibly confirms the active pathogenic strains in the high-risk area of gastric cancer. However, our experiments did not find any correlation between cag-PAI variation and clinical presentations, which may have been due to limitations of this study regarding the small sample size, particularly with gastric cancer patients. Further studies are recommended to increase the sample size, and ethnic classification among Thai population is also recommended. The genetic variations of cag-PAI in H. pylori strains distributed in all Southeast and East Asian countries should be further studied for better understanding the impact of cag-PAI variations in H. pylori-associated gastric carcinogenesis. Taken together, H. pylori strains circulating in Thailand may tend to be of low virulence based on genetic variation within the cag-PAI region. The presence of distinct variations in cag-PAI between Thailand and Korea may be one possible reason for the striking differences between these two countries in terms of the incidence of gastric cancer.
Conclusions
This study provides information regarding the prominent genetic variation of the cag-PAI region of H. pylori strains among the Thai population, which may be partially explained by the linkage with the Asian paradox phenomenon of this area. However, other factors, including ethnicity, host genetics, and environment factors, are also responsible for H. pylori pathogenesis.
Acknowledgments
The authors thank the Unit of Endoscopy Medicine, Sunpasitthiprasong Hospital, for specimen collection. We also thank the Central Laboratory of Amnatcharoen Campus, Mahidol University, for supporting scientific facilities throughout this study.
Author contributions
The manuscript has been seen and approved by all the authors.
Funding information
This research was supported by Thailand Research Fund (MRG5980069) and Mahidol University (Talent Management).
Compliance with ethical standards
This research was approved by the Institutional Human Ethics Committee (MU-CIRB 2019/004.1501) of Mahidol University.
Conflict of interest
The authors declare that they have no conflict of interest.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Dunn BE, Cohen H, Blaser MJ. Helicobacter pylori. Clin Microbiol Rev. 1997;10(4):720–741. doi: 10.1128/CMR.10.4.720. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Fock KM, Ang TL. Epidemiology of Helicobacter pylori infection and gastric cancer in Asia. J Gastroenterol Hepatol. 2010;25(3):479–486. doi: 10.1111/j.1440-1746.2009.06188.x. [DOI] [PubMed] [Google Scholar]
- 3.Sahara S, Sugimoto M, Vilaichone RK, Mahachai V, Miyajima H, Furuta T, Yamaoka Y. Role of Helicobacter pylori cagA EPIYA motif and vacA genotypes for the development of gastrointestinal diseases in southeast Asian countries: a meta-analysis. BMC Infect Dis. 2012;12:223. doi: 10.1186/1471-2334-12-223. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Myint T, Miftahussurur M, Vilaichone RK, Ni N, Aye TT, Subsomwong P, Uchida T, Mahachai V, Yamaoka Y. Characterizing Helicobacter pylori cagA in Myanmar. Gut Liver. 2018;12(1):51–57. doi: 10.5009/gnl17053. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Zaidi SF. Helicobacter pylori associated Asian enigma: does diet deserve distinction? World J Gastrointest Oncol. 2016;8(4):341–350. doi: 10.4251/wjgo.v8.i4.341. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Chen SY, Zhang RG, Duan GC. Pathogenic mechanisms of the oncoprotein CagA in H. pylori-induced gastric cancer (review) Oncol Rep. 2016;36(6):3087–3094. doi: 10.3892/or.2016.5145. [DOI] [PubMed] [Google Scholar]
- 7.Costa AC, Figueiredo C, Touati E. Pathogenesis of Helicobacter pylori infection. Helicobacter. 2009;14(Suppl 1):15–20. doi: 10.1111/j.1523-5378.2009.00702.x. [DOI] [PubMed] [Google Scholar]
- 8.Censini S, Lange C, Xiang Z, Crabtree JE, Ghiara P, Borodovsky M, Rappuoli R, Covacci A. cag, a pathogenicity island of Helicobacter pylori, encodes type I-specific and disease-associated virulence factors. Proc Natl Acad Sci U S A. 1996;93(25):14648–14653. doi: 10.1073/pnas.93.25.14648. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Covacci A, Rappuoli R. Tyrosine-phosphorylated bacterial proteins: Trojan horses for the host cell. J Exp Med. 2000;191(4):587–592. doi: 10.1084/jem.191.4.587. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Yamaoka Y, Orito E, Mizokami M, Gutierrez O, Saitou N, Kodama T, Osato MS, Kim JG, Ramirez FC, Mahachai V, Graham DY. Helicobacter pylori in North and South America before Columbus. FEBS Lett. 2002;517(1–3):180–184. doi: 10.1016/s0014-5793(02)02617-0. [DOI] [PubMed] [Google Scholar]
- 11.Yamaoka Y, El-Zimaity HM, Gutierrez O, Figura N, Kim JG, Kodama T, Kashima K, Graham DY. Relationship between the cagA 3′ repeat region of Helicobacter pylori, gastric histology, and susceptibility to low pH. Gastroenterology. 1999;117(2):342–349. doi: 10.1053/gast.1999.0029900342. [DOI] [PubMed] [Google Scholar]
- 12.Yuan XY, Yan JJ, Yang YC, Wu CM, Hu Y, Geng JL. Helicobacter pylori with East Asian-type cagPAI genes is more virulent than strains with Western-type in some cagPAI genes. Braz J Microbiol. 2017;48(2):218–224. doi: 10.1016/j.bjm.2016.12.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Go MF, Kapur V, Graham DY, Musser JM. Population genetic analysis of Helicobacter pylori by multilocus enzyme electrophoresis: extensive allelic diversity and recombinational population structure. J Bacteriol. 1996;178(13):3934–3938. doi: 10.1128/JB.178.13.3934-3938.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Hsu PI, Hwang IR, Cittelly D, Lai KH, El-Zimaity HM, Gutierrez O, Kim JG, Osato MS, Graham DY, Yamaoka Y. Clinical presentation in relation to diversity within the Helicobacter pylori cag pathogenicity island. Am J Gastroenterol. 2002;97(9):2231–2238. doi: 10.1111/j.1572-0241.2002.05977.x. [DOI] [PubMed] [Google Scholar]
- 15.Chomvarin C, Namwat W, Chaicumpar K, Mairiang P, Sangchan A, Sripa B, Tor-Udom S, Vilaichone RK. Prevalence of Helicobacter pylori vacA, cagA, cagE, iceA and babA2 genotypes in Thai dyspeptic patients. Int J Infect Dis. 2008;12(1):30–36. doi: 10.1016/j.ijid.2007.03.012. [DOI] [PubMed] [Google Scholar]
- 16.Maeda S, Yoshida H, Ikenoue T, Ogura K, Kanai F, Kato N, Shiratori Y, Omata M. Structure of cag pathogenicity island in Japanese Helicobacter pylori isolates. Gut. 1999;44(3):336–341. doi: 10.1136/gut.44.3.336. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Jenks PJ, Megraud F, Labigne A. Clinical outcome after infection with Helicobacter pylori does not appear to be reliably predicted by the presence of any of the genes of the cag pathogenicity island. Gut. 1998;43(6):752–758. doi: 10.1136/gut.43.6.752. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Deguchi R, Igarashi M, Watanabe K, Takagi A. Analysis of the cag pathogenicity island and IS605 of Helicobacter pylori strains isolated from patients with gastric cancer in Japan. Aliment Pharmacol Ther. 2004;20(Suppl 1):13–16. doi: 10.1111/j.1365-2036.2004.01982.x. [DOI] [PubMed] [Google Scholar]
- 19.Yamaoka Y, Kodama T, Kashima K, Graham DY, Sepulveda AR. Variants of the 3′ region of the cagA gene in Helicobacter pylori isolates from patients with different H. pylori-associated diseases. J Clin Microbiol. 1998;36(8):2258–2263. doi: 10.1128/JCM.36.8.2258-2263.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Tomasini ML, Zanussi S, Sozzi M, Tedeschi R, Basaglia G, De Paoli P. Heterogeneity of cag genotypes in Helicobacter pylori isolates from human biopsy specimens. J Clin Microbiol. 2003;41(3):976–980. doi: 10.1128/jcm.41.3.976-980.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Ikenoue T, Maeda S, Ogura K, Akanuma M, Mitsuno Y, Imai Y, Yoshida H, Shiratori Y, Omata M. Determination of Helicobacter pylori virulence by simple gene analysis of the cag pathogenicity island. Clin Diagn Lab Immunol. 2001;8(1):181–186. doi: 10.1128/CDLI.8.1.181-186.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Lai CH, Perng CL, Lan KH, Lin HJ. Association of IS605 and cag-PAI of Helicobacter pylori isolated from patients with gastrointestinal diseases in Taiwan. Gastroenterol Res Pract. 2013;2013:356217–356215. doi: 10.1155/2013/356217. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Raei N, Latifi-Navid S, Zahri S. Helicobacter pylori cag pathogenicity island cagL and orf17 genotypes predict risk of peptic ulcerations but not gastric cancer in Iran. Asian Pac J Cancer Prev. 2015;16(15):6645–6650. doi: 10.7314/apjcp.2015.16.15.6645. [DOI] [PubMed] [Google Scholar]
- 24.Lima VP, Silva-Fernandes IJ, Alves MK, Rabenhorst SH. Prevalence of Helicobacter pylori genotypes (vacA, cagA, cagE and virB11) in gastric cancer in Brazilian’s patients: an association with histopathological parameters. Cancer Epidemiol. 2011;35(5):e32–e37. doi: 10.1016/j.canep.2011.02.017. [DOI] [PubMed] [Google Scholar]
- 25.Mukhopadhyay AK, Kersulyte D, Jeong JY, Datta S, Ito Y, Chowdhury A, Chowdhury S, Santra A, Bhattacharya SK, Azuma T, Nair GB, Berg DE. Distinctiveness of genotypes of Helicobacter pylori in Calcutta, India. J Bacteriol. 2000;182(11):3219–3227. doi: 10.1128/jb.182.11.3219-3227.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Yadegar A, Mohabati Mobarez A, Zali MR. Genetic diversity and amino acid sequence polymorphism in Helicobacter pylori CagL hypervariable motif and its association with virulence markers and gastroduodenal diseases. Cancer Med. 2019;8(4):1619–1632. doi: 10.1002/cam4.1941. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Zhang C, Xu S, Xu D. Risk assessment of gastric cancer caused by Helicobacter pylori using CagA sequence markers. PLoS One. 2012;7(5):e36844. doi: 10.1371/journal.pone.0036844. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Merino E, Flores-Encarnacion M, Aguilar-Gutierrez GR. Functional interaction and structural characteristics of unique components of Helicobacter pylori T4SS. FEBS J. 2017;284(21):3540–3549. doi: 10.1111/febs.14092. [DOI] [PubMed] [Google Scholar]
- 29.Tegtmeyer N, Wessler S, Backert S. Role of the cag-pathogenicity island encoded type IV secretion system in Helicobacter pylori pathogenesis. FEBS J. 2011;278(8):1190–1202. doi: 10.1111/j.1742-4658.2011.08035.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Podzorski RP, Podzorski DS, Wuerth A, Tolia V. Analysis of the vacA, cagA, cagE, iceA, and babA2 genes in Helicobacter pylori from sixty-one pediatric patients from the Midwestern United States. Diagn Microbiol Infect Dis. 2003;46(2):83–88. doi: 10.1016/s0732-8893(03)00034-8. [DOI] [PubMed] [Google Scholar]
- 31.Nomura A, Stemmermann GN, Chyou PH, Kato I, Perez-Perez GI, Blaser MJ. Helicobacter pylori infection and gastric carcinoma among Japanese Americans in Hawaii. N Engl J Med. 1991;325(16):1132–1136. doi: 10.1056/NEJM199110173251604. [DOI] [PubMed] [Google Scholar]
- 32.Day AS, Jones NL, Lynett JT, Jennings HA, Fallone CA, Beech R, Sherman PM. cagE is a virulence factor associated with Helicobacter pylori-induced duodenal ulceration in children. J Infect Dis. 2000;181(4):1370–1375. doi: 10.1086/315394. [DOI] [PubMed] [Google Scholar]
- 33.Tafreshi M, Guan J, Gorrell RJ, Chew N, Xin Y, Deswaerte V, Rohde M, Daly RJ, Peek RM, Jr, Jenkins BJ, Davies EM, Kwok T. Helicobacter pylori type IV secretion system and its adhesin subunit, CagL, mediate potent inflammatory responses in primary human endothelial cells. Front Cell Infect Microbiol. 2018;8:22. doi: 10.3389/fcimb.2018.00022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Bauer B, Moese S, Bartfeld S, Meyer TF, Selbach M. Analysis of cell type-specific responses mediated by the type IV secretion system of Helicobacter pylori. Infect Immun. 2005;73(8):4643–4652. doi: 10.1128/IAI.73.8.4643-4652.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Ahmadzadeh A, Ghalehnoei H, Farzi N, Yadegar A, Alebouyeh M, Aghdaei HA, Molaei M, Zali MR, Pour Hossein Gholi MA. Association of CagPAI integrity with severeness of Helicobacter pylori infection in patients with gastritis. Pathol Biol (Paris) 2015;63(6):252–257. doi: 10.1016/j.patbio.2015.09.004. [DOI] [PubMed] [Google Scholar]
- 36.Nguyen LT, Uchida T, Tsukamoto Y, Trinh TD, Ta L, Mai HB, Le HS, Ho DQ, Hoang HH, Matsuhisa T, Okimoto T, Kodama M, Murakami K, Fujioka T, Yamaoka Y, Moriyama M. Clinical relevance of cagPAI intactness in Helicobacter pylori isolates from Vietnam. Eur J Clin Microbiol Infect Dis. 2010;29(6):651–660. doi: 10.1007/s10096-010-0909-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Akopyants NS, Clifton SW, Kersulyte D, Crabtree JE, Youree BE, Reece CA, Bukanov NO, Drazek ES, Roe BA, Berg DE. Analyses of the cag pathogenicity island of Helicobacter pylori. Mol Microbiol. 1998;28(1):37–53. doi: 10.1046/j.1365-2958.1998.00770.x. [DOI] [PubMed] [Google Scholar]
- 38.Kersulyte D, Akopyants NS, Clifton SW, Roe BA, Berg DE. Novel sequence organization and insertion specificity of IS605 and IS606: chimaeric transposable elements of Helicobacter pylori. Gene. 1998;223(1–2):175–186. doi: 10.1016/s0378-1119(98)00164-4. [DOI] [PubMed] [Google Scholar]
- 39.Mattar R, Marques SB, Monteiro Mdo S, Dos Santos AF, Iriya K, Carrilho FJ. Helicobacter pylori cag pathogenicity island genes: clinical relevance for peptic ulcer disease development in Brazil. J Med Microbiol. 2007;56(Pt 1):9–14. doi: 10.1099/jmm.0.46824-0. [DOI] [PubMed] [Google Scholar]
- 40.Hatakeyama M. Helicobacter pylori CagA—a bacterial intruder conspiring gastric carcinogenesis. Int J Cancer. 2006;119(6):1217–1223. doi: 10.1002/ijc.21831. [DOI] [PubMed] [Google Scholar]
- 41.Higashi H, Tsutsumi R, Fujita A, Yamazaki S, Asaka M, Azuma T, Hatakeyama M. Biological activity of the Helicobacter pylori virulence factor CagA is determined by variation in the tyrosine phosphorylation sites. Proc Natl Acad Sci U S A. 2002;99(22):14428–14433. doi: 10.1073/pnas.222375399. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Seo JW, Park JY, Shin TS, Kim JG. The analysis of virulence factors and antibiotic resistance between Helicobacter pylori strains isolated from gastric antrum and body. BMC Gastroenterol. 2019;19(1):140. doi: 10.1186/s12876-019-1062-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Mohamed R, Hanafiah A, Rose IM, Manaf MR, Abdullah SA, Sagap I, van Belkum A, Yaacob JA. Helicobacter pylori cagA gene variants in Malaysians of different ethnicity. Eur J Clin Microbiol Infect Dis. 2009;28(7):865–869. doi: 10.1007/s10096-009-0712-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Chomvarin C, Phusri K, Sawadpanich K, Mairiang P, Namwat W, Wongkham C, Hahnvajanawong C. Prevalence of cagA EPIYA motifs in Helicobacter pylori among dyspeptic patients in Northeast Thailand. Southeast Asian J Trop Med Public Health. 2012;43(1):105–115. [PubMed] [Google Scholar]
- 45.Vilaichone RK, Mahachai V, Tumwasorn S, Wu JY, Graham DY, Yamaoka Y. Molecular epidemiology and outcome of Helicobacter pylori infection in Thailand: a cultural cross roads. Helicobacter. 2004;9(5):453–459. doi: 10.1111/j.1083-4389.2004.00260.x. [DOI] [PubMed] [Google Scholar]
- 46.Talarico S, Gold BD, Fero J, Thompson DT, Guarner J, Czinn S, Salama NR. Pediatric Helicobacter pylori isolates display distinct gene coding capacities and virulence gene marker profiles. J Clin Microbiol. 2009;47(6):1680–1688. doi: 10.1128/JCM.00273-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Zhang XS, Tegtmeyer N, Traube L, Jindal S, Perez-Perez G, Sticht H, Backert S, Blaser MJ. A specific A/T polymorphism in Western tyrosine phosphorylation B-motifs regulates Helicobacter pylori CagA epithelial cell interactions. PLoS Pathog. 2015;11(2):e1004621. doi: 10.1371/journal.ppat.1004621. [DOI] [PMC free article] [PubMed] [Google Scholar]