Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2021 Jan 11;11(2):43. doi: 10.1007/s13205-020-02609-3

Molecular characterization and population evolution analysis of Watermelon mosaic virus isolates on cucurbits of Northwest Iran

Sevil Nematollahi 1,✉, Neda Panahborhani 1, Davoud Koolivand 2
PMCID: PMC7801552  PMID: 33489666

Abstract

One of the destructive potyviruses which cause economic damage and serious yield losses to cucurbit crops around the world is Watermelon mosaic potyvirus. In 2016, 305 leaf samples from different cucurbit cultivars with deformation and reduction in leaf size, blistering, mild and severe mosaic symptoms were collected from different cucurbits-growing regions in Northwest of Iran. Total RNA and their cDNA were tested by RT-PCR assay using two sets of specific primers corresponding to the partial sequences of CP and P1 genomic regions, in which approximately 80 out of 305 samples were found to be infected by WMV. DNA fragments of about 780 bp and 545 bp in length were amplified that belonged to the CP and P1 genes, respectively. Phylogenetic trees of WMV isolates were clustered into three main independent groups with significant FST values (> 0.50 and > 0.55) for CP and P1 genes, respectively. dN/dS ratios obtained less than one (< 1) for CP gene that showed the WMV populations have been under the negative selection, whereas for P1 gene, the dN/dS values were calculated > 1 for EM clade containing; China, France, and Italy populations and < 1 for CL and G2 clades; South Korea and Iran populations. This results demonstrated that the WMV evolutionary selection pressure on the P1 gene is dependent on conditions such as the variety of cultivars and the type of cultivation.

Keywords: Genetic differential, Population analysis, Potyvirus

Introduction

Watermelon mosaic virus is one of the main viruses that attacks to cucurbit species such as melon (Cucumis melo L.), cucumber (C. sativus L.), squash (Cucurbita sp.), and watermelon (Citrullus lanatus L.), some legumes, orchids, and weeds (Chare and Holmes 2006), and it causes severe quality and yield losses of cucurbit crops worldwide and induces different symptoms in Cucurbitaceae plants (Rajbanshi and Ali 2016). General symptoms of WMV.

according to the isolate and the host cultivar include mild to severe mosaic with blistering of the leaves, stunting, deformation of leaves and fruits, and chlorosis (Ayazpour and Vahidian 2016). WMV is a member of the largest plant viruses’ genus, i.e. genus Potyvirus within the family Potyviridae with a worldwide distribution and it most common in tropical and subtropical regions of the world. WMV transmitted in nature by several aphid species in a non-persistent manner. Its genome contains a single-stranded positive-sense RNA (+ ssRNA) of around 10,035-nt long which encodes a unique large open reading frame and it is processed at least into ten proteins (Sharifi et al. 2008) and has the close relationship with soybean mosaic virus (SMV) another potyvirus in terms of the genome sequence (Desbiez and Lecoq 2004). WMV was recorded for the first time from Italy in watermelon by Webb and Scott (1965), and has been recognized as a major virus infecting cucurbit crops (Perotto et al. 2017), and was first described by Ebrahim-Nesbat (1974) from Iran. Several studies reported that this virus has also been found in mixed infection with other viruses such as cucumber mosaic virus (CMV), moroccan watermelon mosaic virus (MWMV), papaya ringspot virus (PRSV), and zucchini yellow mosaic virus (ZYMV) (Glasa et al. 2011; Bertin et al. 2020). Previous studies have shown WMV isolates have been classified into three distinct molecular groups: Classic (CL), Group 2 (G2), and Emergent (EM) based on NIb-CP, P1, and N-terminal of CP genomic regions (Glasa et al. 2011; Hajizadeh et al. 2017).

Mutation and recombination are common evolutionary factors in genetic diversity and variation in populations of plant RNA viruses and are known as the preliminary source of variation in populations (Gao et al. 2015). Genetic diversity is an essential phenomenon in RNA virus population that allows a virus to evolve during environmental changes and tolerate selection pressure (Schneider and Roossinck 2001). To design the best strategies for plant viral disease management, population genetic studies of viruses can help us to understand important characteristics of their biology such as their geographical ranges, epidemiology, and virulence (Rubio et al. 2013).

The genetic structure of WMV isolates have mostly been analyzed based on the CP gene in Iran and around the world (Glasa et al. 2011; Hajizadeh et al. 2017) but there are not any information on the genetic structure and sequence characteristics of WMV isolates from the Northwest of Iran based on the other regions of the genome. Hence, the main objectives of this survey were to exact phylogenetic position and population analysis of WMV isolates from Iran where no detailed studies have already been done from different cultivars of cucurbits based on the partial of CP and P1 genes.

Material and methods

Sampling

During spring to autumn in 2016, a total of 305 leaf samples from major cucurbit include Summer squash (Cucurbita pepo L.), Pumpkin (Cucurbita maxima Duch.), cucumber (Cucumis sativus L.), watermelon (Citrllus lanatnus Thunb.), Muskmelon (Cucumis melo var. reticulatus), and Winter melon (Cucumis melo var. indorus) plants infected by WMV were collected from different regions of Northwest of Iran. Samples were preserved on calcium chloride granules at 4 °C and then stored at − 20 °C for genetic processing.

RNA extraction, RT-PCR, cloning, sequencing

Total RNAs from leaves were extracted from the suspected samples. Then, the reverse transcription reactions (RT) were carried out using the Hyperscript master mix (Genall, South Korea) with random hexamer primer in a total volume of 10 μl, according to manufacturer’s instruction. The RT-PCR reactions were performed with two sets of primers. WMV-F 5-AATCAGTGTCTCTGCAATCAGG-3 and WMV-R 5′ATTCACGTCCCTTGCAGTGTG3′ from nucleotides 8923–8945 at the N-terminal region to Nucleotides 9744-9724 at the C-terminal region of CP gene; and WMV354F 5′GAGACCTTAGTGCATCAGGAG3′ and WMV926R 5′GCTTGCTGTTCATACTTGCC3′ from nucleotides 353–373 to nucleotides 907–926 corresponding to a part of P1 gene as forward and reverse primers (Glasa et al. 2011).

Initial denaturation was performed at 94 °C for 2 min, followed by 30 cycles at 94 °C for 1 min, 50 °C in the case of CP primer and 56 °C in the case of P1 for 45 s, 72 °C for 1 min and a final elongation step at 72 °C for 5 min. PCR products were analyzed on 1% agarose gel at 80 V with 1 × TBE. The gel was stained in ethidium bromide solution (1 mg/ml) for 15 min and visualized with gel documentation (White/Ultraviolet transiluminotor-UVP-UK) (Feinberg and Vogelstein 1983).

PCR products of the CP and P1 genes were ligated into pTZ57R/T vector (Fermentas, Lithuania) according to the manufacturer’s protocol and incubated at 4 °C overnight and the ligations mix were transformed into Escherichia coli strain DH5a using Chung et al. (1989) method. The recombinant plasmids were verified by the PCR colony and purified clones from each gene were subjected to sequencing by Macrogen Inc.

Phylogenetic analysis

The obtained sequences in this survey were analyzed and compared with available in the GenBank from around the world using the BLAST program (Table 1). Multiple sequence alignment of 27 nucleotide sequences including eight new Iranian isolates without outgroup were carried out by ClustalW algorithm (Larkin et al. 2007) implemented in the program MEGA 7 (Kumar et al. 2016) using default parameters.

Table 1.

Accession numbers, hosts, and origins of watermelon mosaic virus isolates/strains were analyzed in this survey

Location Isolates/strains Host Accession number Collection date
Complete genome China WMV-CHN, WMV-ShanXi, WMV-Li, CH99/69 Watermelon, watermelon, Alcea rosea, Lagerstroemia indica, Cucurbita pepo DQ399708, JX079685, MG194418, MN296125 2006, 2014, 2017, 2020
South Korea TA-om3, TA-om2, IS-me2, HS-sq6, GC-wm2, HS-om3, ES-gs2 Cucumis melo, Cucumis melo, Cucumis melo, Cucurbita moschata, Citrullus lanatus, Cucumis melo var. makuwa, Panax ginseng MN854651, MN854650, MN854647, MN854646, MN854643, MN854645, MN854641 2019, 2019, 2015, 2017, 2019, 2017, 2019
France WMV-Fr, C07-284, Cg09-640, A08-170, C07-014, C06-257, FBR04-37, FMF00-LL1 –, zucchini, zucchini, zucchini, melon, melon, – AY437609, JF273468, JF273467, JF273466, JF273464, JF273463, EU660586, EU660581 2004, 2007, 2009, 2008, 2007, 2006, 2004, 2000
Spain Vera Cucumis melo MH469650 2018
Italy Lecce, ITA00-G, Citrullus lanatus, FJ823122, EU660590 2012, 2000
Chile CHI02-481 – EU660582 2002
CP Iran (new isolates) T1Ahr, T4mdb T5ngd, Tab32 Cucumis sativus, Citrullus lanatus, Cucurbita pepo, Cucurbita pepo MH711915, MH711917, MH711919, MH711921 2019, 2019, 2019, 2019
P1 Iran (new isolates) T1Ahr, T4mdb T5ngd, Tab32 Cucumis sativus, Citrullus lanatus, Cucurbita pepo, Cucurbita pepo MH711916, MH711918, MH711920, MH711922 2019, 2019, 2019, 2019
Open in a new tab

To examine the evolutionary relationships of WMV isolates, the phylogenetic trees for the coat protein and P1 genes of 27 WMV isolates from different parts of the world; Chile, Central and East of the Asian continent (Iran, China, and South Korea), and the European continent (Italy, France, and Spain) populations were constructed by the Maximum-Likelihood (ML) method based on Kimura 2-parameter’s model implemented in MEGA 7 without root branch support was computed using the bootstrap method based on 1000 replications and all branches with < 70% bootstrap were collapsed (Kumar et al. 2016). Moreover, Sequence Demarcation Tool program version 1.2 (SDT v1.2) (Muhire et al. 2014) was used to generate a pairwise nucleotide sequence identity matrix.

Population evolution

Genetic differentiation and number of haplotypes (H), haplotype diversity (Hd), number of polymorphic (segregation) sites (S), total number of mutations η (Eta), average number of nucleotide differences (k), average pairwise nucleotide diversity (π = Pi), and dN/dS was DnaSP version 6 program (Rozas et al. 2017). There are three types of selection pressure, including positive (diversifying), neutral, and negative (purifying). The gene is under positive, neutral, and negative selection when dN/dS (ω) ratio is > 1, = 1, and < 1, respectively (Rozas et al. 2017).

Three statistical tests, Tajima’s D (Tajima 1989), Fu and Li’s D* and F* (Fu and Li 1993), implemented in the DnaSP 6 program used to assess the neutral selection hypothesis on CP and P1 genes among WMV populations.

Population differentiation parameters including: KS*, KST*, Z*, Snn, and FST (Hudson 2000) among phylogroups and geographical populations of WMV isolates were DnaSP 6. To examine the degree of virus gene flow (migration), the FST test statistic was evaluated using DnaSP v.6.10.01 (Hudson 2000). The P value of FST ranges can take from 0, no genetic differentiation, to 1, complete genetic differentiation as fully differentiated populations (Tsompana et al. 2005). Values of FST above 0.25 suggest a significant genetic differentiation within the population (Gao et al. 2015).

Results

Field observation

During the cucurbit-growing season, visual viral symptoms in the inspected cucurbits including mild and severe mosaic, leaf deformation, chlorosis, necrotic spots, and reduced yield were observed based on virus descriptions, they seemed to be infected by WMV. Some symptoms such as leaves and fruits deformation, stunting, and mottling were observed in the fields with common symptoms of WMV in some samples. A wide range of the observed symptoms in the fields may be occurred due to mix infections with other viruses such as zucchini yellow mosaic virus (ZYMV) and cucumber mosaic virus (CMV).

RT-PCR amplification

RT-PCR amplified DNA fragments of about 780 bp and 545 bp in length corresponding to a part of the CP and P1 genes in 80 samples out of the 305 tested samples, respectively. Infection rates for C. pepo L., C. lanatnus Thunb., C. sativus L., C. maxima Duch., C. melo var. reticulatas and C. melo var. indorus were 28%, 17%, 15%, 13%, 11% and 10%. The new Iranian sequences were deposited in the GenBank database accession numbers MH711915, MH711917, MH711919, and MH711921 for the CP gene and MH711916, MH711918, MH711920, and MH711922 for the P1 gene. No amplification was obtained from healthy samples or water controls which were used as negative controls.

Phylogenetic analysis

Our new nucleotide sequences were blasted with all the WMV variants in the GeneBank database based on the high levels of sequence similarities and revealed that the new sequences belonged to WMV. The identities of the CP gene were 96–99% between the new four Iranian and other reported isolates in the GenBank whereas the identities among the new Iranian WMV isolates were 98% to 99% based on nucleotide sequences (Fig. 1a). The amino acid identities between Iranian isolates and isolates around the world was around 95% to 99% based on the Coat Protein. The nucleotide identities of P1 gene were 84–97.62% between the new four Iranian and other reported isolates in the GenBank. The sequences that obtained from the P1 gene in this survey showed high sequence identity (96.88–99%) among themselves (Fig. 1b). Amino acid identity was estimated around 94–98% between new isolates and other reported isolates.

Fig. 1.

Fig. 1

Open in a new tab

Pairwise nucleotide sequence identity matrix of WMV isolates from Iran and complete genome isolates/strains from the GenBank, generated using SDT software for CP gene (a) and P1 gene (b)

Two unrooted phylogenetic trees were constructed based on a part of the CP and P1 genes by the Maximum-Likelihood (ML) method (Figs. 2, 3). Figure 2 showed the phylogenetic tree based on a part of the CP gene consisted of three main clusters (CL, G2, and EM) that each cluster was divided again into several branches (Fig. 2). Cluster CL includes isolates from France, Italy, Spain, South Korea, Chile, and Iran. Cluster EM consists of isolates from China, South Korea, and France. A few isolates from France, China, and Iran were placed in cluster G2 (Fig. 2). The result of phylogenetic analysis based on the nucleotide sequences of a part of the P1 gene for 27 isolates showed that the phylogenetic tree was grouped into three main groups. Of these, fourteen WMV isolates were grouped in CL cluster including isolates from France, South Korea, Spain, China, and Iran. Five isolates from Italy, Chile, and Iran were placed in G2 cluster. Remaining isolates from China, France, South Korea, and Italy grouped in EM cluster (Fig. 3).

Fig. 2.

Fig. 2

Open in a new tab

Unrooted phylogenetic relationship of global WMV isolates/strains constructed based on the CP sequences by the maximum-likelihood (ML) method implemented in MEGA 7. Branch support was computed using the bootstrap method based on 1000 replicates. Bootstrap values over 70% are given at the nodes. The new Iranian isolates showed in bold with black circle

Fig. 3.

Fig. 3

Open in a new tab

Unrooted phylogenetic relationship of global WMV isolates/strains constructed based on the P1 sequences by the maximum-likelihood (ML) method implemented in MEGA 7. Branch support was computed using the bootstrap method based on 1000 replicates. Bootstrap values over 70% are given at the nodes. The new Iranian isolates showed in bold with black circle

Population evolution analysis

At the first, the subpopulations made based on the geographical regions including; China, South Korea, France, Iran and Italy or based on phylogroups in the phylogenetic tree including; CL, G2 and EM (Table 2). To analyze genetic variation and polymorphism of the WMV populations based on a part of the CP and P1 genes, all the obtained sequences were evaluated by several genetic diversity parameters (Tables 2, 3). The maximum nucleotide diversities, π values (0.05299 and 0.17064), and also the highest average numbers of differences, k values (41.333 and 93.000), between WMV isolates belonged to the Iranian and Italian populations for CP and P1 genes, respectively (Tables 2, 3). However, the largest number of segregation (parsimonious) sites, S values (93 and 132), and mutation within the segregation sites, η (Eta) values (95 and 140), were found for the French and Chinese WMV populations for CP and P1 genes, respectively (Tables 2, 3). In addition, the lowest values of π (0.03312 and 0.07655) and K (25.833 and 40.571) were calculated for the Chinese and South Korean WMV populations for CP and P1 genes, respectively (Tables 2, 3). The highest values of π (0.03994 and 0.10642) and k (31.154 and 57.679) were estimated for CL and EM clades for CP and P1 genes, respectively. The ratio of dN/dS (ω) was estimated < 1 for all populations based on the CP gene; and < 1 and > 1 for WMV populations based on the P1 gene. For P1 gene, the ω values were calculated > 1 for EM clade; China, France, and Italy populations. The ω values were found < 1 for CL and G2 clades; South Korea and Iran populations (Table 3). The results showed that the CP gene of WMV populations is under negative selection and the P1 gene of WMV populations is under negative and positive selections.

Table 2.

Genetic and polymorphism characterizations of WMV CP from different populations

Phylogroup N H Hd S η K π SS NS Pi (s) Pi (a) ω
All 27 27 1.000 158 170 39.405 0.05052 170.02 609.98 0.18897 0.01193 0.063
CL 13 13 1.000 100 106 31.154 0.03994 169.73 610.27 0.14683 0.01021 0.069
G2 5 5 1.000 55 55 22.000 0.02821 170.00 610.00 0.08923 0.01115 0.125
EM 9 9 1.000 29 29 9.944 0.01275 170.46 609.54 0.04596 0.00346 0.075
Geographical origin
 China 4 4 1.000 50 51 25.833 0.03312 170.96 609.04 0.11443 0.01027 0.090
 SouthKorea 7 7 1.000 66 67 28.619 0.03669 169.93 610.07 0.13985 0.00796 0.057
 France 8 8 1.000 93 95 39.250 0.05032 169.98 610.02 0.19667 0.00954 0.048
 Italy 2 2 1.000 35 35 35.000 0.04487 170.83 609.17 0.16976 0.00985 0.058
 Iran 4 4 1.000 76 78 41.333 0.05299 169.38 610.63 0.17519 0.01911 0.109
Open in a new tab

N number of isolate, H number of haplotypes/isolates, Hd haplotype diversity, S number of polymorphic (Segregating) sites, η(Eta) total number of mutations, k average number of nucleotide differences between isolates, π nucleotide diversity, dS synonymous nucleotide diversity, dN non-synonymous nucleotide diversity. Maximum values between populations are in bold

Table 3.

Genetic and polymorphism characterizations of WMV P1 from different populations

Phylogroup N H Hd S η K π SS NS Pi (s) Pi (a) ω
All 27 24 0.989 236 274 68.376 0.12975 104.17 417.83 0.12143 0.13323 1.097
CL 14 11 0.956 107 108 19.176 0.03618 103.68 424.32 0.04020 0.03538 0.880
G2 5 5 1.000 53 55 25.300 0.04642 109.60 433.40 0.04878 0.04604 0.943
EM 8 8 1.000 139 147 57.679 0.10642 108.73 428.27 0.07608 0.11481 1.509
Geographical origin
 China 4 4 1.000 132 140 74.000 0.14042 105.33 416.67 0.10117 0.15200 1.502
 SouthKorea 7 6 0.952 124 124 40.571 0.07655 103.81 424.19 0.07752 0.07601 0.980
 France 8 6 0.893 128 135 55.036 0.10443 104.46 417.54 0.09541 0.10794 1.131
 Italy 2 2 1.000 93 93 93.000 0.17064 107.67 435.33 0.11146 0.18606 1.670
 Iran 4 14 1.000 107 109 55.833 0.10245 108.46 434.54 0.10861 0.10144 0.545
Open in a new tab

Several test statics such as Tajima’s D, Fu and Li’s D* and F* were examined to investigate the molecular variation patterns of WMV populations based on a part of the CP and P1 gene sequences, (Tables 4, 5). Results the non-significantly positive values for France population in both genes and South Korea population for Tajima’s D and Fu and Li’s F* statistical tests for the CP gene (Tables 4, 5). Significantly negative and non-significantly positive values were obtained for CL and EM clades for all statistical tests on the P1 gene, respectively (Table 5).

Table 4.

Neutrality test statistic characterization in WMV based on the CP gene populations

Comparisons πa Tajima’s D Fu and Li's D* Fu and Li's F*
All 0.05052 − 0.41848ns − 0.84139ns − 0.82963ns
CL 0.03994 − 0.40081ns − 0.86373ns − 0.84629ns
G2 0.01275 − 0.34066ns − 0.39930ns − 0.43199ns
EM 0.02821 − 1.25932ns − 1.25932 − 1.36484
Geographical origin
 China 0.03312 − 0.74279ns − 0.68041ns − 0.73485ns
 South Korea 0.03669 0.27032ns − 0.00503ns 0.06297ns
 France 0.05032 0.38757ns 0.15401ns 0.23309ns
 Italy 0.04487 nd nd nd
 Iran 0.05299 − 0.29763ns − 0.21578ns − 0.24650ns
Open in a new tab

P > 0.10, 0.10 > P > 0.05, P < 0.05

ns Non-significant, nd Four or more sequences are needed to compute Tajima’s and Fu and Li’s statistics

aπ: Nucleotide diversity per site

Table 5.

Neutrality test statistic characterization in WMV based on the P1 gene populations

Comparisons πa Tajima’s D Fu and Li's D* Fu and Li's F*
All 0.12975 − 0.15059ns − 0.16130ns − 0.18626ns
CL 0.03618 − 1.94476 − 2.43123 − 2.64059
G2 0.04642 − 0.31483ns − 0.22897ns − 0.26676ns
EM 0.10642 0.09484ns 0.12376ns 0.13067ns
Geographical origin
 China 0.14042 − 0.32431ns − 0.14136ns − 0.18757ns
 South Korea 0.07655 − 1.16097ns − 1.14842ns − 1.27640ns
 France 0.10443 0.31133ns 0.32318ns 0.35788ns
 Italy 0.17064 nd nd nd
 Iran 0.10245 − 0.63749ns − 0.57881ns − 0.63200ns
Open in a new tab

Differentiation of WMV populations

Genetic differentiation analysis of the WMV populations showed that three phylogroups in both genes (CP and P1) with significant K*, Z*, and Snn independent tests were completely distinct. The related Snn values were significantly high (mostly 1.000 and/or near 1.000). It is also confirmed by high FST (> 0.50 and > 0.55) for CP and P1 genes, respectively (Tables 6, 7). Among WMV populations, the non-significant Z* values were calculated no significant differentiation between the French population with the Italian and the Iranian populations and between the Chinese and Italian populations for both genes (CP and P1). The highest FST values (0.340 and 0.433) were found for China versus Iran populations and South Korea versus Iran populations based on CP and P1 genes, respectively, (Tables 6, 7) that it could be concluded there is not similarity between subpopulations.

Table 6.

Gene flow and genetic differentiation estimates for populations of WMV based on the CP

Population aKS* aK* KS*, KST*p value aZ* P value Snn P value bFST
CL vs G2 2.92151 0.13990 0.0000*** 3.82536 0.0000*** 1.000 0.0000*** 0.527
CL vs EM 3.17499 0.10639 0.0000*** 3.45985 0.0000*** 1.000 0.0000*** 0.496
G2 vs EM 2.41743 0.23520 0.0010** 2.91391 0.0000*** 1.000 0.0010** 0.688
Geographical origin
 China vs South Korea 3.02729 0.05200 0.0420* 2.78263 0.0160* 0.954 0.0040** 0.172
 China vs France 3.21196 0.04091 0.0900ns 3.12358 0.1350ns 0.750 0.0880ns 0.092
 China vs Italy 2.78698 0.17591 0.2050ns 1.54019 0.2690ns 1.000 0.0680ns 0.314
 China vs Iran 3.23046 0.11077 0.0210* 1.93910 0.0270* 1.000 0.0270* 0.340
 South Korea vs France 3.24898 0.04578 0.0780ns 3.46264 0.0310* 0.800 0.0380* 0.105
 South Korea vs Italy 3.12342 0.06167 0.0340* 2.42517 0.0430* 0.666 0.5760ns 0.136
 South Korea vs Iran 3.28071 0.07538 0.0140* 2.62097 0.0070** 0.909 0.0240* 0.243
 France vs Italy 3.35361 0.03845 0.0790ns 2.83009 0.2600ns 0.600 0.7330ns 0.132
 France vs Iran 3.43370 0.04458 0.0540ns 3.03207 0.0590ns 0.625 0.2810ns 0.141
 Italy vs Iran 3.67394 − 0.02499 0.6410ns 1.99755 0.6410ns 0.416 0.8830ns N/A
Open in a new tab

*0.01 < P < 0.05; **0.001 < P < 0.01; ***P < 0.001

aK*, KST*, Z*, and Snn are test statistics of genetic differentiation

bFST, coefficient of gene differentiation, which measures inter-population diversity

Table 7.

Gene flow and genetic differentiation estimates for populations of WMV based on the P1

Population KS* aKST* Ks*, KST* P value aZ* P value Snn P value bFST
CL vs G2 2.70195 0.20580 0.0000*** 3.71926 0.0000*** 1.000 0.0000*** 0.754
CL vs EM 2.99541 0.18888 0.0000*** 3.89702 0.0000*** 1.000 0.0000*** 0.613
G2 vs EM 3.66914 0.11461 0.0000*** 2.65888 0.0000*** 1.000 0.0060** 0.558
Geographical origin
 China vs South Korea 3.46707 0.08833 0.0210* 2.79333 0.0320* 0.681 0.1720ns 0.247
 China vs France 3.28667 0.10308 0.0370* 3.04592 0.0450* 0.750 0.0730ns 0.101
 China vs Italy 4.07477 0.04264 0.2100ns 1.70740 0.2080ns 0.500 0.4760ns N/A
 China vs Iran 3.82308 0.09283 0.0260* 2.09985 0.0560ns 0.750 0.1990ns 0.299
 South Korea vs France 3.11489 0.04470 0.0640ns 3.56655 0.0390* 0.666 0.0700ns 0.022
 South Korea vs Italy 3.25124 0.13360 0.0580ns 2.34054 0.0500ns 0.666 0.4800ns 0.256
 South Korea vs Iran 3.35076 0.13696 0.0040** 2.67093 0.0030** 0.818 0.0540ns 0.433
 France vs Italy 3.02397 0.15049 0.0460* 2.67718 0.0810ns 0.800 0.1660ns 0.140
 France vs Iran 3.16082 0.15611 0.0030** 3.05479 0.0610ns 0.916 0.0170* 0.343
 Italy vs Iran 3.62540 0.08628 0.1530ns 1.53992 0.1770ns 0.666 0.3860ns N/A
Open in a new tab

Discussion

Recombination and mutation are quite common in potyviruses (Desbiez et al. 2011). Potyviruses are one of the serious problems that reduce the quality and quantity of cucurbit crops in Iran and all over the world (Ayazpour and Vahidian 2016). In the present survey, we observed a variety of viral symptoms including mild to severe mosaic, leaf deformation, chlorosis, necrotic spots, stunting, and reduced yield in the different cucurbit fields of Northwest in Iran. So, the objectives of this work were the determination of the geographical origins, genetic diversity, and molecular evolution of the WMV isolates especially from the locations where no detailed studies have already been done.

Different symptoms may show the presence of other viruses and/or mix infections by common cucurbit viruses. Other viruses infected cucurbits including papaya ringspot virus (PRSV), clover yellow vein virus (ClYVV), melon vein-banding mosaic virus (MVBMV), zucchini yellow feck virus (ZYFV), algerian watermelon mosaic virus (AWMV), turnip mosaic virus (TuMV), watermelon leaf mottle virus (WLMV), cucumber green mottle mosaic virus (CGMMV), watermelon silver mottle virus (WSMoV), ZYMV, and CMV have already been reported in the most regions of cucurbit fields in mixed or individually infection (Lin et al. 2012; Perotto et al. 2017; Nematollahi et al. 2014).

In this study, various cucurbit growing regions and different cultivars in the northwest of Iran such as Clarita, Mahan, Supper Star, Soheil, Bita, Vana, Zhina and Nor were assessed for the identification and population genetic analysis of WMV. Some new Iranian WMV isolates were characterized by RT-PCR assay using two pair of specific primers corresponding to different regions of WMV genome and sequenced.

According to the previous literatures, phylogenetic analysis of a part of the CP and P1 gene sequences showed that all WMV isolates were polyphyletic and speared in more than one phylogenetic group and the phylogenetic tree of WMV strains/isolates mainly clustered into three phylogroups (Figs. 2, 3) (Glasa et al. 2011; Hajizadeh et al. 2017). The CL group was the largest group in both CP and P1 genes including the WMV isolates from France, South Korea, Spain, and Iran (Figs. 2, 3).

Although recombination is one of the basic mechanisms in genetic structure and evolution of plant viruses (Garcia-Arenal et al. 2003), and commonly occurs in potyviruses (Chare and Holmes 2006), and other viruses based on the full-length genome or complete genes (Sokhandan et al. 2018; Abadkhah et al. 2018). However, the recombination events was not examined in this research because logical results will not generate based on uncompleted genes.

In this research, genetic diversity and molecular evolutionary were investigated to identify haplotypes and infer genetic relationships between populations of the WMV based on the CP and P1 genes. In genetic diversity analysis among geographic regions, the lowest nucleotide diversities (π), (0.03312 and 0.07655), were observed for the Chinese and South Korean WMV populations for CP and P1 genes, respectively. It is possible that South Korean and Chinese WMV isolates were isolated from the limited geographic region, because of that these isolates do not showed high nucleotide diversity. The size of haplotype diversity (Hd) can range from 0, meaning no diversity, to 1.000, which indicates high levels of haplotype diversity (Nei and Tajima 1981). Our data showed that Hd was 0.989 to 1.000, indicating very high levels of diversity for each gene. These levels were similar to a previous study of WMV variability in Iran, which were 1.000 (Hajizadeh et al. 2017). Evolutionary selection pressure on the studied partial CP and P1 genes was examined through the ratio of substitution rates at non-synonymous (dN) and synonymous sites (dS). For the CP gene, all of the WMV populations were under negative selection (ω < 1) whereas on the P1 gene the estimated ω ratios were less than one (ω < 1) for South Korea and Iran populations; and more than one (ω > 1) for China, France, and Italy populations. This results suggest that the WMV evolutionary selection pressure on the P1 gene is dependent on the use of a variety of cultivars, the type of cultivation, virus transmission between different cucurbit plants in different locations, environment condition in different geographical locations, WMV epidemiology, and control of aphids (Nigam et al. 2019; Gadhave et al. 2019; Dombrovsky et al. 2005).

Non-significantly negative values were obtained by neutrality test statics (Tajima’s D, Fu and Li’s D* and F*) for all populations except for France population in all test statics and South Korea population in Tajima’s D and Fu and Li’s F* statistical tests which were obtained non-significantly positive value (Tables 4, 5). Generally, negative values showed that the estimated polymorphism was less than what expected. All populations in all three phylogroups of WMV seem to be at equilibrium because all neutrality test statistics were non-significant.

Genetic differentiation and gene flow among WMV populations were determined using the Ks*, Z*, Snn, and FST statistical tests (Tables 6, 7). The East-Asian (China) population was differentiated from the other WMV populations because of the Snn values were significantly mostly 1.000 and/or near 1.000 except in comparison with the French and South Korean populations for the CP gene (Table 6). In geographical regions, the maximum FST values (0.340 and 0.433) between Chinese and Iranian populations for the CP gene and South Korean and Iranian populations for the P1 gene, respectively, could be due to the long distances between these countries. Moreover, non-significant Z* values were indicated no differentiation between these populations.

In conclusion, Iran now is one of the important countries for the production of cucurbits in the world. Evolution and differentiation between populations of WMV that may be occurred by environment condition, vector transmission, and host change are the major findings of this study. The current work also revealed that negative and positive selections and mutation may be the potential drivers of the dynamics of WMV molecular evolution. It also seems that the movement of the virus among different cucurbit cultivars, migration in different geographical areas, and infected seeds and pollens have been playing an essential role in shaping the WMV population structure.

Acknowledgements

This research was supported by Islamic Azad University, Tabriz Branch, Tabriz-Iran. We would like to thanks from Miss Mahsa Abadkhah to valuable help in data analysis in this paper

Author contributions

SN and DK conceived the project and designed the experiments; SN and NP performed the experiments; DK analyzed the data; DK wrote the paper; SN and DK revised the final version of the manuscript; all authors read and approved the final version of the manuscript.

Compliance with ethical standards

Conflict of interest

The authors declare that they have no competing interests.

References

  1. Ayazpour K, Vahidian M. Study of watermelon mosaic virus in cucurbit fields of Jahrom area. Iran Vegetos. 2016;29:4. doi: 10.5958/2229-4473.2016.00115.4. [DOI] [Google Scholar]
  2. Bertin S, Manglli A, McLeish M, Tomassoli L. Genetic variability of watermelon mosaic virus isolates infecting cucurbit crops in Italy. Adv Virol. 2020 doi: 10.1007/s00705-020-04584-9. [DOI] [PubMed] [Google Scholar]
  3. Chare ER, Holmes EC. A phylogenetic survey of recombination frequency in plant RNA viruses. Adv Virol. 2006;151:933–946. doi: 10.1007/s00705-005-0675-x. [DOI] [PubMed] [Google Scholar]
  4. Chung CT, Niemela SA, Miller RH. One-step preparation of competent Escherichia coli: transformation and storage of bacterial cells in the same solution. Proc Natl Acad Sci USA. 1989;86:2172–2175. doi: 10.1073/pnas.86.7.2172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Dombrovsky A, Huet H, Chejanovsky N, Raccah B. Aphid transmission of a potyvirus depends on suitability of the helper component and the N terminus of the coat protein. Adv Virol. 2005;150:287–298. doi: 10.1007/s00705-004-0407-7. [DOI] [PubMed] [Google Scholar]
  6. Desbiez C, Joannon B, Wipf-Scheibel C, Chandeysson C, Lecoq H. Recombination in natural populations of watermelon mosaic virus: new agronomic threat or damp squib? J Gen Virol. 2011;92:1939–1948. doi: 10.1099/vir.0.031401-0. [DOI] [PubMed] [Google Scholar]
  7. Desbiez C, Lecoq H. The nucleotide sequence of watermelon mosaic virus (WMV, Potyvirus) reveals interspecific recombination between two related potyviruses in the 5′ part of the genome. Adv Virol. 2004;149:1619–1632. doi: 10.1007/s00705-004-0340-9. [DOI] [PubMed] [Google Scholar]
  8. Ebrahim-Nesbat F. Distribution of watermelon mosaic viruses 1 and 2 in Iran. Phytopathology. 1974;79:352–358. doi: 10.1111/j.1439-0434.1974.tb02717.x. [DOI] [Google Scholar]
  9. Feinberg AP, Vogelstein B. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem. 1983;132:6–13. doi: 10.1016/0003-2697(83)90418-9. [DOI] [PubMed] [Google Scholar]
  10. Fu YX, Li WH. Statistical tests of neutrality of mutations. Genetics. 1993;133:693–709. doi: 10.1093/genetics/133.3.693. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Gadhave KR, Dutta B, Coolong T, Srinivasan R. A non-persistent aphid-transmitted Potyvirus differentially alters the vector and non-vector biology through host plant quality manipulation. Sci Rep. 2019;9:1–12. doi: 10.1038/s41598-019-39256-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gao F, Lin W, Shen J, Liao F. Genetic diversity and molecular evolution of arabis mosaic virus based on the CP gene sequence. Adv Virol. 2015;161:1047–1051. doi: 10.1007/s00705-015-2729-z. [DOI] [PubMed] [Google Scholar]
  13. Garcia-Arenal F, Fraile A, Malpica JM. Variation and evolution of plant virus populations. Int Microbiol. 2003;6:225–232. doi: 10.1007/s10123-003-0142-z. [DOI] [PubMed] [Google Scholar]
  14. Glasa M, Bananej K, Predajňa L, Vahdat A. Genetic diversity of watermelon mosaic virus in Slovakia and Iran shows distinct pattern. Plant Dis. 2011;95:38–42. doi: 10.1094/PDIS-05-10-0355. [DOI] [PubMed] [Google Scholar]
  15. Hajizadeh M, Bahrampour H, Abdollahzadeh J. Genetic diversity and population structure of watermelon mosaic virus. J Plant Dis Prot. 2017;124:601–610. doi: 10.1007/s41348-017-0114-8. [DOI] [Google Scholar]
  16. Hudson RR. A new statistic for detecting genetic differentiation. Genetics. 2000;155:2011–2014. doi: 10.1093/genetics/155.4.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Abadkhah M, Koolivand D, Eini O. A new distinct clade for iranian tomato spotted wilt virus isolates based on the polymerase, nucleocapsid, and non-structural genes. Plant Pathol J. 2018;34(6):514–531. doi: 10.5423/PPJ.OA.04.2018.0062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016;33(7):1870–1874. doi: 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. Clustal W and Clustal X version 2.0. Bioinformatics. 2007;23(21):2947–2948. doi: 10.1093/bioinformatics/btm404. [DOI] [PubMed] [Google Scholar]
  20. Lin CY, Ku HM, Chiang YH, Ho HY, Yu TA, Jan FJ. Development of transgenic watermelon resistant to cucumber mosaic virus and watermelon mosaic virus by using a single chimeric transgene construct. Transgenic Res. 2012;21:983–993. doi: 10.1007/s11248-011-9585-8. [DOI] [PubMed] [Google Scholar]
  21. Muhire BM, Varsani A, Martin DP. SDT: a virus classification tool based on pairwise sequence alignment and identity calculation. PLoS ONE. 2014;9:e108277. doi: 10.1371/journal.pone.0108277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Nei M, Tajima F. DNA polymorphism detectable by restriction endonucleases. Genetics. 1981;97:145–163. doi: 10.1093/genetics/97.1.145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Nematollahi S, Haghtaghi E, Koolivand D, Hajizadeh M. Molecular detection of cucumber green mottle mosaic virus variants from cucurbits fields in Iran. Arch Phytopathol Plant Prot. 2014;47:1303–1310. doi: 10.1080/03235408.2013.840102. [DOI] [Google Scholar]
  24. Nigam D, LaTourrette K, Souza PFN, Garcia-Ruiz H. Genome-wide variation in potyviruses. Front Plant Sci. 2019;10:1–28. doi: 10.3389/fpls.2019.01439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Perotto MC, Pozzi EA, Celli MG, Luciani CE, Mitidieri MS, Conci VC. Identifcation and characterization of a new potyvirus infecting cucurbits. Adv Virol. 2017 doi: 10.1007/s00705-017-3660-2. [DOI] [PubMed] [Google Scholar]
  26. Rajbanshi N, Ali A. First complete genome sequence of a watermelon mosaic virus isolated from watermelon in the United States. Genome Announc. 2016;4(2):e00299–e316. doi: 10.1128/genomeA.00299-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Rozas J, Ferrer-Mata A, Sanchez-DelBarrio JC, Guirao-Rico S, Librado P, Ramos-Onsins SE, Sánchez-Gracia A. DnaSP 6: DNA sequence polymorphism analysis of large datasets. Mol Biol Evol. 2017;34(12):3299–3302. doi: 10.1093/molbev/msx248. [DOI] [PubMed] [Google Scholar]
  28. Rubio L, Guerri J, Moreno P. Genetic variability and evolutionary dynamics of viruses of the family Closteroviridae. Front Microbiol. 2013;4:1–15. doi: 10.3389/fmicb.2013.00151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Schneider WL, Roossinck MJ. Genetic diversity in RNA virus ouasispecies is controlled by host–virus interactions. J Virol. 2001;75(14):6566–6571. doi: 10.1128/JVI.75.14.6566-6571.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Sharifi M, Massumi H, Heydarnejad J, Hosseini Pour A, Shaabanian M, Rahimian H. Analysis of the biological and molecular variability of watermelon mosaic virus isolates from Iran. Virus Genes. 2008;37:304–313. doi: 10.1007/s11262-008-0271-8. [DOI] [PubMed] [Google Scholar]
  31. Sokhandan-Bashir N, Melcher U. Population genetic analysis of grapevine fanleaf virus. Adv Virol. 2012;157:1919–1929. doi: 10.1007/s00705-012-1381-0. [DOI] [PubMed] [Google Scholar]
  32. Tajima F. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics. 1989;123:585–595. doi: 10.1093/genetics/123.3.585. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Tsompana M, Abad J, Purugganan M, Moyer JW. The molecular population genetics of the tomato spotted wilt virus (TSWV) genome. Mol Ecol. 2005;14:53–66. doi: 10.1111/j.1365-294X.2004.02392.x. [DOI] [PubMed] [Google Scholar]
  34. Webb RE, Scott HA. Isolation and identification of watermelon mosaic virus 1 and 2. Phytopathology. 1965;55:895–900. [Google Scholar]

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES