Skip to main content
Journal of Clinical Laboratory Analysis logoLink to Journal of Clinical Laboratory Analysis
. 2020 Jul 12;34(11):e23459. doi: 10.1002/jcla.23459

Epidemiology and molecular characteristics of the type VI secretion system in Klebsiella pneumoniae isolated from bloodstream infections

Mao Zhou 1, You Lan 1, Siyi Wang 1, Qingxia Liu 1, Zijuan Jian 1, Yanming Li 1, Xia Chen 1, Qun Yan 1, Wenen Liu 1,
PMCID: PMC7676210  PMID: 32656871

Abstract

Background

The type VI secretion system (T6SS) has been identified as a novel virulence factor. This study aimed to investigate the prevalence of the T6SS genes in Klebsiella pneumoniae‐induced bloodstream infections (BSIs). We also evaluated clinical and molecular characteristics of T6SS‐positive K pneumoniae.

Methods

A total of 344 non‐repetitive K. pneumoniae bloodstream isolates and relevant clinical data were collected from January 2016 to January 2019. For all isolates, T6SS genes, capsular serotypes, and virulence genes were detected by polymerase chain reaction, and antimicrobial susceptibility was tested by VITEK® 2 Compact. MLST was being conducted for hypervirulent K. pneumoniae (HVKP).

Results

69 (20.1%) were identified as T6SS‐positive K. pneumoniae among 344 isolates recovered from patients with BSIs. The rate of K1 capsular serotypes and ten virulence genes in T6SS‐positive strains was higher than T6SS‐negative strains (P = .000). The T6SS‐positive rate was significantly higher than T6SS‐negative rate among HVKP isolates. (P = .000). The T6SS‐positive K. pneumoniae isolates were significantly more susceptible to cefoperazone‐sulbactam, ampicillin‐sulbactam, cefazolin, ceftriaxone, cefotan, aztreonam, ertapenem, amikacin, gentamicin, levofloxacin, and ciprofloxacin (P < 0.05). More strains isolated from the community and liver abscess were T6SS‐positive K. pneumoniae (P < .05). Multivariate regression analysis indicated that community‐acquired BSIs (OR 2.986), the carriage of wcaG (OR 10.579), iucA (OR 2.441), and p‐rmpA (OR 7.438) virulence genes, and biliary diseases (OR 5.361) were independent risk factors for T6SS‐positive K. pneumoniae‐induced BSIs.

Conclusion

The T6SS‐positive K. pneumoniae was prevalent in individuals with BSIs. T6SS‐positive K. pneumoniae strains seemed to be hypervirulent which revealed the potential pathogenicity of this emerging gene cluster.

Keywords: bloodstream infections, hypervirulent, Klebsiella pneumoniae, T6SS, virulence factor


The type VI secretion system (T6SS) as a novel virulence factor. This study aimed to investigate the prevalence of the T6SS genes in Klebsiella pneumoniae‐induced bloodstream infections and the molecular characteristics of T6SS‐positive K. pneumoniae.

graphic file with name JCLA-34-e23459-g001.jpg

1. INTRODUCTION

Klebsiella pneumoniae is an important pathogen causing bloodstream infections (BSIs). According to the China Antimicrobial Surveillance Network (CHINET), the isolation rate of K. pneumoniae in blood was 15.3%, second only to Escherichia coli. In recent years, scholars have discovered a new type of K. pneumoniae called hypervirulent K. pneumoniae (HVKP). 1 , 2 Compared with classic K. pneumoniae (CKP), HVKP was characterized by causing severe invasive community‐acquired infections with metastatic spread in immunocompetent individuals. 3 , 4 Usually, hypervirulent strains were resistant to most antimicrobials. 5 However, multidrug‐resistant HVKP strains were increasingly reported recently. The emergence of this superbug could cause severe fatal infections in both the hospital and the community. 6 , 7 , 8 , 9

Bacterial secretion systems are ubiquitous; until now, eight types of secretion systems have been described (T1SS, T2SS, T3SS, T4SS, T5SS, T6SS, T7SS, and T9SS). By secreting proteins as virulence factor, bacteria can attack other microorganisms, evade the host immune system, cause tissue damage, and invade host cells. 10 The type VI secretion system (T6SS) is a transmembrane complex which is used to deliver effectors to hosts or target bacteria. The action process is similar to the puncture mechanism used for phage tail contraction. An effector‐loaded needle is injected into the target cell. 11 , 12 As an important virulence factor, T6SS plays a key role in colonization competition and infection of bacteria. Several intestinal pathogens use T6SS to antagonize symbiotic intestinal E.coli promoting colonization and disease progression. 13 T6SS in Campylobacter jejuni has been shown to be important for adhesion and invasion of host cells in vitro. 14 K. pneumoniae T6SS contributes to bacterial competition, cell invasion, type‐1 fimbriae expression, and in vivo colonization. 15

T6SS has been identified as a novel virulence factor. There were less reports about the characteristics of BSIs caused by K. pneumoniae expressing T6SS genes. So, the purpose of this study was to investigate the distribution of the T6SS genes and clinical and molecular characteristics in K. pneumoniae‐induced BSIs.

2. MATERIAL AND METHODS

2.1. Isolates and Clinical data collection

In this study, a total of 344 non‐repetitive K. pneumoniae bloodstream isolates and relevant clinical data were collected from January 2016 to January 2019. Isolates were recovered from samples with positive for blood culture, after separation and cultivation, and then identified by MALDI‐TOF MS (Bruker). The distinction between community‐acquired and hospital‐acquired BSIs was determined by the time of detection of K. pneumoniae in blood cultures. Within 48 hours after admission was defined as community‐acquired BSIs. But over 48 hours into inpatient admission and infections correlated with the presence of medical devices was defined as hospital‐acquired BSIs. 5 , 16 Meanwhile, the following clinical information of the patients was collected from medical records, like age, gender, origin of bacteremia, personal history, underlying disease, and clinical outcomes.

2.2. Detection of T6SS genes, capsular serotypes, and virulence genes

The presence of capsular serotypes and virulence genes was detected by polymerase chain reaction (PCR) as previously described. 17 Intracellular proliferative F family proteins (IcmF), valine‐glycine repeat protein (VgrG), and hemolysin‐coregulated protein (Hcp) were indicated to be core proteins of the T6SS. 15 To identify the T6SS genes in K. pneumoniae, PCR was performed using primer pairs designed specifically for icmF, vgrG, and hcp in this study. Genomic DNA of K. pneumonia was extracted by boiling method. PCR products were electrophoresed in 1.0% agarose gel, and they were visualized using a Gel Doc ™ XR image analysis station (Bio‐Red) to judge whether the gene was positive. Strains positive for p‐rmpA and iroB and iucA were designated as HVKP. 18 icmF, vgrG, and hcp are all positive were designated as T6SS‐positive in this study. All primers used were listed in Table 1.

Table 1.

Primers used in this study

Primer name DNA sequence (5′‐3′) Amplicon size (bp)
Capsular serotypes
K1 F: GGTGCTCTTTACATCATTGC 1283
R: GCAATGGCCATTTGCGTTAG
K2 F: GACCCGATATTCATACTTGACAGAG 641
R: CCTGAAGTAAAATCGTAAATAGATGGC
K5 F: TGGTAGTGATGCTCGCGA 741
R: CCTGAACCCACCCCAATC
K20 F: CGGTGCTACAGTGCATCATT 280
R: GTTATACGATGCTCAGTCGC
K54 F: CATTAGCTCAGTGGTTGGCT 881
R: GCTTGACAAACACCATAGCAG
K57 F: CTCAGGGCTAGAAGTGTCAT 1037
R: CACTAACCCAGAAAGTCGAG
Virulence genes
p‐rmpA F: CATAAGAGTATTGGTTGACAG 461
R: CTTGCATGAGCCATCTTTCA
wcaG F: GGTTGGKTCAGCAATCGTA 169
R: ACTATTCCGCCAACTTTTGC
allS F: CATTACGCACCTTTGTCAGC 764
R: GAATGTGTCGGCGATCAGCTT
iutA

F: GGGAAAGGCTTCTCTGCCAT

R: TTATTCGCCACCACGCTCTT

920
Aerobactin

F: GCATAGGCGGATACGAACAT

R: CACAGGGCAATTGCTTACCT

556
mrkD

F: AAGCTATCGCTGTACTTCCGGCA

R: GGCGTTGGCGCTCAGATAGG

340
Kfu

F: GGCCTTTGTCCAGAGCTACG

R: GGGTCTGGCGCAGAGTATGC

638
ybtS

F: GACGGAAACAGCACGGTAAA

R: GAGCATAATAAGGCGAAAGA

242
iucA

F: GCATAGGCGGATACGAACAT

R: CACAGGGCAATTGCTTACCT

556
iroB

F: TGTGTGCTGTGGGTGAAAGC

R: ATGTTCGGTGAGATTCGCCAGT

2711
entB

F: GTCAACTGGGCCTTTGAGCCGTC

R: TATGGGCGTAAACGCCGGTGAT

400
T6SS genes
hcp F: TCCCGACCGATAACAACACC 242
R: GATGTCGTGCATCAGGGGAT
vgrG F: TGAGCGTGTTTGTGCGAAAG 259
R: TGACGCCCGTAATATCCTGC
icmF F: GACCGCTTACGGACAACTGA 485
R: CACTCAGCACCCAGTCCATT

2.3. Multilocus sequence typing (MLST) and eBURST

MLST was performed for all HVKP through amplification, sequencing, and analyzing seven housekeeping genes for K. pneumoniae, including gapA, infB, mdh, pgi, phoE, rpoB, and tonB. Sequence types (STs) were determined according to the MLST database (https://pubmlst.org/bigsdb?db=pubmlst_mlst_seqdef). Then, analysis of genetic relationships between different STs was performed by eBURST. 19

2.4. Antimicrobial susceptibility testing

All K. pneumoniae strains underwent antimicrobial susceptibility testing by bioMerieux VITEK® 2 Compact (bioMerieux). The bacterial suspension was added to the matching Gram‐negative bacilli susceptibility identification card for culture and identification, according to the instructions and the standard operating procedures of the instrument. A panel of 20 antimicrobial agents was tested, including cefoperazone‐sulbactam, ampicillin‐sulbactam, piperacillin‐tazobactam, cefazolin, ceftazidime, ceftriaxone, cefepime, cefotan, aztreonam, ertapenem, meropenem, imipenem, tobramycin, amikacin, gentamicin, levofloxacin, ciprofloxacin, trimethoprim‐sulfamethoxazole, furantoin, and tigecycline. Carbapenem‐resistant and extended‐spectrum β‐lactamase (ESBL)‐producing K. pneumoniae were also identified. The minimum inhibitory concentrations (MICs) of antimicrobial agents were interpreted according to the performance standards for antimicrobial susceptibility testing issued by the Clinical and Laboratory Standards Institute (CLSI) in 2019. 20 E. coli ATCC25922, Staphylococcus aureus ATCC 25923, and Pseudomonas aeruginosa ATCC27853 were quality control strains.

2.5. Statistical analysis

Categorical variable analysis was used by Chi‐square test or Fisher's exact test. Student's t test or the Mann‐Whitney U test was used to analyze the measurement data. A P value < .05 was considered statistically significant. The virulence and clinical characteristics were summarized, and the risk factors of T6SS‐positive K. pneumoniae‐induced BSIs were determined by logistic regression analysis. All variables with P values < .1 were incorporated into a multivariate model using a backward approach. All data analysis was performed by SPSS software (version 25.0).

3. RESULTS

3.1. Distribution of T6SS genes, capsular serotypes, and virulence genes

Among 344 K. pneumoniae isolates recovered from patients with BSIs, 69 strains (20.1%) were positive for T6SS genes. A total of 108 isolates (31.4%) detected positive for common hypervirulent capsular types: K1, K2, K5, K20, K54, and K57. Capsular serotypes K1, K2, K5, K20, K54, and K57 comprised 38(11.1%), 36(10.5%), 4(1.2%), 3(0.9%), 3(0.9%), and 18 (5.2%) of all 344 K. pneumoniae strains, respectively. According to data analysis, the prevalence of K1 capsular serotype in T6SS‐positive strains was higher than T6SS‐negative strains (P = .000). But K20 and K54 were not detected in the T6SS‐positive strains.

As shown in Table 2, prevalence rates of eleven virulence genes were tested, including p‐rmpA, wcaG, alls, iutA, Aerobactin, mrkD, Kfu, ybtS, iucA, iroB, and entB. Except for ybtS, the positive rates of other virulence genes were significantly higher in T6SS‐positive strains (P = .000). Compared with T6SS‐negative strains, the T6SS‐positive strains had significantly higher positive rates of p‐rmpA, wcaG, Aerobactin, Kfu, iucA, and iroB (P < .05). As determined by positive p‐rmpA, iroB, and iucA, 27 strains (7.8%) were HVKP. The T6SS‐positive rate was significantly higher than T6SS‐negative rate among HVKP isolates (P = .000).

Table 2.

Capsular types and virulence gene distribution of T6SS‐positive and T6SS‐negative K. pneumoniae bloodstream isolates

Virulence factors All (n = 344) (%) T6SS‐positive (n = 69) (%) T6SS‐negative (n = 275) (%) P value
Virulence gene
p rmpA 79(23.0) 30(43.5) 49(17.8) .000*
wcaG 39(11.3) 24(34.8) 15(5.5) .000*
allS 192(55.8) 45(65.2) 147(53.5) .079
iutA 99(28.8) 22(31.9) 77(28.0) .524
Aerobactin 86(25.0) 30(43.5) 56(20.4) .000*
mrkD 326(94.8) 67(97.1) 259(94.2) .330
Kfu 86(25.0) 28(40.6) 58(21.1) .001*
ybtS 192(55.8) 34(49.3) 158(57.5) .221
iucA 175(50.9) 44(63.8) 131(47.6) .017*
iroB 45(13.1) 20(29.0) 25(9.1) .000*
entB 336(97.7) 69(100.0) 267(97.1) .366
Capsular serotype
K1 38(11.0) 17(24.6) 21(7.6) .000*
K2 36(10.5) 5(7.2) 31(11.3) .329
K5 4(1.2) 1(1.4) 3(1.1) .804
K54 3(0.9) 0(0.0) 3(1.1) 1.000
K20 3(0.9) 0(0.0) 3(1.1) 1.000
K57 18(5.2) 5(7.2) 13(4.7) .401
HVKP 27(7.8) 14(20.3) 13(4.7) .000*

Abbreviations: HVKP, hypervirulent Klebsiella pneumoniae.

*

A P value < .05 was considered to be statistically significant.

3.2. MLST and eBURST analysis

MLST analysis of 27 HVKP strains found that 13(48.1%) strains were ST23, 3 (11.1%) strains were ST268, 2 (7.4%) strains were ST25. 2 (7.4%) strains were ST375, while ST218, ST39, ST2446, ST1534, ST893, ST412, and ST65 were 1 (3.7%) strain, respectively. In Table 3, among 14 T6SS‐positive HVKP strains, ST23 was most common that reaching 11 strains (78.6%), which was much higher than T6SS‐negative HVKP (P = .002). However, ST268 was the common in T6SS‐negative HVKP, with 3 strains (23.1%). In ST23 HVKP strains, 9 strains (69.2%) capsular type were K1. eBURST analysis showed that ST218 and ST23 were related, and ST375 and ST25 were related. HVKP had no obvious epidemic trend during 2016 to 2019.

Table 3.

MLST of T6SS‐positive and T6SS‐negative K. pneumoniae bloodstream isolates

Sequence types All (n = 27) T6SS‐positive (n = 14) T6SS‐negative (n = 13) P value
ST23 13(48.1%) 11(78.6%) 2(15.4%) .002*
ST268 3(11.1%) 0 3(23.1%) .098
ST25 2(7.4%) 0 2(15.4%) .222
ST375 2(7.4%) 1(7.1%) 1(7.7%) 1.000
ST218/ST39/ST2446/ST893/ ST65 1(3.7%) 0 1(7.7%) .481
ST1534/ST412 1(3.7%) 1(7.1%) 0 1.000
*

A P value < .05 was considered to be statistically significant.

3.3. Antimicrobial resistance of T6SS‐positive and T6SS‐negative K. pneumoniae bloodstream isolates

Generally, all tested antimicrobial resistance of T6SS‐positive K. pneumoniae was lower than that of T6SS‐negative strains. Except for natural resistance to ampicillin, the highest resistance rate was K. pneumoniae to ampicillin‐sulbactam. Fortunately, it can be seen from Table 4 that the current resistance rate to tigecycline was low to 1.5%. The T6SS‐positive K. pneumoniae isolates were significantly more susceptible to cefoperazone‐sulbactam, ampicillin‐sulbactam, cefazolin, ceftriaxone, cefotan, aztreonam, ertapenem, amikacin, gentamicin, levofloxacin, and ciprofloxacin (P < .05). Especially, the detection rate of carbapenem‐resistant K. pneumoniae (CR‐KP) in the T6SS‐positive strain was also lower (P < .05). A summary of these results was shown in Table 4.

Table 4.

Antimicrobial resistance of T6SS‐positive and T6SS‐negative K pneumoniae bloodstream isolates

Antimicrobial agent All (n = 344) (%) T6SS‐positive (n = 69) (%) T6SS‐negative (n = 275) (%) P value
Cefoperazone‐sulbactam 114(33.1) 15(21.7) 99(36.0) .024*
Ampicillin‐sulbactam 199(57.8) 32(46.4) 167(60.7) .031*
Piperacillin‐tazobactam 109(31.7) 16(23.2) 93(33.8) .090
Cefazolin 192(55.8) 28(40.6) 164(59.6) .004*
Ceftazidime 134(39.0) 22(31.9) 112(40.7) .178
Ceftriaxone 173(50.3) 26(37.7) 147(53.5) .019*
Cefepime 132(38.4) 20(29.0) 112(40.7) .073
Cefotan 112(32.6) 15(21.7) 97(35.3) .032*
Aztreonam 163(47.4) 23(33.3) 140(50.9) .009*
Ertapenem 110(32.0) 15(21.7) 95(34.5) .041*
Meropenem 102(29.7) 14(20.3) 88(32.0) .057
Imipenem 100(29.1) 14(20.3) 86(31.3) .072
Tobramycin 72(20.9) 9(13.0) 63(22.9) .072
Amikacin 60(17.4) 5(7.2) 55(20.0) .013*
Gentamicin 108(31.4) 10(14.5) 98(35.6) .001*
Levofloxacin 118(34.3) 16(23.2) 102(37.1) .030*
Ciprofloxacin 125(36.3) 17(24.6) 108(39.3) .024*
Trimethoprim‐sulfamethoxazole 143(41.6) 24(34.8) 119(43.3) .201
Furantoin 162(47.1) 27(39.1) 135(49.1) .138
Tigecycline 5(1.5) 1(1.4) 4(1.5) 1.000
CR‐KP 110(32.0) 15(21.7) 95(34.5) .041*
ESBL+ 48(14.0) 6(8.7) 42(15.3) .159

Abbreviations: CR‐KP, carbapenem‐resistant Klebsiella pneumoniae;ESBL+, producing extended‐spectrum beta‐lactamase.

*

A P value < .05 was considered to be statistically significant.

3.4. Clinical characteristics

Table 5 shows the clinical characteristics of K. pneumoniae‐induced BSIs and T6SS‐positive and T6SS‐negative isolates. Patients of all ages with K. pneumoniae‐caused BSIs could be seen, while mainly were males. There was no obvious difference in age and sex between the two groups. T6SS‐positive K. pneumoniae was more easily acquired from the community than T6SS‐nagetive isolates. Strains isolated from liver abscess were likely to be T6SS‐positive K. pneumoniae (P < .05). It could be found from multivariate regression analysis that community‐acquired infections (OR 2.986,95% CI:1.367‐6.523), the carriage of wcaG (OR 10.579, 95% CI:2.589‐43.221), iucA (OR 2.441, 95% CI:1.085‐5.632), and p‐rmpA (OR 7.438, 95% CI:1.235‐44.796) virulence genes, and biliary diseases (OR 5.361,95%CI:1.428‐20.127) were independent risk factors for T6SS‐positive K. pneumoniae‐induced BSIs. Surprisingly, the virulence gene ybtS seemed to be a protective factor (OR 0.200, 95% CI: 0.083‐0.483).

Table 5.

Clinical characteristics of T6SS‐positive and T6SS‐negative K pneumoniae bloodstream isolates

Characteristics All (n = 344) T6SS‐positive (n = 69) T6SS‐negative (n = 275) P value
Age 42.69 ± 25.83 41.96 ± 24.76 42.86 ± 26.13 .684
Gender
Male 210(61.0%) 45(65.2%) 165(60.0%) .427
Female 134(39.0%) 24(34.8%) 110(40.0%)
Acquisition
Community‐acquired 192(55.8%) 46(66.7%) 146(53.1%) .042*
Hospital‐acquired 152(44.2%) 23(33.3%) 129(46.9%)
Primary site
Respiratory tract 212(61.6%) 42(60.9%) 170(61.8%) .885
Biliary tract 15(4.4%) 1(1.4%) 14(5.1%) .321
Intra‐abdomen 38(11.0%) 5(7.2%) 33(12.0%) .260
Liver abscess 10(2.9%) 5(7.2%) 5(1.8%) .016*
Brain 13(3.8%) 4(5.8%) 9(3.3%) .326
Urinary tract 12(3.5%) 3(4.3%) 9(3.3%) .663
Others 44(12.8%) 9(13.0%) 35(12.7%) .944
Personal history
Smoking history 69(20.1%) 12(17.4%) 57(20.7%) .536
Drinking history 63(18.3%) 10(14.5%) 53(19.3%) .359
Chemotherapy history 58(16.9%) 12(17.4%) 46(16.7%) .895
Blood transfusion history 26(7.6%) 3(4.3%) 23(8.4%) .318
Underlying condition
Hypertension 83(24.1%) 17(24.6%) 66(24.0%) .912
Cancer 59(17.2%) 12(17.4%) 47(17.1%) .953
Diabetes mellitus 55(16.0%) 14(20.3%) 41(14.9%) .276
Premature baby 44(12.8%) 12(17.4%) 32(11.6%) .201
Hematological diseases 41(11.9%) 7(10.1%) 34(12.4%) .611
Biliary tract disease 36(10.5%) 11(15.9%) 25(9.1%) .096
Pulmonary infection 33(9.6%) 6(8.7%) 27(9.8%) .777
Acute severe pancreatitis 28(8.1%) 6(8.7%) 22(8.0%) .850
Liver cirrhosis 13(3.8%) 3(4.3%) 10(3.6%) .729
Multiple bacterial infections 66(19.2%) 11(15.9%) 55(20.0%) .444
Septic shock 85(24.7%) 13(18.8%) 72(26.2%) .206
Death in hospital 19(5.5%) 6(8.7%) 13(4.7%) .197
*

A P value < .05 was considered to be statistically significant.

4. DISCUSSION

This retrospective study analyzed the prevalence, and molecular and clinical characteristics of 344 patients with K. pneumoniae‐induced BSIs from January 2016 to January 2019. It was the first study that focusing on the new virulence factor T6SS in K. pneumoniae bloodstream isolates.

Hypermucoviscosity and strong iron acquisition systems were important characteristic of HVKP. 21 , 22 Hence, like the majority researches, strains positive for p‐rmpA, iroB, and iucA were considered as HVKP in this study, and the results demonstrated that 27(7.8%) strains were HVKP. 18 The prevalence rate of K. pneumoniae‐induced BSIs was 7.8%, similar to the study conducted in Spain, but much lower than previous studies conducted in China (24.5% or 21.6%). 23 , 24 , 25 The inconsistent definition of HVKP may be the cause of this phenomenon. “String test” was widely used to identify HVKP in most previous studies, while it was confirmed that it did not distinguish HVKP from CKP. A clear and unified identification of HVKP was urgently needed.

Currently, T6SS has been identified as a virulence factor, which can inject enzymes, toxins, or other proteins into competing bacteria or host cells, and secrete proteins as virulence factors. 26 As an important core protein of the T6SS, VgrG forms a cell‐puncturing tip and Hcp forms a tail‐tube structure for transport effector proteins. 27 VgrG was not only a directly interact device, but also a secreted protein of T6SS, which exerted virulent infections. 28 , 29 When VgrG was separated from the Hcp tube, the secreted proteins of T6SS were also released into the host cell through the Hcp tube. 30 IcmF were the conservatively integrated inner membrane proteins of T6SS and responsible for delivering effector proteins to target cells. 31 The sequencing results of K. pneumoniae indicated that NTUH‐K2044 K. pneumoniae had two gene Loci, Locus I contained protein‐encoding genes secreted by hcp, vgrG, and icmF, Locus III contained vgrG and icmF genes. So, in our study, strains positive for icmF, vgrG, and hcp were designated as T6SS‐positive. Based on this standard, our study indicated that the frequency of T6SS genes among K. pneumoniae bloodstream isolates was 20.1%, which was lower than K. pneumoniae isolated from pyogenic liver abscess (PLA) (88.1%) and the intestinal (41.5%). 15

As a key virulence factor, K1 and K2 were most associated with hypervirulent of all capsular serotypes among K. pneumoniae. 32 We used PCR to test six common high‐virulence‐associated capsular serotypes. K1 was most frequently in K. pneumoniae bloodstream isolates, followed by K2. Analysis revealed that detection rate of K1 in T6SS‐positive strains was significantly higher than T6SS‐negative strains. In addition, there was a study demonstrated that T6SS genes contributes to the development of meningitis caused by K1 E. coli. 33 Taken together, T6SS‐positive K. pneumoniae strain seems to have a strong virulence potential.

The virulence of the T6SS‐positive K. pneumoniae strains was further supported by this study that the positive rates of the virulence genes except for ybts were higher in T6SS‐positive than T6SS‐negative strains. More importantly, p‐rmpA, wcaG, Aerobactin, Kfu, and iucA were related to hypervirulent, hypermucoviscosity phenotype, and iron acquisition. 34 , 35 , 36 , 37 Moreover, the rate of T6SS‐positive strains was significantly higher than T6SS‐negative strains among HVKP. Whole genome sequencing declared that genes coding for iron uptake systems are encoded in adjacencies of T6SS, suggesting that T6SS might play a role in iron import. 38 As is known to all, iron acquisition is a vital part of HVKP. These findings further supported the view that T6SS‐positive strains may have a relationship with hypervirulence.

Similar to other studies, the most prevalent ST in HVKP isolates was ST23. 5 Among the 13 ST23 HVKP isolates, 11(78.6%) were T6SS‐positive and only 2 were T6SS‐negetive. In ST23 strains, 9(69.2%) capsular type were K1. ST23 seemed to be related to K1, which had been shown by many studies. 39 , 40 , 41 Several researches proved that ST23 was closely related to K. pneumoniae virulence. 34 , 42 , 43 Complexing capsular serotypes, virulence genes, and hypervirulence‐associated ST23, there was an evidence that T6SS‐positive K. pneumoniae strains was hypervirulent.

The antimicrobial resistance rates of T6SS‐positive K. pneumoniae strains in this study were lower than T6SS‐negetive. But carbapenem‐resistant, tigecycline‐resistant, and ESBL‐producing K. pneumoniae still existed. As we know, hypervirulent strains were usually sensitive to antimicrobials. Also, HVKP were difficult to obtain or lose resistance‐associated plasmids, and capsules can also affect the horizontal spread of resistant genes. 44 However, the studies about ESBLs‐producing, carbapenemase‐resistant, even NDM‐1 HVKP strains have been reported increasingly in recent years. 6 , 7 , 8 , 9 , 45 Once hypervirulence and high resistance characteristics are combined, it will undoubtedly become a great threat to public health.

HVKP was characterized by causing severe and spreadable community‐acquired infections like liver abscess in young healthy people. 46 , 47 Analysis of clinical characteristics showed that T6SS‐positive K. pneumoniae was more easily acquired from the community, which was also a manifestation of hypervirulent. More T6SS‐positive K. pneumoniae were isolated from patients with liver abscess. There was a study about K. pneumoniae isolated from PLA claimed that T6SS genes aid interspecies and intraspecies antibacterial competitiveness, mediate in the transcriptional expression of type‐1 fimbriae, and promote the occurrence of liver abscesses. 15 Besides, it was worth noting that biliary disease seemed to be related to T6SS‐positive K. pneumoniae. However, biliary tract infections were mostly caused by CKP in previous studies. 48 The coordinated regulation of T6SS and the bile efflux transporter ensuring C. jejuni survival during exposure to the upper range of physiological concentrations of deoxycholicacid. 14 The adaptive mechanism may also exist in T6SS‐positive K. pneumoniae, and relevant researches are required to corroborate the association between T6SS‐positive K. pneumoniae and biliary disease.

In conclusion, the prevalence of T6SS genes is high among K. pneumoniae BSIs. T6SS‐positive strains exhibit hypervirulent properties and potential pathogenicity. Community‐acquired infections, the carriage of wcaG, iucA, and p‐rmpA virulence genes, and biliary diseases were independent risk factors, of T6SS‐positive K. pneumoniae‐induced BSIs. This study introduced the molecular and clinical characteristics of T6SS‐positive K. pneumoniae isolated from BSIs which make clinicians aware of the importance in epidemiologic surveillance of this gene cluster. Furthermore, it can also contribute to the in‐depth study about virulence mechanism of K. pneumoniae.

CONFLICTS OF INTEREST

The author reports no conflicts of interest in this work.

ETHICAL APPROVAL

The study was approved by the Ethics Committee of Xiangya Hospital, Central South University. No informed consent was taken because this study was retrospective, and it did not cause additional medical procedure.

ACKNOWLEDGMENTS

We thank all the staff in the Microbiology Department of Xiangya Hospital for their kind help. This work was supported by the National Natural Science Foundation of China (81672066).

Zhou M, Lan Y, Wang S, et al. Epidemiology and molecular characteristics of the type VI secretion system in Klebsiella pneumoniae isolated from bloodstream infections. J Clin Lab Anal. 2020;34:e23459 10.1002/jcla.23459

REFERENCES

  • 1. Wang JH, Liu YC, Lee SS, et al. Primary liver abscess due to Klebsiella pneumoniae in Taiwan[J]. Clin Infect Dis. 1998;26:1434‐1438. [DOI] [PubMed] [Google Scholar]
  • 2. Patel PK, Russo TA, Karchmer AW. Hypervirulent Klebsiella pneumoniae[J]. Open Forum. Infectious Diseases. 2014;1(1):ofu028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Fang CT, Lai SY, Yi WC, et al. Klebsiella pneumoniae Genotype K1: An Emerging Pathogen That Causes Septic Ocular or Central Nervous System Complications from Pyogenic Liver Abscess[J]. Clin Infect Dis. 2007;45(3):284‐293. [DOI] [PubMed] [Google Scholar]
  • 4. Jun JB. Klebsiella pneumoniae Liver Abscess[J]. Infect Chemother. 2018;50(3):210‐218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Liu YM, Li BB, Zhang YY, et al. Clinical and Molecular Characteristics of Emerging Hypervirulent Klebsiella pneumoniae Bloodstream Infections in Mainland China[J]. Antimicrob Agents Chemother. 2014;58(9):5379‐5385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Gu D, Dong N, Zheng Z, et al. A fatal outbreak of ST11 carbapenem‐resistant hypervirulent Klebsiella pneumoniae in a Chinese hospital: A molecular epidemiological study[J]. Lancet Infect Dis. 2017;18(1):37‐46. [DOI] [PubMed] [Google Scholar]
  • 7. Zhang Y, Zeng J, Liu W, et al. Emergence of a hypervirulent carbapenem‐resistant Klebsiella pneumoniae isolate from clinical infections in China[J]. J Infect. 2015;71(5):553‐560. [DOI] [PubMed] [Google Scholar]
  • 8. Roumayne LF, Brenda CM, Graziela SR, et al. High Prevalence of Multidrug‐Resistant Klebsiella pneumoniae Harboring Several Virulence and β‐Lactamase Encoding Genes in a Brazilian Intensive Care Unit[J]. Front Microbiol. 2018;9:1‐15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Liu Z, Gu Y, Li X, et al. Identification and Characterization of NDM‐1‐producing Hypervirulent (Hypermucoviscous) Klebsiella pneumoniae in China[J]. Ann Lab Med. 2019;39(2):167‐175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Pena RT, Blasco L, Ambroa A, et al. Relationship Between Quorum Sensing and Secretion Systems[J]. Front Microbiol. 2019;10:1100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Russell AB, Hood RD, Bui NK, et al. Type VI secretion delivers bacteriolytic effectors to target cells[J]. Nature. 2011;475(7356):343‐347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Russell AB, Peterson SB, Mougous JD. Type VI secretion system effectors: poisons with a purpose[J]. Nat Rev Microbiol. 2014;12(2):137‐148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Coyne MJ, Comstock LE. Type VI secretion systems and the gut microbiota[J]. Microbiol Spectrum. 2019;7(2):343‐350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Lertpiriyapong K, Gamazon ER, Feng Y, et al. Campylobacter jejuni Type VI Secretion System: Roles in Adaptation to Deoxycholic Acid, Host Cell Adherence, Invasion, and In Vivo Colonization[J]. PLoS One. 2012;7(8):e42842. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Hsieh PF, Lu YR, Lin TL, et al. Klebsiella pneumoniae type VI secretion system contributes to bacterial competition, cell invasion, type‐1 fimbriae expression, and in vivo colonization [J]. J Infect Dis. 2018;219(4):637‐647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Meng X, Liu S, Duan J, et al. Risk factors and medical costs for healthcare‐associated carbapenem‐resistant Escherichia coli infection among hospitalized patients in a Chinese teaching hospital[J]. BMC Infect Dis. 2017;17(1):82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Compain F, Babosan A, Brisse S, et al. Multiplex PCR for Detection of Seven Virulence Factors and K1/K2 Capsular Serotypes of Klebsiella pneumoniae. Journal of Clinical Microbiology[J]. 2014;52(12):4377‐4380. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Yan Q, Zhou M, Zou M, et al. Hypervirulent Klebsiella pneumoniae induced ventilator‐associated pneumonia in mechanically ventilated patients in China[J]. European Journal of Clinical Microbiology. 2016;35(3):387‐396. [DOI] [PubMed] [Google Scholar]
  • 19. Feil EJ, Li BC, Aanensen DM, et al. eBURST: Inferring Patterns of Evolutionary Descent among Clusters of Related Bacterial Genotypes from Multilocus Sequence Typing Data[J]. J Bacteriol. 2004;186(5):1518‐1530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Clinical and Laboratory . Standards Institute (CLSI). The Performance stands for antimicrobial susceptibility testing [S]. The M100–S29. 2019. [Google Scholar]
  • 21. Catalán‐Nájera JC, Garza‐Ramos U, Barrios‐Camacho H. Hypervirulence and hypermucoviscosity: Two different but complementary Klebsiella spp. phenotypes? [J]. Virulence. 2017;8(7):1111‐1123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Shon AS, Bajwa RP, Russo TA. Hypervirulent (hypermucoviscous) Klebsiella pneumoniae: a new and dangerous breed[J]. Virulence. 2013;4(2):107‐118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Cubero M, Grau L, Tubau F, et al. Hypervirulent Klebsiella pneumoniae clones causing bacteraemia in adults in a teaching hospital in Barcelona, Spain (2007–2013) [J]. Clin Microbiol Infect. 2016;22(2):154‐160. [DOI] [PubMed] [Google Scholar]
  • 24. Li J, Ren J, Wang W, et al. Risk factors and clinical outcomes of hypervirulent Klebsiella pneumoniae induced bloodstream infections[J]. Eur J Clin Microbiol Infect Dis. 2017;37(4):679‐689. [DOI] [PubMed] [Google Scholar]
  • 25. Lan Y, Zhou M, Jian Z, et al. Prevalence of pks gene cluster and characteristics of Klebsiella pneumoniae‐induced bloodstream infections[J]. J Clin Lab Anal. 2019;33(4):e22838. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Agnetti J, Seth‐Smith HMB, Ursich S, et al. Clinical impact of the type VI secretion system on virulence of Campylobacter species during infection[J]. BMC Infect Dis. 2019;19(1):237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Renault MG, Zamarreno Beas J, Douzi B, et al. The gp27‐like Hub of VgrG Serves as Adaptor to Promote Hcp Tube Assembly[J]. J Mol Biol. 2018;430(18):3143‐3156. [DOI] [PubMed] [Google Scholar]
  • 28. Hachani A, Lossi NS, Hamilton A, et al. Type VI secretion system in Pseudomonas aeruginosa: secretion and multimerization of VgrG proteins[J]. J Biol Chem. 2011;286(14):12317‐12327. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Bröms JE, Meyer L, Lavander M, et al. DotU and VgrG, core components of type VI secretion systems, are essential for Francisella LVS pathogenicity[J]. PLoS One. 2012;7(4):e34639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Durand E, Cambillau C, Cascales E, et al. VgrG, Tae, Tle, and beyond: the versatile arsenal of Type VI secretion effectors[J]. Trends Microbiol. 2014;22(9):498‐507. [DOI] [PubMed] [Google Scholar]
  • 31. Sexton JA, Miller JL, Yoneda A, et al. Legionella pneumophila DotU and IcmF Are Required for Stability of the Dot/Icm Complex[J]. Infect Immun. 2004;72(10):5983‐5992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Paczosa MK, Mecsas J. Klebsiella pneumoniae: Going on the Offense with a Strong Defense[J]. Microbiology & Molecular Biology Reviews Mmbr. 2016;80(3):629‐661. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Zhou Y, Tao J, Yu H, et al. Hcp Family Proteins Secreted via the Type VI Secretion System Coordinately Regulate Escherichia coli K1 Interaction with Human Brain Microvascular Endothelial Cells[J]. Infect Immun. 2012;80(3):1243‐1251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Lee CR, Lee JH, Park KS, et al. Antimicrobial Resistance of Hypervirulent Klebsiella pneumoniae: Epidemiology, Hypervirulence‐Associated Determinants, and Resistance Mechanisms[J]. Front Cell Infect Microbiol. 2017;7:483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Jin XZ, Zhi WL, Chen C, et al. Biofilm Formation in Klebsiella pneumoniae Bacteremia Strains Was Found to be Associated with CC23 and the Presence of wcaG[J]. Front Cell Infect Microbiol. 2018;8:21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Cheng HY, Chen YS, Wu CY, et al. RmpA Regulation of Capsular Polysaccharide Biosynthesis in Klebsiella pneumoniae CG43[J]. J Bacteriol. 2010;192(12):3144‐3158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Russo TA, Olson R, Macdonald U, et al. Aerobactin Mediates Virulence and Accounts for Increased Siderophore Production under Iron‐Limiting Conditions by Hypervirulent (Hypermucoviscous) Klebsiella pneumoniae[J]. Infect Immun. 2014;82(6):2356‐2367. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Barbosa VAA, Lery LMS. Insights into Klebsiella pneumoniae type VI secretion system transcriptional regulation[J]. BMC Genom. 2019;20(1):506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Turton JF, Englender H, Gabriel SN, et al. Genetically similar isolates of Klebsiella pneumoniae serotype K1 causing liver abscesses in three continents[J]. J Med Microbiol. 2007;56(5):593‐597. [DOI] [PubMed] [Google Scholar]
  • 40. Chung DR, Lee HR, Lee SS, et al. Evidence for Clonal Dissemination of the Serotype K1 Klebsiella pneumoniae Strain Causing Invasive Liver Abscesses in Korea[J]. J Clin Microbiol. 2008;46(12):4061‐4063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Guo Y, Wang S, Zhan L, et al. Microbiological and Clinical Characteristics of Hypermucoviscous Klebsiella pneumoniae Isolates Associated with Invasive Infections in China[J]. Front Cell Infect Microbiol. 2017;7:24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Siu LK, Fung CP, Chang FY, et al. Molecular Typing and Virulence Analysis of Serotype K1 Klebsiella pneumoniae Strains Isolated from Liver Abscess Patients and Stool Samples from Noninfectious Subjects in Hong Kong, Singapore, and Taiwan[J]. J Clin Microbiol. 2011;49(11):3761‐3765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Luo Y, Wang Y, Ye L, et al. Molecular epidemiology and virulence factors of pyogenic liver abscess causing Klebsiella pneumoniae in China[J]. Clin Microbiol Infect. 2014;20(11):818‐824. [DOI] [PubMed] [Google Scholar]
  • 44. Wyres KL, Wick RR, Judd LM, et al. Distinct evolutionary dynamics of horizontal gene transfer in drug resistant and virulent clones of Klebsiella pneumoniae[J]. PLoS Genet. 2019;15(4):e1008114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Li J, Huang ZY, Yu T, et al. Isolation and characterization of a sequence type 25 carbapenem‐resistant hypervirulent Klebsiella pneumoniae from the mid‐south region of China[J]. BMC Microbiol. 2019;19(1):219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Siu LK, Yeh KM, Lin JC, et al. Klebsiella pneumoniae liver abscess: a new invasive syndrome[J]. Lancet Infect Dis. 2012;12(11):881‐887. [DOI] [PubMed] [Google Scholar]
  • 47. Shon AS, Russo TA. Hypervirulent Klebsiella pneumoniae: The next superbug? [J]. Future Microbiol. 2012;7(6):669‐671. [DOI] [PubMed] [Google Scholar]
  • 48. Wu H, Li D, Zhou H, et al. Bacteremia and other body site infection caused by hypervirulent and classic Klebsiella pneumoniae[J]. Microb Pathog. 2017;104:254‐262. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Clinical Laboratory Analysis are provided here courtesy of Wiley

RESOURCES