Skip to main content
PLOS One logoLink to PLOS One
. 2020 Nov 10;15(11):e0239528. doi: 10.1371/journal.pone.0239528

Regulatory and evolutionary adaptation of yeast to acute lethal ethanol stress

Jamie Yang 1,2, Saeed Tavazoie 1,2,3,*
Editor: Alvaro Galli4
PMCID: PMC7654773  PMID: 33170850

Abstract

The yeast Saccharomyces cerevisiae has been the subject of many studies aimed at understanding mechanisms of adaptation to environmental stresses. Most of these studies have focused on adaptation to sub-lethal stresses, upon which a stereotypic transcriptional program called the environmental stress response (ESR) is activated. However, the genetic and regulatory factors that underlie the adaptation and survival of yeast cells to stresses that cross the lethality threshold have not been systematically studied. Here, we utilized a combination of gene expression profiling, deletion-library fitness profiling, and experimental evolution to systematically explore adaptation of S. cerevisiae to acute exposure to threshold lethal ethanol concentrations—a stress with important biotechnological implications. We found that yeast cells activate a rapid transcriptional reprogramming process that is likely adaptive in terms of post-stress survival. We also utilized repeated cycles of lethal ethanol exposure to evolve yeast strains with substantially higher ethanol tolerance and survival. Importantly, these strains displayed bulk growth-rates that were indistinguishable from the parental wild-type strain. Remarkably, these hyper-ethanol tolerant strains had reprogrammed their pre-stress gene expression states to match the likely adaptive post-stress response in the wild-type strain. Our studies reveal critical determinants of yeast survival to lethal ethanol stress and highlight potentially general principles that may underlie evolutionary adaptation to lethal stresses in general.

Introduction

Stress studies in yeast have mostly focused on acquired stress tolerance, the phenomenon in which exposure to a non-lethal dose of stress allows yeast to survive a subsequent exposure to a lethal dose. Exposure to this mild dose of stress activates a general stress response that allows the cells to better survive exposure to other lethal stresses, known as cross protection [13]. Many stresses activate the environmental stress response (ESR), which roughly encompasses 900 genes that change their expression in response to the stress [4, 5]. This common response to stress includes about 300 induced genes that are generally involved in stress defense, including genes in the categories of DNA damage repair, cell wall modification, vacuolar functions, detoxification of reactive oxygen species, and heat shock proteins. The ESR also encompasses 600 repressed genes that encode ribosomal proteins, ribosome biogenesis factors, translation initiation proteins, tRNA synthesis proteins, and proteins involved in other growth-related processes [4, 6]. The expression of these upregulated and downregulated group of genes show identical but opposite patterns. Additionally, the magnitude of the expression changes is proportional to the degree of stress imposed on the cells. Because of the dominance of the ESR in the literature of yeast stress response, we make multiple comparisons to it below.

Many studies have found that the ESR is tightly coupled to growth rate [79], and it is prohibitively difficult to optimize the growth and stress defense independently of each other [10]. Studies that utilized the pooled yeast knockout library have found an inverse correlation between growth rate and stress survival, with ribosome biogenesis, translation, and mitochondrial functions providing the link between growth rate and stress defense [8]. Stress-specific pathways are revealed once the dominant growth-rate effects are factored out. Our experiments are set up in such a way as to exclude strains that have reduced growth rate, since this would be a trivial solution to stress defense.

Some studies that investigated acute exposure to lethal stress have suggested that a fraction of cells in a population can survive lethal stress due to either a bet-hedging mechanism in which the sub-population exist in a slow growing protected state [9] or a mild environmental stress response activation through random double-strand breaks [11]. Either of these two scenarios would occur in a small percentage of cells, causing that subset of the population to be slow growing and allowing them to survive acute lethal doses of stress.

In order to better understand the mechanisms of survival in the face of acute lethal stress, we exposed yeast cells to two minutes of lethal ethanol stress, a time period short enough to minimize the activation of any programmed cellular response during the period of stress. We used RNA-seq to discover global transcriptional responses of yeast cells following the acute stress. In addition, we used fitness profiling of the pooled yeast knockout library to determine genes and pathways that contributed to survival under lethal ethanol stress. In order to determine whether and to what extent the survival-rate could evolve, we exposed multiple populations of yeast cells to repeated lethal ethanol stress. This experimental evolution paradigm led to a strain of yeast that showed an order of magnitude improvement in survival without compromising growth rate. Significant differences in global transcriptional responses of the evolved strain accompany its superior survival.

Results

Survival of yeast cells following acute lethal exposure to ethanol

We developed an acute lethal stress paradigm in which haploid yeast cells were treated with a brief two-minute exposure to a range of ethanol concentrations (19% - 26%). This brief exposure reduced the possibility of a direct transcriptional response during the period of stress. In this way, we created conditions in which the cellular state immediately prior to the stress and the longer-term transcriptional responses following the short period of stress were dominant contributors to survival. As can be seen from the stress-survival curve (Fig 1A), ethanol exposure above 20% causes lethality as determined by fraction survival of colony forming units. Furthermore, survival drops exponentially for concentrations within the lethal range, reaching 10−5 at 26% ethanol.

Fig 1. Global transcriptional response to threshold lethal acute ethanol stress.

Fig 1

(A) The fraction survival of yeast CFUs exposed to two minutes of ethanol stress, from 19% to 26% ethanol. Error bars represent standard error. (B) Procedure used to perform stress assay on yeast cells and to collect samples for RNA-seq. (C) Number of differentially expressed genes, for each post-stress time point relative to the pre-stress time point, measured as the number of genes with more than a two-fold expression change. The total number of differentially expressed genes was broken down into those with a two-fold downregulation and those with a two-fold upregulation. (D) Clustering of the time-course gene expression data using k-means with 10 clusters. Gene ontology analysis was performed on each of the clusters, and significant functional categories (p<0.001) are shown. (E) Average expression from the 12 most significant gene ontology categories in the 15- or 30-minute post-stress time point. Red colored lines indicate upregulated genes and blue colored lines indicate downregulated genes within the early post-stress time points. (F) Average expression of condensed chromosome and spore wall assembly genes, along with the expression of UME6 and IME1.

Global transcriptional response at the threshold of lethal ethanol stress

In order to gain better insights into the cellular pathways that may contribute to acute ethanol stress survival, we carried out transcriptional profiling using RNA-seq [12]. To minimize any confounding effects from dying cells, we chose to determine transcriptional responses at the threshold level of lethality corresponding to 20% ethanol. The transcriptional state of the haploid yeasts (strain BY4741) were monitored starting prior to stress exposure, and followed until one hour after stress exposure, sampling at various time points during the recovery from stress (Fig 1B).

The samples collected from the experiment were analyzed by RNA-seq. Comparison of global transcriptional states between each post-stress time point and the pre-stress time point revealed transcriptional changes that accompany any adaptation following stress. Fig 1C shows the number of genes that exhibit a two-fold change in expression at each post-stress time point compared to the pre-stress time point. The number of genes that showed a two-fold change is greatest at the 15-minute time point, suggesting that the peak response to ethanol stress occurs early. At the early time points (15 and 30 minutes), there are roughly five times as many genes (~1500) with a two-fold decrease than a two-fold increase (~300), indicating that the transcriptional response to ethanol stress is largely driven by a global downregulation of gene expression.

To discover dominant patterns of gene expression following stress, we carried out unsupervised clustering of genes using the k-means algorithm [13]. The gene expression patterns of the ten resulting clusters are shown in Fig 1D, demonstrating both induced and repressed groups of genes. The application of iPAGE [14], a pathway discovery algorithm, revealed that these expression clusters were significantly enriched in various functional categories and biological processes (Fig 1D). There are 4 clusters (3, 4, 6, 8) that show decreased expression over the entire recovery period. Ribosome biogenesis, ribosomal proteins, and translation are three well-documented functional categories, part of the environmental stress response, that decrease in expression in response to a variety of stresses [4, 5]. Cluster 10 shows the strongest upregulated response during the early time periods, suggesting the possible adaptive role of protein refolding by heat shock proteins in the adaptation to ethanol stress. This is consistent with previous studies that have shown induction of heat shock proteins in response to mild ethanol stress (4–10% ethanol) [15]. Cluster 7 contains upregulated genes in lipid biosynthesis, more specifically, sphingolipid biosynthesis. Membrane lipid composition is known to play an important role in sublethal ethanol and heat stress [16], and increased sphingolipid biosynthesis has been shown to increase tolerance to heat stress in yeast [17]. Other studies have shown that vesicular and vacuolar transport are both important in yeast survival to mild ethanol stress [1823], represented here in clusters 1 and 9, respectively. While induction of vesicular genes occurs shortly after exposure to ethanol, upregulation of vacuolar functions shows a delayed induction, peaking closer to 60 minutes after the onset of ethanol stress.

In addition to partitional clustering using the k-means algorithm, we also performed hierarchical clustering. The resulting dendrogram is shown in S1 Fig. Clustering by both genes and time points, we see that the 15-minute and 30-minute post-stress time points are most similar, with the pre-stress time point differing the most from all the post-stress time points.

In order to capture the broadest possible set of pathways modulated during the adaptation process, we compared the gene expression at each of the post-stress time points to the pre-stress time point and discovered gene ontology classes that are significantly enriched in them. The complete list of these categories can be found in S1 Table. The average gene expression from the 12 most significant functional categories modulated during the early time points (15 and 30 minutes) are shown in Fig 1E. Whereas lipid biosynthesis was significant in one of the upregulated patterns in Fig 1D, here lipid transporter is also shown to be significantly induced, further suggesting its importance in ethanol stress response. Regulation of RNA polymerase II transcription [24] and protein kinase activity [25] are both categories that are known to be upregulated in response to a variety of stresses. The ATPase activity category consists of some genes that code for heat shock proteins, including the Hsp70 family, all of which have been shown to protect against mild ethanol stress [15]. The ATPase activity category is also composed of genes that code for vacuolar H+-ATPase, required for tolerance to straight chain alcohols through vacuolar acidification [22]. The category that is upregulated the greatest during the early time points, cellular bud, is composed of genes involved in creating a protuberance from the mother cell to create a daughter cell, which have not been previously implicated in ethanol stress adaptation. This group of genes have functions in polarized growth, localization of proteins to either mother or daughter cell, cytokinesis, and cell wall formation [26].

Some of the processes upregulated from Fig 1D and 1E are related to damages that are known to be caused by ethanol. The dominant process by which yeast cells die from high ethanol concentrations is increased membrane fluidity and subsequent decrease in membrane integrity [27]. Other biological functions are also damaged upon ethanol exposure [28], which are summarized in Table 1, along with how the cells in our experiments responded to ethanol stress in that category. The upregulation of processes that are normally disrupted by ethanol suggests that our post-stress cells are mounting a response to counteract the damaging effects of ethanol.

Table 1. Known influence of ethanol on yeast cells and its corresponding post-stress response in our dataset.

Ethanol influence Response to threshold lethal ethanol stress
increased membrane fluidity upregulation of lipid biosynthesis
inhibition of H+-ATPase upregulation of H+-ATPases
inhibition of transport processes upregulation of lipid transport
disruption of vacuole morphology upregulation of vacuolar functions

The functional category that shows the greatest downregulation is sugar transporter activity. Other transport processes, such as ammonium transport and organic acid transport, are also downregulated in response to ethanol stress in our data, but to a lesser extent. Transport processes play an important role in the ethanol stress response, with some reports of general inhibition of transport processes [29] as well as reports of an increase of transport processes, specifically hexose transport [30] under mild ethanol stress. Deletion of transport genes has also been shown to hurt survival when yeast cells were exposed to mild ethanol stress [20]. Vesicle-mediated transport was upregulated in our dataset, suggesting both an increase and decrease of transport processes at threshold lethal ethanol stress, depending on the substrate being transported.

Two categories, spore wall assembly and condensed chromosome, show an initial decrease during the early recovery period with a subsequent increase in gene expression at 60 minutes of recovery (Fig 1D, cluster 2. Average expression change shown in Fig 1E). Chromosome condensation occurs during meiosis in yeast [31]. Meiosis and spore formation are processes that are specific to diploid yeast [32], and their surprising modulation in haploid yeast suggests their potentially novel adaptive value in response to acute lethal ethanol stress. The application of FIRE [33], a cis-regulatory motif discovery algorithm, on cluster 2 of Fig 1D revealed two overrepresented motifs (S2 Fig). One of these was the URS1 motif (5’-GGCGGC-3’), which is recognized by UME6/IME1, a major transcriptional regulator of early meiosis genes [34, 35]. While UME6 directly binds the URS1 motif and is a key transcriptional repressor of early meiosis genes, IME1 activates transcription of these genes through its interaction with UME6. Fig 1F shows the expression changes of UME6 and IME1 in relation to the average expression changes of spore wall assembly and condensed chromosome genes. The initial decrease in spore wall assembly and condensed chromosome expression could be explained by an upregulation of the repressor UME6 and downregulation of the activator IME1, but by 60 minutes post-stress, the activating effects of IME1 dominate.

Contribution of all non-essential genes to survival under acute exposure to lethal ethanol stress

Transcriptional responses to extreme stress can reflect pathways that may be adaptive. Alternatively, these gene expression dynamics may reflect nonadaptive or even maladaptive responses that may only be of value within the organism’s native habitat [36]. In order to systematically determine the contribution of yeast genes to acute lethal stress, we carried out, in triplicate, fitness profiling of a pooled haploid yeast deletion library [37] upon exposure to lethal ethanol stress (Fig 2A). We used 24.5% ethanol, which is the concentration at which 1% of the wild-type population survives after a 2-minute exposure. The inclusion of a post-stress outgrowth phase reduced the likelihood that some mutants may achieve better survival due to a severe growth defect. This haploid library contains 4,500 deletions of most non-essential genes, with each gene deletion represented by a unique 20-nucleotide barcode [37]. Comparing the abundance of post-stress gene deletions to pre-stress gene deletions, we were able to systematically quantify the effects of each gene deletion on survival.

Fig 2. Utilizing the pooled yeast deletion library to determine contributions of all non-essential genes to survival.

Fig 2

(A) Procedure used to perform stress assay on yeast cells and to determine contribution of each gene deletion to survival. (B) Histogram of fitness (survival) scores. (C) Maximum gene expression fold change versus statistically significant fitness scores to determine concordance between a gene’s transcriptional response and its contribution to stress survival. (D) Boxplot showing that negative fitness scores have a significant positive expression change (p < 2.2 x 10−16), and positive fitness scores have a significant negative expression change (p = 1.9 x 10−13).

This analysis revealed gene deletions that significantly increased or decreased survival. There were 192 gene deletions that significantly improved survival and 735 gene deletions that significantly diminished survival (see Materials and Methods). The list of the top gene deletions with positive and negative fitness effects are shown in Table 2. For the gene deletions that diminished survival, six out of the top twenty have vacuolar functions, suggesting their essentiality for yeast survival under lethal ethanol stress. For the gene deletions that improved survival, five out of the top twenty are non-essential ribosomal subunits [38], three are mitochondrial proteins [3941], and two are in the TOR (target of rapamycin) pathway [42, 43]. Increased survival from deletion of ribosomal and mitochondrial genes are consistent with prior yeast deletion studies showing a similar benefit under various other stresses [8, 44]. Decreased expression of TOR pathway components is well known to increase survival under a broad range of stresses [4547]. More ribosomal genes are revealed if we expand the list to the top 100 gene deletions. In fact, when we performed iPAGE analysis on the full range of scores, we found significant enrichment for ribosome genes at the positive end of the fitness distribution, suggesting that ablation of non-essential components of translation are beneficial under acute lethal stress (S3 Fig).

Table 2. Top 20 most enriched and depleted gene deletions upon exposure to lethal ethanol stress based on fitness score.

ENRICHED
Gene Name Systematic Name Score Description
AAH1 YNL141W 8.26 adenine deaminase
LTV1 YKL143W 8.05 EGO/GSE complex subunit, upstream of TOR complex
FTR1 YER145C 7.72 iron permease
RPL13A YDL082W 7.72 ribosomal 60S subunit
SNT1 YCR033W 7.71 deacetylase, positive regulation of stress-activated MAPK cascade
AFG3 YER017C 7.59 mitochondrial metallopeptidase
RPS16A YMR143W 7.47 ribosomal 40S subunit
TRM13 YOL125W 7.38 Methyltransferase
EAP1 YKL204W 7.15 translation initiation factor, TOR pathway
RPL14A YKL006W 6.90 ribosomal 60S subunit
RPL16B YNL069C 6.80 ribosomal 60S subunit
PIL1 YGR086C 6.51 eisosome assembly
KSS1 YGR040W 6.11 MAP kinase
PET117 YER058W 5.86 electron transport chain
ASF1 YJL115W 4.20 nucleosome assembly factor, stress response
MRP7 YNL005C 4.02 mitochondrial ribosomal large subunit
VPS24 YKL041W 3.81 vacuolar protein sorting
CTR1 YPR124W 3.74 copper transporter
REG1 YDR028C 3.49 protein phosphatase regulator
GAT2 YMR136W 3.34 transcription factor
DEPLETED
Gene Name Systematic Name Score Description
VPS69 YPR087W -12.4 vacuolar protein sorting
SIW14 YNL032W -6.92 tyrosine phosphatase
NGG1 YDR176W -6.81 Acetyltransferase
YJL047C-A YJL047C-A -6.79 unknown function
DGA1 YOR245C -6.38 acyltransferase, triglyceride biosynthesis
INO2 YDR123C -6.34 transcription factor, phospholipid biosynthesis
IRC23 YOR044W -6.16 unknown function
VPS13 YLL040C -5.97 vacuolar protein sorting
SUE1 YPR151C -5.96 degradation of cytochrome c
UGA4 YDL210W -5.79 GABA transport, located on vacuole membrane
MON1 YGL124C -5.70 guanine nucleotide exchange factor, located on vacuole membrane
DUR3 YHL016C -5.64 putrescine, spermidine, urea transporter
ISN1 YOR155C -5.53 nucleotidase, breaks IMP to inosine
AHK1 YDL073W -5.52 scaffold protein, important in osmotic stress
YCF1 YDR135C -5.32 glutathione transporter, located on vacuole membrane
PMC1 YGL006W -5.28 ATPase, located on vacuole membrane
YGL015C YGL015C -5.25 unknown function
YGL140C YGL140C -5.24 unknown function
ICL1 YER065C -5.24 isocitrate lyase, induced by growth on ethanol
TUF1 YOR187W -5.24 mitochondrial translation elongation factor

S2 Table summarizes the pathways and genes that are affected during mild ethanol stress exposure and compares the directionality of their post-stress responses to the response at threshold of lethality determined here. From the top section of the table, it is clear that all pathways affected by mild stress are also affected in the same direction in both our transcriptional profiling and deletion library experiments. At the gene level, however, only 20 out of 50 genes trend in the same direction from our RNA-seq data, and only 8 out of 50 genes agree from our deletion library data. Individual genes do not overlap significantly between mild and lethal ethanol stress. In fact, even between 8% and 11% ethanol, different genes were associated with ethanol tolerance [28]. However, on the pathway level, there is significant agreement between the responses to mild and lethal ethanol stress.

To determine whether the transcriptional reprograming was adaptive, we asked whether there was a significant association between the fitness effect of a gene deletion and the maximal transcriptional change of a gene across the post-stress time course. Plotting all significant positive and negative fitness scores of gene deletions against their maximal post-stress expression fold-change, we noticed that ~85% (639 of 754) of all significant genes exhibited a negative relationship (Fig 2C and 2D), suggesting that much of the global transcriptional reprograming likely plays an adaptive role under acute lethal ethanol stress.

Experimental evolution of increased survival upon lethal ethanol stress

The genetic perturbations in the yeast deletion library enabled us to determine the extent to which loss-of-function mutations substantially improves survival of yeast cells to lethal ethanol stress. We were curious to what extent random mutations and selection may drive improved lethal stress survival and whether gene expression reprogramming may be a key element in the improved survival. To this end, we developed a laboratory experimental evolution paradigm in which wild-type haploid yeast cells were exposed to lethal ethanol stress and then recovered in an outgrowth phase over multiple cycles of evolution. In each round, cells were first grown to saturation in rich media, diluted and grown until mid-log phase, then exposed to two minutes of lethal ethanol stress. The surviving cells were then regrown to saturation, thus starting the next round of selection (Fig 3A). Whereas some studies use nutrient-limited media during the regrowth phase so as to minimize growth-based competition [48], we wished to avoid accumulation of mutations that cause generic slow-growth, which would be a trivial solution to lethal stress survival. Our strategy favored mutations that increased survival without compromising bulk growth rate. As such, we decided to recover the cells in rich media following lethal stress exposure. Since slow-growing beneficial mutations will be positively selected for during stress exposure and negatively selected for during recovery, it may explain the non-monotonic and cyclical pattern of survival throughout the laboratory evolution process (S4 Fig).

Fig 3. Laboratory experimental evolution to repeated acute lethal ethanol stress selects for mutants with substantially enhanced survival.

Fig 3

(A) Laboratory evolution protocol. At every round of selection, survival was measured by plating, and experiments were stopped when survival was enhanced substantially beyond the baseline level of 1%. (B) Fraction survival of the naive wild-type strain (black), evolved population (red), and 3 distinct clones from the evolved population (green). Horizontal lines indicate the average survival of each of the replicates. JY304 is derived from the colony with the highest percent survival. (C) Analogous to Fig 1A, comparing the fraction survival of strain JY304 to the wild-type strain at a range of ethanol concentrations, from 19% to 26%. Error bars indicate standard error. (D) Growth curves of strain JY304 and wild-type strain. (E) Testing cross-protection of cells evolved under ethanol stress, compared to the wild-type strain, stressed at 70 mM hydrogen peroxide. Error bars indicate standard error. (F) Same as D except with heat stress at 57°C.

Experimental evolution was carried out in triplicate populations. The lethal selection was calibrated to have a baseline survival of ~1%. The best performing evolved population showed an average of ~35% survival compared to the parental strain (Fig 3B, red vs. black). Individual colonies exhibited an average survival of at least 10% (Fig 3B, green). The colony with the highest average fraction survival (hereinafter referred to as strain JY304) was chosen for subsequent phenotypic and molecular analyses. We first determined the survival advantage of strain JY304 across a range of ethanol concentrations (Fig 3C). At the highest concentration tested (26%), we saw nearly a hundred-fold increase in survival. Remarkably, this survival advantage was not accompanied by any significant reduction in the bulk growth rate of the population (Fig 3D).

Cross-resistance of the evolved strain across orthogonal lethal stresses

The survival advantage of the strain JY304 may be due exclusively to ethanol-specific advantages conferred by the underlying mutations. Alternatively, at least some of the survival advantage may be due to more general survival effects beyond lethal ethanol stress. To see any evidence for such cross-resistance, we determined haploid yeast survival to orthogonal stresses: 70 mM hydrogen peroxide and 57°C heat stress, both for a duration of two minutes. As can be seen in Fig 3E and 3F, strain JY304 showed significantly higher survival for both stresses, suggesting that at least part of the survival advantage is non-specific to ethanol.

Evolution of transcriptional responses in the evolved hyper-surviving strain

The evolved strain JY304 may achieve superior ethanol survival due to an improved ability to reprogram gene expression during the minutes and hours following exposure to lethal stress. Alternatively, some of the survival advantage may be due to establishment of a pre-stress cellular state that is more resistant to lethal stress. In order to determine the extent to which these differing strategies may contribute to survival, we carried out transcriptional profiling of strain JY304 exactly as performed for the parental wild-type strain. The parental strain showed a dramatic shift in gene expression in the fifteen minutes post-stress, repressing and inducing a large number of genes that led to a substantial divergence in the global transcriptional state, followed by a gradual recovery of gene expression back towards the pre-stress patterns over an hour (Fig 1C). The evolved strain, however, exhibited a less dramatic shift in gene expression that was largely maintained in the post-stress period without significant recovery (Fig 4A).

Fig 4. Transcriptional responses of an extreme ethanol stress survivor.

Fig 4

(A) Correlation between each of the post-stress time points to the pre-stress time point for both strain JY304 and the wild-type strain. (B) Clustering of the time-course gene expression data using k-means with 10 clusters for strain JY304. Gene ontology analysis was performed on each of the clusters, and significant functional categories (p<0.001) are shown for each cluster. For comparison, the heatmap for the wild-type time-course gene expression clustering is shown to the left. Note: The significant functional categories for strain JY304 do not apply to the wild-type heatmap, which is unaltered from Fig 1D. (C-E) Average expression of the three functional categories that are significantly (p<0.001) up- or downregulated in the wild-type strain in response to ethanol stress (right), along with a boxplot of their corresponding pre-stress expression in strain JY304. The categories are kinase (C) (p < 2.2 x 10−16), ribosomal protein (D) (p = 0.005415), and translation (E) (p = 0.00324).

To discover significant patterns of gene expression, we performed unsupervised clustering using the k-means algorithm with k = 10. This revealed gene expression clusters, six of which showed the same enrichment in functional categories as observed in the parental strain. Three of these categories were upregulated (vesicle, proteasome complex, protein refolding) and three were downregulated (ribosomal protein, ribosome biogenesis, nucleosome). Although the directionality of these gene expression dynamics was similar to the parental strain, the magnitude of change was significantly different. All six categories showed a lower magnitude of change in strain JY304 compared to the wild-type strain. The overall lower magnitude of change is evident in the comparison of the heat maps (Fig 4B).

In addition to performing k-means clustering, we also carried out hierarchical clustering. The resulting dendrogram is shown in S5 Fig. Clustering by both genes and time points, we see that the 15-minute and 30-minute post-stress time points are most similar, with the pre-stress time point differing the most from all the post-stress time points. This pattern is the same as that of the wild-type strain.

To take a closer look at the pre-stress state of the evolved and parental strains, we compared the global expression of genes in strain JY304 to the wild-type strain during the exponential growth phase in rich media in the absence of stress. Remarkably, we saw significant differences in pre-stress gene expression states: 266 genes were higher in expression more than two-fold and 52 genes were lower in expression more than two-fold between strain JY304 and the wild-type strain. Table 3 contains a list of the twenty most highly differentially expressed genes. Many of the most highly differentially expressed genes are of unknown function, suggesting the potential importance of novel genes and pathways that have yet to be elucidated, but may play an important role in the ethanol stress response. There are also several categories of genes that are seen in both the increased and decreased expression categories: transposable element, heat shock protein, helicase, and mitochondrial protein.

Table 3. Top 20 most differentially expressed genes in both the positive and negative directions in strain JY304 compared to the parental strain during exponential growth.

INCREASED EXPRESSION
Gene Name Systematic Name Fold increase Description
YMR046C YMR046C 26.7 transposable element
YKL131W YKL131W 6.7 unknown function
YLR410W-A YLR410W-A 6 transposable element
HSP32 YPL280W 5.5 heat shock protein
YBL111C YBL111C 4.9 helicase-like protein
YHL037C YHL037C 4.8 unknown function
YHL005C YHL005C 4.8 unknown function
YGL235W YGL235W 4.4 unknown function
ATP6 Q0085 4.3 mitochondrial protein
AI1 Q0050 4.2 mitochondrial protein
YPL060C-A YPL060C-A 3.8 transposable element
SDP1 YIL113W 3.8 stress-inducible MAP kinase phosphatase, shifts location upon heat stress
YDR261C-C YDR261C-C 3.7 transposable element
YPR136C YPR136C 3.7 unknown function
YBR224W YBR224W 3.6 unknown function
RRT16 YNL105W 3.5 unknown function
COX3 Q0275 3.4 mitochondrial protein
AI2 Q0055 3.4 mitochondrial protein
YPR197C YPR197C 3.3 unknown function
COB Q0105 3.2 mitochondrial protein
DECREASED EXPRESSION
Gene Name Systematic Name Fold decrease Description
YGL088W YGL088W 75.9 unknown function
YDR545C-A YDR545C-A 38.3 unknown function
SNA3 YJL151C 9.8 vesicular sorting of proteins to vacuole
YIL177C YIL177C 7.9 helicase
SRB6 YBR253W 6.7 RNA polymerase II subunit
CUE4 YML101C 5.2 unknown function
YGR027W-A YGR027W-A 4.9 transposable element
TAR1 YLR154W-C 4.7 mitochondrial protein
YLR156W YLR156W 3.9 unknown function
COX13 YGL191W 3.8 mitochondrial protein
PGA2 YNL149C 3.6 protein transport
HSP33 YOR391C 3.4 heat shock protein
HHT1 YBR010W 2.9 histone H3, rRNA transcription
YBR064W YBR064W 2.8 unknown function
COF1 YLL050C 2.8 golgi to plasma membrane transport
YAR010C YAR010C 2.8 transposable element
YJR028W YJR028W 2.8 transposable element
YPR137C-A YPR137C-A 2.8 transposable element
RPB9 YGL070C 2.7 RNA polymerase II subunit
HTB2 YBL002W 2.5 Histone H2B

To explore the difference between the pre-stress state of strain JY304 and the parental strain at the level of significantly enriched pathways, we performed iPAGE analysis, which revealed 53 significant gene ontology terms with significant differences in expression (p<0.001), clearly showing a difference in the pre-stress cellular state between these two strains (S3 Table). Examination of the three most significant functional categories (kinase, ribosomal protein, and translation) showed that in strain JY304, there was a reprogramming of gene expression such that its pre-stress state was shifted towards that of the wild-type strain at 15 minutes post-stress (Fig 4C–4E). This suggests that strain JY304 is already in a more stress-resistant state during normal growth and is better prepared to survive an acute transition to lethal stress. In fact, when we compared the pre-stress expression profile of strain JY304 to the post-stress expression profile of the wild-type strain, we noticed a striking Pearson correlation of 0.88 between the two expression profiles. The kinase, ribosomal protein, and translation categories are all part of a general stress response, explaining why strain JY304 also better survives hydrogen peroxide and heat stress (Fig 3E and 3F).

Discussion

We have examined yeast survival and adaptation to acute exposure to lethal ethanol stress. A novel aspect of our experimental design is that the two-minute ethanol exposure minimizes the time for cells to mount a transcriptional response, making the cell’s survival dependent on either its pre-existing state prior to the onset of stress or transcriptional response following the stress. Many of our results, however, are consistent with findings from previous yeast stress experiments. A two-minute exposure to threshold lethal ethanol stress is enough to activate the repressed portion of the ESR, as seen by the significant downregulation of ribosome biogenesis, ribosomal proteins, and translation in our data. We did not, however, see a significant upregulation of genes induced in the ESR. While the ESR shows twice as many genes downregulated (~600) than upregulated (~300) (4), we see five times as many genes downregulated (~1500) than upregulated (~300). Additionally, while the induced and repressed responses of the ESR show equal but opposite magnitude, our repressed response was much stronger, between a two-fold and eleven-fold downregulation on average for significantly repressed functional categories. In contrast, all our most significantly upregulated functional categories were only upregulated less than two-fold, on average (Fig 1E). It would be interesting to explore other stresses at the threshold of lethality to see if they show a similar imbalance between their upregulated and downregulated responses. S6 Fig summarizes the most important functional categories we discovered in response to ethanol stress at the threshold of lethality.

Two gene functional categories, chromosome condensation, which only occurs during meiosis, and spore wall assembly, have only previously been known to occur in diploid yeast. Their significant downregulation shortly after acute ethanol stress suggests a possible adaptive role. In diploid yeast, starvation stress propels yeast cells to undergo meiosis and sporulation [49], but the downregulation of these genes in our data may indicate a novel function. Chu et al., 1998 [50] performed time-course transcriptional profiling during meiosis in yeast to determine all the genes that were significantly induced during meiosis, categorizing them into early, early middle, middle, and late middle stages. The genes from our chromosome condensation and spore wall assembly categories that overlapped with their data were all found to be induced in the early stage of meiosis. Most of the genes known to be involved in the early stage of meiosis function in meiotic prophase, which consists of pairing of homologous chromosomes and recombination. About one-third of these 62 genes contain, in their upstream region, the conserved URS1 motif, which was also found in our analysis. Under heat shock, protein binding at URS1 is lost [51], which allows HSP82 to be de-repressed and subsequently activate HSF1 [52]. How this process works in haploid yeast is unknown. Moreover, the role of the URS1 element under ethanol stress has not been previously studied.

It is important to note that the pooled yeast deletion library contains only non-essential gene deletions. It is likely that some essential genes also play an adaptive role in lethal ethanol stress survival, but they are not accessible to examination in the deletion library. A possibly way to test those genes would be to use temperature-sensitive mutants, a heterozygous diploid library, or CRISPR-interference [53].

When comparing the response to ethanol at 20% (transcriptional profiling of wild-type cells) versus the response at 24.5% ethanol (fitness profiling of deletion library), we are making the assumption that the core response to ethanol stress is similar across the regime spanning 20–24.5% ethanol. As shown by the top section of S2 Table, the pathways affected by mild ethanol stress versus acute lethal ethanol stress are very much in agreement, and we believe this core response extends into the realm of lethality. For example, downregulation of ribosomal proteins and translation are universal responses at various ethanol concentrations below, at, and above 20% ethanol. We do acknowledge, however, that there may be some differences in the transcriptional responses between 20% and 24.5% ethanol. Our analysis therefore attempts to capture the most significant global similarities and differences.

The question of whether the post-stress transcriptional response in our wild-type cells is adaptive is a difficult one to conclusively answer. We believe that it does confer a fitness benefit for a couple of reasons. First, our pooled yeast deletion library experiments showed a significant negative association between transcriptional change and fitness, as shown in Fig 2C and 2D. Second, as shown in Table 1, the post-stress upregulation of lipid biosynthesis, ATPases, lipid transport, and vacuolar functions, all of which are normally disrupted by ethanol, suggests that the cells have mounted a response to counteract the damaging effects of ethanol. However, in order for us to conclusively demonstrate that our post-stress cells are adaptive, additional experiments would need to be performed to test individual genes of interest.

Recent studies suggest that stress defense and growth rate cannot be optimized independently of each other. Zakrzewska et al., 2011 [8], using the haploid pooled yeast deletion library, demonstrated a growth rate of 0.34 doublings per hour corresponding to a 1% survival and a growth rate of 0.26 doublings per hour corresponding to 30% survival, regardless of the type of stress used. Lu et al., 2009 [7], using heat stress, demonstrated a growth rate of 0.44 doublings per hour corresponding to 1% survival and a growth rate of 0.22 doublings per hour corresponding to 30% survival. Both of these studies clearly demonstrated a negative correlation between growth rate and stress survival. Our study, however, showed that our evolved strain JY304, with a survival greater than 30%, had a bulk growth rate comparable to that of the wild-type strain.

While it may seem that we have evolved a strain that is able to optimize both growth rate and stress survival, we do not know the distribution of growth rates in the population. It is possible that strain JY304 exhibits a bet-hedging effect in which a small fraction of the population grows at a slow rate and, thus, is partially protected from acute lethal stress. Although we have clearly shown that part of the increased survival of strain JY304 is due to a bulk gene expression shift to a post-stress state, we are unable to determine whether and how much additional survival benefit is achieved through a slow growing subpopulation since our experiments only measured bulk growth rate.

While the survival advantage of strain JY304 was not accompanied by any significant reduction in the bulk growth rate of the population, there is a possibility that certain environments exist in which strain JY304 would exhibit lower fitness than the wild-type strain. Just like the ESR conveys general stress protection, it does not explain behavior in some laboratory stresses, such as various nutrient deprivation [6]. It is certainly possible that strain JY304 does not perform optimally in those environments as well. Additionally, this lack of tradeoff between growth rate and survival applies to acute lethal stresses, but we have not determined how the two strains compare under stresses of long durations. How our evolved strain holds up in numerous other laboratory conditions and environments would be an important subject for future studies.

We have shown that acute exposure of S. cerevisiae to ethanol at levels beyond 20% leads to exponential loss of viability. We have determined that the response of haploid yeast cells at the threshold of lethality is characterized by global reprogramming of gene expression largely matching the ESR response in the downregulated genes but with additional unique features including pathways that operate during meiosis in diploid cells. Parallel survival profiling of the yeast deletion library under lethal ethanol stress suggests that much of the post-stress transcriptional reprogramming is adaptive. We utilized laboratory experimental evolution to determine the extent to which survival to lethal ethanol stress could be enhanced and identified strains that had substantially improved survival across a range of ethanol concentrations beyond 20%. Contrary to expectation, we found that enhanced survival was not accompanied by a reduction in bulk growth-rate. Transcriptional profiling of one such hyper-resistant strain showed that, at least, part of the survival advantage can be attributed to regulatory rewiring that establishes a pre-adapted transcriptional state in non-ethanol stressed cells. Our studies provide novel insights into the mechanisms of adaptation to acute lethal stress and the strategies by which cells may improve survival.

Materials and methods

Media and growth conditions

We used YPD broth (10 g/L Bacto yeast extract, 20 g/L Bacto peptone, 20 g/L glucose) and YPD agar plates (YPD broth with 20 g/L Bacto agar) for routine growth of yeast strains. All experiments were performed using standard complete + glucose (sc+glu) media (6.7 g/L yeast nitrogen base (Difco), 2 g/L yeast synthetic drop-out mix (US Biologicals), 20 g/L glucose) and sc+glu plates (sc+glu media with 20 g/L Bacto agar). All growth on plates occurred at 30°C. All growth in liquid media also occurred at 30°C and shaking at 220 rpm in an Innova 42 incubator (New Brunswick). To test growth rate, the number of cells were tracked by measuring optical density at a wavelength of 660 nm using an Ultrospec 3100 pro spectrophotometer (Biochrom).

Yeast strains

All yeast strains were derived from BY4741 (Mat a his3Δ1 leu2Δ0 met15Δ0 ura3Δ0) [54], which is the strain we refer to as wild-type. All deletion strains were obtained from the S. cerevisiae knockout collection [55].

Stress experiments

All stress experiments, regardless of background or using the pooled yeast deletion library, were performed identically. Cells were first grown to mid-log phase in 25 mL sc+glu in a 250-mL flask at 30°C and then washed. They were transferred to 50 mL Falcon tubes and centrifuged for five minutes at 3000 rcf to pellet in an Allegra 25R centrifuge (Beckman Coulter). The supernatant was discarded, and the cells were resuspended in 25 mL deionized water. They were again centrifuged for five minutes at 3000 rcf to pellet. The supernatant was discarded, and the cells were resuspended in 1 mL of deionized water. They were then centrifuged at 20,000 rcf to pellet on a benchtop centrifuge. The supernatant was discarded, and the cells were resuspended in 600 microliters of deionized water. The pre-stress time points for all experiments were taken from this cell suspension.

To stress the cells with ethanol or hydrogen peroxide, 400 microliters of the suspension was added to 600 microliters of solution containing the appropriate stress, immediately vortexed, set at room temperature for two minutes, vortexed again, and immediately removed from the stress. The 600 microliters of solution contained the level of the stressor such that the final 1 mL of cell suspension contained the desired concentration of ethanol or hydrogen peroxide. For example, if the cells were to experience a stress level of 20% ethanol, 200 microliters of 100% ethanol were added to 400 microliters of deionized water. As soon as 400 microliters of cells were added to this solution, the final 1 mL volume of cells would immediately encounter the 20% ethanol stress. In the case of heat stress, 400 microliters of the pre-stress cell suspension were added to 600 microliters of deionized water. This 1 mL of cell suspension was vortexed, placed in a water bath at the desired temperature for two minutes, vortex again, and immediately removed from the stress.

For ethanol and hydrogen peroxide stress, the stress was removed through dilution. The 1 mL of stressed cells was diluted tenfold into deionized water and vortexed. The post-stress time points for all experiments were taken from this final cell suspension, whether it be for recovery or plating. A control experiment was performed in which cells were subjected to the tenfold diluted concentration of the desired stress. They were in this mild stress for four hours and plated periodically on sc+glu plates. There was no loss in viability in any of the tenfold diluted concentrations of either hydrogen peroxide or ethanol stress.

For all experiments in which fraction survival was calculated, 100 microliters were removed from the pre-stress and post-stress cell suspension for serial dilutions in deionized water and then plated on sc+glu plates. The number of colonies (CFU) from the plates were counted daily until the CFU count no longer increased. The number of cells before and after stress were calculated from the CFU counts. Fraction survival was defined as the ratio of post-stress cells to pre-stress cells.

Transcriptional profiling using RNA-seq

Diagrammatically shown in Fig 1B, there were five time points taken for each experiment, which will be referred to as growth, pre-stress, 15 minutes post-stress, 30 minutes post-stress, and 60 minutes post-stress. Yeast colonies were picked from YPD plates and grown overnight in 2 mL of sc+glu media at 30°C until saturation. The next day, cells were back-diluted 1:200 into 25 mL of fresh, prewarmed sc+glu media in a 250-mL flask and grown for 6 hours at 30°C. Before washing the cells in preparation for ethanol stress exposure, 1.5 mL of cells were removed and centrifuged at 20,000 rcf for 1 minute to pellet. The supernatant was removed, and the pellet was immediately frozen and stored at -80°C. This sample is used to determine gene expression levels in the “optimal” growth conditions. The rest of the 23.5 mL of cells were then washed and stressed as described above in “Stress experiments”. From the 600-microliter pre-stress cell suspension, 150 microliters were removed, pelleted, and frozen, similar to the growth time point. This sample is the pre-stress time point, used to determine gene expression levels immediately prior to stress exposure. The cells were recovered from the ethanol stress in deionized water. During this recovery period, 1.5 mL of cells were removed at 15 minutes, 30 minutes, and 60 minutes to pellet and freeze. All samples were stored at -80°C until preparation for sequencing.

Fitness profiling of a pooled haploid yeast deletion library

Diagrammatically shown in Fig 2A, the pooled yeast deletion library was thawed from a frozen stock and grown in 25 mL of sc+glu media in a 250-mL flask at 30°C until mid-log phase. Samples were then washed and stressed as described above in “Stress experiments”. 150 microliters of the pre-stress cell suspension was saved as the pre-stress time point sample. The post-stress cell suspension was subjected to an outgrowth period in sc+glu media at 30°C until the cells reached early log phase, which was then saved as the post-stress time point sample. All experiments were performed with 24.5% ethanol and in triplicates.

Laboratory experimental evolution for enhanced survival to lethal ethanol stress

Diagrammatically shown Fig 3A, yeast colonies were picked from YPD plates and grown overnight in 2 mL of sc+glu media at 30°C until saturation. The next day, cells were back-diluted 1:200 into 25 mL of fresh, prewarmed sc+glu media in a 250-mL flask at 30°C, and grown for six hours. The cells were then washed and stressed, and fraction survival was also calculated as described above in “Stress experiments”. From the ten-fold diluted post-stress cell resuspension, 500 microliters were added to 2 mL of sc+glu media and regrown in 30°C until saturation, thus starting the next round of evolution. Whenever cells were back-diluted 1:200 for the six-hour growth, 300 microliters of cells were frozen and stored in -80°C to capture the cellular state at every round of evolution. All experiments continued for 10–12 rounds of evolution. Three parallel lines of laboratory evolution were performed for any given strain background and stress condition. At the end of the evolution experiment, one evolved population from each replicate line was chosen for further analysis and for sequencing.

These experiments were designed in such a way as to select for both stress defense as well as fast growth. While certain laboratory evolution studies use nutrient-limited media during the recovery period after stress to limit selection for strains that grow faster or recover from the stress faster [48], we wished to avoid accumulation of mutations that cause generic slow growth, which would be a trivial solution to lethal stress survival given the established link between growth rate and stress defense. This strategy favored mutations that increased survival without compromising growth rate or recovery time. Since slow-growing mutations will be positively selected for during stress exposure and negatively selected for during recovery, we saw non-monotonic and cyclical patterns of survival. As such, the last round of evolution was not necessarily when the evolved cells survive the best to lethal stress. Upon noticing this observation, we altered our approach for choosing the evolved population to use for sequencing and other analyses. We selected the evolved population that was highest for surviving lethal stress based on the fraction survival data from the platings, rather than just using the evolved population from the last round of evolution.

Each evolved population was tested for stress survival under the same stress used to evolve them, using the protocol described above in “Stress experiments”. The population was then streaked on sc+glu plates and individual colonies were chosen to test for survival. We avoided picking the smallest colonies so as to not bias for slow growing cells. At least six colonies from each population were tested for survival. The highest surviving colony overall was used for transcriptional profiling by RNA-seq.

Transcriptional profiling by RNA-seq

RNA was isolated using the YeaStar RNA Kit (Zymo Research). Between step 5 and 6 of the protocol, the sample was treated with DNase I (Sigma-Aldrich). An in-column DNase digestion was performed according to Appendix A of RNA Clean & Concentrator-5 (Zymo Research). From the isolated RNA, rRNA was removed using the Ribo-Zero rRNA Removal Kit (Illumina). Samples were barcoded and prepared for sequencing using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs). All samples were pooled and sequenced using a NextSeq 500 sequencer (Illumina).

Sequencing of fitness profiling experiment

DNA was isolated with the YeaStar Genomic DNA Kit (Zymo Research) and the pooled deletion library barcodes were amplified in parallel for subsequent sequencing. For a given gene deletion, it is replaced, immediately downstream of the start codon, with an 18-nucleotide universal priming site U1 (GATGTCCACGAGGTCTCT), a unique 20-nucleotide TAG sequence, another 18-nucleotide universal priming site U2 (CGTACGCTGCAGGTCGAC), a 1537 base pair KanMX cassette that contains the KAN gene, a 19-nucleotide universal priming site D2 (CGAGCTCGAATTCATCGAT), a different unique 20-nucleotide TAG sequence, a 17-nucleotide universal priming site (CTACGAGACCGACACCG), and ends with a TAA stop codon, which replaces the normal stop codon for that gene. The KAN gene confers resistance to the antibiotic kanamycin in bacteria and the antibiotic geneticin in yeast. Since not all gene deletions had an annotated downstream TAG, only the upstream TAG was sequenced.

In order to use Illumina platform for sequencing, Illumina compatible adapter were required to be added to the TAG sequence. We decided to use the Illumina Truseq adapters. The two universal priming sites (U1 and U2) were used to add the Truseq adapters. This was performed using two rounds of PCR that resulted in a final sequence of the form AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTN[611]ATGGATGTCCACGAGGTCTCTNNNNNNNNNNNNNNNNNNNNCGTACG CTGCAGGTCGACAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG. The sequence is flanked by 5’ and 3’ ends of the Illumina Truseq adapters (normal font), with the underlined sequence indicating a specific sequence for multiplexing different samples. We used Truseq adapters 2, 4, 5, and 6. The bold, bold/underlined, and bold/italic sequences represent the U1, TAG, and U2 sequences, respectively. The italic section indicates custom-made internal indices (ATCACG, TTAGGCG, ACTTGACG, GATCAGTAG, TAGCTTACAG, GGCTACGAGTG) for additional multiplexing. These internal indices were made in such a way as to minimize failure during sequencing due to overabundance of one type of nucleotide. All samples were pooled and sequenced using a NextSeq 500 sequencer (Illumina).

Pre-processing of sequencing results

All sequencing reads were first separated based on sample number using bcl2fastq conversion software (Illumina). For RNA-seq, sequencing reads were clipped to remove Illumina adapter sequences (AGATCGGAAGAGC) using cutadapt [56]. They were then trimmed using Trimmomatic 0.33 [57] to remove end bases with a quality score below three and retain only the part of the read that has quality score above fifteen using a four-base sliding window. Reads that were less than ten base pairs as a result of this trimming were discarded. For the deletion library data, a second demultiplex step, using a custom-written script, was performed after the initial bcl2fastq to separate samples based on internal staggered indices. By searching for the U1 and U2 primer sequences, we were able to find the unique 20-nucleotide TAG sequence in each sequencing read. All reads that did not contain a TAG sequence were discarded.

Mapping of sequencing reads

For the RNA-seq data, reads were aligned to the reference transcriptome of S. cerevisiae strain S288C (https://downloads.yeastgenome.org/sequence/S288C_reference/orf_dna/) using kallisto [58]. Most of our samples had greater than 90% of their reads mapped to the S288C transcriptome, with the lowest at 85.6%. The counts for each gene from the kallisto output were expressed in the normalized form, transcripts per million (TPM). TPM counts for each sample were then combined into a matrix, and genes in which all samples had a raw read count below ten were discarded from further analysis.

For the deletion library data, reads were mapped to the reference file of all TAG sequences using bowtie2, default settings [59]. All reads that mapped to multiple TAG sequences were discarded. A total of 4,563 gene deletions were represented in our samples. The total number of TAG sequences was normalized across all samples, and all gene deletions in which the read count was less than ten was discarded.

Clustering of RNA-seq data and functional category analysis

For clustering, all genes in which the coefficient of variation across all time points was below 0.2 were removed. The remaining genes were clustered in R using k-means, with a range of cluster sizes from 5–30. The genes and their cluster designations were used as input to iPAGE (Pathway Analysis of Gene Expression) to identify the likely pathways that are overrepresented in each of the clusters [14]. We decided to use a cluster size of ten for all downstream analyses because it provided the best balance between the number of distinct transcriptional dynamics and minimal redundancy in the pathways that were enriched within them. As can be seen from Fig 1D, one of the ten clusters (cluster 8) does not have any significant pathways. Increasing the number of clusters increases the number of empty clusters. To expand the list of relevant pathways, iPAGE analysis was also performed on each of the individual post-stress time points after being mathematically zero-transformed by the pre-stress time point. The full list of pathways was then filtered for only significant terms (p<0.001). The list of pathways was large and had many redundant terms, so it was summarized into functional categories using REVIGO [60]. In addition to k-means clustering, we also performed hierarchical clustering of both genes and time points, using the average linkage clustering method.

Enrichment/depletion and functional category analysis

DEseq2 was used to determine gene deletions that are significantly enriched or depleted after stress survival [61]. We chose to use DESeq2 based on our data fitting a negative binomial distribution. Robinson et al., 2014 [62] demonstrated that approaches based on negative binomial models, such as DESeq, that were originally used to analyze RNA-seq data, were directly applicable to Bar-seq data. Enrichment score was determine based on the average fitness of triplicates, and significance was determined by a Benjamini-Hochberg adjusted p-value < 0.05. The resulting enrichment scores were used as input to iPAGE. The common functional categories between the yeast deletion library data and the RNA-seq data were then compared to determine if any association existed between the two datasets.

Supporting information

S1 Fig. Clustering of the time-course gene expression data of the wild-type strain using hierarchical clustering.

Both genes and time points were clustered, with all time points adjusted to be relative to the pre-stress time point.

(TIF)

S2 Fig. Overrepresented motifs from condensed chromosome and spore wall assembly genes.

Using FIRE de novo motif discovery on condensed chromosome and spore wall assembly genes, two overrepresented motifs in the promoter region of those genes were discovered.

(TIF)

S3 Fig. Over- and underrepresented pathways within the full range of fitness scores.

The pathways that are over- or underrepresented in ethanol stress. Overrepresented pathways are shown in red and underrepresented pathways are shown in blue.

(TIF)

S4 Fig. Tracking survival at each round of laboratory evolution.

The fraction survival was calculated at each round of laboratory evolution for all three replicate lines of the wild-type background.

(TIF)

S5 Fig. Clustering of the time-course gene expression data of strain JY304 using hierarchical clustering.

Both genes and time points were clustered, with all time points adjusted to be relative to the pre-stress time point.

(TIF)

S6 Fig. Major functional categories discovered in the post-stress period at the threshold of lethality.

Categories in red are those significantly upregulated post-stress. Categories in blue are those significantly downregulated post-stress.

(TIF)

S1 Table. All functional categories modulated during the adaptation process of haploid yeast exposed to threshold lethal ethanol stress.

(XLS)

S2 Table. Comparison of pathways and genes affected following mild ethanol stress versus acute lethal ethanol stress.

This table lists functional categories (top) that are affected by mild ethanol stress or individual genes (bottom) that are important in mild ethanol stress survival. The directionality of the mild ethanol stress response is compared to whether our wild-type cells increases/decreases expression of the gene/pathway and whether deletion of the gene/pathway increases/decreases fitness after acute lethal ethanol exposure. A blank indicates that the pathway or gene did not significantly change in our data.

(XLSX)

S3 Table. All significantly differentiated functional categories between strain JY304 and the wild-type strain during exponential growth.

(XLS)

Acknowledgments

We thank the Tavazoie laboratory for many helpful discussions and guidance.

Data Availability

The authors submitted their datasets to GEO with accession number: GSE151786.

Funding Statement

NIH (R01-AI077562) and NIH (R01-HG009065) to S.T. NIH MSTP award to J.Y. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript S.T. received salary support base on his effort from both NIH grants.

References

  • 1.Hottiger T, Boller T, Wiemken A. Rapid changes of heat and desiccation tolerance correlated with changes of trehalose content in Saccharomyces cerevisiae cells subjected to temperature shifts. FEBS letters. 1987. August 10;220(1):113–5. 10.1016/0014-5793(87)80886-4 [DOI] [PubMed] [Google Scholar]
  • 2.Benaroudj N, Lee DH, Goldberg AL. Trehalose Accumulation during Cellular Stress Protects Cells and Cellular Proteins from Damage by Oxygen Radicals. Journal of Biological Chemistry. 2001. June 29;276(26):24261–7. 10.1074/jbc.M101487200 [DOI] [PubMed] [Google Scholar]
  • 3.Sanchez Y, Taulien J, Borkovich KA, Lindquist S. Hsp104 is required for tolerance to many forms of stress. The EMBO journal. 1992. June;11(6):2357–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Gasch AP, Spellman PT, Kao CM, Carmel-Harel O, Eisen MB, Storz G, et al. Genomic expression programs in the response of yeast cells to environmental changes. Molecular biology of the cell. 2000. December;11(12):4241–57. 10.1091/mbc.11.12.4241 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Causton HC, Ren B, Sang Seok Koh, Harbison CT, Kanin E, Jennings EG, et al. Remodeling of yeast genome expression in response to environmental changes. Molecular biology of the cell. 2001. February;12(2):323–37. 10.1091/mbc.12.2.323 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Gasch AP, Werner-Washburne M. The genomics of yeast responses to environmental stress and starvation. Functional and Integrative Genomics. 2002. September 1;2(4–5):181–92. 10.1007/s10142-002-0058-2 [DOI] [PubMed] [Google Scholar]
  • 7.Lu C, Brauer MJ, Botstein D. Slow growth induces heat-shock resistance in normal and respiratory-deficient yeast. Molecular biology of the cell. 2009. February 1;20(3):891–903. 10.1091/mbc.e08-08-0852 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Zakrzewska A, Van Eikenhorst G, Burggraaff JEC, Vis DJ, Hoefsloot H, Delneri D, et al. Genome-wide analysis of yeast stress survival and tolerance acquisition to analyze the central trade-off between growth rate and cellular robustness. Molecular biology of the cell. 2011. November 15;22(22):4435–46. 10.1091/mbc.E10-08-0721 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Levy SF, Ziv N, Siegal ML. Bet hedging in yeast by heterogeneous, age-correlated expression of a stress protectant. PLoS biology. 2012. May;10(5). 10.1371/journal.pbio.1001325 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Ho YH, Gasch AP. Exploiting the yeast stress-activated signaling network to inform on stress biology and disease signaling. Current genetics. 2015. November 1;61(4):503–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Yaakov G, Lerner D, Bentele K, Steinberger J, Barkai N. Coupling phenotypic persistence to DNA damage increases genetic diversity in severe stress. Nature ecology & evolution. 2017. January 4;1(1):1–8. [DOI] [PubMed] [Google Scholar]
  • 12.Lister R, O’Malley RC, Tonti-Filippini J, Gregory BD, Berry CC, Millar AH, et al. Highly Integrated Single-Base Resolution Maps of the Epigenome in Arabidopsis. Cell. 2008. May 2;133(3):523–36. 10.1016/j.cell.2008.03.029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.MacQueen J. Some methods for classification and analysis of multivariate observations. In Proceedings of the fifth Berkeley symposium on mathematical statistics and probability. 1967 Jun 21 (Vol. 1, No. 14, pp. 281–297).
  • 14.Goodarzi H, Elemento O, Tavazoie S. Revealing Global Regulatory Perturbations across Human Cancers. Molecular cell. 2009. December 11;36(5):900–11. 10.1016/j.molcel.2009.11.016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Piper PW, Talreja K, Panaretou B, Moradas-Ferreira P, Byrne K, Praekelt UM, et al. Induction of major heat-shock proteins of Saccharomyces cerevisiae, including plasma membrane Hsp30, by ethanol levels above a critical threshold. Microbiology. 1994. November 1;140(11):3031–8. [DOI] [PubMed] [Google Scholar]
  • 16.Swan TM, Watson K. Stress tolerance in a yeast lipid mutant: membrane lipids influence tolerance to heat and ethanol independently of heat shock proteins and trehalose. Canadian journal of microbiology. 1999. July 15;45(6):472–9. [DOI] [PubMed] [Google Scholar]
  • 17.Cowart LA, Obeid LM. Yeast sphingolipids: recent developments in understanding biosynthesis, regulation, and function. Biochimica et Biophysica Acta—Molecular and Cell Biology of Lipids. 2007. March 1;1771(3):421–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.D’amore T, Panchal CJ, Russell I, Stewart GG. A Study of Ethanol Tolerance in Yeast. Critical reviews in biotechnology. 1989. January 27 1;9(4):287–304. [DOI] [PubMed] [Google Scholar]
  • 19.Walker GM. Yeast physiology and biotechnology. John Wiley & Sons; 1998. April 8. [Google Scholar]
  • 20.Kubota S, Takeo I, Kume K, Kanai M, Shitamukai A, Mizunuma M, et al. Effect of ethanol on cell growth of budding yeast: genes that are important for cell growth in the presence of ethanol. Bioscience, biotechnology, and biochemistry. 2004. April;68(4):968–72. 10.1271/bbb.68.968 [DOI] [PubMed] [Google Scholar]
  • 21.Yoshikawa K, Tanaka T, Furusawa C, Nagahisa K, Hirasawa T, Shimizu H. Comprehensive phenotypic analysis for identification of genes affecting growth under ethanol stress in Saccharomyces cerevisiae. FEMS yeast research. 2009. February 1;9(1):32–44. 10.1111/j.1567-1364.2008.00456.x [DOI] [PubMed] [Google Scholar]
  • 22.Charoenbhakdi S, Dokpikul T, Burphan T, Techo T, Auesukaree C. Vacuolar H+-ATPase Protects Saccharomyces cerevisiae Cells against Ethanol-Induced Oxidative and Cell Wall Stresses. 2016. May 15;82(10):3121–30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Navarro-Tapia E, Nana RK, Querol A, Pérez-Torrado R. Ethanol cellular defense induce unfolded protein response in yeast. Frontiers in microbiology. 2016. February 18;7:189 10.3389/fmicb.2016.00189 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Choder MO, Young RA. A portion of RNA polymerase II molecules has a component essential for stress responses and stress survival. Molecular and cellular biology. 1993. November 1;13(11):6984–91. 10.1128/mcb.13.11.6984 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Ho YH, Shishkova E, Hose J, Coon JJ, Gasch AP. Decoupling yeast cell division and stress defense implicates mRNA repression in translational reallocation during stress. Current Biology. 2018. August 20;28(16):2673–80. 10.1016/j.cub.2018.06.044 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Cherry JM, Hong EL, Amundsen C, Balakrishnan R, Binkley G, Chan ET, et al. Saccharomyces Genome Database: the genomics resource of budding yeast. Nucleic acids research. 2012. January 1;40(D1):D700–5. 10.1093/nar/gkr1029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Mishra P, Prasad R. Relationship between ethanol tolerance and fatty acyl composition of Saccharomyces cerevisiae. Applied microbiology and biotechnology. 1989. March 1;30(3):294–8. [Google Scholar]
  • 28.Stanley D, Bandara A, Fraser S, Chambers PJ, Stanley GA. The ethanol stress response and ethanol tolerance of Saccharomyces cerevisiae. Journal of applied microbiology. 2010. July;109(1):13–24. 10.1111/j.1365-2672.2009.04657.x [DOI] [PubMed] [Google Scholar]
  • 29.Leão C, Van Uden N. Effects of ethanol and other alkanols on passive proton influx in the yeast Saccharomyces cerevisiae. Biochimica et Biophysica Acta—Biomembranes. 1984. July 11;774(1):43–8. 10.1016/0005-2736(84)90272-4 [DOI] [PubMed] [Google Scholar]
  • 30.Chandler ML, Stanley GA, Rogers P, Chambers P. A genomic approach to defining the ethanol stress response in the yeast Saccharomyces cerevisiae. Ann Microbiol. 2004. January 1;54(4):427–54. [Google Scholar]
  • 31.Yang H, Ren Q, Zhang Z. Chromosome or chromatin condensation leads to meiosis or apoptosis in stationary yeast (Saccharomyces cerevisiae) cells. FEMS yeast research. 2006. December 1;6(8):1254–63. 10.1111/j.1567-1364.2006.00123.x [DOI] [PubMed] [Google Scholar]
  • 32.Wagstaff JE, Klapholz S, Esposito RE. Meiosis in haploid yeast. Proceedings of the National Academy of Sciences. 1982 May 1;79(9):2986–90. [DOI] [PMC free article] [PubMed]
  • 33.Elemento O, Slonim N, Tavazoie S. A universal framework for regulatory element discovery across all genomes and data types. Molecular cell. 2007. October 26;28(2):337–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Rubin-Bejerano I, Mandel S, Robzyk K, Kassir Y. Induction of meiosis in Saccharomyces cerevisiae depends on conversion of the transcriptional represssor Ume6 to a positive regulator by its regulated association with the transcriptional activator Ime1. Molecular and cellular biology. 1996. May 1;16(5):2518–26. 10.1128/mcb.16.5.2518 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Kupiec M, Byers B, Esposito RE, Mitchell AP. The molecular and cellular biology of the yeast Saccharomyces. Cell Cycle and Cell Biology. 1997;3. [Google Scholar]
  • 36.Tagkopoulos I, Liu YC, Tavazoie S. Predictive behavior within microbial genetic networks. science. 2008. June 6;320(5881):1313–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Winzeler EA, Shoemaker DD, Astromoff A, Liang H, Anderson K, Andre B, et al. Functional characterization of the S. cerevisiae genome by gene deletion and parallel analysis. Science. 1999. August 6;285(5429):901–6. 10.1126/science.285.5429.901 [DOI] [PubMed] [Google Scholar]
  • 38.Planta RJ, Mager WH. The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast. 1998. March 30;14(5):471–7. 10.1002/(SICI)1097-0061(19980330)14:5&lt;471::AID-YEA241&gt;3.0.CO;2-U [DOI] [PubMed] [Google Scholar]
  • 39.Fearon KA, Mason TL. Structure and regulation of a nuclear gene in Saccharomyces cerevisiae that specifies MRP7, a protein of the large subunit of the mitochondrial ribosome. Molecular and cellular biology. 1988. September 1;8(9):3636–46. 10.1128/mcb.8.9.3636 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.McEwen JE, Hong KH, Park S, Preciado GT. Sequence and chromosomal localization of two PET genes required for cytochrome c oxidase assembly in Saccharomyces cerevisiae. Current genetics. 1993. January 1;23(1):9–14. 10.1007/BF00336742 [DOI] [PubMed] [Google Scholar]
  • 41.Guelin E, Rep M, Grivell LA. Yeast sequencing reports. Sequence of the AFG3 gene encoding a new member of the FtsH/Yme1/Tma subfamily of the AAA‐protein family. Yeast. 1994. October;10(10):1389–94. [DOI] [PubMed] [Google Scholar]
  • 42.Kim J, Guan KL. Amino acid signaling in TOR activation. Annual review of biochemistry. 2011. July 7;80:1001–32. [DOI] [PubMed] [Google Scholar]
  • 43.Cosentino GP, Schmelzle T, Haghighat A, Helliwell SB, Hall MN, Sonenberg N. Eap1p, a novel eukaryotic translation initiation factor 4E-associated protein in Saccharomyces cerevisiae. Molecular and cellular biology. 2000. July 1;20(13):4604–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Welch AZ, Gibney PA, Botstein D, Koshland DE. TOR and RAS pathways regulate desiccation tolerance in Saccharomyces cerevisiae. Molecular biology of the cell. 2013. January 15;24(2):115–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Powers RW, Kaeberlein M, Caldwell SD, Kennedy BK, Fields S. Extension of chronological life span in yeast by decreased TOR pathway signaling. Genes and development. 2006. January 15;20(2):174–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Wei M, Fabrizio P, Madia F, Hu J, Ge H, Li LM, et al. Tor1/Sch9-regulated carbon source substitution is as effective as calorie restriction in life span extension. PLoS genetics. 2009. May;5(5). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Pan Y, Schroeder EA, Ocampo A, Barrientos A, Shadel GS. Regulation of yeast chronological life span by TORC1 via adaptive mitochondrial ROS signaling. Cell metabolism. 2011. June 8;13(6):668–78. 10.1016/j.cmet.2011.03.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Boer VM, Amini S, Botstein D. Influence of genotype and nutrition on survival and metabolism of starving yeast. Proceedings of the National Academy of Sciences. 2008 May 13;105(19):6930–5. [DOI] [PMC free article] [PubMed]
  • 49.Nasmyth KA. Molecular genetics of yeast mating type. Annual review of genetics. 1982. December;16(1):439–500. [DOI] [PubMed] [Google Scholar]
  • 50.Chu S, DeRisi J, Eisen M, Mulholland J, Botstein D, Brown PO, et al. The transcriptional program of sporulation in budding yeast. Science. 1998. October 23;282(5389):699–705. 10.1126/science.282.5389.699 [DOI] [PubMed] [Google Scholar]
  • 51.Erkine AM, Magrogan SF, Sekinger EA, Gross DS. Cooperative Binding of Heat Shock Factor to the Yeast HSP82 Promoter In Vivo and In Vitro. Molecular and cellular biology. 1999. March 1;19(3):1627–39. 10.1128/mcb.19.3.1627 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Uffenbeck SR, Krebs JE. The role of chromatin structure in regulating stress-induced transcription in Saccharomyces cerevisiae. Biochemistry and cell biology. 2006. August;84(4):477–89. 10.1139/o06-079 [DOI] [PubMed] [Google Scholar]
  • 53.Qi LS, Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP, et al. Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell. 2013. February 28;152(5):1173–83. 10.1016/j.cell.2013.02.022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Brachmann CB, Davies A, Cost GJ, Caputo E, Li J, Hieter P, et al. Designer deletion strains derived from Saccharomyces cerevisiae S288C: A useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast. 1998. January 30;14(2):115–32. 10.1002/(SICI)1097-0061(19980130)14:2&lt;115::AID-YEA204&gt;3.0.CO;2-2 [DOI] [PubMed] [Google Scholar]
  • 55.Giaever G, Chu AM, Ni L, Connelly C, Riles L, Véronneau S, et al. Functional profiling of the Saccharomyces cerevisiae genome. Nature. 2002. July 25;418(6896):387–91. 10.1038/nature00935 [DOI] [PubMed] [Google Scholar]
  • 56.Martin M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal. 2011. May 2;17(1):10–2. [Google Scholar]
  • 57.Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014. August 1;30(15):2114–20. 10.1093/bioinformatics/btu170 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Bray NL, Pimentel H, Melsted P, Pachter L. Near-optimal probabilistic RNA-seq quantification. Nature biotechnology. 2016. May;34(5):525–7. 10.1038/nbt.3519 [DOI] [PubMed] [Google Scholar]
  • 59.Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nature methods. 2012. April;9(4):357–9. 10.1038/nmeth.1923 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Supek F, Bošnjak M, Škunca N, Šmuc T. Revigo summarizes and visualizes long lists of gene ontology terms. PLoS one. 2011;6(7). 10.1371/journal.pone.0021800 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome biology. 2014. December 1;15(12):500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Robinson DG, Chen W, Storey JD, Gresham D. Design and analysis of Bar-seq experiments. G3: Genes, Genomes, Genetics. 2014. January 1;4(1):11–8. [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Alvaro Galli

Transfer Alert

This paper was transferred from another journal. As a result, its full editorial history (including decision letters, peer reviews and author responses) may not be present.

7 Jul 2020

PONE-D-20-17709

Regulatory and evolutionary adaptation of yeast to acute lethal ethanol stress

PLOS ONE

Dear Dr. Tavazoie,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Aug 21 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Alvaro Galli

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2.Thank you for stating the following in the Acknowledgments Section of your manuscript:

'JY was supported by the NIH MSTP MD-PhD training program. ST was supported by grants from the NIH (R01-AI077562 and R01-HG009065).'

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

 'The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.'

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

3. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.

4. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: I Don't Know

Reviewer #3: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors investigated multiple aspects of yeast response and adaptation to severe ethanol stress. They specifically focus on survival after a pulse of highly lethal stress, rather than response to mild stress that frequently studies. The authors employed a very clever experimental setup that allowed them to study this phenomenon and utilize a wide variety of methodologies to investigate the underlying mechanisms, including RNA-seq for expression profiling, a genetic screen with a barcoded deletion library, and lab evolution experiments. The results described match observations of previous studies and provide new insights that will be interesting to many in the field. The key result the author described, the ethanol evolved strains reprogramming their pre-stress transcriptional program so it matches the post-stress transcriptional program in the ancestor strain, is interesting and has implications far beyond the S. cerevisiae model system.

Overall, this work’s approach for observing the response to lethal ethanol exposure is both unique and complementary to the current understanding of sub-lethal stress responses. The main limitation of the work is the lack of biological replicates for some of the high-throughput experiments which limits the capacity to generalize the interesting observations the author made. Additionally, the methodology used for deriving biological insight from gene expression profiling are non-intuitive and may be suboptimal for this dataset. An alternative and more common approach should be considered instead. To summarize, the manuscript is overall written well and describes interesting findings in the yeast stress response that will be interesting to many researchers. I recommend only minor revisions before its publication.

Major comments

1. The experimental setup of brief stress exposure is clever and uncommon. At least two reasons can explain why only some cells survive while other don’t. Either (1) cells survived since they were able to mount a post-stress response that is essential for survival (as the propose in the abstract) or (2) that surviving cells expressed genes essential for survival pre-stress (as they mention in the introduction). The authors conclude that the post-response transcriptional response is adaptive (increases fitness) since they see a negative correlation between transcriptional change and fitness of a strain deleted for the same gene (figure 2). I am not convinced that this observation is sufficient to draw this strong conclusion. It could be that these genes are essential for ethanol survival since their basal expression prior to the stress is key for survival (and their transcriptional changes post stress is inconsequential but still correlated with survival). This conclusion can only be supported with additional experiments that will test if stress survival is diminished or is left unchanged if transcription post-stress is inhibited (of specific genes or gene sets of interest). Indeed, results from the evolved strain support the notion that the transcriptional program prior to the stress can increase stress survival. The question of whether the post-stress response is adaptive is a truly hard one and could therefore be left unanswered in the scope of this paper. However, I suggest it would be discussed in more detail in the discussion section.

2. A significant part of the pathway enrichment analysis from the RNA-seq dataset is built on functional enrichment (iPAGE) of individual genes sets found by k-means clustering (with 10 clusters). The choice of 10-cluster seems arbitrary (despite the short discussion in the methods section). In fact, many of these clusters seem highly correlated in the overall transcriptional response and therefore the functional enrichment done on individual clusters may not capture the underlying biology correctly. I suggest that the authors also provide a more straightforward analysis of the RNAseq dataset by performing hierarchical clustering. They can then extract the clusters from this analysis (for downstream iPAGE work). Accompanying this analysis with a figure showing the heatmap and dendrogram will allow readers to get an impartial representation of transcriptional changes at a single gene resolution. This analysis can be added to figures 2 and 4 as complementary subplots or it could be used to replace 1D and 4B.

3. Overall the figures would benefit from more specific labels and titles, and consistent scales. For example, figure 3 displays survival fraction in three different ways (horizontal lines and dots for clones in 3B, mean and errorbars in 3C, no errorbar in 3D, and bars with errorbars in 3E and 3F). Figure legends are also typically too short and sometimes omit key information (for example, what do the errorbars in figure 3E and 3F represent. It would also be very helpful to mark strain JY304 on its corresponding point in figure 3B and clearly indicate in the figure labels of 3C-F that the measurements are for evolved JY304 (rather than just “evolved”).

Minor comments:

1. On page 6 top paragraph, it states transcription was monitored for 4 hours but data shared only goes to 1 hour.

2. There are multiple instances that give relative amounts instead of actual numbers. For example: 85% of LOF genes exhibit anti correlation (pg 12), ESR has 2x downregulated genes and this work showed 5x downregulated genes from lethal exposure. To show relativity is scalable (pg 18), ‘Many’ early stage meiosis genes poses the URS1 motif (pg 18)

3. On page 10 the author provides a list of references (36-41). It is unclear what information is taken from these references. Is it the gene pathway affiliation?

4. Are the qualifications for significantly differentiated genes in previous ESR works and this work levels the same? If not, twice as many downregulated than upregulated genes in ESR as to 5x as many down regulated in these findings is not comparable.

5. The emphasis on these findings’ impact on industry is unclear since the acute stress used for this study is likely irrelevant for industrial ethanol production. Comments on this connection (in both the abstract and discussion) should either be further explained and supported or can be omitted altogether (the work is interesting and valuable on its own).

Reviewer #2: In this manuscript Yang and Tavazoie explore the ability of yeast to cope with acute ethanol stress. The key components of the project are:

1) Identify genes and categories of genes that change expression in response to a short (2-minute) ethanol stress that is sufficient to kill some percentage of the cells and characterize their response.

2) Identify genes that play important roles in ethanol survival using a barseq approach of a deletion library and compare this list of genes to the genes with changed expression after stress.

3) Evolve strains to cope with acute ethanol stress. Based on the best surviving strain, determine whether there is a tradeoff between growth rate and ability to survive. Determine whether there are pre- and post-stress transcriptional changes in the evolved strains compared to wild-type.

4) Determine whether the evolved response is a general stress response or is specific to ethanol.

This is a largely descriptive paper in that although it identifies genes and gene categories involved in these responses and changes, it doesn't really dig into the mechanistic basis of them. The experiments appear to be carefully and consistently done. The identification of gene categories that are enriched or depleted in the various experiments use tools developed in the Tavazoie lab.

There are some parts of the paper that could use clarification or elaboration.

- On the top of page 6 it says that monitoring the transcriptional response proceeding for four hours after the stress, but the post-stress RNA-seq timepoints are only 15, 30, and 60 minutes.

- The main comparison of pre- and post-stress transcriptional response is done at 20% ethanol when survival looks to be near 100%. On what basis shouuld we assume that the transcriptional response after 20% ethanol stress is the same as one after 23% or 24.5% ethanol stress, even for cells that don't die? This may in fact be true, and it makes sense, as the authors say, to avoid confounding the stress response with transcriptional changes due to death, but it isn't obvious that these transcriptional responses should necessarily be the same as the ones for cells that survive 24.5% ethanol (like the barseq and experimental evolution experiments)

- The word "correlation" is used several times in the text, but actual correlations aren't run (and would be inappropriate for the data in Fig. 2C since this is a decidedly non-linear pattern). How about the more general term "association"?

- Is DeSeq2 appropriate for barseq analysis? It wasn't designed for this and so using it in this way needs some justification.

- Was DeSeq2 also used for the expression analysis? The statistical (pre-clustering) analysis of RNA-seq data wasn't described so far as I can see unless this is dealth with in the downstream programs like iPAGE.

- As the authors say, the lack of a tradeoff between growth and survival is unexpected and contrary to previous findings. If there is no tradeoff then why wouldn't yeast be in this hyper-resistant pre-stress state all the time? After all, it conveys general stress protection. While I don't think the authors need to solve this mystery in this paper, it probably deserves some more discussion. Do the identities of the genes and pathways involved give any clue as to where a tradeoff might lie? Could the authors do one more experiment where they test growth rates in minimal media? Here's a (completely) speculative hypothesis: perhaps the evolved pre-stress transcriptional state renders the cells too sensitive to stress. Under the YPD growth like the authors used, things are good and the stress response isn't triggered. But under minimal media while the wild-type strain doesn't grow as fast but still grows, the evolved strain over compensates and triggers a stress response where there really isn't one. This is (as I said) completely speculative, but perhaps a few easy growth experiments in different conditions might be able to locate where a tradeoff is or further support the surprising finding that there is none.

- The evolution results are all based on a single strain. But it looks from the methods that other strains were genome sequenced (but not transriptionally profiled?) Also, if the evolved strains were genome-sequenced, was there anything informative there? It just seems like a loose end. How unusual is JY304? Do the other evolved strains also show this lack of growth/survival tradeoff? Was JY304 the one population on page 26 that fit the initial criteria?

- Where it is possible, the authors should post the code/scripts they used to run the analyses and process the raw data.

- How dependent are the results and conclusions on the number of clusters chosen for the cluster analyses? Do results change if you go to 6 or 15 instead of 10?

Reviewer #3: Summary of the research

In the manuscript “Regulatory and evolutionary adaptation of yeast to acute lethal ethanol stress”, the authors investigated the relatively untouched question of how cells survive acute stress. Most studies of stress responses in yeast (and potentially other species) were focused on uncovering the stereotypical gene expression change, which requires the experimenters to subject the cells to a sufficiently long period of stress to allow gene expression changes to reach or get close to the maximal level. In this study, however, the authors asked a different question, which is what genes are involved in the cells’ ability to survive a severe but brief exposure to the stress, specifically, they examined ethanol stress at a concentration between 19-26%.

The authors made a number of novel and significant findings. First, using transcriptome profiling by RNA-seq post-stress, they uncovered gene functional groups that are significantly up- or down-regulated. I especially appreciate the authors’ further testing of whether the gene expression changes were adaptive (helping the cells to survive and recover from the stress-induced damages) or maladaptive (as a result of and potentially cause for further damages). This is achieved by subjecting the non-essential gene deletion library in the yeast to the same stress treatment, and letting the surviving cells go through a round of outgrowth meant to remove the slow-growth mutants that would have survived the stress but are not of interest. The result revealed that the majority of the genes with expression changes are potentially adaptive, as their corresponding deletion mutants exhibit consistent fitness effects (genes down-regulated after the acute stress exhibited higher fitness when deleted and vice versa).

Not content with what they learned, they decided to subject wild-type yeast cells to an experimental evolution scheme, where the cells were exposed to an alternating environment of acute ethanol stress followed by an outgrowth in the rich media. Because the level of acute stress is such that at the beginning of the experiment, only 1% of the cells will survive, there is probably more room to improve fitness by increasing the survival following the ethanol stress than optimizing the growth rate in the rich media (which does happen, but at a small magnitude. see work from Desai lab and others). They carried out three technical replicates and chose to focus on the most successful one, which improved its survival by ~35% (there are quite a bit of heterogeneity among the three replicates in terms of their improvement in survival rates, suggesting that the genomic targets for adaptive mutations may be relatively small, and the order of acquiring those mutations may also matter).

To identify genes whose transcriptional changes in the evolved strain may underlie its higher survival, the authors compared both the post-stress and pre-stress expression states between the evolved and the parent strains. For the post-stress expression changes, they found that the evolved strain shared 6/10 functional categories of significantly induced/repressed genes compared with the parent strain, but the magnitude of changes are smaller, and there is not a significant “recovery” (regression to the pre-stress state) as the parent strain does. In terms of the pre-stress states, they revealed two significant findings. First, the most significantly differentially expressed genes mostly have unknown functions or belong to transposable elements. It is unclear whether these genes relate to the better survival trait of the evolved strain. If they do, it would suggest that our knowledge about the most well-studied eukaryotic genome is still grossly lacking! Second, their pathway analysis among the DGEs between the evolved and the parent strains pre-stress revealed many of the same categories of genes that are induced or repressed in the parent strain following the ethanol exposure, suggesting that one of the potential mechanisms behind the evolved strain’s higher survival is by making some of the transcriptional changes induced by the stress a constitutive state of the cell. It is important to note that although the authors showed that the mutant doesn’t suffer any growth disadvantage during the log phase in rich media, there could be hidden costs that are only revealed when the cells are subject to more complex environments, such as rapid adjustment to different nutrient source or growth under limited nutrients. Also, I don’t agree with the authors in their claim that this decoupling between growth and stress resistance is unexpected, because the selection scheme they implemented essentially requires the mutants to fulfill those two criteria. However, that doesn’t diminish the significance of their finding that these two factors may be separable (although, see above comments on other environments).

Criticism

Overall the experiments were very well-designed and possible explanations were considered and tested, which I very much appreciate. I would have loved to know, with more direct perturbation experiments and phenotypic assays, about how some of the most significantly induced or repressed genes contribute to the survival of the cells, following their RNA-seq analysis. Another place where I would love to know more about is the cellular heterogeneity among the population of the evolved strain -- was its better survival as a population the result of a uniform improvement of all cells, or was it due to the evolution of a bet-hedging strategy, where a small sub-population of cells were “set aside” as slow-growers and can better weather the stress. Experiments done in E. coli (e.g. “persisters”, from Stanis Leibler lab) has shown that the persistence phenomenon exists and is evolvable via genetic changes. I do believe, however, the work presented in this manuscript is sufficient for publication. The above requests were my personal curiosity and I hope/believe that they are on the authors’ todo list as well. Below, however, I list a number of suggestions and raise some concerns, in the hope that they help the authors further improve the manuscript.

Main concern:

The authors emphasized the distinction between the acute stress scheme they used in multiple places. I have two problems with respect to this. First, while it is easy to understand how the pre-stress cellular state could be important for the acute stress scheme, it’s less clear to me what they mean by “long-term expression change following the stress”. In particular, how is that different from the “canonical” ethanol stress response that the cells mount following a less acute stress scheme, as studied by the others? Second, and directly related to the above, I would love to see a direct comparison of the genes identified via the RNA-seq and deletion library screening in the acute stress with the known gene expression changes and GO categories following a more mild stress challenge, as revealed in other studies. The authors did mention one of the distinctions -- among the ESR genes, the downregulated genes show more similarity while the up-regulated ESR genes are absent among those responding to the acute stress.

Minor concerns / suggestions:

1. The introduction could be more tightly connected to the main questions and findings of the paper. For example, the authors spent a paragraph talking about the ESR. It is not clear, however, what is the relationship between the ESR and their finding until I read the Discussions. If each piece of background information can have a clear connection to the main points of the paper, it will make the introduction less arbitrary and more informative.

2. The description of the gene pathways enriched among the DGE following acute ethanol stress feel like long and diffused. This is probably a general challenge to genome-wide characterization. I wonder if the authors can attach the most important categories to a cartoon of the cell. By connecting gene categories to particular organelles of the cell or a specific biological process, e.g. DNA-repair, meiosis, bud formation etc., it will help the readers absorb and appreciate the information.

3. I would like to get the authors’ interpretation of the apparently high levels of heterogeneity in the improvement in fitness among the three replicate populations in their experimental evolution.

4. What are the major damages of high concentrations of ethanol to the cells? Can we tie the DE genes’ function to those damages?

5. In Figure 4B, it is not clear to me whether the ten categories in the mutant vs the parent strain match each other. Another way of asking this question is, is the heatmap for the parent strain the same as in Figure 1 but just reordered or are they matched to the 10 categories identified in the evolved strain? A clarification in the legend would have been helpful.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Amir Mitchell and Brittany Rosener

Reviewer #2: No

Reviewer #3: Yes: Bin He

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 Nov 10;15(11):e0239528. doi: 10.1371/journal.pone.0239528.r002

Author response to Decision Letter 0


24 Aug 2020

We thank the reviewers for their insightful and extremely helpful comments. We have addressed all their concerns below and have modified the manuscript to reflect the changes/additions. The reviewer comments are in regular text. Our responses are underlined. Changes made to the manuscript are presented as italic.

Reviewer 1:

Major comments:

1. “The experimental setup of brief stress exposure is clever and uncommon. At least two reasons can explain why only some cells survive while others don’t. Either (1) cells survived since they were able to mount a post-stress response that is essential for survival (as the propose in the abstract) or (2) that surviving cells expressed genes essential for survival pre-stress (as they mention in the introduction). The authors conclude that the post-response transcriptional response is adaptive (increases fitness) since they see a negative correlation between transcriptional change and fitness of a strain deleted for the same gene (figure 2). I am not convinced that this observation is sufficient to draw this strong conclusion. It could be that these genes are essential for ethanol survival since their basal expression prior to the stress is key for survival (and their transcriptional changes post stress is inconsequential but still correlated with survival). This conclusion can only be supported with additional experiments that will test if stress survival is diminished or is left unchanged if transcription post-stress is inhibited (of specific genes or gene sets of interest). Indeed, results from the evolved strain support the notion that the transcriptional program prior to the stress can increase stress survival. The question of whether the post-stress response is adaptive is a truly hard one and could therefore be left unanswered in the scope of this paper. However, I suggest it would be discussed in more detail in the discussion section.”

Response: This is an important point raised by the reviewer. Indeed, the transcriptional change post-stress is suggestive of a fitness benefit. However, in order for us to conclusively demonstrate this, additional experiments need to be performed to precisely test this hypothesis for every gene. We have therefore softened this interpretation in the main text and have added the following to the discussion section:

“The question of whether the post-stress transcriptional response in wild-type cells is adaptive is a difficult one to conclusively answer. We believe that it does confer a fitness benefit for a couple of reasons. First, our pooled yeast deletion library experiments showed a significant negative association between transcriptional change and fitness, as shown in Fig 2C-D. Second, as shown in Table 1, the post-stress upregulation of lipid biosynthesis, ATPases, lipid transport, and vacuolar functions, all of which are normally disrupted by ethanol, suggests that the cells have mounted a response to counteract the damaging effects of ethanol. However, in order for us to conclusively demonstrate that our post-stress cells are adaptive, additional experiments would need to be performed to test individual genes of interest.”

2. “A significant part of the pathway enrichment analysis from the RNA-seq dataset is built on functional enrichment (iPAGE) of individual genes sets found by k-means clustering (with 10 clusters). The choice of 10-cluster seems arbitrary (despite the short discussion in the methods section). In fact, many of these clusters seem highly correlated in the overall transcriptional response and therefore the functional enrichment done on individual clusters may not capture the underlying biology correctly. I suggest that the authors also provide a more straightforward analysis of the RNAseq dataset by performing hierarchical clustering. They can then extract the clusters from this analysis (for downstream iPAGE work). Accompanying this analysis with a figure showing the heatmap and dendrogram will allow readers to get an impartial representation of transcriptional changes at a single gene resolution. This analysis can be added to figures 2 and 4 as complementary subplots or it could be used to replace 1D and 4B.”

Response: We had originally performed a range of partitional and hierarchical clustering analyses on these expression data (including varying the number of clusters) and had concluded that the current presentation of 10 clusters best captures the broad dynamics observed. However, we agree with the reviewer that adding a hierarchical clustering of these data would be a very useful representation. We have, thus, performed these analyses and have provided them in the Supplementary Figures S1 Fig and S5 Fig for both the parental and evolved strains. Additionally, we have added additional text describing our observation from the hierarchical clustering.

3. “Overall the figures would benefit from more specific labels and titles, and consistent scales. For example, figure 3 displays survival fraction in three different ways (horizontal lines and dots for clones in 3B, mean and errorbars in 3C, no errorbar in 3D, and bars with errorbars in 3E and 3F). Figure legends are also typically too short and sometimes omit key information (for example, what do the errorbars in figure 3E and 3F represent. It would also be very helpful to mark strain JY304 on its corresponding point in figure 3B and clearly indicate in the figure labels of 3C-F that the measurements are for evolved JY304 (rather than just “evolved”).”

Response: We thank the reviewer for these helpful suggestions. The figures and figure legends have been updated to reflect these.

Minor comments:

1. “On page 6 top paragraph, it states transcription was monitored for 4 hours but data shared only goes to 1 hour.”

Response: We thank the reviewer for pointing out this error. We have corrected the text from “four hours” to “one hour”.

2. “There are multiple instances that give relative amounts instead of actual numbers. For example: 85% of LOF genes exhibit anti correlation (pg 12), ESR has 2x downregulated genes and this work showed 5x downregulated genes from lethal exposure. To show relativity is scalable (pg 18), ‘Many’ early stage meiosis genes poses the URS1 motif (pg 18).”

Response: We thank the reviewer for this suggestion. We have added absolute numbers to relevant places in the paper, including the ones mentioned on pages 12 and 18.

3. “On page 10 the author provides a list of references (36-41). It is unclear what information is taken from these references. Is it the gene pathway affiliation?”

Response: Yes, these are references to the genes/pathways. We have now split these citations to more clearly link them with their corresponding genes/pathways.

4. “Are the qualifications for significantly differentiated genes in previous ESR works and this work levels the same? If not, twice as many downregulated than upregulated genes in ESR as to 5x as many down regulated in these findings is not comparable.”

Response: Yes, in references 4 and 5, the original ESR papers, both groups used two-fold gene expression cutoffs for downregulated and upregulated genes, so we used the same criteria for our paper.

5. “The emphasis on these findings’ impact on industry is unclear since the acute stress used for this study is likely irrelevant for industrial ethanol production. Comments on this connection (in both the abstract and discussion) should either be further explained and supported or can be omitted altogether (the work is interesting and valuable on its own).”

Response: We appreciate this point raised by the reviewer and have omitted the findings’ impact on industry in both the abstract and discussion.

Reviewer 2:

1. “On the top of page 6 it says that monitoring the transcriptional response proceeding for four hours after the stress, but the post-stress RNA-seq timepoints are only 15, 30, and 60 minutes.”

Response: We thank the reviewer for pointing out this error. We have corrected the text from “four hours” to “one hour”.

2. “The main comparison of pre- and post-stress transcriptional response is done at 20% ethanol when survival looks to be near 100%. On what basis should we assume that the transcriptional response after 20% ethanol stress is the same as one after 23% or 24.5% ethanol stress, even for cells that don't die? This may in fact be true, and it makes sense, as the authors say, to avoid confounding the stress response with transcriptional changes due to death, but it isn't obvious that these transcriptional responses should necessarily be the same as the ones for cells that survive 24.5% ethanol (like the barseq and experimental evolution experiments).”

Response: We appreciate the reviewer’s perspective here, and we agree that there may be some differences in the transcriptional responses between 20% and 23-24% ethanol stress. However, we expect the core responses to be very similar. We have added the following to the discussion in order to point out this assumption:

“When comparing the response to ethanol at 20% (transcriptional profiling of wild-type cells) versus the response at 24.5% ethanol (fitness profiling of deletion library), we are making the assumption that the core response to ethanol stress is similar across the regime spanning 20-24.5% ethanol. As shown by the top section of S2 Table, the pathways affected by mild ethanol stress versus acute lethal ethanol stress is very much in agreement, and we believe this core response extends into the realm of lethality. For example, downregulation of ribosomal proteins and translation are universal responses at various ethanol concentrations below, at, and above 20% ethanol. We do acknowledge, however, that there may be some differences in the transcriptional responses between 20% and 24.5% ethanol. Our analysis therefore attempts to capture the most significant global similarities and differences.”

3. “The word "correlation" is used several times in the text, but actual correlations aren't run (and would be inappropriate for the data in Fig. 2C since this is a decidedly non-linear pattern). How about the more general term "association"?”

Response: We agree and have changed “correlation” to “association” or “relationship” in instances where an actual correlation was not determined.

4. “Is DeSeq2 appropriate for barseq analysis? It wasn't designed for this and so using it in this way needs some justification.”

Response: We added the following justification in our methods as to why we chose DESeq2:

“We chose to use DESeq2 based on our data fitting a negative binomial distribution. Robinson et al., 2014 (reference 62) demonstrated that approaches based on negative binomial models, such as DESeq, that were originally used to analyze RNA-seq data, were directly applicable to Bar-seq data.”

5. “Was DeSeq2 also used for the expression analysis? The statistical (pre-clustering) analysis of RNA-seq data wasn't described so far as I can see unless this is dealt with in the downstream programs like iPAGE.”

Response: DESeq2 was not used for the expression analysis. After mapping the RNA-seq reads, we converted the counts for each gene into transcripts per million, and removed any genes in which all time points had a count less than 10 (Methods section “Mapping of sequencing reads”). Before clustering, we removed all genes in which the coefficient of variation was below 0.2 (Methods section “Clustering of RNA-seq data and functional category analysis”). We did not filter the results further based on any statistical analysis because we wanted the input for clustering and iPAGE to be as unbiased as possible.

6. “As the authors say, the lack of a tradeoff between growth and survival is unexpected and contrary to previous findings. If there is no tradeoff then why wouldn't yeast be in this hyper-resistant pre-stress state all the time? After all, it conveys general stress protection. While I don't think the authors need to solve this mystery in this paper, it probably deserves some more discussion. Do the identities of the genes and pathways involved give any clue as to where a tradeoff might lie? Could the authors do one more experiment where they test growth rates in minimal media? Here's a (completely) speculative hypothesis: perhaps the evolved pre-stress transcriptional state renders the cells too sensitive to stress. Under the YPD growth like the authors used, things are good and the stress response isn't triggered. But under minimal media while the wild-type strain doesn't grow as fast but still grows, the evolved strain over compensates and triggers a stress response where there really isn't one. This is (as I said) completely speculative, but perhaps a few easy growth experiments in different conditions might be able to locate where a tradeoff is or further support the surprising finding that there is none.”

Response: Although this lack of tradeoff between growth and survival is unexpected and contrary to previous findings, there is definitely a possibility that certain environments exist in which our evolved strains would perform worse than wild-type strains. Just as the environmental stress response conveys general stress protection, it does not explain behavior in some laboratory stresses, such as various nutrient deprivations. It is certainly possible that our evolved strain performs sub-optimally in those environments as well. Additionally, this lack of tradeoff applies to acute lethal stresses as described in our manuscript, but we have no idea how the two strains compare under stresses of long durations. How the evolved cells hold up in numerous other laboratory conditions and environments is a good subject for future studies. We have expanded our discussion section to include this point as shown below:

“While the survival advantage of strain JY304 was not accompanied by any significant reduction in the bulk growth rate of the population, there is a possibility that certain environments exist in which strain JY304 would exhibit lower fitness than the wild-type strain. Just like the ESR conveys general stress protection, it does not explain behavior in some laboratory stresses, such as various nutrient deprivations (6). It is certainly possible that strain JY304 does not perform optimally in those environments as well. Additionally, this lack of tradeoff between growth rate and survival applies to acute lethal stresses, but we have not determined how the two strains compare under stresses of long durations. How our evolved strain holds up in numerous other laboratory conditions and environments would be an important subject for future studies.”

7. “The evolution results are all based on a single strain. But it looks from the methods that other strains were genome sequenced (but not transcriptionally profiled?) Also, if the evolved strains were genome-sequenced, was there anything informative there? It just seems like a loose end. How unusual is JY304? Do the other evolved strains also show this lack of growth/survival tradeoff? Was JY304 the one population on page 26 that fit the initial criteria?”

Response: We had preliminary whole-genome sequencing results from some of the evolved strains but did not find any significant recurring mutations. We have, thus, removed this section of the methods since these results were not mentioned anywhere else in our paper. In addition, since our goal was to compare the evolved strain with the highest survival to the wild-type strain, we did not transcriptionally profile the other strains that showed inferior survival.

8. “Where it is possible, the authors should post the code/scripts they used to run the analyses and process the raw data.”

Response: We have deposited the README file describing our general steps has the following DOI: https://www.protocols.io/view/yang-tavazoie-sequencing-readme-bjt5knq6. The relevant code/scripts described in the README file are located at https://github.com/yang-jamie/SCRIPTS.

9. “How dependent are the results and conclusions on the number of clusters chosen for the cluster analyses? Do results change if you go to 6 or 15 instead of 10?”

Response: We had performed the clustering using a range of clusters from 5-30. The ten-cluster partition provided the best balance between the number of distinct transcriptional dynamics and minimal redundancy in the pathways that were enriched within them. We have revised the Methods section “Clustering of RNA-seq data and functional category analysis” to clarify this point.

Reviewer 3:

Main comments:

1. “The authors emphasized the distinction between the acute stress scheme they used in multiple places. I have two problems with respect to this. First, while it is easy to understand how the pre-stress cellular state could be important for the acute stress scheme, it’s less clear to me what they mean by “long-term expression change following the stress”. In particular, how is that different from the “canonical” ethanol stress response that the cells mount following a less acute stress scheme, as studied by the others?”

Response: Since the “canonical” ethanol stress response was determined at ethanol concentrations well below the threshold of lethality, we cannot assume that they are necessarily similar to the response at the threshold of lethality. Our aim therefore was to determine the similarities and differences that do exist between them.

2. “Second, and directly related to the above, I would love to see a direct comparison of the genes identified via the RNA-seq and deletion library screening in the acute stress with the known gene expression changes and GO categories following a more mild stress challenge, as revealed in other studies. The authors did mention one of the distinctions -- among the ESR genes, the downregulated genes show more similarity while the up-regulated ESR genes are absent among those responding to the acute stress.”

Response: We thank the reviewer for this suggestion. We have now added a supplemental table (S2 Table) and additional text to reflect this comparison. See below:

“S2 Table summarizes the pathways and genes that are affected during mild ethanol stress exposure and compares the directionality of their post-stress responses to the response of our data at or above the threshold of lethality. From the top section of the table, it is clear that all pathways affected by mild stress are affected in the same direction by both our transcriptional profiling and deletion library data. On the gene level, however, only 20 out of 50 genes trend in the same direction from our RNA-seq data, and only 8 out of 50 genes agree from our deletion library data. Individual genes do not overlap significantly between mild and lethal ethanol stress. In fact, even between 8% and 11% ethanol, different genes were associated with ethanol tolerance. However, on the pathway level, there is significant agreement between the responses to mild and lethal ethanol stress.”

Minor comments:

1. “The introduction could be more tightly connected to the main questions and findings of the paper. For example, the authors spent a paragraph talking about the ESR. It is not clear, however, what is the relationship between the ESR and their finding until I read the Discussions. If each piece of background information can have a clear connection to the main points of the paper, it will make the introduction less arbitrary and more informative.”

Response: We thank the reviewer for this suggestion. The discussion of ESR was included because of its dominance in the literature of yeast stress response and our subsequent comparisons throughout the paper. We have now slightly modified the introduction to make this link more tangible.

2. “The description of the gene pathways enriched among the DGE following acute ethanol stress feel like long and diffused. This is probably a general challenge to genome-wide characterization. I wonder if the authors can attach the most important categories to a cartoon of the cell. By connecting gene categories to particular organelles of the cell or a specific biological process, e.g. DNA-repair, meiosis, bud formation etc., it will help the readers absorb and appreciate the information.”

Response: We thank the reviewer for this helpful suggestion. We have now added a cartoon figure, mentioned in the discussion and designated as supplementary figure S6 Fig, as shown below:

3. “I would like to get the authors’ interpretation of the apparently high levels of heterogeneity in the improvement in fitness among the three replicate populations in their experimental evolution.”

Response: As described in our methods section “Laboratory experimental evolution for enhanced survival to lethal ethanol stress”, our experiments were designed in such a way as to select for both stress defense as well as fast growth. Since slow-growing beneficial mutations will be positively selected for during stress exposure and negatively selected for during recovery, it may explain the non-monotonic and cyclical pattern of survival throughout the laboratory evolution process. Especially at the earlier cycles of the evolution, since only 1% of the yeast cells survive, there is a large bottleneck effect after each stress event, leading to high levels of heterogeneity in each replicate population.

4. “What are the major damages of high concentrations of ethanol to the cells? Can we tie the DE genes’ function to those damages?”

Response: We thank the reviewer for this suggestion. The dominant process by which yeast cells die from high concentrations of ethanol is increased membrane fluidity and subsequent decrease in membrane integrity. Other damages caused by ethanol include inhibition of H+-ATPase activity, inhibition of transport processes, and disruption of vacuole morphology. Our analyses suggest that our post-stress cells have altered their gene expression levels to counteract these damaging effects caused by ethanol. We have added a new table (now Table 1) to tie in the DE genes’ functions to those damages.

5. “In Figure 4B, it is not clear to me whether the ten categories in the mutant vs the parent strain match each other. Another way of asking this question is, is the heatmap for the parent strain the same as in Figure 1 but just reordered or are they matched to the 10 categories identified in the evolved strain? A clarification in the legend would have been helpful.”

Response: We thank the reviewer for pointing out this confusion. The ten categories in the evolved and parent strain are not the same. The parent strain heatmap is unaltered from Fig 1D. We have now added this clarification to the figure caption.

Attachment

Submitted filename: Response to Reviewers.docx

Decision Letter 1

Alvaro Galli

9 Sep 2020

Regulatory and evolutionary adaptation of yeast to acute lethal ethanol stress

PONE-D-20-17709R1

Dear Dr. Tavazoie,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Alvaro Galli

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: All comments have been addressed

Reviewer #3: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #2: Yes

Reviewer #3: No

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #2: Yes

Reviewer #3: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #2: The authors have addressed my concerns. I hope they continue to explore what they've discovered in future studies - I look forward to learning what they find.

Two more minor word choice comments:

strains vs. strain in the sentences starting "This experimental evolution paradigm..."

In the discussion: "When comparing...versus lethal ethanol stress _are_ very much..."

Reviewer #3: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

Reviewer #3: Yes: Bin He

Acceptance letter

Alvaro Galli

22 Sep 2020

PONE-D-20-17709R1

Regulatory and evolutionary adaptation of yeast to acute lethal ethanol stress

Dear Dr. Tavazoie:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Alvaro Galli

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig. Clustering of the time-course gene expression data of the wild-type strain using hierarchical clustering.

    Both genes and time points were clustered, with all time points adjusted to be relative to the pre-stress time point.

    (TIF)

    S2 Fig. Overrepresented motifs from condensed chromosome and spore wall assembly genes.

    Using FIRE de novo motif discovery on condensed chromosome and spore wall assembly genes, two overrepresented motifs in the promoter region of those genes were discovered.

    (TIF)

    S3 Fig. Over- and underrepresented pathways within the full range of fitness scores.

    The pathways that are over- or underrepresented in ethanol stress. Overrepresented pathways are shown in red and underrepresented pathways are shown in blue.

    (TIF)

    S4 Fig. Tracking survival at each round of laboratory evolution.

    The fraction survival was calculated at each round of laboratory evolution for all three replicate lines of the wild-type background.

    (TIF)

    S5 Fig. Clustering of the time-course gene expression data of strain JY304 using hierarchical clustering.

    Both genes and time points were clustered, with all time points adjusted to be relative to the pre-stress time point.

    (TIF)

    S6 Fig. Major functional categories discovered in the post-stress period at the threshold of lethality.

    Categories in red are those significantly upregulated post-stress. Categories in blue are those significantly downregulated post-stress.

    (TIF)

    S1 Table. All functional categories modulated during the adaptation process of haploid yeast exposed to threshold lethal ethanol stress.

    (XLS)

    S2 Table. Comparison of pathways and genes affected following mild ethanol stress versus acute lethal ethanol stress.

    This table lists functional categories (top) that are affected by mild ethanol stress or individual genes (bottom) that are important in mild ethanol stress survival. The directionality of the mild ethanol stress response is compared to whether our wild-type cells increases/decreases expression of the gene/pathway and whether deletion of the gene/pathway increases/decreases fitness after acute lethal ethanol exposure. A blank indicates that the pathway or gene did not significantly change in our data.

    (XLSX)

    S3 Table. All significantly differentiated functional categories between strain JY304 and the wild-type strain during exponential growth.

    (XLS)

    Attachment

    Submitted filename: Response to Reviewers.docx

    Data Availability Statement

    The authors submitted their datasets to GEO with accession number: GSE151786.


    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES