Summary
The oxygenated carotenoid zeaxanthin provides numerous benefits to human health due to its antioxidant properties. Especially it is linked to protecting, together with the xanthophyll lutein, the retina in the human eye by filtering harmful blue light thus delaying the progression of age‐related macular degeneration (AMD), the most prevalent cause of blindness in developed countries. Despite its high nutritional value, zeaxanthin is less available than other substantial carotenoids in our diet. To solve this shortage, we chose to develop a new food source that would contain a high concentration of natural zeaxanthin. Tomato (Solanum lycopersicum L.) was selected as the target plant since it is the second largest vegetable crop grown worldwide and its fruit characteristically synthesizes and accumulates a high concentration of carotenoids. We employed two genetic approaches in order to enhance zeaxanthin biosynthesis in tomato fruit: a transgenic metabolic engineering and classical genetic breeding. A nontransgenic tomato line, named ‘Xantomato’, was generated whose fruit accumulated zeaxanthin at a concentration of 39 μg/g fresh weight (or 577 μg/g dry weight), which comprised ca. 50% of total fruit carotenoids compared to zero in the wild type. This is the highest concentration of zeaxanthin reached in a primary crop. Xantomato can potentially increase zeaxanthin availability in the human diet and serve as raw material for industrial applications.
Keywords: zeaxanthin, carotenoid biosynthesis, metabolic engineering, antioxidants, AMD
Introduction
Carotenoid pigments play indispensable functions in all photosynthetic organisms as accessory pigments for light harvesting, in the photosynthetic reaction centres and in protecting the photosynthetic apparatus against oxygen radicals produced by excessive light energy. Carotenoids are synthesized in plants, algae, cyanobacteria and certain fungi and nonphotosynthetic bacteria, but not in animals. Nonetheless, carotenoids are essential components of the human diet. Firstly and most importantly, β‐carotene, α‐carotene and β‐cryptoxanthin serve as the main precursors for the biosynthesis of vitamin A (retinol) and its derivative all‐trans‐retinoic acid. Other health benefits of carotenoids are related to their properties as antioxidants. They are implicated in reducing cancer and cardiovascular diseases and enhancing the immune system and bone health (Eggersdorfer and Wyss, 2018; Rodriguez‐Concepcion et al., 2018). Furthermore, specific health benefits for brain development and cognitive functions have been linked to lutein (Giordano and Quadro, 2018; Johnson, 2014; Stringham et al., 2019).
The xanthophylls (oxygenated carotenoids) zeaxanthin, lutein and their metabolite meso‐zeaxanthin, accumulate in the macula lutea of the human retina (Arunkumar et al., 2020; Sauer et al., 2019). In recent years, it has been recognized that these xanthophylls protect the macula by filtering damaging blue‐light irradiation and through their antioxidant activity (Arunkumar et al., 2018; Johnson, 2014; Sauer et al., 2019). High dietary intake of lutein and zeaxanthin, and elevated levels of these xanthophylls in the serum are associated with lower risk of age‐related macular degeneration (AMD) (Sabour‐Pickett et al. (2012), which is the most prevalent cause of blindness in developed countries (Congdon et al., 2004; Flaxman et al., 2017). Dietary supplementation of lutein and zeaxanthin decreased the progression of AMD by ~10% (AREDS2 Research Group, 2013; Chew et al., 2013). Based on the AREDS2 nutritional recommendations, lutein and zeaxanthin are now the standard of care for reducing the probability of advanced AMD (Arunkumar et al., 2018; Gorusupudi et al., 2017; Sauer et al., 2019; Wu et al., 2015). Other health benefits of zeaxanthin include anti‐inflammatory effects (Johnson, 2014), reduced risk of atherosclerosis (Dwyer et al., 2001), head and neck cancer (Leoncini et al., 2016) and breast cancer (Wang et al., 2014). Despite these benefits, zeaxanthin availability in our diet is relatively poor. Except for scallions, green leafy vegetables, which are rich in lutein, contain zero or negligible amounts of zeaxanthin (Perry et al., 2009). Some fruits, such as peppers, oranges, papaya and mango, contain zeaxanthin within the range of 2–10 μg/g fresh weight (FW) (Dias et al., 2018; Holden et al., 1999; Perry et al., 2009; Sajilata et al., 2008). In specific varieties of paprika and orange peppers and Goji berries (Lycium fruit), zeaxanthin can reach 600–800 μg/g dry weight (ca. 45–70 μg/g FW) (Yossa Nzeuwaet al., 2019; Burri et al., 2016; Deli et al., 1996; García et al., 2007; Hornero‐Méndez et al., 2002; Maiani et al., 2009; Niro et al., 2017; Patsilinakos et al., 2018). However, these are high‐cost minor foods for most consumers. A common source of zeaxanthin in human nutrition is sweet corn with ca. 5 μg/g FW zeaxanthin in regular varieties although a higher concentration of up to 25 μg/g FW has been reported in kernels of bio‐fortified varieties (O'Hare et al., 2015; O'Hare et al., 2014). The concentration of zeaxanthin in the egg yolk, which is the major nonplant dietary source of xanthophylls, is 6–10 μg/g (Rasmussen et al., 2012). It is therefore desirable to develop a low‐cost and sustainable source of natural zeaxanthin in a widespread crop that can serve the fresh market as well as industrial production. Tomato (Solanum lycopersicum) is globally the second largest vegetable crop with a yearly worldwide production of over 180 million tonnes (FAO, http://www.fao.org/faostat/en/?#data/QC). Tomato fruit synthesizes carotenoids that accumulate in chromoplasts, organelles adapted to store high concentration of carotenoids. Fresh tomato fruit contains 60–160 μg/g FW of lycopene, which constitutes 80%–95% of the total carotenoid content. These attributes make tomato an excellent target crop of metabolic engineering to produce zeaxanthin.
Carotenoid biosynthesis in plants has been described at the molecular level (reviewed in (Hirschberg, 2001; Moise et al., 2014; Rosas‐Saavedra and Stange, 2016; Ruiz‐Sola and Rodriguez‐Concepcion, 2012; Yuan et al., 2015). This process takes place within plastids and catalysed by nuclear‐encoded enzymes (Figure 1a). Regulation of phytoene synthase (PSY) has been shown to determine the flux of the pathway, thus affecting the level of total carotenoids. Phytoene undergoes desaturation and geometrical isomerization to yield all‐trans‐lycopene. Cyclization of both ends of the linear molecule lycopene by lycopene β‐cyclase (LCYB) generates β,β‐carotene (β‐carotene), with two identical β‐ionone rings, whereas cyclization at one end by LCYB and the other end by ε‐cyclase (LCY‐E), yielding an ε‐ionone ring, produces α‐carotene (β,ε‐carotene). Beta‐carotene is converted to zeaxanthin following hydroxylation of both β‐rings. Three β‐ionone hydroxylase enzymes exist in tomato, the nonhaem iron BCH1 and BCH2, and the p450‐type hydroxylase CYP97A (Figure 1b). The enzyme zeaxanthin epoxidase (ZEP) converts zeaxanthin to violaxanthin that is metabolized to neoxanthin by a yet unidentified neoxanthin synthase (NSY).
Figure 1.
(a) The biosynthetic pathway of carotenoids, from geranylgeranyl diphosphate to β‐xanthophylls. (b) A detailed description of the conversion of lycopene to zeaxanthin in tomato. CycB, chromoplastic lycopene β‐cyclase; CrtR‐b (BCH), nonhaem β‐carotene hydroxylase; CRTISO, ζ‐carotene isomerase; CYP97B, cytochrome p450 β‐carotene hydroxylase; LcyB, chloroplastic lycopene β‐cyclase. NSY, neoxanthin synthase; NXD1, neoxanthin‐deficient 1; PDS, phytoene desaturase; PSY, phytoene synthase; ZDS, ζ‐carotene desaturase; ZEP, zeaxanthin epoxidase; cycB, (Bsh), a dominant allele of HIGH‐BETA; hp3, A null mutation in ZEP.
The fleshy fruit of tomato develops from ovary over a period of 6–8 weeks after anthesis. During this period, the fruit is green and its carotenoid composition is comparable to leaves, comprising of mainly photosynthesis‐associated xanthophylls. At the onset of ripening, also known as the ‘breaker’ stage, lycopene begins to accumulate due mainly to changes in gene expression. At this stage, transcription of genes for lycopene synthesis is up‐regulated while transcription of genes for both lycopene ε‐cyclase (LCY‐E) and lycopene β‐cyclase (LCYB), which metabolize lycopene, is down‐regulated (Bramley, 2002; Enfissi et al., 2017; Pecker et al., 1996; Ronen et al., 2000; Ronen et al., 1999). Expression of these genes is developmentally regulated but also affected by other factors, such as environment and hormones (Cruz et al., 2018; Giovannoni et al., 2017; Klee and Giovannoni, 2011; Li et al., 2019; Liu et al., 2015; Sun and Li, 2020).
Over the last two decades, metabolic engineering of carotenoid biosynthesis in crop plants has been employed in order to increase their nutritional and economic value (reviewed in (Giuliano, 2014; Giuliano, 2017; Watkins and Pogson, 2020; Zheng et al., 2020). Tomato fruit contains a high concentration of lycopene as the major carotenoid pigment that accumulates during ripening due to its enhanced synthesis, diminished metabolism to cyclic carotenes and sequestration in a crystalline form. These metabolic processes are predominantly regulated by differential gene expression. Several attempts to manipulate the expression of lycopene β‐cyclase and β‐carotene hydroxylase genes to facilitate xanthophyll accumulation in tomato fruit have been previously reported (D'Ambrosio et al., 2011; D'Ambrosio et al., 2011; Enfissi et al., 2019; Giorio et al., 2008; Giuliano, 2014; Giuliano et al., 2008; Huang et al., 2013; Nogueira et al., 2017). Concurrent overexpression of carotene beta‐hydroxylase 1 (BCH1, CrtR‐b1) and lycopene β‐cyclase (LCYB) did not result in any appreciable increase in the xanthophyll content of ripe fruits compared to the overexpression of only the LCYB transgene (Giorio et al., 2008). Overexpression of carotene beta‐hydroxylase 2 (BCH2, CrtR‐b2) in tomato fruit produced free violaxanthin and a significant amount of esterified xanthophylls in hemizygous transgenic plants at the immature green stage (D'Ambrosio et al., 2011). Yet, at the ripe stage, total xanthophyll content was only 8% of total carotenoids with small amounts of zeaxanthin (D'Ambrosio et al., 2011). However, another experiment succeeded to obtain ca. 13 μg/g FW of zeaxanthin plus β‐cryptoxanthin in tomato fruit by simultaneous transgenic expression of Arabidopsis LCYB and pepper BCH (b‐Chy) genes with the Pds promoter (Dharmapuri et al., 2002).
Here, we describe the development of tomato varieties whose fruit synthesize and accumulate zeaxanthin as their main carotenoid constituent. To this end, we have utilized existing mutations that affect carotenoid biosynthesis in a classic genetic breeding approach as well as a transgenic metabolic engineering of carotenoid biosynthesis in fruit.
Results
Genetic breeding of high‐zeaxanthin tomato
Tomato fruit mainly accumulates lycopene as a carotenoid end product due to the down‐regulation of expression of Lcy‐e and Lcy‐b (Hirschberg, 2001; Pecker et al., 1996; Ronen et al., 1999). The first step towards obtaining beta‐xanthophylls in tomato fruit is enhancing β‐carotene synthesis. It was previously established that a chromoplast‐specific lycopene β‐cyclase, CYCB, is responsible for β‐carotene synthesis in tomato fruit (Ronen et al., 2000). Several dominant alleles of HIGH‐BETA were isolated following the introgression of the CycB (B) gene from wild tomato species (Tomes et al., 1956). We have characterized an allele of HIGH‐BETA in the heirloom tomato line ‘Jaune Flamme’ of an unknown genetic background with an indeterminate growth habit and orange‐coloured fruit. The genomic DNA sequence of CycB from this line was found to be identical to the gene from the green‐fruited wild species Solanum habrochaites (LA0316) (Dalal et al., 2010) (The C.M. Rick Tomato Genetics Resource Center, TGRC, https://tgrc.ucdavis.edu/index.aspx), which was previously described (NCBI Accession KP233161 (Orchard, 2014). Therefore, we termed this allele BSh. Fruits of BSh accumulated β‐carotene up to 80% of total carotenoids (Table 1). To verify that accumulation of β‐carotene was linked to CycB, we crossed mutant BSh with the ‘wild‐type’ tomato variety M82. The high β‐carotene phenotype was co‐segregated with the BSh allele in F2 offspring at a ratio of 1:3. The intermediate concentration of β‐carotene in the fruit of F1 hybrid of BShxM82 compared with parental line BSh fits the semi‐dominance nature of the allele (Table 1). Expression of CycB in BSh during ripening, measured by qRT‐PCR, was 40‐fold higher than in the wild‐type variety M82, while expression of other genes in the carotenoid biosynthesis pathway, such as Pds, Zds and Psy1, did not significantly change (Figure 2).
Table 1.
Carotenoid concentration in ripe fruits (μg/g fresh weight, FW)
Line/ Genotype | Phytoene + Phytofluene | Lycopene | β‐Carotene | β‐Cryptoxanthin | Zeaxanthin | Lutein | Others | Total carotenoids | Per cent of β‐xanth |
---|---|---|---|---|---|---|---|---|---|
M82 | 8.8 ± 2.8 | 45.8 ± 7.3 | 1.0 ± 0.2 | 0.1 ± 0.1 | 0.4 ± 0.2 | 0.8 | 56.9 ± 10.1 | <1 | |
Bshs* | 0.9 ± 0.4 | 2.2 ± 0.7 | 22.4 ± 1.8 | 0.1 ± 0.1 | 0.4 ± 0.2 | 1.4 | 27.3 ± 2.0 | <1 | |
BShx M82 (F1) | 3.0 ± 0.8 | 16.7 ± 2.5 | 15.4 ± 2.0 | 0.1 | 0.7 ± 0.1 | 2.5 † | 38.3 ± 4.4 | <1 | |
hp3 | 6.3 ± 1.2 | 26.6 ± 6.7 | 3.5 ± 0.4 | 5.2 ± 0.3 | 2.7 ± 0.9 | 0.5 | 44.7 ± 7.6 | 11.6 | |
Green‐stripe (gs) | 7.6 ± 1.2 | 78.6 ± 13.8 | 11.8 ± 0.8 | 1 ± 0.1 | 99.1 ± 13.7 | ||||
Green‐flesh (gf) | 4.2 ± 1.4 | 25.6 ± 8.4 | 2.9 ± 0.7 | 2.1 ± 0.2 | 1.7 | 33.9 ± 9.3 | 0 | ||
hp3/BSh | 1.0 ± 0.3 | 1.6 ± 0.8 | 26.1 ± 3.5 | 0.3 ± 0.1 | 7.7 ± 0.6 | 1.1 ± 0.6 | 0.3 | 38.5 ± 4.4 | 20.8 |
hp2dg | 29.0 ± 2.4 | 105.1 ± 4.9 | 9.4 ± 0.3 | 148.1 ± 4.1 | |||||
hp3/gf | 8.5 ± 1.5 | 81.3 ± 7.2 | 7.9 ± 1.3 | 7.8 ± 0.5 | 3.1 ± 0.3 | 0.2 | 108.8 ± 8.3 | 7.2 | |
hp3/gs | 9.6 ± 0.4 | 34 ± 1.0 | 2.2 ± 0.3 | 4.2 ± 0.2 | 0.6 ± 0.1 | 50.6 ± 3.8 | 8.3 | ||
hp3/BSh/gf | 3.3 ± 0.8 | 1.8 ± 1.2 | 33.8 ± 6.0 | 0.5 ± 0.2 | 7.0 ± 1.4 | 0.7 ± 0.1 | 4.5 ‡ | 53.3 ± 7.6 | 14.1 |
hp3/BSh/gs | 24.3 ± 3.7 | 1.0 ± 0.1 | 16.3 ± 2 | 0.6 ± 0.3 | 42.6 ± 3.9 | 40.6 | |||
hp3/BSh/gs/hp2dg #1 (F2) | 1.0 ± 0.1 | 0.1 | 26.7 ± 0.3 | 0.6 | 34.8 ± 0.8 | 1.5 ± 0.2 | 0.5 | 65.5 ± 1.4 | 53.7 |
hp3/BSh/gs/hp2dg #2 (F2) | 2.2 ± 0.3 | 0.8 | 37.2 ± 2.2 | 1.1 ± 0.1 | 32.4 ± 2.4 | 0.9 ± 0.1 | 0.8 | 75.7 ± 4.2 | 44.4 |
hp3/BSh/gs/hp2dg #3 (F2) | 0.8 ± 0.1 | 21.4 ± 2.4 | 0.6 | 22.6 ± 0.8 | 0.6 ± 0.3 | 1.6 | 47.5 ± 3.8 | 48.8 | |
hp3/BSh/gs/hp2dg #4 (F2) | 1.8 ± 0.5 | 34.0 ± 2.2 | 0.8 | 25.4 ± 2.2 | 1.4 ± 0.5 | 1.2 | 64.5 ± 4.5 | 40.6 | |
hp3/BSh/gs/hp2dg #5 (F3) | 4.7 ± 0.6 | 34.7 ± 4.9 | 0.8 ± 0.2 | 37.8 ± 3.5 | 2.3 ± 0.6 | 80.4 ± 9.7 | 48.0 | ||
hp3/BSh/gs/hp2dg #6 (F3) | 3.9 ± 0.2 | 37.0 ± 1.9 | 1.0 ± 0.1 | 39.0 ± 0.7 | 1.7 ± 0.2 | 82.6 ± 2.6 | 48.4 | ||
hp3/BSh/gs/hp2dg #7 (F3) | 6.2 ± 2 | 43.4 ± 5.2 | 0.7 ± 0.1 | 33.5 ± 4.6 | 3.9 ± 1 | 87.8 ± 10.1 | 39.0 |
Jaune Flamme line of unknown genetic background.
γ‐carotene 2.2.
γ‐carotene 3.7.
Figure 2.
Expression of carotenoid biosynthesis genes in ripe fruits (breaker + 3 days) of wild type (M82) and BSh lines. Gene annotations as in Figure 1. Messenger RNA was quantified by determined by real‐time polymerase chain reaction (PCR) as described in Experimental Procedures.
Mutant BSh was crossed with high‐pigment 3 (hp3), a tomato mutant impaired in zeaxanthin epoxidase (ZEP) (Galpaz et al., 2008). Both leaves and fruit of hp3 contained significantly higher amounts of zeaxanthin (Tables 1 and 2). Accumulation of zeaxanthin in the fruit of the double‐mutant BSh/hp3 was approximately 50% higher than in the single mutant hp3 (Table 1). While the conversion of lycopene to β‐carotene was more efficient in BSh/hp3 plants, only a small fraction of β‐carotene was utilized for the synthesis of β‐xanthophylls.
Table 2.
Carotenoid composition in tomato leaves (μg/g FW)
Line | β‐Carotene | Zeaxanthin | Antheraxanthin | Violaxanthin | Neoxanthin | Lutein | Total carotenoids |
---|---|---|---|---|---|---|---|
M82 | 6.1 ± 0.4 | 0.8 ± 0.2 | 1.1 ± 0.1 | 22.7 ± 2.6 | 32.7 ± 2.3 | 82.1 ± 6.3 | 145.5 ± 11 |
CrtI | 5 ± 1.4 | 1.6 | 3.6 ± 0.4 | 24.2 ± 3.1 | 19.8 ± 1.0 | 38.9 ± 0.6 | 93.1 ± 3.9 |
hp3 | 2.4 ± 0.3 | 27.3 ± 3.6 | 4.1 ± 0.9 | 3.7 ± 0.9 | 51.7 ± 14.2 | 89.2 ± 13.8 | |
hp3/BSh/wf/CcBCH2#1 | 2.1 ± 0.9 | 26.5 ± 4.8 | 12.1 ± 3 | 2.7 ± 0.9 | 16.7 ± 2.8 | 22 ± 2.3 | 82.2 ± 13.3 |
To increase xanthophyll synthesis, we crossed the double‐mutant BSh/hp3 with two different recessive mutants: the green fruit mutant STAY‐GREEN, which is impaired in the SlSGR1 protein (Luo et al., 2013) and GREEN‐STRIPE (gs). The rationale behind these crossings was inspired by observations suggesting that fruits of various green‐flesh varieties contain a higher concentration of total carotenoids, including xanthophylls incorporated in the photosynthetic apparatus (Luo et al., 2013). The concentration of zeaxanthin in fruits of the triple mutant BSh/hp3/gs more than doubled compared the double‐mutant BSh/hp3, to a significant level of 16 µg/g FW (Table 1, Figure S1).
The triple mutant BSh/hp3/gs line was crossed with the high‐pigment mutant hp2dg (Levin et al., 2006) to generate a quadruple homozygous mutant BSh/hp3/gs/hp2dg, which was confirmed by genotyping of F2 plants. The recessive mutation hp2 in the DE‐ETIOLATED 1 (DET1) gene (Mustilli et al., 1999) was found to increase the plastid compartment size in leaf and fruit cells thus elevating chlorophyll levels in immature fruit and total carotenoids in ripe fruit (Azari et al., 2010). The carotenoid composition of four lines from this F2 population exhibited a high level of zeaxanthin accumulation up to 34.8 µg/g FW (Table 1, Figure S1) and their typical appearance is presented in Figure 3 and Figure S2. Zeaxanthin concentration in F3 offspring of self‐pollinated line hp3/BSh/gs/hp2dg #1 reached 39.0 µg/g FW, which equal to 557 µg/g in dry weight (DW) (Table 1). This line, which also contained 37 µg/g FW (529 µg/g DW) β‐carotene, was named ‘Xantomato’.
Figure 3.
(a) Typical appearance of zeaxanthin‐containing fruit of the genotype BSh/hp3/gs/hp2dg (Xantomato); (b) fruit of the variety M82 (b); (c) carotenoid composition in Xantomato and WT fruit (μg/g FW).
The ultrastructure of chromoplasts in the ripe fruit of HIGH‐BETA (BSh) and the zeaxanthin‐accumulating quadruple mutant BSh/hp3/gs/hp2dg was examined using transmission electron microscopy (TEM) (Figure 4). Lycopene present in the chromoplasts of tomato fruit is sequestered in the form of crystalline structures (Harris and Spurr, 1969a; Rosso, 1968), but other carotenoids can be stored in different types of formations (Harris and Spurr, 1969b; Mohr, 1979; Nogueira et al., 2013). The plastids in M82 fruit, which mainly accumulated lycopene and phytoene, contained typical crystals and remnant lamella membranes with crystalline structures and a few large plastoglobuli (Figure 4a). Beta‐carotene‐accumulating plastids in BSh fruit contained many plastoglobuli accompanied by a small number of rod‐shaped crystalline membranes (Figure 4b,c). The chromoplasts of the quadruple mutant BSh/hp3/gs/hp2dg, which contained approximately equal amounts of β‐carotene and zeaxanthin, encompassed fewer plastoglobuli than in Bsh. In addition, these chromoplasts contained many rod‐shaped membranous structures (Figure 4d–f). Since this phenomenon correlates with the accumulation of xanthophylls, it is likely that β‐carotene is mainly stored in plastoglobuli while zeaxanthin is sequestered in the rod‐shaped membranous structures.
Figure 4.
Electron micrographs of chromoplasts in pericarp cells of ripe fruits. (a) M82, ‘wild type’ with mainly lycopene (80%–85% of total carotenoids); (b, c) BSh, with 80%–85% β‐carotene; (d–f) BSh/hp3/gs/hp2dg, with 40% β‐carotene and 53% zeaxanthin. c—lycopene crystals; cm—crystalline membranes; cw—cell wall; g—globules; im—rod‐shaped internal membranes; im1—developing rod‐shaped internal membranes; pe—plastid envelope; bars indicate actual size.
Transgenic breeding of high‐zeaxanthin tomato
An alternative approach to enhancing the hydroxylation of β‐carotene in tomato fruit is utilizing transgenic expression of β‐carotene hydroxylase (BCH). Considering the high levels of β‐xanthophylls that accumulate in Citrus, we chose the BCH2 gene from Citrus clementina. Fruits of this species also accumulate a significant amount of β‐cryptoxanthin (Dhuique‐Mayer et al., 2005). Full‐length cDNA of BCH2 from Citrus clementina without the first 89 codons that encode the predicted transit peptide, in the plasmid vector pBCH2 was expressed in β‐carotene‐producing cells of E. coli that carried plasmid pBETA (Cunningham and Gantt, 2007). Carotenoid analysis confirmed that the C. clementina BCH2 (CcBCH2) exhibited β‐carotene hydroxylation activity in E. coli (Figure 5). The level of zeaxanthin in E. coli was lower than that of β‐cryptoxanthin, indicating that β‐carotene di‐hydroxylation by CcBCH2 in E. coli cells is less efficient than the mono‐hydroxylation (Figure 5).
Figure 5.
Carotenoid composition in E. coli cells expressing BCH2 from C. clementina. Total carotenoids from E. coli cells carrying the plasmid pBETA only contain β‐carotene. Cells containing both pBETA and CcBCH2 accumulate β‐cryptoxanthin and zeaxanthin.
Next, the C. clementina BCH2 full‐length cDNA behind the constitutive CaMV 35S promoter was introduced into the hp3/BSh double‐mutant tomato plant using Agrobacterium‐mediated transformation. Seven independent transgenic plants of hp3/BSh/35S:CcBCH2 were obtained. A number of the transgenic plants exhibited slightly yellow fruit at the mature‐green stage due to an accumulation of zeaxanthin already present at that stage (Table 3). Carotenoid composition in the ripe fruit of T1 plants revealed a wide range of xanthophyll accumulation in different transgenic lines (Table 3). Zeaxanthin made up the majority of β‐xanthophylls accumulated with only a small amount of β‐cryptoxanthin present. The transgenic line that accumulated the highest level of xanthophylls, hp3/BSh‐CcBCH2#1 (Table 3 and Figure S3), was selected for further breeding in this project.
Table 3.
Carotenoid concentration (μg/g FW) in ripe fruit of transgenic tomato plants
Line | Phytoene + Phytofluene | Lycopene | β‐Carotene | β‐Cryptoxanthin | Zeaxanthin | Lutein | Others | Total carotenoids | Per cent of β‐xanth. |
---|---|---|---|---|---|---|---|---|---|
hp3/BSh | 1.0 ± 0.3 | 1.6 ± 0.8 | 26.1 ± 3.5 | 0.3 ± 0.1 | 7.7 ± 0.6 | 1.1 ± 0.6 | 0.3 | 38.5 ± 4.4 | 26.0 |
hp3/BSh/CcBCH2#1 | 0.1 ± 0.1 | 0.1 ± 0.1 | 2.0 ± 0.4 | 0.5 ± 0.1 | 10.6 ± 1.1 | 0.5 ± 0.1 | 14.1 ± 1.6 | 78.7 | |
hp3/BSh/CcBCH2#3 | 3.5 ± 0.8 | 3.2 ± 0.6 | 24.7 ± 3.2 | 2.0 ± 0.3 | 0.3 ± 0.1 | 0.9 | 36.1 ± 3.8 | 0.1 | |
hp3/BSh/CcBCH2#4 | 5.0 ± 2.5 | 3.6 | 48.9 ± 6.2 | 2.2 | 2.1 | 1.6* | 57.3 | <0.1 | |
hp3/BSh/CcBCH2#5 | 0.41 ± 0.1 | 0.2 | 3.6 ± 0.6 | 4.2 ± 0.8 | 90.4 | ||||
hp3/BSh/CcBCH2#6 | 7.8 ± 0.8 | 0.5 ± 0.1 | 6.2 ± 0.9 | 0.1 ± 0.1 | 14.6 ± 1.6 | 45.9 | |||
hp3/BSh/CcBCH2#7 | 2.1 ± 0.8 | 0.3 ± 0.1 | 4.2 ± 1.0 | 7.5 ± 1.6 | 60.0 | ||||
hp3/BSh/CcBCH2#9 | 26.1 ± 9.1 | 3.1 ± 0.4 | 0.7 ± 0.2 | 0.9 | 32.1 ± 12 | 0.1 | |||
hp3/BSh/CcBCH2#1/CrtI | 26.4 ± 7.2 | 0.6 ± 0.1 | 16.3 ± 1.5 | 1.9 ± 0.4 | 2.2 | 47.4 ± 8.5 | 35.7 | ||
wf † | 35 ± 5.2 | 1.7 ± 1.5 | 0.7 ± 0.1 | 42.2 | 0 | ||||
hp3/wf | 14.0 ± 1.1 | 29 ± 5.2 | 2.2 ± 0.1 | 2.1 ± 0.1 | 53.8 ± 3.8 | <0.1 | |||
hp3/BSh/wf | 3 ± 0.3 | 49.2 ± 4.8 | 0.4 ± 0.4 | 13.6 ± 0.2 | 1.3 ± 0.1 | 67.5 ± 4.9 | 20.7 | ||
hp3/BSh/wf/CcBCH2#1 | 2.6 ± 0.3 | 1.2 ± 0.3 | 22.6 ± 3.9 | 1.5 ± 0.3 | 28.9 ± 4.2 | 82.4 |
From Galpaz et al. (2006).
Mainly γ‐carotene.
To eliminate possible adverse effects due to the co‐suppression of expression by the endogenous β‐carotene hydroxylase, the transgenic line hp3/BSh/CcBCH2#1 was crossed with the mutant white‐flower (wf), which is impaired in the chromoplast‐specific β‐carotene hydroxylase, BCH2 (CrtR‐b2) (Galpaz et al., 2006). The fruits of the homozygous triple mutant hp3/BSh/wf contained a significantly higher concentration of zeaxanthin than those of hp3/BSh (Tables 1 and 3).
The triple mutant hp3/BSh/CcBHC2#1 was crossed with a transgenic tomato line overexpressing the bacterial phytoene desaturase gene, crtI, under the control of the constitutive CaMV 35S promoter (Romer et al., 2000). The concentrations of the xanthophylls in hp3/BSh/C.hx‐1/CrtI fruit increased compared with hp3/BSh/CcBCH2#3, with a significant increase in the β‐carotene levels (Tables 3 and 4; Figure S3). This result points out the possibility that pushing the flux of the carotenoid biosynthetic pathway forward with overexpression of upstream enzymes could contribute to further elevation of zeaxanthin accumulation.
Table 4.
Carotenoid composition in pericarp tissue of mature‐green fruit (μg/g FW)
Line | β‐Cryptoxanthin | Zeaxanthin | Violaxanthin | Neoxanthin | Lutein | Total carotenoids |
---|---|---|---|---|---|---|
M82 | 0.6 ± 0.1 | 0.4 ± 0.1 | 1.3 ± 0.2 | 2.2 ± 0.4 | ||
hp3/BSh/CcBCH2#1 | 7.5 | 1.2 ± 0.1 | 8.7 ± 0.1 | |||
hp3/BSh/CcBCH2#1/CrtI | 0.2 | 14.5 ± 0.5 | 2.2 ± 0.2 | 16.8 ± 0.7 |
Discussion
Metabolic engineering of zeaxanthin has been previously achieved in several plants. In potato (Solanum tuberosum L.), concentration of zeaxanthin in tubers was tripled to 0.99 μg/g DW (3–5 μg/g FW) by silencing of LCY‐E (Diretto et al., 2007) and to 40 μg/g dry weight (ca. 10 μg/g FW) by silencing of zeaxanthin epoxidase (ZEP) (Romer et al., 2002). Transgenic expression in a white corn variety of Psy1 from corn, crtI from the bacteria Pantoea ananatis and Lcy‐b and Bch from Gentiana lutea increased dramatically zeaxanthin levels in seeds to 34.5 μg/g dry weight (Zhu et al., 2008). In a yellow endosperm corn variety, transgenic expression of Psy1, crtI and Lcy‐b quadrupled zeaxanthin in seeds to 56.5 μg/g dry weight (Naqvi et al., 2011). In tomato, accumulation of ca. 13 μg/g FW of zeaxanthin plus β‐cryptoxanthin in fruit was achieved by the transgenic expression of LCYB and BCH (Dharmapuri et al., 2002). In this study, we have demonstrated that carotenoid biosynthesis in tomato fruit can be successfully manipulated nontransgenically to achieve zeaxanthin accumulation at a concentration of 39 μg/g FW (equal to 650 μg/g dry weight), which comprises ca. 50% of total fruit carotenoids. To the best of our knowledge, this is the highest level of zeaxanthin reached in a major crop such as tomato.
We ascribe the high‐zeaxanthin accumulation in Xantomato to the unique combination of three primary mutations: HIGH‐BETA (Bsh), high‐pigment 3 (hp3) and green‐stripe (gs) that transform an existing biosynthesis pathway dedicated to carotenoid accumulation in fruit. Fruit of the tomato mutant HIGH‐BETA accumulates β‐carotene due to high expression of the fruit‐specific lycopene β‐cyclase (CycB) (Ronen et al., 2000). All known HIGH‐BETA (B) alleles were originated through genetic introgression from various green‐fruited wild tomato species (Lincoln and Porter, 1950; Ronen et al., 2000; Stommel, 2001; Stommel and Haynes, 1994; Tomes et al., 1958; Tomes et al., 1954). We have used the allele BSh, which was originated from S. habrochaites, because it displays the strongest phenotype among known HIGH‐BETA mutations as evident by the fact that β‐carotene in its fruits represents> 80% of total carotenoids (Table 1). This reflects a highly efficient lycopene cyclization activity by CYCB encoded by BSh. The conversion of β‐carotene to downstream xanthophylls in tomato fruit was found to be more complicated to attain. Based on earlier studies, it has been suggested that the β‐carotene accumulated naturally in HIGH‐BETA fruit is not as accessible to hydroxylation by transgenic β‐hydroxylases as β‐carotene produced by a transgenic LCYB cyclase, possibly due to metabolic channelling between LCY‐b and BCY hydroxylase (Giuliano et al., 2008).
It is apparent from our data that the total carotenoid concentration in BSh fruit is lower than in wild‐type tomato. The steady‐state concentration of carotenoids in fruit is controlled by the flux of the biosynthetic pathway, through sequestration mechanisms that determine the storage capacity of the plastids, and by degradation processes that are catalysed by carotenoid cleavage dioxygenases (CCD) or by nonspecific cleavage facilitated by the lipoxygenase TomLoxC (Gao et al., 2019). Loss of function of the enzyme zeaxanthin epoxidase (ZEP) in the mutant hp3, or silencing of the ZEP gene, causes a modest build‐up of zeaxanthin in fruit (Galpaz et al., 2008; Romer et al., 2002; Wolters et al., 2010; Table 2). This result demonstrates that β‐carotene hydroxylation does take place to some extent in tomato fruit. Since zeaxanthin does not accumulate in either normal or HIGH‐BETA fruit, we deduce that it is metabolized to violaxanthin, which is the precursor for abscisic acid (ABA) synthesis. In addition, it is probable that fruit chromoplasts do not possess a mechanism to store free zeaxanthin, and thus, it can be constantly degraded by the CCD enzymes. Both processes cited above may explain the reduced quantity of total carotenoids in BSh fruit.
While plants with a combination of BSh and hp3 mutations yielded fruit with 7.7 μg/g fresh weight of zeaxanthin, the addition of the green‐stripe (gs) genotype, more than doubled this concentration, and the ratio of zeaxanthin plus β‐cryptoxanthin to total β‐cyclized carotenoids increased from 27% to 41% (Table 1). The molecular nature of gs is yet unknown and, therefore, an explanation of its contribution to overall zeaxanthin accumulation is difficult. However, it appears that hydroxylation of β‐carotene in fruits is catalysed by the chloroplastidial enzymes BCH1 and/or CYP97A since the inactivation of the chromoplast‐specific nonhaem diiron enzyme BCH2 in the mutant white‐flower (Galpaz et al., 2006) did not eliminate the biosynthesis of zeaxanthin (Table 3). Therefore, we suggest that gs elevates either the expression or activity of these enzymes. Furthermore, there remains a possibility that the gs mutation may somehow alter the mechanism in which zeaxanthin is degraded after the transition from chloroplast to chromoplast. By contrast, the allele Green‐flesh (gf), which elevated zeaxanthin level in hp3 by 50%, did not show any effect in the hp3/BSh double mutant (Table 1). This difference from gs can be explained by the different molecular basis of the green phenotype appearance of the fruit, which excludes the expression CYCB in the same cells where endogenous chloroplast‐type hydroxylases are active. The differences in fruit carotenoids among F2 plants of the genotype hp3/BSh/gs/hp2dg (Table 1) reflect the genetic variability resulting from mixing four distinct tomato germplasms. It is expected that other alleles also affect zeaxanthin accumulation in the chromoplasts. Independent assortment of alleles in F2 plants has enabled the selection of quantitative trait loci (QTLs) for high zeaxanthin in F3 and can be further exploited in future genetic breeding.
The final increase of zeaxanthin accumulation was provided by the mutation high‐pigment 2 (hp2), which impairs the tomato DET1 homolog that functions in photomorphogenesis (Mustilli et al., 1999) and enhances fruit metabolites (Liu et al., 2004). Fruit of allele hp2dg of this mutation was found to be more active metabolically (Bino et al., 2005; Kolotilin et al., 2007; Levin et al., 2006; Liu et al., 2004). The combination of the alleles hp3, BSh, gs and hp2dg, not only elevated the level of zeaxanthin but also raised its ratio to 49% of total fruit carotenoid content.
Xanthophylls found in the chromoplast of flowers are usually sequestered in the form of xanthophyll esters (Ariizumi et al., 2014; Yamamizo et al., 2010). This phenomenon was demonstrated also within fruit chromoplasts of transgenic tomatoes that accumulated ketocarotenoids that were mainly sequestered in esterified forms within plastoglobuli (Enfissi et al., 2019). The entirety of the zeaxanthin that accumulated in the fruits examined over the course of our study was observed in its free form, that is nonesterified. Its sequestration in fruit is correlated with the appearance of rod‐shaped membrane structures observed in chromoplasts of the quadruple homozygous mutants but not in other mutants, including in the β‐carotene accumulating BSh (Figure 4). In bell pepper chromoplasts, xanthophylls, including zeaxanthin, accumulate in specific lipoprotein fibrils that also contain galactolipids, phospholipids and fibrillin protein (Deruere et al., 1994). The uncharacteristic rod‐shaped internal membranes seen in zeaxanthin‐containing chromoplasts can potentially sequester zeaxanthin. In bilayer membranes, free trans‐zeaxanthin adopts a transmembrane orientation with a tilt angle of ~ 40 degrees relative to the membrane plane with the polar hydroxyl groups located at the opposite polar zones of the lipid bilayer (Grudzinski et al., 2017). It is possible that this form of sequestration limits the storage capacity of zeaxanthin in tomato chromoplast and free zeaxanthin molecules that are not associated with membranes are more susceptible to enzymatic degradation. Moreover, the two forms of carotenoid sequestration in chromoplasts, where β‐carotene is in plastoglobuli and zeaxanthin is in rod‐shaped membranes (Figure 4), can explain the limitation of converting all of the β‐carotene to zeaxanthin in the fruit of both hp3/BSh/gs and hp3/BSh/CcBCH2. Once β‐carotene is captured within plastoglobuli, it is less accessible to enzymatic hydroxylation. In BSh fruit, part of the β‐carotene produced by the efficient cyclization activity of CYCB is sequestered in plastoglobuli, which are inaccessible to hydroxylases. This may also explain previous observations that β‐carotene in HIGH‐BETA fruit is not hydroxylated by a transgenic BCH (Giuliano et al., 2008). According to this hypothesis, hydroxylation of β‐carotene in the genotypes hp3/BSh/gs and hp3/BSh/CcBCH2 is enabled when channelling of carotenoid intermediates exist inside a presumed enzymatic complex. In this case, the tomato endogenous BCH2 may be more efficient than the transgenic CcBCH2.
Transgenic expression of BCH2 from C. clementina in the genetic background of hp3/BSh raised zeaxanthin accumulation, but significantly decreased the level of β‐carotene, as well as total carotenoids content. This phenotype could be attributed to either degradation of zeaxanthin that is similar to an observation reported in Arabidopsis callus cells (Schaub et al., 2018), or to co‐suppression of the endogenous tomato β‐carotene hydroxylase by the transgenic C. clementina BCH2. The mutation in the white‐flower mutant that was used in this experiment is located within the intron–exon junction of exon #2 in the tomato BCH2, which results in exon skipping during RNA processing (Galpaz et al., 2006). The mechanism by which this mutation increases the zeaxanthin level in the mutant line hp3/BSh/wf/CcBCH2#1 (Table 3) is unknown. However, it can be explained by eliminating the co‐suppression of both the endogenous BCH and transgenic C. clementina BCH2 genes by the transgenic overexpression of CcBCH2. Although transgenic expression of citrus BCH2 in the triple mutant, line hp3/BSh/wf/CcBCH2#1, increased the amount of β‐xanthophylls nearly twofold by utilizing most of the β‐carotene, the total carotenoid concentration decreased by 59% (Table 3). Furthermore, the overall xanthophyll concentration in this mutant was higher than in the corresponding parent, hp3, by approximately fivefold, but was not accompanied by an accumulation of β‐carotene. This is probably the reason for the observed reduction in total fruit carotenoid content (Table 3).
A comparison between the transgenic to nontransgenic approaches in order to obtain a high‐zeaxanthin tomato shows that the latter was more successful. This consequence suggests that besides metabolic engineering by manipulation of a particular gene, accumulation of zeaxanthin is influenced by factors other than the expression of a specific carotenoid biosynthesis gene, such as plastid differentiation, as well as, chromoplast and plastid ultrastructure (Lado et al., 2015). The nontransgenic high‐zeaxanthin line, which we named Xantomato, has a commercial advantage over the transgenic lines in the present market situation. However, both high‐pigment mutations that were used in this study to increase zeaxanthin accumulation, hp3 and hp2dg, have negative pleiotropic effects on plant development and tolerance to stresses and thus have deleterious effects on yield. The rate of the effect has been difficult to measure in plants with indeterminate growth. However, the economic advantages of tomato fruit, which contains 577 μg/g DW zeaxanthin and 529 μg/g DW of β‐carotene achieved here, may overcome this adverse horticultural effect.
Experimental procedures
Plant material and growth conditions
Tomato (Solanum lycopersicum) cultivar M82 served as a reference ‘wild‐type’. The tomato mutant HIGH‐BETA (allele BSh) plant was isolated by visual screening for orange fruit in a population of widespread heirloom tomato lines and was identified as a Jaune Flamme line of an unknown genetic background with a phenotype of indeterminate growth and orange‐coloured fruit. The mutants high‐pigment 3 (hp3‐1) (e1472) and white‐flower 1 (wf1‐2) (e1827) were previously described (Galpaz et al., 2006; Galpaz et al., 2008). The mutant green‐stripe (gs) was originated from line LA0212 (Tomato Genetics Resource Center, Davis; https://tgrc.ucdavis.edu/Monogenic%20stock%20list‐2014.pdf) and was found in an heirloom tomato line of unknown background. Mutants green‐flesh (gf) ‘Nyagous’ cultivar and high‐pigment 2 (hp2dg) were obtained from the collection of Prof. Zamir (The Hebrew University of Jerusalem, Israel).
Plants were grown in the greenhouse for crossings as described (Neuman et al., 2014). Phenotypic characterization was verified over four growing seasons in plants grown in greenhouses and open fields. The transgenic 35S:CRTI in the tomato line Ailsa Craig (Romer et al., 2000) were kindly provided by Prof. Paul D. Fraser (Royal Holloway, University of London).
Pigment extraction and analysis
Fresh samples of fruit and leaves were collected from three biological replicates. Leaf pigments were extracted from 500 mg of young leaves, incubated with acetone overnight in Eppendorf tubes. The tissue was ground and, following centrifugation, the acetone phase was dried under a stream of N2. Fruit pigments were extracted from 150 to 250 mg of fresh pericarp tissue of fruit at the 'mature‐green' or 'ripe' stages. Pericarp tissue of Xantomato fruit at the ripe stage contains 93.1 ± 0.5% water. The tissue was ground in 1 mL of 1:1 water chloroform mixture. The chloroform phase was separated by centrifugation and dried under a stream of N2. The dried carotenoid extracts were dissolved in 500 μL acetone. Carotenoids were separated by high‐performance liquid chromatography (HPLC) using a Waters system consisting of a Waters 600 pump, Waters 996 photodiode array detector and Waters 717 plus auto sampler (Waters, Milford, MA). The static phase consisted of Spherisorb® ODS2 C18 reversed‐phase column from Phenomenex (silica 5 μm, 3.2 mm 250 mm) (Phenomenex®, Torrance, CA) and the mobile phase consisted of a solvent gradient as described in Table S1 at a constant flow of 1.6 mL/min (Table S1). The spectrum between 200 and 700 nm was recorded at a rate of one full spectrum per second. The carotenoids were identified according to their typical retention time certified by standards and characteristic absorption spectra.
DNA extraction and genotyping using DNA markers
Young tomato leaf samples of approximately 15 mg were used for DNA extraction as described previously (Eshed and Zamir, 1995). The genotyping of the homozygous mutants was confirmed by Cleaved Amplified Polymorphic Sequence (CAPS) or by sequencing. Primers and CAPS restriction enzymes for genotyping are described in Table S2.
RNA extraction and measurement of mRNA with Quantitative Real‐Time RT‐PCR
RNA extraction from fruit at the ‘ripe’ stage was performed of approximately 200 mg powder tissue with TRI Reagent RNA isolation reagent (Sigma‐Aldrich) according to the manufacturer’s protocol. Reverse transcription and DNase treatment were performed with the iScript™ gDNA Clear cDNA Synthesis Kit #172‐5035 (Bio‐Rad). To eliminate genomic DNA contamination, the cDNA was amplified using ACTIN primers (Table S3) that differentiate between genomic DNA and cDNA sequences. The cDNA was amplified by ProFlex PCR System (Applied Biosystems by Thermo Fisher Scientific). Quantitative polymerase chain reactions were performed using the Applied Biosystems™ Fast SYBR™ Green Master Mix on a StepOnePlus™ Real‐Time PCR System (Applied Biosystems). Cycling conditions were 95 °C for 20 s, followed by 40 cycles of 95 °C for 3 s, 60 °C for 30 s and fluorescence acquisition at 60 °C. For each gene, the relative mRNA level was determined in three biological replicates. The gene ACTIN served as a control for normalization. Primers used for RT‐PCR amplification are described in Table S3.
Expression of BCH2 from C. clementina in E. coli
The cDNA of β‐carotene hydroxylase 2 (BCH2) from Citrus clementina (NCBI accession number: txid85681) was obtained from RNA isolated from pulp of fresh fruit followed by RT‐PCR using primers 5′‐AGCCACTAGTTGCCCGCGTGGCCGAGAAATTG‐3′ (forward) and 5′‐GTCGCTCGAGCTGATCCAAAAATTGGTCCTC‐3′ (reverse). For expression in E. coli, 267 nucleotides were truncated from the 5′ end of the predicted mRNA (NCBI Reference Sequence: XM_006421968.1), which includes part of the presumed transit peptide. The remaining cDNA sequence from nucleotide 267 to 936 was cloned into the plasmid pBluescript SK+ between the SpeI and XhoI sites, generated pBCH2 vector. The insert was sequenced to identify possible PCR‐derived mutations. The plasmid was transfected to E. coli strain XL1‐Blue grown on Luria–Bertani (LB) containing plasmid pAC‐BETAipi, which carries Erwinia herbicola ipi, crtE, crtB, crtI, crtY was used (Cunningham and Gantt, 2007). To enhance the expression of BCH2, 24 mg/L of isopropyl 1‐thio‐β‐D‐galactopyranoside (IPTG) were added to the LB medium. E. coli cells were grown overnight at 37 °C on LB solid plates followed by 5 days at room temperature for pigment accumulation.
Construct design and tomato transformation
Full‐length cDNA of BCH2 from C. clementina fruit tissue was used as template for PCR amplification using the following primers: 5′‐CCACAATCCACAATCCACTTC‐3′ (Forward) and 5′‐TGATCCAAAAATTGGTCCTC‐3′ (Reverse) and cloned into the multiple cloning site of the plasmid pJET 1.2 (CloneJET PCR Cloning Kit # K1231) (Thermo Fisher Scientific, Eldan Electronic Instruments Ltd. Israel). The insert was sequenced to confirm its integrity and was excised from the plasmid by the restriction enzymes XhoI and XbaI. The insert was cloned into the XhoI and XbaI sites of the intermediate plasmid pART7 behind the CaMV constitutive promoter 35S, with a Nos terminator, and then cleaved by the restriction enzyme NotI and ligated into the T‐DNA binary vector pART27, which contains the NPTII gene for kanamycin resistance (Gleave, 1992). This plasmid was designated pBCH2‐pART27. The plasmid pBCH2‐pART27 was transfected into Agrobacterium tumefaciens (GV3101) by electrophoresis. Transformed Agrobacterium culture was incubated for 15 min with detached 10‐day‐old tomato cotyledons of the homozygous double‐mutant hp3/BSh, obtained in F2 progenies of a cross between the high‐pigment 3 (hp3) (Galpaz et al., 2008) and HIGH‐BETA BSh (this work). Cotyledons were placed on feeder plates and after 48 h were transferred to an SL1 medium (Jones medium with 400 mg/L carbenicillin, 1 mg/L zeatin, 100 mg/L kanamycin and 0.7% agar). After 14 days, the cotyledons were transferred to an SL2 medium (Jones medium with 250 mg/L carbenicillin, 100 mg/L Kanamycin, 1 mg/L zeatin, 0.5 mg/L zeatin riboside, 0.1 mg/L IAA and 0.8% agar). Calli were excised from the cotyledons after a week or so and transferred again to SL2 medium plates. The calli were then transferred to an SL3 medium (Jones medium with 250 mg/L carbenicillin, 70 mg/L Kanamycin, 0.15 mg/L zeatin, 0.1 mg/L IAA and 0.8% agar). Shoots emerging from the calli were transferred to rooting medium (Nitsch medium with 150 mg/L carbenicillin, 50 mg/L Kanamycin, 50 mg/L Kanamycin and 1–2 mg/L IBA) for additional two weeks and then transferred to a transparent container with wet soil. Sturdy plantlets were finally transferred to 4‐litre pots in the greenhouse. Transgenic plants were identified by PCR amplification of the T‐DNA sequence (primers described in Table S2) and sequencing.
Transmission electron microscopy (TEM)
The ultrastructures of chromoplasts in the pericarp of ripe fruit were examined using transmission electron microscopy (TEM) as described in Galpaz et al. (2008). Fresh tomato fruit in the ripe stage of development was hand‐cut. Samples were fixed with 5% glutaraldehyde in 0.1 m cacodylate buffer solution, pH 7.4, overnight at 4 °C. After four washes in cacodylate buffer, tissue was post‐fixed with cacodylate buffer, containing 2% OsO4 and 1.5% potassium ferricyanide, for 2 h at room temperature, dehydrated in a graded ethyl alcohol series followed by propylene oxide and embedded in Agar 100 resin (Agar Scientific; http://www.agarscientific.com). Polymerization was carried out at 60 °C for 48 h. For electron microscopy, ultrathin sections were cut on an LKB III ultratome. Ultrathin sections were mounted on copper 200 mesh thin bar grids and stained with uranyl acetate and lead citrate. Images were captured using a Tecnai‐12 electron microscope (Philips; http://www.philips.com) equipped with a Megaview II CCD camera and analysis software version 3.0 (Soft Imaging System GmbH).
Conflict of interest
The authors declare no conflict of interest.
Author contribution
UK and JH conceived the idea and designed the research plan. UK carried out the genetic manipulations to generate the hp3/Bsh genotypes as well as the transgenic manipulations and analysed the carotenoids. AK and DZ performed the breeding with hp2dg and carried out the field tests. The manuscript was written by UK and edited by JH and DZ.
Supporting information
Figure S1 Concentration of zeaxanthin + β‐cryptoxanthin in ripe fruits from various genotypes (see text for details).
Figure S2 Typical fruit of green‐stripe (gs) and Xantomato.
Figure S3 Concentration of zeaxanthin plus β‐cryptoxanthin in ripe fruits of various genotypes.
Table S1 The solvent gradient procedure used for the separation of carotenoids by HPLC at a constant flow of 1.6 ml/min.
Table S2 The primer used for the genotyping of the different tomato mutants.
Table S3 Primer used in quantitative RT‐PCR amplification of tomato genes.
Acknowledgements
We thank Dr. Yael Friedmann for her proficient assistance with the transmission electron microscopy and Marc Simanowitz and Nurit Bar‐Nun for the valuable comments on the manuscript. This research was supported by the Israel Science Foundation grant 850/13, and by EC FP7 KBBE programme DISCO, project 613513.
Karniel, U. , Koch, A. , Zamir, D. and Hirschberg, J. (2020) Development of zeaxanthin‐rich tomato fruit through genetic manipulations of carotenoid biosynthesis. Plant Biotechnol. J., 10.1111/pbi.13387
References
- AREDS2 Research Group (2013) Lutein + zeaxanthin and omega‐3 fatty acids for age‐related macular degeneration: the Age‐Related Eye Disease Study 2 (AREDS2) randomized clinical trial. JAMA 309, 2005–2015. [DOI] [PubMed] [Google Scholar]
- Ariizumi, T. , Kishimoto, S. , Kakami, R. , Maoka, T. , Hirakawa, H. , Suzuki, Y. , Ozeki, Y. et al(2014) Identification of the carotenoid modifying gene PALE YELLOW PETAL 1 as an essential factor in xanthophyll esterification and yellow flower pigmentation in tomato (Solanum lycopersicum). Plant J. 79, 453–465. [DOI] [PubMed] [Google Scholar]
- Arunkumar, R. , Calvo, C.M. , Conrady, C.D. and Bernstein, P.S. (2018) What do we know about the macular pigment in AMD: the past, the present, and the future. Eye (Lond), 992–1004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Arunkumar, R. , Gorusupudi, A. and Bernstein, P.S. (2020) The macular carotenoids: a biochemical overview. Biochim. Biophys. Acta Mol. Cell Biol. Lipid. 10.1016/j.bbalip.2020.158617 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Azari, R. , Tadmor, Y. , Meir, A. , Reuveni, M. , Evenor, D. , Nahon, S. , Shlomo, H. et al (2010) Light signaling genes and their manipulation towards modulation of phytonutrient content in tomato fruits. Biotechnol. Adv. 28, 108–118. [DOI] [PubMed] [Google Scholar]
- Bino, R.J. , De Vos, C.H.R. , Lieberman, M. , Hall, R.D. , Bovy, A. , Jonker, H.H. , Tikunov, Y. et al (2005) The light‐hyperresponsive high pigment‐2 dg mutation of tomato: alterations in the fruit metabolome. New Phytol. 166, 427–438. [DOI] [PubMed] [Google Scholar]
- Bramley, P.M. (2002) Regulation of carotenoid formation during tomato fruit ripening and development. J. Exp. Bot. 53, 2107–2113. [DOI] [PubMed] [Google Scholar]
- Burri, B.J. , La Frano, M.R. and Zhu, C. (2016) Absorption, metabolism, and functions of beta‐cryptoxanthin. Nutr. Rev. 74, 69–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chew, E.Y. , Clemons, T.E. , Sangiovanni, J.P. , Danis, R.P. , Ferris III, F.L. , Elman, M.J. , Antoszyk, A.N. et al (2013) Secondary analyses of the effects of lutein/zeaxanthin on age‐related macular degeneration progression: AREDS2 Report No. 3. JAMA Ophthalmol. 132, 142–149. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Congdon, N. , O'Colmain, B. , Klaver, C.C. , Klein, R. , Munoz, B. , Friedman, D.S. , Kempen, J. et al (2004) Causes and prevalence of visual impairment among adults in the United States. Arch. Ophthalmol. 122, 477–485. [DOI] [PubMed] [Google Scholar]
- Cruz, A.B. , Alves, F.R.R. , Purgatto, E. , Peres, L.E.P. , Rossi, M. and Freschi, L. (2018) Light, ethylene and auxin signaling interaction regulates carotenoid biosynthesis during tomato fruit ripening. Front. Plant Sci. 9, 1370 https:/doi.org10.3389/fpls.2018.01370 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cunningham Jr, F.X. and Gantt, E. .(2007) A portfolio of plasmids for identification and analysis of carotenoid pathway enzymes: Adonis aestivalis as a case study. Photosynth. Res. 92, 245–259. [DOI] [PubMed] [Google Scholar]
- Dalal, M. , Chinnusamy, V. and Bansal, K.C. (2010) Isolation and functional characterization of Lycopene beta‐cyclase (CYC‐B) promoter from Solanum habrochaites . BMC Plant Biol. 10, 61. [DOI] [PMC free article] [PubMed] [Google Scholar]
- D'Ambrosio, C. , Stigliani, A.L. and Giorio, G. .(2011) Overexpression of CrtR‐b2 (carotene beta hydroxylase 2) from S. lycopersicum L. differentially affects xanthophyll synthesis and accumulation in transgenic tomato plants. Transgenic Res. 20, 47–60. [DOI] [PubMed] [Google Scholar]
- Deli, J. , Matus, Z. and Toth, G. (1996) Carotenoid composition in the fruits of Capsicum annuum cv Szentesi Kosszarvu during ripening. J. Agr Food Chem. 44, 711–716. [Google Scholar]
- Deruere, J. , Romer, S. , d'Harlingue, A. , Backhaus, R.A. , Kuntz, M. and Camara, B. (1994) Fibril assembly and carotenoid overaccumulation in chromoplasts ‐ a model for supramolecular lipoprotein structures. Plant Cell, 6, 119–133. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dharmapuri, S. , Rosati, C. , Pallara, P. , Aquilani, R. , Bouvier, F. , Camara, B. and Giuliano, G. (2002) Metabolic engineering of xanthophyll content in tomato fruits. FEBS Lett. 26068, 1–5. [DOI] [PubMed] [Google Scholar]
- Dhuique‐Mayer, C. , Caris‐Veyrat, C. , Ollitrault, P. , Curk, F. and Amiot, M.J. (2005) Varietal and interspecific influence on micronutrient contents in citrus from the Mediterranean area. J. Agricult. Food Chem. 53, 2140–2145. [DOI] [PubMed] [Google Scholar]
- Dias, M.G. , Olmedilla‐Alonso, B. , Hornero‐Mendez, D. , Mercadante, A.Z. , Osorio, C. , Vargas‐Murga, L. and Melendez‐Martinez, A.J. (2018) Comprehensive database of carotenoid contents in Ibero‐American foods. A valuable tool in the context of functional foods and the establishment of recommended intakes of bioactives. J Agric. Food Chem. 66, 5055–5107. [DOI] [PubMed] [Google Scholar]
- Diretto, G. , Welsch, R. , Tavazza, R. , Mourgues, F. , Pizzichini, D. , Beyer, P. and Giuliano, G. (2007) Silencing of beta‐carotene hydroxylase increases total carotenoid and beta‐carotene levels in potato tubers. BMC Plant Biol. 7, 11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dwyer, J.H. , Navab, M. , Dwyer, K.M. , Hassan, K. , Sun, P. , Shircore, A. , Hama‐Levy, S. et al (2001) Oxygenated carotenoid lutein and progression of early atherosclerosis ‐ The Los Angeles Atherosclerosis Study. Circulation, 103, 2922–2927. [DOI] [PubMed] [Google Scholar]
- Eggersdorfer, M. and Wyss, A. (2018) Carotenoids in human nutrition and health. Arch. Biochem. Biophys. 652, 18–26. [DOI] [PubMed] [Google Scholar]
- Enfissi, E.M. , Nogueira, M. , Bramley, P.M. and Fraser, P.D. (2017) The regulation of carotenoid formation in tomato fruit. Plant J. 89, 774–788. [DOI] [PubMed] [Google Scholar]
- Enfissi, E.M.A. , Nogueira, M. , D'Ambrosio, C. , Stigliani, A.L. , Giorio, G. , Misawa, N. and Fraser, P.D. (2019) The road to astaxanthin production in tomato fruit reveals plastid and metabolic adaptation resulting in an unintended high lycopene genotype with delayed over‐ripening properties. Plant Biotechnol. J. 17, 1501–1513. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Eshed, Y. and Zamir, D. (1995) An introgression line population of Lycopersicon pennellii in the cultivated tomato enables the identification and fine mapping of yield‐associated QTL. Genetics, 141, 1147–1162. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Flaxman, S.R. , Bourne, R.R.A. , Resnikoff, S. , Ackland, P. , Braithwaite, T. , Cicinelli, M.V. , Das, A. et al (2017) Global causes of blindness and distance vision impairment 1990–2020: A systematic review and meta‐analysis. Lancet Glob. Health. 5, e1221–e1234. [DOI] [PubMed] [Google Scholar]
- Galpaz, N. , Ronen, G. , Khalfa, Z. , Zamir, D. and Hirschberg, J. (2006) A chromoplast‐specific carotenoid biosynthesis pathway is revealed by cloning of the tomato white‐flower locus. Plant Cell, 18, 1947–1960. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Galpaz, N. , Wang, Q. , Menda, N. , Zamir, D. and Hirschberg, J. (2008) Abscisic acid deficiency in the tomato mutant high‐pigment 3 leading to increased plastid number and higher fruit lycopene content. Plant J. 53, 717–730. [DOI] [PubMed] [Google Scholar]
- Gao, L. , Gonda, I. , Sun, H. , Ma, Q. , Bao, K. , Tieman, D.M. , Burzynski‐Chang, E.A. et al (2019) The tomato pan‐genome uncovers new genes and a rare allele regulating fruit flavor. Nat. Genet. 51, 1044–1051. [DOI] [PubMed] [Google Scholar]
- García, M.I. , Lozano, M. , de Espinosa, V.M. , Ayuso, M.C. , Bernalte, M.J. , Vidal‐Aragón, M.C. and Pérez, M.M. (2007) Agronomic characteristics and carotenoid content of five Bola‐type paprika red pepper (Capsicum annuum L.) cultivars. Sci. Hortic. 113, 202–207. [Google Scholar]
- Giordano, E. and Quadro, L. (2018) Lutein, zeaxanthin and mammalian development: Metabolism, functions and implications for health. Arch.of Biochem. Biophys. 647, 33–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Giorio, G. , Stigliani, A. and D'Ambrosio, C. .(2008) Over‐expression of carotene β‐hydroxylase 1 (CrtR‐b1) and lycopene β‐cyclase (Lcy‐b) in transgenic tomato fruits. Acta Hortic. 789, 277–284. [Google Scholar]
- Giovannoni, J. , Nguyen, C. , Ampofo, B. , Zhong, S. and Fei, Z. (2017) The epigenome and transcriptional dynamics of fruit ripening. Ann. Rev. Plant Biol. 68, 61–84. [DOI] [PubMed] [Google Scholar]
- Giuliano, G. (2014) Plant carotenoids: genomics meets multi‐gene engineering. Curr. Opin. Plant Biol. 19C, 111–117. [DOI] [PubMed] [Google Scholar]
- Giuliano, G. (2017) Provitamin A biofortification of crop plants: a gold rush with many miners. Curr. Opin. Biotechnol. 44, 169–180. [DOI] [PubMed] [Google Scholar]
- Giuliano, G. , Tavazza, R. , Diretto, G. , Beyer, P. and Taylor, M.A. (2008) Metabolic engineering of carotenoid biosynthesis in plants. Trends Biotechnol. 26, 139–145. [DOI] [PubMed] [Google Scholar]
- Gleave, A.P. (1992) A versatile binary vector system with a T‐DNA organisational structure conducive to efficient integration of cloned DNA into the plant genome. Plant Mol Biol. 20, 1203–1207. [DOI] [PubMed] [Google Scholar]
- Gorusupudi, A. , Nelson, K. and Bernstein, P.S. (2017) The age‐related eye disease 2 study: micronutrients in the treatment of macular degeneration. Adv. Nutr. 8, 40–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Grudzinski, W. , Nierzwicki, L. , Welc, R. , Reszczynska, E. , Luchowski, R. , Czub, J. and Gruszecki, W.I. (2017) Localization and orientation of xanthophylls in a lipid bilayer. Sci. Rep. 7, 9619–10183. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Harris, W.M. and Spurr, A.R. (1969a) Chromoplasts of tomato fruits.2. Red tomato. Am. J. Bot. 56, 380–389. [Google Scholar]
- Harris, W.M. and Spurr, A.R. (1969b) Chromoplasts of tomato fruits. 1. Ultrastructure of low‐pigment and High‐Beta mutants. Carotene analyses. Am. J. Bot. 56, 369–379. [Google Scholar]
- Hirschberg, J. (2001) Carotenoid biosynthesis in flowering plants. Curr. Opin. Plant Biol. 4, 210–218. [DOI] [PubMed] [Google Scholar]
- Holden, J.M. , Eldridge, A.L. , Beecher, G.R. , Buzzard, I.M. , Bhagwat, S. , Davis, C.S. , Douglass, L.W. et al (1999) Carotenoid content of U.S. foods: an update of the database. J. Food Comp. Analysis, 12, 169–196. [Google Scholar]
- Hornero‐Méndez, D. , Costa‐García, J. and Mínguez‐Mosquera, M. (2002) Characterization of carotenoid high‐producing Capsicum annuum cultivars selected for paprika production. J. Agricult. Food Chem. 50, 5711–5716. [DOI] [PubMed] [Google Scholar]
- Huang, J.C. , Zhong, Y.J. , Liu, J. , Sandmann, G. and Chen, F. (2013) Metabolic engineering of tomato for high‐yield production of astaxanthin. Metabol. Eng. 17, 59–67. [DOI] [PubMed] [Google Scholar]
- Johnson, E.J. (2014) Role of lutein and zeaxanthin in visual and cognitive function throughout the lifespan. Nutr. Rev. 72, 605–612. [DOI] [PubMed] [Google Scholar]
- Klee, H.J. and Giovannoni, J.J. (2011) Genetics and control of tomato fruit ripening and quality attributes. Annu. Rev. Genet. 45, 41–59. [DOI] [PubMed] [Google Scholar]
- Kolotilin, I. , Koltai, H. , Tadmor, Y. , Bar‐Or, C. , Reuveni, M. , Meir, A. , Nahon, S. et al (2007) Transcriptional profiling of high pigment‐2 dg tomato mutant links early fruit plastid biogenesis with its overproduction of phytonutrients. Plant Physiol. 145, 389–401. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lado, J. , Zacarias, L. , Gurrea, A. , Page, A. , Stead, A. and Rodrigo, M.J. (2015) Exploring the diversity in Citrus fruit colouration to decipher the relationship between plastid ultrastructure and carotenoid composition. Planta, 242, 645–661. [DOI] [PubMed] [Google Scholar]
- Leoncini, E. , Edefonti, V. , Hashibe, M. , Parpinel, M. , Cadoni, G. , Ferraroni, M. , Serraino, D. et al (2016) Carotenoid intake and head and neck cancer: a pooled analysis in the International Head and Neck Cancer Epidemiology Consortium. Eur J Epidemiol. 31, 369–383. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Levin, I. , De Vos, C.H.R. , Tadmor, Y. , Bovy, A. , Lieberman, M. , Oren‐Shamir, M. , Segev, O. et al (2006) High pigment tomato mutants ‐ more than just lycopene (a review). Israel J. Plant Sci. 54, 179–190. [Google Scholar]
- Li, S. , Chen, K. and Grierson, D. (2019) A critical evaluation of the role of ethylene and MADS transcription factors in the network controlling fleshy fruit ripening. New Phytol. 221, 1724–1741. [DOI] [PubMed] [Google Scholar]
- Lincoln, R.E. and Porter, J.W. (1950) Inheritance of β‐carotene in tomatoes. Genetics, 35, 206–211. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu, Y. , Roof, S. , Ye, Z. , Barry, C. , van Tuinen, A. , Vrebalov, J. , Bowler, C. et al (2004) Manipulation of light signal transduction as a means of modifying fruit nutritional quality in tomato. Proc. Natl. Acad. Sci. USA, 101, 9897–9902. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu, L. , Shao, Z. , Zhang, M. and Wang, Q. .(2015) Regulation of carotenoid metabolism in tomato. Mol Plant. 8, 28–39. [DOI] [PubMed] [Google Scholar]
- Luo, Z. , Zhang, J. , Li, J. , Yang, C. , Wang, T. , Ouyang, B. , Li, H. et al (2013) A STAY‐GREEN protein SlSGR1 regulates lycopene and beta‐carotene accumulation by interacting directly with SlPSY1 during ripening processes in tomato. New Phytol. 198, 442–452. [DOI] [PubMed] [Google Scholar]
- Maiani, G. , Caston, M.J. , Catasta, G. , Toti, E. , Cambrodon, I.G. , Bysted, A. , Granado‐Lorencio, F. et al (2009) Carotenoids: actual knowledge on food sources, intakes, stability and bioavailability and their protective role in humans. Mol. Nutr. Food Res. 53(S2), S194–S218. [DOI] [PubMed] [Google Scholar]
- Mohr, W.P. (1979) Pigment bodies in fruits of Crimson and high pigment lines of tomatoes. Annals Bot. 44, 427–434. [Google Scholar]
- Moise, A.R. , Al‐Babili, S. and Wurtzel, E.T. (2014) Mechanistic aspects of carotenoid biosynthesis. Chem. Rev. 114, 164–193. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mustilli, A.C. , Fenzi, F. , Ciliento, R. , Alfano, F. and Bowler, C. (1999) Phenotype of the tomato high pigment‐2 mutant is caused by a mutation in the tomato homolog of DEETIOLATED1 . Plant Cell, 11, 145–157. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Naqvi, S. , Zhu, C. , Farre, G. , Sandmann, G. , Capell, T. and Christou, P. (2011) Synergistic metabolism in hybrid corn indicates bottlenecks in the carotenoid pathway and leads to the accumulation of extraordinary levels of the nutritionally important carotenoid zeaxanthin. Plant Biotechnol. J. 9, 384–393. [DOI] [PubMed] [Google Scholar]
- Neuman, H. , Galpaz, N. , Cunningham Jr, F.X. , Zamir, D. and Hirschberg, J. (2014) The tomato mutation nxd1 reveals a gene necessary for neoxanthin biosynthesis and demonstrates that violaxanthin is a sufficient precursor for abscisic acid biosynthesis. Plant J. 78, 80–93. [DOI] [PubMed] [Google Scholar]
- Niro, S. , Fratianni, A. , Panfili, G. , Falasca, L. , Cinquanta, L. and Alam, M.R. (2017) Nutritional evaluation of fresh and dried Goji berries cultivated in Italy. Italian J. Food Sci. 29, 398–408. [Google Scholar]
- Nogueira, M. , Mora, L. , Enfissi, E.M. , Bramley, P.M. and Fraser, P.D. (2013) Subchromoplast sequestration of carotenoids affects regulatory mechanisms in tomato lines expressing different carotenoid gene combinations. Plant Cell. 25, 4560–4579. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nogueira, M. , Enfissi, E.M.A. , Martinez Valenzuela, M.E. , Menard, G.N. , Driller, R.L. , Eastmond, P.J. , Schuch, W. et al (2017) Engineering of tomato for the sustainable production of ketocarotenoids and its evaluation in aquaculture feed. Proc. Natl. Acad. Sci. USA, 114, 10876–10881. [DOI] [PMC free article] [PubMed] [Google Scholar]
- O'Hare, T.J. , Martin, I. , Fanning, K.J. , Kirchhoff, S. , Wong, L.S. , Keating, V. , Pun, S. et al (2014) Sweetcorn colour change and consumer perception associated with increasing zeaxanthin for the amelioration of age‐related macular degeneration. Acta Hortic. 221–226. [Google Scholar]
- O'Hare, T.J. , Fanning, K.J. and Martin, I.F. (2015) Zeaxanthin biofortification of sweet‐corn and factors affecting zeaxanthin accumulation and colour change. Archiv. Biochem. Biophys. 572, 184–187. [DOI] [PubMed] [Google Scholar]
- Orchard, C.J. (2014) Naturally occurring variation in the promoter of the chromoplast‐specific Cyc‐B gene in tomato can be used to modulate levels of â‐carotene in ripe tomato fruit. 1–90. The Ohio State University. [Google Scholar]
- Patsilinakos, A. , Ragno, R. , Carradori, S. , Petralito, S. and Cesa, S. (2018) Carotenoid content of Goji berries: CIELAB, HPLC‐DAD analyses and quantitative correlation. Food Chem. 268, 49–56. [DOI] [PubMed] [Google Scholar]
- Pecker, I. , Gabbay, R. , Cunningham Jr, F.X. and Hirschberg, J. (1996) Cloning and characterization of the cDNA for lycopene b‐cyclase from tomato reveals decrease in its expression during fruit ripening. Plant Mol. Biol. 30, 807–819. [DOI] [PubMed] [Google Scholar]
- Perry, A. , Rasmussen, H. and Johnson, E.J. (2009) Xanthophyll (lutein, zeaxanthin) content in fruits, vegetables and corn and egg products. J. Food Comp. Analysis, 22, 9–15. [Google Scholar]
- Rasmussen, H.M. , Muzhingi, T. , Eggert, E.M.R. and Johnson, E.J. (2012) Lutein, zeaxanthin, meso‐zeaxanthin content in egg yolk and their absence in fish and seafood. J. Food Comp. Analysis, 27, 139–144. [Google Scholar]
- Rodriguez‐Concepcion, M. , Avalos, J. , Bonet, M.L. , Boronat, A. , Gomez‐Gomez, L. , Hornero‐Mendez, D. Limon, M.C. et al (2018) A global perspective on carotenoids: metabolism, biotechnology, and benefits for nutrition and health. Prog. Lipid Res. 70, 62–93. [DOI] [PubMed] [Google Scholar]
- Romer, S. , Fraser, P.D. , Kiano, J.W. , Shipton, C.A. , Misawa, N. , Schuch, W. and Bramley, P.M. (2000) Elevation of the provitamin A content of transgenic tomato plants. Nat. Biotechnol. 18, 666–669. [DOI] [PubMed] [Google Scholar]
- Romer, S. , Lubeck, J. , Kauder, F. , Steiger, S. , Adomat, C. and Sandmann, G. (2002) Genetic engineering of a zeaxanthin‐rich potato by antisense inactivation and co‐suppression of carotenoid epoxidation. Metab. Eng. 4, 263–272. [DOI] [PubMed] [Google Scholar]
- Ronen, G. , Cohen, M. , Zamir, D. and Hirschberg, J. (1999) Regulation of carotenoid biosynthesis during tomato fruit development: expression of the gene for lycopene epsilon‐cyclase is down‐regulated during ripening and is elevated in the mutant Delta . Plant J. 17, 341–351. [DOI] [PubMed] [Google Scholar]
- Ronen, G. , Carmel‐Goren, L. , Zamir, D. and Hirschberg, J. (2000) An alternative pathway to β‐carotene formation in plant chromoplasts discovered by map‐based cloning of Beta and old‐gold color mutations in tomato. Proc. Natl. Acad. Sci. USA, 97, 11102–11107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rosas‐Saavedra, C. and Stange, C. (2016) Biosynthesis of carotenoids in plants: enzymes and color. Subcell. Biochem. 79, 35–69. [DOI] [PubMed] [Google Scholar]
- Rosso, S.W. (1968) The ultrastructure of chromoplast development in red tomatoes. J. Ultrastruct. Res. 25, 307–322. [DOI] [PubMed] [Google Scholar]
- Ruiz‐Sola, M.A. and Rodriguez‐Concepcion, M. (2012) Carotenoid biosynthesis in arabidopsis: a colorful pathway. Arabidopsis Book, 10, e0158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sabour‐Pickett, S. , Nolan, J.M. , Loughman, J. and Beatty, S. (2012) A review of the evidence germane to the putative protective role of the macular carotenoids for age‐related macular degeneration. Mol. Nutr. Food Res. 56, 270–286. [DOI] [PubMed] [Google Scholar]
- Sajilata, M.G. , Singhal, R.S. and Kamat, M.Y. (2008) The carotenoid pigment zeaxanthin ‐ a review. Comprehen. Rev. Food Sci. Food Safety, 7, 29–49. [Google Scholar]
- Sauer, L. , Li, B. and Bernstein, P.S. (2019) Ocular carotenoid status in health and disease. Annu. Rev. Nutr. 39, 95–120. [DOI] [PubMed] [Google Scholar]
- Schaub, P. , Rodriguez‐Franco, M. , Cazzonelli, C.I. , Álvarez, D. , Wüst, F. and Welsch, R. (2018) Establishment of an Arabidopsis callus system to study the interrelations of biosynthesis, degradation and accumulation of carotenoids. PLoS ONE, 13, e0192158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stommel, J.R. (2001) USDA 97L63, 97L66, and 97L97: tomato breeding lines with high fruit beta‐carotene content. HortScience, 36, 387–388. [Google Scholar]
- Stommel, J.R. and Haynes, K.G. .(1994) Inheritance of β‐carotene content in the wild tomato species Lycopersicon cheesmanii . J. Hered. 85, 401–404. [Google Scholar]
- Stringham, J.M. , Johnson, E.J. and Hammond, B.R. (2019) Lutein across the lifespan: from childhood cognitive performance to the aging eye and brain. Curr. Develop. Nutr. 3, nzz066 10.1093/cdn/nzz066 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sun, T. and Li, L. (2020) Toward the ‘golden’ era: the status in uncovering the regulatory control of carotenoid accumulation in plants. Plant Sci. 290, 110331. [DOI] [PubMed] [Google Scholar]
- Tomes, M.L. , Quackenbush, F.W. and McQuistan, M. (1954) Modification and dominance of the gene governing formation of high concentrations of beta‐carotene in the tomato. Genetics, 39, 810–817. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tomes, M.L. , Quackenbush, F.W. and Kargl, T.E. (1956) Action of the gene B in biosynthesis of carotenes in tomato. Botanical Gazzete, 117, 248–253. [Google Scholar]
- Tomes, M.L. , Quackenbush, F.W. and Kargl, T.E. (1958) Synthesis of b‐carotene in the tomato fruit. Botanical Gazzete, 1264, 250–253. [Google Scholar]
- Wang, L. , Li, B. , Pan, M.X. , Mo, X.F. , Chen, Y.M. and Zhang, C.X. (2014) Specific carotenoid intake is inversely associated with the risk of breast cancer among Chinese women. Br. J. Nutr. 111, 1686–1695. [DOI] [PubMed] [Google Scholar]
- Watkins, J.L. and Pogson, B.J. (2020) Prospects for carotenoid biofortification targeting retention and catabolism. Trends Plant Sci. 10, 501–512. [DOI] [PubMed] [Google Scholar]
- Wolters, A.M. , Uitdewilligen, J.G. , Kloosterman, B.A. , Hutten, R.C. , Visser, R.G. and van Eck, H.J. (2010) Identification of alleles of carotenoid pathway genes important for zeaxanthin accumulation in potato tubers. Plant Mol. Biol. 73, 659–671. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wu, J. , Cho, E. , Willett, W.C. , Sastry, S.M. and Schaumberg, D.A. (2015) Intakes of lutein, zeaxanthin, and other carotenoids and age‐related macular degeneration during 2 decades of prospective follow‐up. JAMA Ophthalmol. 133, 1415–1424. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yamamizo, C. , Kishimoto, S. and Ohmiya, A. (2010) Carotenoid composition and carotenogenic gene expression during Ipomoea petal development. J. Exp. Bot. 61, 709–719. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yossa Nzeuwa, I.B. , Guo, B. , Zhang, T. , Wang, L. , Ji, Q. , Xia, H. and Su, G. (2019) Comparative metabolic profiling of Lycium Fruits (Lycium barbarum and Lycium chinense) from different areas in China and from Nepal. J. Food. Qual. 2019 Article ID 4396027. 10.1155/2019/4396027 [DOI] [Google Scholar]
- Yuan, H. , Zhang, J.X. , Nageswaran, D. and Li, L. (2015) Carotenoid metabolism and regulation in horticultural crops. Horticult Res. 2, 15036 10.1038/hortres.2015.36 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zheng, X. , Giuliano, G. and Al‐Babili, S. (2020) Carotenoid biofortification in crop plants: citius, altius, fortius . Biochim. Biophys. Acta Mol. Cell Biol. Lipid. 10.1016/j.bbalip.2020.158664 [DOI] [PubMed] [Google Scholar]
- Zhu, C. , Naqvi, S. , Breitenbach, J. , Sandmann, G. , Christou, P. and Capell, T. (2008) Combinatorial genetic transformation generates a library of metabolic phenotypes for the carotenoid pathway in maize. Proc. Natl Acad. Sci. 105, 18232–18237. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Figure S1 Concentration of zeaxanthin + β‐cryptoxanthin in ripe fruits from various genotypes (see text for details).
Figure S2 Typical fruit of green‐stripe (gs) and Xantomato.
Figure S3 Concentration of zeaxanthin plus β‐cryptoxanthin in ripe fruits of various genotypes.
Table S1 The solvent gradient procedure used for the separation of carotenoids by HPLC at a constant flow of 1.6 ml/min.
Table S2 The primer used for the genotyping of the different tomato mutants.
Table S3 Primer used in quantitative RT‐PCR amplification of tomato genes.